CN101634615A - Silver staining method of polyacrylamide gel - Google Patents
Silver staining method of polyacrylamide gel Download PDFInfo
- Publication number
- CN101634615A CN101634615A CN200810134507A CN200810134507A CN101634615A CN 101634615 A CN101634615 A CN 101634615A CN 200810134507 A CN200810134507 A CN 200810134507A CN 200810134507 A CN200810134507 A CN 200810134507A CN 101634615 A CN101634615 A CN 101634615A
- Authority
- CN
- China
- Prior art keywords
- silver
- gel
- distilled water
- staining method
- silver staining
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Investigating Or Analysing Biological Materials (AREA)
- Cosmetics (AREA)
Abstract
The invention discloses a silver staining method of a polyacrylamide gel, which comprises the following steps of: firstly, putting an electrophoresed gel into a ceramic disc filled with distilled water; secondly, rinsing the gel by using the distilled water for two times; thirdly, adding a staining solution to carry out the solver staining; fourthly, re-rinsing the gel by using the distilled water for two times; fifthly, adding a developing solution to develop; and finally, using a digital camera to take pictures for the gel. By simplifying the silver staining steps, the silver staining method reduces the types of prepared solutions, simplifies a developing process, saves the dosage of a reagent decreasing the cost, and greatly shortens the developing time and improves the dye staining efficiency on the promise of guaranteeing obtaining an ideal target stripe. The obtained target section is clear enough for convenient genetype judgment and is particularly suitable to be used in processes of studying molecular markers and drawing genetic maps.
Description
Technical field
The present invention relates to a kind of silver staining method of polyacrylamide gel.
Background technology
Because polyacrylamide gel electrophoresis uses few, the difficult diffusion of sample size, has high-resolution and is easy to and observe, and has been widely used in the process of molecule marking research and genetic map construction at present.The silver process of dying behind the conventional polyacrylamide gel electrophoresis mainly may further comprise the steps: the gel behind (1) electrophoresis takes out from the glass plate and puts into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times.(2) immobilized gel: the ethanol immobile liquid submergence gel of adding 10% in dish, be placed on and shake 20min on the shaking table gently, remove immobile liquid, with distilled water rinsing 2 times.(3) gel oxidation: the nitric acid oxidation 5min of adding 1%, nitric acid reclaims, with distilled water rinsing 2 times.(4) silver dyes gel: the cma staining liquid submergence gel of adding 0.1%, and be placed on the shaking table black out and shake 30min gently, remove liquid, with distilled water rinsing 2 times.(5) gel develops: the sodium carbonate of adding 2% colour developing liquid submergence gel in porcelain dish, observe clear showing electrophoretic band on gel while shaking.(6) stop developing: pour out colour developing liquid after band is clear rapidly, add 4% acetate stop bath submergence gel as early as possible, stop chromogenic reaction.(7) stop showing after, add distilled water submergence gel.(8) gel photography: with digital camera gel is taken a picture, as shown in Figure 1, the whole silver process of dying is finished.Silver behind the polyacrylamide gel electrophoresis dyes though all processes has solved, developing process, and simple to operate, easy to use, required time is longer, and resolution is lower, and time-consuming especially, the effort of test in enormous quantities has had a strong impact on the progress of testing.How to improve existing silver staining method, set up that a kind of silver fast and efficiently dyes the band mode that shows, improving silver, to dye efficient be problem to be solved by this invention.
Summary of the invention
In view of the deficiency in the above-mentioned existing silver staining method, the present invention aims to provide a kind of silver and dyes time weak point, the band silver staining method of polyacrylamide gel clearly.
The present invention is achieved through the following technical solutions:
A kind of silver staining method of polyacrylamide gel may further comprise the steps:
(1) gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times;
(2) silver dyes: the adding dyeing liquor carries out silver and dyes, and uses the distilled water rinsing then 2 times;
(3) develop: add developer solution and develop the color;
(4) gel photography: gel is taken a picture with digital camera.
Described dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol.
The described silver time of dying is 5 ~ 20min.
The described silver time of dying is preferably 10min.
Described developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde.
Described development time is 8min.
Described distilled water also can be deionized water.
The silver staining method of a kind of polyacrylamide gel of the present invention, dye step by simplifying silver, reduced the kind that solution is prepared, simplified the colour developing program, saved the consumption of reagent, reduced cost, obtained under the prerequisite of desirable purpose band in assurance, shortened developing time greatly, improved and dyed glue efficient, the purpose fragment that obtains is clear, is beneficial to very much genotypic judgement.
Description of drawings
Fig. 1 dyes figure as a result for the silver of conventional silver staining method;
It is that the silver of 20min dyes figure as a result that Fig. 2 selects the silver time of dying for use for silver staining method of the present invention;
It is that the silver of 15min dyes figure as a result that Fig. 3 selects the silver time of dying for use for silver staining method of the present invention;
It is that the silver of 10min dyes figure as a result that Fig. 4 selects the silver time of dying for use for silver staining method of the present invention;
It is that the silver of 5min dyes figure as a result that Fig. 5 selects the silver time of dying for use for silver staining method of the present invention.
Embodiment
Central idea of the present invention is to improve that silver dyes speed, under the prerequisite of the step that simplifies the operation, guaranteeing that silver dyes effect, obtains clear band is purpose.
The present invention adopts the SSR mark as experimental technique, the bolti primer UNH817 that primer employing Genebank upward issues (accession number: G64035) as follows:
Forward primer sequence: CCTCTTTCTGTGGGTTTCTCC
Reverse primer sequence: CCCAGCCTGCAGTGATACTT
The reaction system cumulative volume is 15 μ L, 10 * Buffer, 1.5 μ L wherein, 10mmol/L dNTPs 0.2 μ L, 5U/ μ L Taq archaeal dna polymerase 0.2 μ L, each 0.5 μ L of the upstream and downstream primer of 10 μ mol/L, dna profiling 0.2 μ L, ddH2O 11.9 μ L.The pcr amplification program is 94.0 ℃ of pre-sex change 5min, then through 34 circulations, and each 94.0 ℃ of sex change 30s that circulate, 52.0 ℃ of annealing 30s, 72.0 ℃ are extended 1min, and last 72.0 ℃ are extended 10min, 4 ℃ of preservations.Adopt the polyacrylamide gel of 12% (39: 1), electrophoresis is 4 hours under 150V voltage.
The silver staining method of a kind of polyacrylamide gel of the present invention, above-mentioned gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times, the adding dyeing liquor carries out silver and dyes, dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol, the silver time of dying is 5～20min, the silver time of dying is preferably 10mm, use the distilled water rinsing then 2 times, add developer solution again and develop the color, developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde, development time is 8min, this moment occurs preferably that silver dyes effect, with digital camera gel taken a picture, and finishes silver and dye process.Wherein, the distilled water of use also can be deionized water.
Embodiment one
Above-mentioned gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times, add dyeing liquor and carry out silver and dye, dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol, and the silver time of dying is 20min, use the distilled water rinsing then 2 times, add developer solution again and develop the color, developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde, and development time is 8min, with digital camera gel is taken pictures, show as Fig. 2.
Implement two
Above-mentioned gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times, add dyeing liquor and carry out silver and dye, dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol, and the silver time of dying is 15min, use the distilled water rinsing then 2 times, add developer solution again and develop the color, developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde, and development time is 8min, with digital camera gel is taken pictures, show as Fig. 3.
Embodiment three
Above-mentioned gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times, add dyeing liquor and carry out silver and dye, dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol, and the silver time of dying is 10min, use the distilled water rinsing then 2 times, add developer solution again and develop the color, developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde, and development time is 8min, with digital camera gel is taken pictures, show as Fig. 4.
Embodiment four
Above-mentioned gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times, add dyeing liquor and carry out silver and dye, dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol, and the silver time of dying is 5min, use the distilled water rinsing then 2 times, add developer solution again and develop the color, developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde, and development time is 8min, with digital camera gel is taken pictures, show as Fig. 5.
Different polyacrylamide gel silver staining method silver dye the result from Fig. 1～Fig. 5 as can be seen: the background that conventional silver staining method silver dyes is more shallow, and the purpose fragment is also comparatively fuzzy, and is clear inadequately, brings certain difficulty to accurately declaring type.Method test after the improvement has used 20min, 15min, four gradients of 10min, 5min, dye the result from silver, to dye the background color of 5min and 10min shallow when silver dyes 15min, 20min for gel silver when developing time was identical, the DNA band did not have evident difference when silver dyed 10min, 15min, 20min, all more clear, be convenient to genotypic judgement, and silver when dying 5min band have fuzzyly slightly, sharpness is relatively poor.Simultaneously, find also in the process of the test that silver dyes the length of time and do not influence developing time, in process color, all Color preferably can occur about 8 minutes.The concrete silver time of dying contrasts as following table:
As can be seen from the above table, conventional method needs the time the longest, need at least as 5 minutes, and the silver staining method after improving needs the time obviously to shorten, and the longest also only needs about 30 minutes.Argentation after the improvement saves time the most, has greatly improved work efficiency.
Conventional method is dyed at silver to be needed in the process just can finish through eight steps, and the method after improving only needs 4 steps.Promptly remove with regard to the core procedure that dyes glue and to reach with regard to offset plate and the photograph step, conventional method divided for six steps carried out, and the method after the improvement then had only for two steps.It is minimum to improve the back method step, operates more easy.Aspect the preparation of staining reagent, the normal dyeing method needs to prepare immobile liquid, oxidation liquid, dyeing liquor, colour developing liquid, 5 kinds of solution of stop bath in dying the glue process, and the colouring method after the improvement only need be prepared dyeing liquor, two kinds of solution of colour developing liquid.Dye the kind that has significantly reduced the solution preparation in the glue process, simplified the colour developing program, saved the consumption of reagent, reduced cost.
Claims (7)
1, a kind of silver staining method of polyacrylamide gel is characterized in that, may further comprise the steps:
(1) gel behind the electrophoresis is put into the porcelain dish that distilled water is housed, with distilled water rinsing 2 times;
(2) silver dyes: the adding dyeing liquor carries out silver and dyes, and uses the distilled water rinsing then 2 times;
(3) develop: add developer solution and develop the color;
(4) gel photography: gel is taken a picture with digital camera.
2, the silver staining method of a kind of polyacrylamide gel according to claim 1 is characterized in that, described dyeing liquor comprises 0.2% AgNO3,1% glacial acetic acid and 10% absolute ethyl alcohol.
3, the silver staining method of a kind of polyacrylamide gel according to claim 2 is characterized in that, the described silver time of dying is 5～20min.
4, the silver staining method of a kind of polyacrylamide gel according to claim 3 is characterized in that, the described silver time of dying is preferably 10min.
5, the silver staining method of a kind of polyacrylamide gel according to claim 1 is characterized in that, described developer solution comprises 3% anhydrous Na OH and 0.5% formaldehyde.
6, the silver staining method of a kind of polyacrylamide gel according to claim 5 is characterized in that, described development time is 8min.
7, the silver staining method of a kind of polyacrylamide gel according to claim 1 is characterized in that, described distilled water also can be deionized water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810134507A CN101634615A (en) | 2008-07-25 | 2008-07-25 | Silver staining method of polyacrylamide gel |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200810134507A CN101634615A (en) | 2008-07-25 | 2008-07-25 | Silver staining method of polyacrylamide gel |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101634615A true CN101634615A (en) | 2010-01-27 |
Family
ID=41593874
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200810134507A Pending CN101634615A (en) | 2008-07-25 | 2008-07-25 | Silver staining method of polyacrylamide gel |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101634615A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102424855A (en) * | 2011-12-29 | 2012-04-25 | 云南省农业科学院经济作物研究所 | Method for carrying out silver staining on DNA (deoxyribonucleic acid) in polyacrylamide gel |
| CN102507289A (en) * | 2011-11-15 | 2012-06-20 | 中国农业大学 | Silver staining reagent and staining method thereof |
| CN104007161A (en) * | 2014-05-12 | 2014-08-27 | 塔里木大学 | Polyacrylamide gel solution for microsatellite marker polymorphism detection and silver staining method |
| CN106596232A (en) * | 2016-12-13 | 2017-04-26 | 广州大学 | Silver staining kit for detecting DNA in polyacrylamide gel and application of silver staining kit |
| CN107345934A (en) * | 2016-05-07 | 2017-11-14 | 中国海洋大学 | A kind of Fast silver-staining of long oyster microsatellite polyacrylamide gel electrophoresis |
| CN109307703A (en) * | 2017-07-26 | 2019-02-05 | 贵州大学 | The native polyacrylamide gel electrophoresis method of Rosa roxburghii Tratt SSR marker polymorphic detection |
| CN110964763A (en) * | 2019-12-17 | 2020-04-07 | 天津大学 | TDT enzyme-based template-independent RNA3，Method for growing DNA at-OH terminal |
-
2008
- 2008-07-25 CN CN200810134507A patent/CN101634615A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102507289A (en) * | 2011-11-15 | 2012-06-20 | 中国农业大学 | Silver staining reagent and staining method thereof |
| CN102424855A (en) * | 2011-12-29 | 2012-04-25 | 云南省农业科学院经济作物研究所 | Method for carrying out silver staining on DNA (deoxyribonucleic acid) in polyacrylamide gel |
| CN104007161A (en) * | 2014-05-12 | 2014-08-27 | 塔里木大学 | Polyacrylamide gel solution for microsatellite marker polymorphism detection and silver staining method |
| CN107345934A (en) * | 2016-05-07 | 2017-11-14 | 中国海洋大学 | A kind of Fast silver-staining of long oyster microsatellite polyacrylamide gel electrophoresis |
| CN106596232A (en) * | 2016-12-13 | 2017-04-26 | 广州大学 | Silver staining kit for detecting DNA in polyacrylamide gel and application of silver staining kit |
| CN106596232B (en) * | 2016-12-13 | 2019-04-30 | 广州大学 | The silver staining kit of DNA and its application in a kind of detection polyacrylamide gel |
| CN109307703A (en) * | 2017-07-26 | 2019-02-05 | 贵州大学 | The native polyacrylamide gel electrophoresis method of Rosa roxburghii Tratt SSR marker polymorphic detection |
| CN110964763A (en) * | 2019-12-17 | 2020-04-07 | 天津大学 | TDT enzyme-based template-independent RNA3，Method for growing DNA at-OH terminal |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101634615A (en) | Silver staining method of polyacrylamide gel | |
| Mansour et al. | Separation of long RNA by agarose–formaldehyde gel electrophoresis | |
| CN105067412B (en) | A kind of vaginal fluid dyeing liquor and preparation method thereof and colouring method | |
| CN107490511B (en) | A kind of haematoxylin dyeing liquid and HE colouring method | |
| CN101619357B (en) | Method for obtaining EST-SSR mark | |
| CN109187149B (en) | Papanicolaou staining kit and staining method thereof | |
| CN106644656A (en) | Hematoxylin-eosin one-step dyeing method | |
| CN101381768B (en) | Molecular identification method for siniperca chuatsi and siniperca scherzeri and kit | |
| CN108103211A (en) | A kind of identification Tridacna (chamestrachea) maxima (R ding), the micro-satellite primers and identification method of Nova giant clam | |
| CN1363006A (en) | Electropnoresis-assisted staining of materials | |
| CN108165647A (en) | A kind of molecule labelling method for being used to identify Chinese cabbage SUZHOUQING(sic), short-foot Huang, Wuta-tsai | |
| CN103808553B (en) | Weak background fluorescence type resin embedding method | |
| CN104797920A (en) | Automatic staining method and staining device for biopolymer | |
| CN102277423B (en) | Quick determination method of number of chromosomes of bivalve by utilizing ovum fluorescent microscope observation | |
| CN112710644A (en) | Zymogram method for determining two-dimensional spatial distribution of activity of rhizosphere phosphatase of aquatic plants | |
| CN102680295B (en) | A kind of method extracting residual micronucleus acid from HE staining section | |
| CN101477001A (en) | DNA silver staining method | |
| CN102967499A (en) | Cell nucleus DNA (Deoxyribose Nucleic Acid) staining method | |
| CN105158125B (en) | A kind of telomere length measuring method | |
| CN104390834A (en) | Sarranine and methyl violet mixed staining method for resin slices and staining solution thereof | |
| CN105300757A (en) | Quick and simple pathological frozen specimen manufacturing method | |
| CN103571909A (en) | Papanicolaou staining fluid and using method thereof | |
| CN106884055B (en) | Method for identifying green tide enteromorpha algae by using gel electrophoresis | |
| CN108998551A (en) | Tea tree quadruple fluorescence SSR molecular marker detection method | |
| CN101381769A (en) | Molecular identification method for siniperca kneri garman and siniperca scherzeri and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Liang Hongwei Inventor after: Zou Guiwei Inventor after: Li Zhong Inventor after: Wang Changzhong Inventor after: Luo Xiangzhong Inventor before: Luo Xiangzhong Inventor before: Liang Hongwei Inventor before: Li Zhong Inventor before: Zou Guiwei Inventor before: Wang Changzhong |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: LUO XIANGZHONG LIANG HONGWEI LI ZHONG ZOU GUIWEI WANG ZHANGZHONG TO: LIANGHONGWEI ZOU GUIWEI LI ZHONG WANG ZHANGZHONG LUO XIANGZHONG |
|
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Open date: 20100127 |