CN101555468B

CN101555468B - Viral variants with altered susceptibility to nucleoside analogs and uses thereof

Info

Publication number: CN101555468B
Application number: CN2009101368310A
Authority: CN
Inventors: A·I·巴尔托罗姆斯; S·A·落卡里尼; A·艾利斯; P·W·安格斯; W·西维尔特
Original assignee: Southern Health Corp; Melbourne Healch-Care Co Ltd; Austin Health
Current assignee: Southern Health Corp; Melbourne Healch-Care Co Ltd; Austin Health
Priority date: 2002-02-07
Filing date: 2003-02-05
Publication date: 2012-09-26
Anticipated expiration: 2023-02-05
Also published as: CN101555468A; AUPS037002A0

Abstract

The present invention relates generally to viral variants exhibiting reduced sensitivity to particular agents and/or reduced interactivity with immunological reagents. More particularly, the present invention is directed to hepatitis B virus (HBV) variants exhibiting complete or partial resistance e to nucleoside analogs and/or reduced interactivity with antibodies to viral surface components including reduced sensitivity to these antibodies. The present invention further contemplates assays for detecting such viral variants, which assays are useful in monitoring anti-viral therapeutic regimens and in developing new or modified vaccines directed against viral agents and in particular HBV variants. The present invention also contemplates the use of the viral variants to screen for agents capable of inhibiting infection, replication and/or release of the virus.

Description

The viral variants and the application thereof that nucleoside analog are had the susceptibility of change

The application is to be that on February 5th, 2003, denomination of invention are divided an application for " 03805162.1 " for " viral variants and the application thereof that nucleoside analog are had the susceptibility of change ", application number the applying date.

Background of invention

Invention field

The present invention relates generally to viral variants, the susceptibility that this viral variants descends to certain drugs performance and/or have the interaction of reduction with immunizing agent.More specifically; The present invention relates to hepatitis B virus (HBV) variant; This hepatitis B virus variant shows all or part of resistance and/or has the interaction of reduction with the antibody of virus surface component nucleosides property analogue, comprises the susceptibility to the decline of these antibody.The present invention further comprises the mensuration that is used to detect this viral variants, thisly is determined on the monitoring antiviral therapy scheme and is valuable in exploitation to the new or improved vaccine of virus especially HBV variant.The present invention also comprises the medicine that utilizes the viral variants screening can suppress virus infection, duplicate and/or discharge.

Prior art details

The detailed content of the document of the publication that the author quotes in this specification sheets is concentrated at the end of specification sheets and is listed.

The document of any prior art is not the admitting or any type of hint of integral part that yet should not be considered to prior art has been constituted in any country general knowledge in this specification sheets.

Special sudden change in aminoacid sequence is expressed as ' Xaa here ₁NXaa ₂', Xaa ₁Be the primary amino-acid residue before the sudden change, n is residue number and Xaa ₂Be the amino acid of sudden change.Abbreviation ' Xaa ' can be trigram or single-letter (that is, ' X ') coding.The amino-acid residue of hepatitis b virus dna polymerase is numbered like this, and the methionine residues in Tyr Met Asp Asp (YMDD) motif is No. 204 residues (Stuyver etc., Hepatology33:751-757,2001).The amino-acid residue of hepatitis B virus surface antigen is numbered according to (J.Gen.Viol.74:341-1348,1993) such as Norder.

The term nucleoside analog has been used to not only refer to Nucleotide but also refer to nucleoside analog.

Hepatitis B virus (HBV) can cause weak property disease symptoms and cause acute hepatic failure.HBV is a dna virus, duplicates and in replication strategy, adopt rt (Summers and Mason, Cell 29:403-415,1982) through the RNA intermediate product.The HBV genome character that contains the dsdna segment structure is complicated, contains the eclipsed ORFs of coded surface, core, polysaccharase and X gene in the dsdna segment structure.The genomic complicated character of HBV shows in Fig. 1.Polysaccharase is made up of four functional zone, terminal protein (TP), transcribed spacer, reversed transcriptive enzyme (rt) and ribozyme (RNAse).

HBV pol gene and env gene are overlapping, can influence the aminoacid sequence of envelope protein in the sudden change of polysaccharase catalyst structure domain, and vice versa.Especially, in HBsAg, find and being called between amino acid 99 and 169 ' a ' determinant HBV in the gene order of structural domain, in fact overlapping with proteic main catalytic domain of varial polymerases especially A and B structural domain.

The existence of HBV archaeal dna polymerase has caused the nucleoside analog can be as the preceding topic of effective antiviral.The instance of the nucleoside analog of testing at present is penciclovir (penciclovir) and its oral forms (FAM) [Vere Hodge, Antiviral ChemChemother 4:67-84,1993; Boyd etc., Antiviral Chem Chemother.32:358-363,1987; Kruger etc., Hepatology 22:219A, 1994; Main etc., J.Viral Hepatitis 3:211-215,1996] lamivudine (Lamivudine) [(-)-β-2 '-deoxidation-3 '-sulfo-cytidine; (3TC or LMV) [Severini etc., Antimicrobial AgentsChemother 39:1430-1435,1995; Dienstag etc., New England J Med333:1657-1661,1995].The new nucleoside analog that has got into clinical trial comprises pyriamidines emtricitabine (Emtricitabine); (-)-β-L-2 '-3 '-two deoxidations-5-fluoro-3 '-sulfo-cytidine (FTC); Fixed (Clevudine) (1-(the 2-fluoro-5-methyl-β-L-arbinofuranose base) uridine of the 5-fluorine derivative of 3TC and gram force husband; L-FMAU), thymus pyrimidine analogue.As 3TC, these are the pyrimidine derivatives with non-natural " L " configuration.Some purine derivatives have also got into clinical trial; They comprise Entecavir (Entecavir) (BMS-200,475; ETV), ring pancreatic desoxyribonuclease analogue, diaminopurine dioxolane (DAPD), dioxolane guanine ((-)-β-D-2-diaminopurine dioxolane; DXG) oral prodrugs, and adefovir ester (Adefovir dipivoxil), acyclic deoxyadenosine monophosphate nucleoside analog Adefovir (Adifovir) (9-[phosphoric acid-methoxy ethyl] VITAMIN B4; PMEA) oral prodrugs.

These medicines are synthetic very effective to suppressing HBV DNA, but the trend that in long-term antiviral chemotherapy, has had the HBV resistant mutants to occur.The resistant mutation rtM204I/V+ of screening key in the rt structural domain in the patient's that secular LMV treats polysaccharase/-rtL180M.The name that is used for polymerase mutation is according to Stuyver etc., 2001, what supra proposed.Have only LMV to be approved for anti-chronic HBV infection.Lamivudine (Lamivudine) is the special effective inhibitors of hbv replication, and passes through the HBV DNA titre of the chronic infectious patients serum behind the inhibition viral DNA synthetic reduction orthotopic liver transplantation (OLT).As if the LMV single therapy can not control hbv replication at longer-term.This is because appearing at during the single therapy of the anti-LMV strain of HBV almost is inevitably, and single therapy is not enough to cause virus sweep usually with regard to itself.

ETV also is the effective inhibitors of hbv replication.ETV is the cyclopentyl pancreatic desoxyribonuclease analogue of anti-hepadnavirus of having of taking orally and simplexvirus vigor.Show that at preclinical study ETV is very effective HBV suppressor factor (Innaimo etc., Antimicrobiol Agent Chem 44:1441-1448,1997 based on enzyme and raji cell assay Raji; Siefer etc., Antimicrobiol Agent Chem 28; 3200-3208,1998; Yamanaka etc., Antimicrobiol Agent Chem 43:190-193,1999).ETV has also proved effect (Colonno etc., the JID 184:1236-45 2001 of anti-WHV in the chronic infection woodchuck hepatitis; Genovesi etc., Antimicrobiol Agent Chem 42:3209-3217,1998).The test that the dosage in one four week progressively rises shows that ETV is highly tolerance, and causes viremia on average to reduce by 2.5 log 10 at the maximum dose level (1mg/ days) of test.It is reported the LMV resistant mutation at the external ETV of having crossed resistance, although Entecavir still can suppress virus replication when high dosage more; In view of ETV is not a L type nucleosides, these data are astonishing a bit.ETV successfully has been used to treat the patient of the HBV sudden change of anti-LMV.There is not special ETV resistant mutants to be described.

The nucleoside analog treatment can be used as single therapy or combination therapy is implemented, and combination therapy is meant and gives two kinds or more kinds of analogue.Nucleoside analog also can be united with other Anti-virus agent (like Interferon, rabbit or HBIG (HBIG)) and given.

Necessity that the HBV variant of identifying anti-nucleosides and/or antibody is arranged here.The change of the regimen that Rapid identification can cause using.

Summary of the invention

The abbreviation of table 1 definition is used to this specification sheets.

Table 1

Abbreviation

Abbreviation	Detail
		3TC	(LMV); (-)-β-2 '-deoxidation-3 '-sulfo-cytidine
ADV	Adefovir
		DAPD	The diaminopurine dioxolane
DXG	The dioxolane guanine
		ETV	Entecavir
FAM	Famciclovir
		FTC	Emtricitabine
HBIG	HBIG
		HBsAg	Hepatitis B virus surface antigen
HBV	Hepatitis B virus
		LMV	Lamivudine
PMEA	Adefovir
		RNAse	Ribozyme
rt	Reversed transcriptive enzyme
		YMDD	Motif in the Tyr Met Asp Asp-polymerase protein; Met is designated as No. 204 residues of reversed transcriptive enzyme here

In the whole specification sheets; Only if the other requirement of context; Word " comprises ", or its version should be understood that to mean said element or its integral body or element set or its whole comprising, rather than gets rid of any other element or its integral body or element set or its integral body.

Nucleotide and aminoacid sequence are to represent through sequence identifier symbol (SEQ ID NO :).SEQ ID NO: be equivalent to sequence identifier < 400>1 in number, < 400>2 etc.Sequence list will provide at the claim postscript.

The position of Nucleotide and amino acid mutation is used from the genotypic nomenclature of B, C or F and is confirmed, this is in the YMDD motif of archaeal dna polymerase the methionine(Met) position and is appointed as 550 (referring to No. the 734831st, Australian Patent).Nucleotide that provides in this specification sheets and amino acid position are based on new nomenclature, and the position of the methionine(Met) among the YMDD is 204 and is called rtM204 here, and rt is the abbreviation of reversed transcriptive enzyme here.

According to the present invention; Identify among the HBV resistance variant patient below; One not only with LMV but also with the patient (patient A) and a liver transplantation patient (patient B) with the ETV treatment of the chronic hepatitis B of ETV treatment, this patient used the many nucleotide medicines that comprise LMV to treat in the past.In combination therapy, according to the present invention, after LMV and ETV treatment, identified to have the HBV resistance variant that in the HBV dna polymerase gene, suddenlys change, sudden change has reduced the susceptibility of HBV to these nucleoside analogs.Corresponding sudden change also takes place in surface antigen.Other nucleoside analog regimen resistance of the method for inspection evaluation of these HBV variants is used for monitoring LMV and/or ETV resistance and/or to(for) exploitation and screening are important as the valuable drug of replacement therapy medicine.Detected sudden change from the key function structural domain of the isolating HBV of patient A, promptly rt169T+rtV173L+rtL180M+rtM204V proves that in functional analysis ETV is had the susceptibility of decline.

The detection of this HBV variant is even more important in the management of regimen, comprises the selection of the suitable medicine that treatment HBV infects.The method of this aspect of the present invention partly has experimenter's the development of the HBV carrying capacity of rising in the presence of nucleoside analog according to monitoring.So the clinician can make amendment or correspondingly selects suitable regimen existing regimen.

Thereby one aspect of the present invention relates to isolating HBV variant; This variant comprises coding mutation in the gene of coding DNA polysaccharase; At least one aminoacid addition, displacement and/or the disappearance that cause archaeal dna polymerase, and the susceptibility that ETV and/or LMV and other optional nucleoside analog performance are descended.Preferably, archaeal dna polymerase shows the susceptibility that descends to ETV or with ETV.The HBV of variation comprises sudden change in the eclipsed ORFs in the zone that one or more F and A-E structural domain by the HBV archaeal dna polymerase define in genome.

The invention further relates to the method for the potentiality that are used for confirming the susceptibility that HBV descends to ETV and/or LMV or other optional nucleoside analog performance; Through from HBV DNA isolation or corresponding mRNA and screening sudden change the nucleotide sequence of coding HBV archaeal dna polymerase; This sudden change causes in the structural domain of any one of said archaeal dna polymerase or a plurality of F and A-E or at least one amino-acid substitution, disappearance and/or interpolation in the most approaching zone there, and should suddenly change with relevant to the susceptibility of ETV and/or LMV resistance or decline.The existence of this sudden change is the indication that possibly have resistance to described Entecavir and/or LMV.Preferably, the HBV variant is to the susceptibility of ETV or ETV and the two performance decline of LMV.

The present invention also provides a kind of compsn, said composition comprise anti-ETV and/or LMV and optional other nucleoside analog variation HBV or from HBV surface antigen or its reorganization or derivative form or its chemical equivalence thing and one or more drug acceptable carriers and/or thinner of the HBV of variation.The HBV that another aspect of the present invention provides foregoing or in the gene of coding DNA polysaccharase, comprises the variation of coding mutation is used for treating and/or preventing the application of hepatitis b virus infected medicine in production; This sudden change causes at least one aminoacid addition, displacement and/or the disappearance of archaeal dna polymerase, and to the susceptibility of the decline of ETV and/or LMV and optional other nucleoside analog.

The present invention also relates to be used for to confirm the whether method of the susceptibility that performance descends to nucleoside analog of HBV strain; Through DNA isolation from HBV or corresponding mRNA; And screening sudden change in the nucleotide sequence of coding DNA polysaccharase, the wherein sudden change below transcribed spacer and rt district: the existence of transcribed spacer L97I, transcribed spacer K115R, transcribed spacer H116L, transcribed spacer L128F, transcribed spacer S137G, transcribed spacer R139G, transcribed spacer F142S, rtY54H, rtL91I, rtA97V, rtY124H, rtH126R, rtS135Y, rtI169T, rtV173L, rtL180M, rtM204V, rtA21S, rtA38E, rtF122L, rtT128N, rtQ130P, rtT184G, rtS202I, rtH248N, rtY252L or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of decline.

Present method also can be implemented through screening sudden change in the nucleotide sequence of coding DNA polysaccharase; B or the sudden change in the C-structure territory: rtI169T in the rt district below wherein, the existence of rtV173L, rtL180M, rtT184G, rtS202I, rtM204V or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of decline.

Should notice that two mutants rtV173L, rtL180M and rtM204V are respectively corresponding to two mutants V519L, L526M and the M550V of No. the 734831st, Australian Patent (adopting the naming system at initial stage).

Deep method is included in screening sudden change in the nucleotide sequence of encoded packets membrane gene, the sudden change (being illustrated in the variation in eclipsed reversed transcriptive enzyme district in the bracket) below wherein in PreS1, PreS2 and S gene: PreS1N114D, PreS1 T115S, PreS2 F22L, PreS2V39A, PreS2 P52L, sL89V, sT118A, sF161L (=rtI169T), sE164D (=rtV173L), sI195M (=rtM204V), the existence of sI208T, PreS1E86Q, PreS1N91K, PreS2 P41H, sQ30K, sP120T, sL176V, sV194F or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of decline.

Preferably, variant is to exist with isolating form, thus they separate from naturally occurring body fluid after through at least one purification step.Perhaps, variant can be kept in isolating body fluid or with dna form.The present invention also relates to comprise from the genome of the HBV that makes a variation or the infectious molecular cloning of its portion gene group.The detection of HBV in cell, cell lysate, culture supernatant liquid and body fluid or its component can be through any method easily; Comprise any detection method based on nucleic acid; For example, through nucleic acid hybridization technique or through one or more polymerase chain reactions (PCRs).Term " body fluid " comprise any fluid of autoblood, lymph, tissue or tract, comprise serum, whole blood, biopsy and biopsy liquid, organ transplantation body and organ suspension are like the liver suspension.The present invention further comprises the use based on the different test format of the detection method of nucleic acid, comprises that restriction fragment length polymorphism (RFLP), AFLP (AFLP), single chain conformation polymorphum (SSCP), amplification and mispairing detect (AMD), scatter Tumor-necrosis factor glycoproteins polymerase chain reaction (IRS-PCR), inverse PCR (iPCR) and reverse transcriptase polymerase chain reaction (RT-PCR) etc.Identifying that special Nucleotide or nucleotides sequence list reverse hybridized is the technology that is particularly useful.Other test format comprises Northern trace, Southern trace, PCR order-checking, antibody method, like enzyme-linked immunosorbent assay (ELISA), Western trace and immunohistochemistry.An analysis that is particularly useful comprises the desired reagent of detection system and the component of immobilized oligonucleotide or oligopeptides mediation.

Another aspect of the present invention relates to the HBV variant that comprises the surface antigen with feature; This surface antigen has the aminoacid sequence that contains single or a plurality of amino-acid substitutions, interpolation and/or disappearance or brachymemma with comparing from the surface antigen of reference or wild-type HBV; And wherein with respect to described HBV variant, the antibody that reference or wild-type surface antigen produce has showed the immunological properties that changes.The immunological properties of a change comprise reduction in the ability of HBV.More specifically, the HBV preceding with treatment compares, the immunological properties that the surface antigen performance of the HBV of variation changes, and the HBV of variation is through the nucleoside analog selection of HBV archaeal dna polymerase here.The HBV of the variation of this aspect of the present invention also can comprise such nucleotide sequence, and the HBV preceding with treatment compares, and this nucleotide sequence comprises one or more nucleotide subsitutions, interpolation and/or disappearance.

The present invention expands to the Equivalent corresponding to the isolating HBsAg of the HBV of variation or its recombinant forms or its verivate or chemistry.Usually; HBsAg or its reorganization or derivative form or its chemical equivalence thing comprise such aminoacid sequence; With compare from HBsAg with reference to HBV; The aminoacid sequence that contains single or a plurality of amino-acid substitutions, interpolation and/or disappearance or brachymemma, and, show the immunological properties that changes to antibody with reference to HBV wherein with respect to the HBV of the HBsAg that has described variation.In one embodiment, the immunological properties of change comprises the ability of the HBV that the neutralization of reduction makes a variation.

The present invention partly according to the evaluation of HBV variant with separate, this HBV variant has a plurality of sudden changes and performance is selected from following two or more character: with respect to wild-type HBV, the susceptibility that one or more nucleoside analogs is reduced or descend; The level of the decline of HBeAg and/or function vigor; Or that descend, immunity interaction cancellation or impaired.Therefore; Evaluation with HBV variant of these sudden change patterns is important; Especially be used to detect the check of HBV variant for exploitation and be used to screen to treating and/or preventing or/and the check that medicament is arranged of the infection that other HBV strain isolated causes by those variants, and the replacement therapy scheme that infects of exploitation control HBV.

Correspondingly; One aspect of the present invention relates to and comprising and at least two isolating HBV variants that are selected from the relevant multiple coding mutation of following character: (a) to the resistance of one or more nucleoside analogs; (b) level and/or the function vigor of HBeAg decline, or that (c) descend, immunity interaction cancellation or impaired.

Another aspect of the present invention relates to the isolating HBV variant that comprises a plurality of coding mutations; The sudden change of these Nucleotide is relevant with following character: (a) to the resistance of one or more nucleoside analogs; (b) level and/or the function vigor that descend of HBeAg, or (c) descend, immunity cancellation or impaired interacts relevant.

Another aspect of the present invention provides and has comprised the multiple isolating HBV variant that is selected from following two or more coding mutations: (a) coding mutation in the gene of coding DNA polysaccharase; Cause at least one aminoacid addition, displacement and/or disappearance to described archaeal dna polymerase; The susceptibility that wherein said variant descends to ETV and/or LMV and other optional nucleoside analog performance; (b) gene of coding HBeAg or the coding mutation in the said gene transcription controlling elements; Wherein said sudden change causes the level and/or the function vigor of the decline of described HBeAg; Or (c) coding mutation in the gene of coding hepatitis B polypeptide; Cause at least one amino acid whose interpolation, displacement and/or disappearance, reduce, cancel or damaged its immunity interaction described polypeptide.

Another one of the present invention relates to imagination and is used to detect the method to the active medicine of HBV performance inhibition; Through producing a gene construct; This construct comprises from the genome that duplicates significant quantity that is contained in the HBV in the plasmid vector, uses the described cell of described construct transfection then, before transfection, during and/or afterwards; With medicine exposing cell to be detected; Under certain condition culturing cell for some time, said condition is if to described drug resistant, then is enough to make hbv replication, expressing gene sequence and/or assembling and/or releasing virus or virus-like particle; And pair cell, cell lysate or culture supernatant liquid are used virus or the virus component detection method confirms in the presence of medicine genetic material and/or assembling and/or release are duplicated, expressed to virus whether.In preferred embodiments; Plasmid vector is that baculovirus vector and method comprise the generation gene construct; This construct comprises the genome that duplicates significant quantity from HBV, and it is included in or is blended in the baculovirus genome to the cells infected significant quantity, and infects described cell with described construct; Before infection, during and/or afterwards; With medicine exposing cell to be detected, under certain condition culturing cell for some time, said condition is if to described drug resistant; Then be enough to make hbv replication, expressing gene sequence and/or assembling and/or releasing virus or virus-like particle pair cell, cell lysate or culture supernatant liquid is used virus or the virus component detection method confirms in the presence of medicine genetic material and/or assembling and/or release are duplicated, expressed to virus whether then.

In alternative embodiment; This method comprises the generation continuous cell line; Comprise the genomic infectious copy of the HBV that duplicates significant quantity; So that described infectious HBV genome stable integration is in described continuous cell line, such as but be not limited to 2.2.15 or AD, with medicine exposing cell to be detected; Culturing cell for some time under certain condition; Said condition is if to described drug resistant, then is enough to make hbv replication, expressing gene sequence and/or assembling and/or releasing virus or virus-like particle pair cell, cell lysate or culture supernatant liquid is used virus or the virus component detection method confirms in the presence of medicine genetic material and/or assembling and/or release are duplicated, expressed to virus whether then.

In alternative embodiment, the present invention also relates in the check of polymerization in vitro enzyme, be used to detect method to the active medicine of HBV polysaccharase performance inhibition.Use the method for inspection that has been identified can measure HBV polymerase activity (Gaillard etc., Antimicrob AgentsChemother.46 (4): 1005-1013,2002; Xiong etc., Hepatology.28 (6): 1669-73,1998).The HBV polysaccharase can be a wild-type or with reference to the HBV polysaccharase of HBV polysaccharase or sudden change.

Combine with these methods, plasmid vector can comprise the gene of encoding part or whole other virus vector, for example baculovirus vector or adenovirus carrier (referring to Ren and Nassal, J.Virol.75 (3): 1104-1116,2001).

The evaluation of viral variants makes it possible to produce vaccine that comprises specific recombinant virus component (for example polysaccharase or coding L, M, the proteic env gene PreS1 of S, PreS2, S) and the treatment vaccine that comprises the HBV variant of defective.Can adopt rational medicinal design to identify or produce the treatment molecule, this treatment molecule can with other component interaction of polysaccharase or coding L, M, the proteic env gene PreS1 of S, PreS2, S or HBV.Such medicine also possibly have the diagnosis potentiality.

Being summarised in the table 2 of sequence identifier of running through the use of this specification sheets provides.

Table 2

The summary of sequence identifier

SEQUENCE ID NO：	Describe
		1	The F district (formula I) of HBV archaeal dna polymerase
2	The A-E district (formula II) of HBV archaeal dna polymerase
		3	Primer (OS1)
4	Primer (TTA3
		5	Primer (JM)
6	Primer (TTA4)
		7	Primer (OS2)
8	Primer SEQ2
		9	Primer TTA2
10	Forward primer PC1
		11	Reverse primer PC2
12	HBV special molecular sign primer
		13-18	TR1 (Fig. 4)
19-24	The Pol Trans (Fig. 5) of TR1
		25-30	The HBsAg Trans of TR1
31	Before the ETV treatment (Fig. 8)
		32	During the ETV treatment (Fig. 8)
33	Before the ETV treatment (Fig. 9)
		34	During the ETV treatment (Fig. 9)
35	Before the ETV treatment (Figure 10)
		36	ETV treatment back (Figure 10)

Brief description

Fig. 1 is the genomic diagram of the HBV of display part double-stranded DNA, shows the eclipsed ORFs of coded surface (S), core (C), polysaccharase (P) and X gene.

The diagram of the clinical case history of Fig. 2 patient A comprises regimen, HBV dna virus carrying capacity and SGPT (ALT) level.

Fig. 3 is the diagram of the chemical structure of Entecavir.

Fig. 4 be during LMV single therapy or the combination therapy of LMV/ Entecavir from patient A sequential sample in the HBV nucleotide sequence synoptic diagram relatively of coding pol gene catalytic domain.

Fig. 5 be during LMV single therapy or the combination therapy of LMV/ Entecavir from patient A sequential sample in the deduced amino acid synoptic diagram relatively of pol gene catalytic domain.

Fig. 6 be during LMV single therapy or the combination therapy of LMV/ Entecavir from patient A sequential sample in the deduced amino acid synoptic diagram relatively of env gene.

Fig. 7 confirms HBV variant latent energy value (P _A) the diagram of computer system.

Fig. 8 be during LMV single therapy (before the ETV) with ETV when treatment from the patient B sequential sample in the HBV nucleotide sequence synoptic diagram relatively of coding pol gene catalytic domain.

Fig. 9 be during LMV single therapy (before the ETV) with ETV when treatment from the patient B sequential sample in the deduced amino acid synoptic diagram relatively of pol gene catalytic domain.

Figure 10 be during LMV single therapy (before the ETV) with ETV when treatment from the patient B sequential sample in the deduced amino acid synoptic diagram relatively of env gene.

Figure 11 and the HBV that does not have the medicine wild-type that contrasts and the rtI169T+rtV173L+rtL180M+rtM204M that encodes to suddenly change are illustrated by the HBV dna replication dna intermediate product of quantitative PCR detection accordingly.

DESCRIPTION OF THE PREFERRED

The present invention partly according to ETV or LMV or ETV and LMV and optional other nucleoside analog to patient treatment after to nucleoside analog have resistance the HBV variant evaluation with separate.Especially, the patient of ETV, ETV and LMV treatment produces the HBV variant to ETV and/or LMV performance susceptibility that reduce or that descend.Here about the susceptibility of ETV and/or LMV relevant " minimizings " or " declines " comprise to nucleoside analog completely or sizable resistance and partial resistance, and be included in nucleoside analog existence time multiple-copy rate or the duplicating efficiency (generation phenotype) higher than wild-type.On the one hand, this can through virus load be elevated to treat before similar or higher level measure easily.

Correspondingly; One aspect of the present invention is to isolating HBV variant; Wherein said variant comprises coding mutation in the gene of coding DNA polysaccharase; At least one the amino acid whose interpolation, displacement and/or the disappearance that cause described archaeal dna polymerase, and wherein said variant susceptibility that ETV and/or LMV and other optional nucleoside analog performance are descended.

Preferably, the susceptibility of reduction is about ETV or ETV and LMV.

Except the sudden change in the gene of coding DNA polysaccharase; Because the genomic overlapping character of HBV (Fig. 1); Corresponding sudden change also can occur in the gene of coded surface antigen (HBsAg), causes and interaction that immunoreagent (for example to HBsAg antibody and immunocyte) reduces.The interactional reduction of the immunoreagent of virus surface component generally includes identification or discerns the disappearance of the immunological memory of virus surface component basically.The interactional HBV variant that the present invention therefore expands to susceptibility that ETV and/or LMV performance are descended and reduces to the immunoreagent performance of HBsAg, wherein variant is screened after ETV and/or LMV associating or sequential therapy.Term " sequential " meaning is to be to be that ETV or each ETV and the repeatedly sequential of LMV or LMV and ETV give behind LMV or the LMV behind the ETV in this respect.

Viral variants thereby can be only have sudden change in the two at archaeal dna polymerase or archaeal dna polymerase and HBsAg.A plurality of sudden changes should understood and comprise to term " sudden change " under the widest background.

The present invention expands to arbitrary structural domain and the especially F of HBV archaeal dna polymerase and the sudden change in A-E zone, as long as described sudden change causes the susceptibility to LMV and/or ETV decline.The F district of HBV archaeal dna polymerase is confirmed by the aminoacid sequence shown in the following formula I [SEQ ID NO:1].

Formula I

L，B ₁，B ₂，D，W，G，P，C，B ₃，B ₄，H，G，B ₅，H，B ₆，I，R，B ₇，P，R，T，P，B ₈，R，V，B ₉，G，G，V，

F，L，V，D，K，N，P，H，N，T，B ₁₀，E，S，B ₁₁，L，B ₁₂，V，D，F，S，Q，F，S，R，G，B ₁₃，B ₁₄，B

₁₅，V，S，W，P，K，F，A，V，P，N，L，B ₁₆，S，L，T，N，L，L，S ^*

Wherein:

B ₁Be L or R or I

B ₂Be E or D

B ₃Be T or D or A or N or Y

B ₄Be E or D

B ₅Be E or K or Q

B ₆Be H or R or N

B ₇Be I or T

B ₈Be A or S

B ₉Be T or R

B ₁₀Be A or T or S

B ₁₁Be R or T

B ₁₂Be V or G

B ₁₃Be S or I or T or N or V

B ₁₄Be T or S or H or Y

B ₁₅Be R or H or K or Q

B ₁₆Be Q or P

And S wherein ^*Be designated as amino acid 74.

In this manual, the conserved regions by the definite archaeal dna polymerase of A-E structural domain is especially relevant.Zone A confirms (and in No. the 734831st, Australian Patent) to E by the aminoacid sequence shown in the Formula Il [SEQ ID NO:2]:

Formula II

S Z ₁ L S W L S L D V S A A F Y H Z ₂ P L H P A A M P H L L Z ₃ G S S G L Z ₄ R Y V A

R L S S Z ₅ S Z ₆ Z ₇ X N Z ₈ Q Z ₉ Z ₁₀ X X X Z ₁₁ L H Z ₁₂ Z ₁₃ C S R Z ₁₄ L Y V S L Z ₁₅ L L Y

Z ₁₆ T Z ₁₇ G Z ₁₈ K L H L Z ₁₉ Z ₂₀ H P I Z ₂₁ L G F R K Z ₂₂ P M G Z ₂₃ G L S P F L L A Q F

T S A I Z ₂₄ Z ₂₅ Z ₂₆ Z ₂₇ Z ₂₈ R A F Z ₂₉ H C Z ₃₀ Z ₃₁ F Z ₃₂ Y M ^* D D Z ₃₃ V L G A Z ₃₄ Z ₃₅ Z ₃₆

Z ₃₇ H Z ₃₈ E Z ₃₉ L Z ₄₀ Z ₄₁ Z ₄₂ Z ₄₃ Z ₄₄ Z ₄₅ Z ₄₆ L L Z ₄₇ Z ₄₈ G I H L N P Z ₄₉ K T K R W G Y

S L N F M G Y Z ₅₀ I G

Wherein:

X is an arbitrary amino acid;

Z ₁Be N or D;

Z ₂Be I or P;

Z ₃Be I or V;

Z ₄Be S or D;

Z ₅Be T or N;

Z ₆Be R or N;

Z ₇Be N or I;

Z ₈Be N or Y or H;

Z ₉Be H or Y;

Z ₁₀Be G or R;

Z ₁₁Be D or N;

Z ₁₂Be D or N;

Z ₁₃Be S or Y;

Z ₁₄Be N or Q;

Z ₁₅Be L or M;

Z ₁₆Be K or Q;

Z ₁₇Be Y or F;

Z ₁₈Be R or W;

Z ₁₉Be Y or L;

Z ₂₀Be S or A;

Z ₂₁Be I or V;

Z ₂₂Be I or L;

Z ₂₃Be V or G;

Z ₂₄Be C or L;

Z ₂₅Be A or S;

Z ₂₆Be V or M;

Z ₂₇Be V or T;

Z ₂₈Be R or C;

Z ₂₉Be F or P;

Z ₃₀Be L or V;

Z ₃₁Be A or V;

Z ₃₂Be S or A;

Z ₃₃Be V or L or M;

Z ₃₄Be K or R;

Z ₃₅Be S or T;

Z ₃₆Be V or G;

Z ₃₇Be Q or E;

Z ₃₈Be L or S or R;

Z ₃₉Be S or F;

Z ₄₀Be F or Y;

Z ₄₁Be T or A;

Z ₄₂Be A or S;

Z ₄₃Be V or I;

Z ₄₄Be T or C;

Z ₄₅Be N or S;

Z ₄₆Be F or V;

Z ₄₇Be S or D;

Z ₄₈Be L or V;

Z ₄₉Be N or Q;

Z ₅₀Be V or I; With

M ^*Be amino acid 204;

And wherein first S is appointed as amino acid 75.

Preferably, sudden change any one or a plurality of F that cause the HBV archaeal dna polymerase and A-E structural domain or near regional inner amino acid array change there.

Another aspect of the present invention is provided at the HBV variant that comprises sudden change in the genomic overlapping open reading frame; Wherein said sudden change is in the zone of being confirmed by one or more F of HBV archaeal dna polymerase and A-E structural domain, and described variant susceptibility that ETV and/or LMV and other optional nucleoside analog performance are descended.

In relevant embodiment; The HBV that in the nucleotide sequence of coding DNA polysaccharase, comprises sudden change is provided variant, and this sudden change has caused interpolation, displacement and/or the disappearance in the one or more amino group of amino acids acid shown in described archaeal dna polymerase Chinese style I [SEQ ID NO:1] and/or the II [SEQ ID NO:2]:

Formula I

Wherein:

B ₁Be L or R or I

B ₂Be E or D

B ₃Be T or D or A or N or Y

B ₄Be E or D

B ₅Be E or K or Q

B ₆Be H or R or N

B ₇Be I or T

B ₈Be A or S

B ₉Be T or R

B ₁₀Be A or T or S

B ₁₁Be R or T

B ₁₂Be V or G

B ₁₃Be S or I or T or N or V

B ₁₄Be T or S or H or Y

B ₁₅Be R or H or K or Q

B ₁₆Be Q or P

And formula II

T S A I Z ₂₄ Z ₂₅ Z ₂₆ Z ₂₇ Z ₂₈ R A F Z ₂₉ H C Z ₃₀ Z ₃₁ F Z ₃₂ Y M ^*D D Z ₃₃ V L G A Z ₃₄ Z ₃₅ Z ₃₆

S L N F M G Y Z ₅₀I G

Wherein:

X is an arbitrary amino acid;

Z ₁Be N or D;

Z ₂Be I or P;

Z ₃Be I or V;

Z ₄Be S or D;

Z ₅Be T or N;

Z ₆Be R or N;

Z ₇Be N or I;

Z ₈Be N or Y or H;

Z ₉Be H or Y;

Z ₁₀Be G or R;

Z ₁₁Be D or N;

Z ₁₂Be D or N;

Z ₁₃Be S or Y;

Z ₁₄Be N or Q;

Z ₁₅Be L or M;

Z ₁₆Be K or Q;

Z ₁₇Be Y or F;

Z ₁₈Be R or W;

Z ₁₉Be Y or L;

Z ₂₀Be S or A;

Z ₂₁Be I or V;

Z ₂₂Be I or L;

Z ₂₃Be V or G;

Z ₂₄Be C or L;

Z ₂₅Be A or S;

Z ₂₆Be V or M;

Z ₂₇Be V or T;

Z ₂₈Be R or C;

Z ₂₉Be F or P;

Z ₃₀Be L or V;

Z ₃₁Be A or V;

Z ₃₂Be S or A;

Z ₃₃Be V or L or M;

Z ₃₄Be K or R;

Z ₃₅Be S or T;

Z ₃₆Be V or G;

Z ₃₇Be Q or E;

Z ₃₈Be L or S or R;

Z ₃₉Be S or F;

Z ₄₀Be F or Y;

Z ₄₁Be T or A;

Z ₄₂Be A or S;

Z ₄₃Be V or I;

Z ₄₄Be T or C;

Z ₄₅Be N or S;

Z ₄₆Be F or V;

Z ₄₇Be S or D;

Z ₄₈Be L or V;

Z ₄₉Be N or Q;

Z ₅₀Be V or I; With

M ^*Be amino acid 204;

And the S in formula I wherein ^*Be designated as amino acid 74, first S in formula II is designated as amino acid 75;

And the susceptibility that wherein said variant descends to ETV and/or LTV and other optional nucleoside analog performance.Preferably, the susceptibility of decline be to ETV or LMV and/or ETV the two.

In addition preferred aspect of the present invention relates to the HBV variant that in the nucleotide sequence of coding HBsAg, comprises sudden change; This sudden change causes in described HBsAg corresponding to amino acid whose interpolation in the zone of the aminoacid sequence shown in formula I and the II, displacement and/or disappearance, the susceptibility that wherein said variant descends to ETV and/or LMV and other optional nucleoside analog performance.

More specifically; The present invention provides the HBV that comprises such surface antigen variant; This surface antigen has the aminoacid sequence that contains single or a plurality of amino-acid substitutions, interpolation and/or disappearance or brachymemma with comparing from the surface antigen of reference or wild-type HBV; And wherein to reference to or the antibody of wild-type surface antigen showed the ability of the said HBV variant of neutralization that descends, described variant is through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy.

Term " combination therapy " is meant ETV and LMV, and the two gives jointly in same compsn or in different compositions, gives simultaneously.Term " sequential therapy " meaning be meant two kinds of medicines in several seconds, several minutes, several hours, several days or a few week with arbitrary order or alternately give.Sequential therapy also comprises to be used or ETV or LMV completion therapeutic process, accomplishes another therapeutic process with other ETV or LMV then.

Correspondingly; The HBV variant that comprises such surface antigen that relates in one aspect in addition of the present invention; This surface antigen is compared with the preceding HBV of treatment has the aminoacid sequence that contains single or a plurality of amino-acid substitutions, interpolation and/or disappearance or brachymemma; And wherein compare with the preceding HBV of treatment; The surface antigen of HBV of variation has showed the immunological properties that changes, and the HBV of variation described herein selects through the nucleoside analog of HBV archaeal dna polymerase, and described variant is through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy.

In relevant embodiment; The present invention provides the HBV that comprises such nucleotide sequence variant; This nucleotide sequence is compared with the preceding HBV of treatment, comprises one or more nucleotide subsitutions, interpolation and/or disappearance, and compares with the preceding HBV of treatment; The HBV variant contains the surface antigen of the immunological properties that performance changes, and described variant is through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy.

Preferably, variant is to exist with isolating form, thus they separate from naturally occurring body fluid after through at least one purification step.Perhaps, variant can be kept in isolating body fluid or with dna form.The present invention also relates to comprise from the genome of the HBV that makes a variation or the infectious molecular cloning of its portion gene group.And, the invention provides the separated portion of HBV from variation, such as but be not limited to isolating HBsAg.Correspondingly, the present invention provides the Equivalent of isolating HBsAg or its recombinant forms or its verivate or chemistry, is through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy from the described HBsAg of the HBV of variation.

More specifically; Another aspect of the present invention relate to isolating variation HBsAg or its reorganization or deutero-form or its chemical equivalence thing; Wherein with from HBsAg compare with reference to HBV; Immunological properties described HBsAg or its reorganization or that the performance of deutero-form or its chemical equivalence thing changes is through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy from the described HBsAg of the HBV of variation.

Even more specifically; The invention provides isolating variant HBsAg or its reorganization or deutero-form or its chemical equivalence thing; With compare from HBsAg with reference to HBV; Wherein said HBsAg or its reorganization or deutero-form or its chemical equivalence thing comprise aminoacid sequence with single or a plurality of amino-acid substitutions, interpolation and/or disappearance or brachymemma; And wherein to reference to the neutralizing antibody of HBV the HBV of the HBsAg that has described variation is had a reduction or do not have in and vigor, be through making the experimenter contact ETV and/or LMV screens in associating or sequential therapy from the described HBsAg of the HBV of variation.

Preferred sudden change in the HBV archaeal dna polymerase comprises the variant that is selected from the patient of ETV and/or the HBV recurrence of LMV treatment back.Preferably, treatment be included in associating or the sequential therapy ETV or ETV and/or LMV the two.The treatment of nucleoside analog is to migration process (bone marrow transplantation (BMT) or OLT) or after the patient's who is diagnosed as hepatitis treatment carry out for example.After the variant screening, the virus load that is higher than the preceding level of treatment can obtain.

Preferred sudden change in the HBV archaeal dna polymerase comprises one or more transcribed spacer L97I, transcribed spacer K115R, transcribed spacer H116L, transcribed spacer L128F, transcribed spacer S137G, transcribed spacer R139G, transcribed spacer F142S, rtY54H, rtL91I, rtA97V, rtY124H, rtH126R, rtS135Y, rtI169T, rtV173L, rtL180M, rtM204V, rtA21S, rtA38E, rtF122L, rtT128N, rtQ130P, rtT184G, rtS202I, rtH248N, rtY252L or its combination or one or more other sudden changes that are equal to, and this is the indication of variant that ETV and/or LMV and other optional nucleoside analog is had the susceptibility of reduction.The naming system that should note amino acid position is based on that methionine residues is designated as coding rtM204 in the YMDD motif.Different in No. the 734831st, this number system and the Australian Patent, the methionine residues in the YMDD motif in No. the 734831st, Australian Patent in the pol gene is designated as coding 550.In this, rtV173L, rtL180M and rtM204V are respectively corresponding to V519L, L526M and the M550V of No. the 734831st, Australian Patent.The meaning of term " transcribed spacer " is the zone that is specified between terminal protein and these two functional zone of reversed transcriptive enzyme.It provides correctly folding and has not had other specific function to give this zone for functional zone.Corresponding sudden change also possibly occur in the env gene, for example at one or more PreS1, among PreS2 and the HBsAg.Concrete sudden change is following: PreS1 N114D, PreS1 T115S, PreS2 F22L, PreS2 V39A, PreS2 P52L, sL89V, sT118A, s161L, sE164D, sI195M, sI208T PreS1 E86Q, PreS1 N91K, PreS2P41H, sQ30K, sP120T, sL176V, sV194F or its combination or the one or more sudden changes that are equal to, this is the indication of variant that ETV and/or LMV and other optional nucleoside analog is had the susceptibility of reduction.SF161L, sE164D or sI195M sudden change also cause the sudden change at pol gene rtI169T, rtV173L or rtM204V respectively in the gene of coding HBsAg.Other corresponding sudden change possibly take place in rt; Like transcribed spacer L97I, transcribed spacer K115R, transcribed spacer H116L, transcribed spacer L128F, transcribed spacer S137G, transcribed spacer R139G, transcribed spacer F142S, rtY54H, rtL91I, rtA97V, rtY124H, rtH126R, rtS135Y, rtI169T, rtV173L, rtL180M, rtM204V, rtA21S, rtA38E, rtF122L, rtT128N, rtQ130P, rtT184G, rtS202I, rtH248N, rtY252L or its combination or one or more other sudden changes of being equal to, this is the indication of variant that ETV and/or LMV and other optional nucleoside analog is had the susceptibility of decline.

The evaluation of variant of the present invention allows to produce a series of check and detects such variant.The detection of this variant is identifying that the resistance variant is important, to confirm suitable chemotherapy form and/or monitoring vaccine scheme or to develop vaccine preparation new or improvement.

Additional aspects of the present invention relate to the method in order to the potentiality of confirming the susceptibility that HBV reduces ETV and/or LMV or other optional nucleoside analog performance; Described method comprises from described HBV DNA isolation or corresponding mRNA; And screening sudden change in the nucleotide sequence of coding HBV archaeal dna polymerase; This sudden change causes in the structural domain of any one of said archaeal dna polymerase or a plurality of F and A-E or at least one amino-acid substitution, disappearance and/or interpolation in the most approaching zone there, and should suddenly change with relevant to the susceptibility of ETV and/or LMV resistance or decline.The existence of this sudden change is the indication that possibly have resistance to described ETV and/or LMV.

Preferably; This check can detect the sudden change below one or more in transcribed spacer and/or rt district: transcribed spacer L97I, transcribed spacer K115R, transcribed spacer H116L, transcribed spacer L128F, transcribed spacer S137G, transcribed spacer R139G, transcribed spacer F142S, rtY54H, rtL91I, rtA97V, rtY124H, rtH126R, rtS135Y, rtI169T, rtV173L, rtL180M, rtM204V, rtA21S, rtA38E, rtF122L, rtT128N, rtQ130P, rtT184G, rtS202I, rtH248N, rtY252L or its combination or one or more other sudden changes that are equal to, this is the indication of variant that ETV and/or LMV and other optional nucleoside analog is had the susceptibility of decline.

Correspondingly; Another aspect of the present invention produces in order to confirm the whether method of the susceptibility that performance descends to nucleoside analog of HBV strain; Described method comprises from described HBV DNA isolation or corresponding mRNA; And screening sudden change in the nucleotide sequence of coding HBV archaeal dna polymerase; The wherein sudden change below transcribed spacer and rt district: the existence of transcribed spacer L97I, transcribed spacer K115R, transcribed spacer H116L, transcribed spacer L128F, transcribed spacer S137G, transcribed spacer R139G, transcribed spacer F142S, rtY54H, rtL91I, rtA97V, rtY124H, rtH126R, rtS135Y, rtI169T, rtV173L, rtL180M, rtM204V, rtA21S, rtA38E, rtF122L, rtT128N, rtQ130P, rtT184G, rtS202I, rtH248N, rtY252L or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of reduction.

Preferred sudden change is rtI169T, rtV173L, rtL180M, rtT184G, rtS202I, rtM204V or its combination or one or more other sudden changes of being equal in the reversed transcriptive enzyme, and this is the indication of variant that ETV and/or LMV and other optional nucleoside analog is had the susceptibility of reduction.

Correspondingly; Another aspect of the present invention relates in order to confirm the whether method of the susceptibility that performance reduces to nucleoside analog of HBV strain; Described method comprises from said HBV DNA isolation or corresponding mRNA; And screening sudden change in the nucleotide sequence of coding HBV archaeal dna polymerase; Sudden change below wherein in the B in rt district or C-structure territory: the existence of rtI169T, rtV173L, rtL180M, rtT184G, rtS202I, rtM204V or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of reduction.

The detection of HBV in cell, cell lysate, culture supernatant liquid or body fluid or its component can be through any method easily; Comprise any detection method based on nucleic acid; For example, through nucleic acid hybridization technique or through one or more polymerase chain reactions (PCRs).Term " body fluid " comprises any liquid that gets autoblood, lymph, tissue or tract, comprises serum, and whole blood, biopsy and biopsy liquid, organ transplantation body and organ suspension are like the liver suspension.The present invention further comprises the use of said difference check form based on nucleic acid detection method, comprises that restriction fragment length polymorphism (RFLP), amplified fragments polymorphum (AFLP), single chain conformation polymorphum (SSCP), amplification and mispairing detect (AMD), interspersedrepetitive sequence polymerase chain reaction (IRS-PCR), inverse PCR (iPCR) and reverse transcriptase polymerase chain reaction (RT-PCR) etc.Other test format comprises Northern trace, Southern trace, PCR order-checking, antibody method, like enzyme-linked immunosorbent assay (ELISA), Western trace and immunohistochemistry.An analysis that is particularly useful comprises the desired reagent of detection system and the component of immobilized oligonucleotide or oligopeptides mediation.

A nucleic acid detection system that is particularly useful is reverse hybridized technology.In this technology, use vitamin H or other aglucon labeled primer to increase DNA from the HBV sample to produce the amplicon of mark.Catch the DNA of amplification through hybridization with the oligonucleotide that is fixed on the solid support (for example cellulose nitrate film) then.Identify special nucleic acid fragment through vitamin H or aglucon.Usually, labeled primer is special to specific nucleotide diversity to be detected.Amplification only takes place in the presence of variation to be detected.There are reverse hybridized analytical form and all of many kinds of forms all to comprise in the present invention.

In cell culture fluid, detecting hbv replication is particularly useful.

Another aspect of the present invention relates to and is used to detect the method to the active medicine of HBV performance inhibition, through:

Produce a gene construct, this construct comprises the genome that duplicates significant quantity from HBV that is contained in the plasmid vector, uses the described cell of described construct transfection then;

Before transfection, during and/or afterwards, with medicine exposing cell to be detected;

Culturing cell for some time under certain condition is if said condition is for to described drug resistant then be enough to make hbv replication, expressing gene sequence and/or assembling and/or releasing virus or virus-like particle; And

Pair cell, cell lysate or culture supernatant liquid are used virus or the virus component detection method confirms in the presence of medicine genetic material and/or assembling and/or release are duplicated, expressed to virus whether.

In preferred embodiments, plasmid vector can comprise encoding part or whole genes of other virus vector, for example baculovirus or adenovirus (Ren and Nassal, 2001, supra), and method comprises:

Produce a gene construct; This construct comprises the genome that duplicates significant quantity from said HBV; It is contained in or is blended in the baculovirus genome or adenoviral gene group of cells infected significant quantity, infects described cell with described construct then;

Before infection, during and/or afterwards, with medicine exposing cell to be detected;

In alternative embodiment, this method comprises:

Produce continuous cell line, this continuous cell line comprises the genomic infectious copy of the HBV that duplicates significant quantity, so that described infectious HBV genome stable integration is in described continuous cell line, such as but be not limited to 2.2.15 or AD;

With medicine exposing cell to be detected;

Culturing cell for some time under certain condition, if said condition for to described drug resistant be enough to make hbv replication] expressing gene sequence and/or assembling and/or releasing virus or virus-like particle; And

Shown in top, variant also can be directed against HBsAg (s gene) and PreS1, the PreS2 env gene detects.Preferred in this sudden change comprises one or more PreS1 N114D, PreS1 T115S, PreS2 F22L, PreS2 V39A, PreS2 P52L, sL89V, sT118A, sF161L, sE164D, sI195M, sI208T PreS1 E86Q, PreS1 N91K, PreS2 P41H, sQ30K, sP120T, sL176V, sV194F.

Correspondingly; Another aspect of the present invention relates in order to confirm the whether method of the susceptibility that performance descends to nucleoside analog of HBV strain; Described method comprises from described HBV DNA isolation or corresponding mRNA; And screening sudden change in the nucleotide sequence of encoded packets membrane gene; Sudden change below wherein in PreS1, PreS2 and HBsAg: the existence of PreS1 N114D, PreS1 T115S, PreS2 F22L, PreS2 V39A, PreS2 P52L, sL89V, sT118A, sF161L, sE164D, sI195M, sI208T PreS1 E86Q, PreS1 N91K, PreS2P41H, sQ30K, sP120T, sL176V, sV194F or its combination or one or more other sudden changes of being equal to is the indications of variant that ETV and/or LMV and other optional nucleoside analog had the susceptibility of reduction.

The present invention partly according to the evaluation of HBV varient with separate, the HBV varient has a plurality of sudden changes and performance is selected from following two or more character: HBV compares with wild-type, the susceptibility that one or more nucleoside analogs is reduced or reduce; The level of the decline of HBeAg and/or function vigor; Or that reduce, immunity interaction that abolish or impaired.Therefore; Evaluation with HBV variant of these sudden change patterns is important; Especially the method for inspection that is used to detect the HBV variant for exploitation be used to screen to treating and/or preventing or/and the method for inspection that medicament is arranged of the infection that other HBV strain isolated causes and the replacement therapy scheme that infects of exploitation control HBV by those variants.

Correspondingly; One aspect of the present invention is to comprising and at least two isolating HBV variants that are selected from the relevant multiple coding mutation of following character: (a) to the resistance of one or more nucleoside analogs; (b) level and/or the function vigor of HBeAg decline, or that (c) descend, immunity interaction cancellation or impaired.

Another aspect of the present invention relates to the isolating HBV variant that comprises a plurality of coding mutations; The sudden change of these Nucleotide is relevant with following character: (a) to the resistance of one or more nucleoside analogs; (b) level and/or the function vigor of HBeAg decline, or that (c) descend, immunity interaction cancellation or impaired.

The detection of the amino acid variant of archaeal dna polymerase can be through accomplishing with reference to the aminoacid sequence shown in formula I and the II.Shown polymorphum representative is in the variation shown in the several data storehouse of the HBV strain that is used for active cause of disease.When the HBV variant comprises when being different from represented amino acid, this strain isolated is considered to have the HBV variant of inferring of the dna polymerase activity of change.

The present invention further comprises the medicine of the HBV variant that suppresses ETV and/or LMV resistance.If the clinician adopts ETV and/or LMV and/or other optional nucleoside analog long-term treatment, this medicine is particularly useful.Medicine can be the chemical molecular of DNA or RNA or proteinic or nonprotein.Screening is also by the valuable potential source of expection as a kind of screening agent from natural product (for example plant, coral and mikrobe).Medicine can be the form of isolating form or pharmaceutical composition and can be with nucleoside analog sequential or give simultaneously.

Correspondingly, another aspect of the present invention relates to and is used to detect the method for the active medicine of HBV performance inhibition, and said HBV is for the susceptibility of ETV and/or LMV performance resistance or decline, and described method comprises:

Another aspect of the present invention is provided for detecting the method for the active medicine of HBV performance inhibition, and said HBV is for the susceptibility of ETV and/or LMV performance resistance or decline, and described method comprises:

Produce a gene construct, this construct comprises the genome that duplicates significant quantity from said HBV, and it is contained in or is blended in the baculovirus genome of cells infected significant quantity, infects described cell with described construct then;

Another aspect of the present invention is provided for detecting the method for the active medicine of HBV performance inhibition, and said HBV is for the susceptibility of ETV and/or LMV performance resistance or reduction, and described method comprises:

Preferably, HBV genome stable integration is gone in the cellular genome.

Though baculovirus vector is particularly useful in embodiment of the present invention, the present invention expands to a series of other carrier, such as, but be not limited to adenovirus.

The present invention further expands to the clone that has gene construct, and this construct comprises the part of all or part of HBV genome or gene or gene.

The present invention also provides HBV variant of the present invention to screen the purposes of antiviral.These antiviral suppress virus.Term " inhibition " comprises antagonism or protects from infection, duplicates, assembles and/or release or any intermediate steps.Preferred antiviral comprises nucleoside analog, yet the present invention expands to non-nucleoside molecule.

In addition, reasonably medicinal design also can be used to identify or produce chemical molecular, these chemical moleculars or simulate nucleosides or interact with specific nucleotide sequence or specific Nucleotide.Combinatorial chemistry and double cross screening are to be used for one of some technology of identifying potential treatment or diagnostic medicine.

In an example, the crystalline structure of polysaccharase or surface antigen is used for reasonably designing little chemical molecular, and these chemical moleculars possibly interact with the key area of function and/or the desired molecule of antigenicity.This medicine is useful and/or the epi-position of change surface antigen as the activity inhibitor of polysaccharase.

Because and from the similarity of hiv reverse transcriptase, several models of HBV polysaccharase prepare (Das etc., J.Viol.75 (10): 4771-4779,2001; Bartholomeusz etc., Intervirology40 (5-6): 337-342 1997; Allen etc., Hepatology27 (6): 1670-1677,1998).The model of HBV polysaccharase can be used for being directed against the HBV of coding resistant mutation and the rational drug design of the effective novel drugs of wild-type virus.The rational medicine that is designed can be based on the improvement to existing antiviral, for example is used to screen the medicine of the HBV of the coding sudden change relevant with resistance.Virus or the clone who expresses the HBV genomic material of encoding mutant also can be used for screening new antiviral.

Top method is particularly useful in the suppressor factor of the HBV that identifies anti-ETV and/or LMV.The present invention thereby expand to the compsn of suppressor factor.Suppressor factor also can be the form of antibody or genetic molecule, for example ribozyme, be used for that RNAi suppresses altogether or inductive antisense molecule and/or adopted molecule is arranged.Mentioning RNAi comprises and relates to siRNA.

Term " compsn " comprises " pharmaceutical composition ".

Suppressor factor is called as " active ingredient " or " active compound " below, and the suppressor factor list that provides above can being selected from.

Compsn can comprise the antigenicity component of HBV, the HBV variant of defective type or the medicine of identifying through natural product screening or rational drug design (comprising combinatorial chemistry).

Medicine acceptable carrier and/or thinner comprise any and whole solvents, dispersion medium, dressing, antibacterium and anti-mycotic agent, etc. blend absorption delay agent etc.This medium or reagent to pharmaceutically active substance to be used for this area well-known.Except any and medium or the reagent inconsistent routine of active ingredient, also comprise its application in therapeutic compsn.The active ingredient that replenishes also can be referred in the compsn.

Pharmaceutical composition also can comprise genetic molecule, carrier that for example can transfection purpose cell, and this carrier has the nucleic acid molecule of the aspartyl protease inhibitor of can encoding.For example carrier can be a virus vector.

The medicament forms that is fit to the injection use comprises aseptic aqueous solution (being water soluble) here and is used to face the sterilized powder with preceding preparation sterile injectable solution.It must be stablized under production and holding conditions and must under antimicrobial (for example bacterium and fungi) contamination, preserve.Carrier can be solvent or diluent media, for example comprises water, ethanol, polyvalent alcohol (for example, USP Kosher, Ucar 35, liquid macrogol etc.), their suitable mixture and vegetables oil.Suitable flowability can be held, such as, through using superfactant.The inhibition of microbial process can pass through multiple antibacterium and antifungal agents is realized, for example, and hydroxybenzoate, butylene-chlorohydrin, phenol, Sorbic Acid, thirmerosal etc.In many examples, preferably comprise isotonic agent, for example sugar or sodium-chlor.The prolongation of injectable composition absorbs and can postpone absorption agent, for example aluminum monostearate and gelatin through in the compsn of medicine, using.

The sterile injectable solution active compound in suitable solvent and desired active ingredient and other optional active ingredient mixing through making aequum prepares through filtration sterilization or other suitable sterile method then.Under the situation of the sterilized powder that is used to prepare sterile injectable solution, appropriate preparation method comprises vacuum-drying and Freeze Drying Technique, can produce to have the powder that active ingredient adds any additional required component.

Suitably protected when active ingredient, it can be taken orally, and for example, use inert diluent or use absorbable right food carrier, or the gelatine capsule of the hard or soft shell of packing into, maybe can be compressed into tablet.Be used for oral therapeutic administration, active ingredient can and mixed with excipients, and use with forms such as digestible tablet, cheek sheet, lozenge, capsule, elixir, suspension agent, syrup, wafer papers.It is 1% active compound that this compsn and preparation should comprise weight at least.The percentage composition of compsn and preparation yes can be different and can be easily at the about 5%-80% of unit weight.The amount of the active compound in this treatment effective compsn is to make to obtain proper dosage.According to preferred compositions of the present invention or preparation is such preparation, so that oral dosage unit form comprises the active compound of about 0.1 μ g-200mg.The dosage that can select comprises about about 1000mg of 1 μ g-and the about 500mg of about 10 μ g-.These dosage are individual or every kg body weight according to each.Administration per hour can be, day, week, month or year.

Tablet, cheek sheet, pill or capsule etc. also can comprise the component of after this listing.Tamanori is like natural gum, Sudan Gum-arabic, W-Gum or gelatin; Vehicle is like Lin Suanergai; Disintegrating agent is like W-Gum, potato starch, alginic acid etc.; Lubricant is like Magnesium Stearate; And sweeting agent, like sucrose, lactose or asccharin or seasonings, like spearmint oil, wintergreen oil or cherry flavor.When the medicament unit form is a capsule, except the raw material of top type, it can comprise liquid vehicle.Multiple other raw material can be used as dressing or changes the physical form of medicament unit and occur.For example, tablet, pill or capsule can encapsulate with shellac, sugar or the two.Syrup or elixir can comprise active compound, sucrose as sweeting agent, methyl and propylbenzoic acid ester as sanitas, dyestuff and seasonings.Certainly, when any medicament unit form of preparation used any raw material should be pharmaceutical purity and nontoxicity in institute's consumption basically.In addition, active compound can be incorporated in the goods and preparation that continue to discharge

As mentioned above, the present invention further expands to the isolating HBsAg from HBV variant described herein.More specifically, the invention provides the Equivalent of HBsAg or its recombinant forms or its deutero-or chemistry.Isolating surface component with, more specifically, isolating surface antigen or its reorganization, deutero-or the chemistry Equivalent useful in the exploitation of biological composition (for example vaccine preparation).

Another aspect of the present invention provides compsn, said composition comprise anti-ETV and/or LMV and optional other glycosides analogue variation HBV or from the HBV surface antigen of the HBV of described variation or its reorganization or deutero-form or its chemical equivalence thing and one or more drug acceptable carriers and/or thinner.

Shown in top, can produce antibody to the HBV that suddenlys change, and be used for being directed against the passive or direct immunity of the infection that causes by these viruses.Antibody can result from human or inhuman animal.In the latter case, the non-human antibody need remove immunity or humanization more specifically before use.Go immunity to comprise, for example, transplanting is arrived on total antibody fragment combination (Fab) polypeptide of people from the complementary determining region (CDRs) of the variable region of mouse or non-human animal's anti-HBV antibody.Perhaps, the amino acid of definition epi-position can be suddenlyd change so that epi-position is no longer discerned by people's MHCII mixture in antibody variable region.

In the scope of ribozyme, consider antisense or common inhibition (RNAi), this is very expediently to the gene silencing after transcribing.DNA or RNA or use be can apply and mixture or its chemical analog comprised the special RNAi of HBVmRNA.

All this molecules can comprise in the pharmaceutical composition.

In other embodiment, the present invention provides biological composition, said composition comprise the HBV variant or from the HBsAg of described variation HBV or L, M or S albumen or its reorganization or deutero-form or its chemical equivalence thing.

Usually, if HBV is used, it at first will be attenuated.Biological composition according to this respect of the present invention further comprises one or more medicine acceptable carrier and/or thinners usually.

Biological composition can comprise that from a kind of HBsAg of HBV variant or similar molecule or compsn can be the mixture from the HBsAg of a series of anti-ETV and/or LMV HBV variant or L, M or S albumen or similar molecule.Similar interior contract appearance is applicable to the compsn that comprises HBV.

The present invention further to the use of HBV variant in the production of treatment vaccine of defective type, is used for to individual vaccination to prevent having specific nucleotide sequence or the infection of encode specific polysaccharase or surface antigen or the proteic HBV variant of L, M or S.

In one embodiment, for example, the HBV variant is accredited as has specific sudden change in its polysaccharase, and this sudden change is given the resistance of nucleoside analog or the susceptibility of decline.This then variant can be by sudden change so that it becomes defective type, that is, attenuation maybe can not cause infection.The virus of the anti-nucleoside analog of such defective type can be used as the treatment vaccine to the virus of the severe toxicity that in polysaccharase, has identical sudden change then.

The present invention is extended for the test kit of HBV of the variation of anti-ETV and/or LMV.This test kit is passable, for example, comprises from the reagent of PCR or other nucleic acid hybridization technique or based on the technological reagent of immunology detection.Check that is particularly useful comprises the oligonucleotide that is used for fixing or the required reagent and the component of detection system of oligopeptides mediation.

Another aspect of the present invention relates to the method in order to the potentiality of confirming the susceptibility that HBV descends to ETV and/or LMV or other optional nucleoside analog performance; Through from HBV DNA isolation or corresponding mRNA and screening sudden change the nucleotide sequence of coding HBV archaeal dna polymerase; This sudden change causes in the structural domain of any one of said archaeal dna polymerase or a plurality of F and A-E or at least one amino-acid substitution, disappearance and/or interpolation in the most approaching zone there; And should sudden change with relevant to the susceptibility of ETV and/or LMV resistance or decline, wherein the existence of this sudden change is the indication that possibly have resistance to described ETV and/or LMV.

The assessment of potential viral variants is important to screening suitable regimen.Obtained suitable promotion under this help that is evaluated at the computingmachine of software programming, its calculating is used for the index (I of at least two characteristics relevant with viral variants _vS) to provide corresponding to the latent energy value (P of viral variants to the resistance or the susceptibility of particular chemical compound or immunoreagent _A).I _vS can be selected from (a) ability to the susceptibility of specific compound or immunoreagent performance resistance or decline; (b) the HBV polysaccharase different with wild-type; (c) with wild-type HBV different surface antigen; (d) patient's morbidity and restorative potentiality.Thereby, according to the present invention, the I of this specific character _vS is kept in the machine-readable storage media, and it can processing data provides P with the biological specimen of giving specific viral variants or comprising this viral variants _A

Therefore, in other one side, the present invention relates to computer program, the possible validity of the biological specimen that is used for assessing viral variants or comprise viral variants is to confirm that described product comprises at a regimen that the experimenter is suitable:

(1) coding is as input I _vS accepts at least two kinds with described viral reagent or comprise the relevant characteristic of biological specimen of viral reagent, and wherein said characteristic is selected from:

(a) to the ability of the susceptibility of specific compound or immunoreagent performance resistance or decline;

(b) archaeal dna polymerase different with wild-type HBV

(c) with wild-type HBV different surface antigen; Or

(d) patient's morbidity and restorative potentiality;

(e) replication that changes (rising or descend);

(2) calculate said I _vS's and so that the coding corresponding to the summation of the Pv of described viral variants or biological specimen to be provided; With

(3) store calculation of coding machine computer-readable recording medium.

In related fields, the present invention is extended for the computingmachine of the possible validity of the biological specimen of assessing viral variants or comprising viral variants, and wherein said computingmachine comprises:

(1) machine-readable data storage media comprises with machine-readable data coded data storage medium, and wherein said machine-readable data comprises and is used for the I relevant with at least two specific characters of said viral variants or biological specimen _vS, wherein said characteristic is selected from:

(a) to the ability of the susceptibility of specific compound or immunoreagent performance resistance or reduction;

(b) archaeal dna polymerase different with wild-type HBV;

(c) with wild-type HBV different surface antigen; Or

(d) patient's morbidity and restorative potentiality;

(e) replication that changes (rising or descend);

(2) be used for the working memory of store instruction, this instruction is used to handle described machine-readable data;

(3) be attached to the center processing unit of described working memory and described machine-readable data storage media, be used to handle described machine-readable data so that the said I corresponding to said Compound P v to be provided _vThe summation of s; And

(4) be attached to the output hardware of described center processing unit, be used to receive described Pv.

The present invention adopts the computer system of any general or special purpose and comprises the treater with internal memory and at least one input-output apparatus (for example terminal) telecommunications.This system can be including, but not limited to PC, workstation or large scale computer.Treater can be the specialized treater that general use treater or microprocessor or execution are positioned at the program of memory ram.Program can be positioned over RAM from storing device (for example, disk or pre-programmed ROM internal memory).Memory ram both had been used for data storing and also had been used for the program execution in one embodiment.Computer system comprises that also being arranged in different physical entities still passes through the treater of network electronic communication and the system of internal memory.For example, the computer system that has whole characteristics that Fig. 7 sets forth is useful in embodiment of the present invention.More specifically; Fig. 7 is the synoptic diagram of typical computer workstation; This workstation passes through; For example, internal bus or external network make treater (101), RAM (102), ROM (103), terminal (104) and optional external memory storage (for example disk, CD ROM or tape (105) have mutual telecommunications (100).

The present invention further describes through following non-limiting example.

Embodiment 1

The eclipsed genome of HBV

The eclipsed genome of HBV is represented in Fig. 1.The gene of coding DNA polysaccharase (P) and peplos gene, Pre-S1 and Pre-S2 are overlapping, and overlapping with X and core (C) Gene Partial.The HBV coating comprises little, medium and big HBV surface antigen.Big protein component is called as HBV surface antigen (HBsAg) and is centered on by the S gene order.Pre-S1 and Pre-S2 gene order coding another one coating component.

Embodiment 2

Patient and treatment

Patient A is a male sex of 44 years old who suffers from chronic hepatitis B, the HBV dna level that raises in 0 day (on July 9th, 1999) performance (＞2000pg/ml), and be proposed and carry out LMV treatment (Fig. 2) immediately.The HBsAg of patient A is positive and anti--HBe is positive.The HBV dna level drops to 8pg/ml in LMV treatment beginning back 54 days course of treatment.It is low-level in the time of 199 days that HBV DNA keeps, and recurrence so that HBV dna level have occurred duplicating and reached 1826pg/ml.During by the 241st day, Serum ALT peaks and is 741IU/l.To the HBV dna sequencing, detect anti-LMV virus.The patient has added double blinding ETV the 382nd day (on July 24th, 2000) then and has added the LMV clinical trial.By the 784th day, the HBV dna level only drops to 33pg/m and ALT is reduced to 167IU/L.The patient is begun open-label ETV add LMV.Yet, HBV dna level and ALT continue to raise and at the 894th day to HBV dna sequencing (Fig. 2).

Patient B is a liver-transplantation patients.This patient has used many kinds of nucleoside analog treatments, comprises ganciclovir (ganciclovir), Famciclovir (famciclovir) LMV and ETV.The patient is used the LMV treatment before ETV.The patient is at present in the ETV treatment.During the ETV treatment, the HBV dna level reduces to and is lower than 5pg/ml.The 532nd day of ETV treatment, the 993pg/ml that is elevated to of HBV dna level appearred in after being equivalent to transplant the 3857th day.HBV DNA from this sample further carries out property testing through order-checking.

Embodiment 3

The detection of virus marker thing

Use commercially available immune analysis determination RTSs (HBsAg), HBeAg (HBeAg), anti--HBe and special IgG and IgM (Abbott laboratory, North Chicago, IL, the U.S.) of HBcAg (HBcAg).(Beltsville MD) uses and catches hybridization analysis and measure the hepatitis B virus DNA level for Digene Hybrid Capture II, Digene Diagnostics Inc. according to manufacturer's guide.The threshold value that manufacturer statement is used for detecting clinical sample HBV viremia is 0.7 * 10 ⁶Copy/ml or 2.5pg/ml, [Hendricks DA etc., Am J Clin Pathol 104:537-46,1995].

Embodiment 4

The order-checking of HBV DNA

As in the past at Aye etc., J Hepatol.26:1148-53, described in 1997, HBV DNA (Fig. 2) in the 100 μ l serum that 6 different time points are collected, extracted.Oligonucleotide is by Geneworks, Adelaide, and Australia is synthetic.The amplification of HBV pol gene is by Aye etc., and 1997, supra describes.

Use is available from MO BIO Laboratories Inc (La Jo1la; CA) the special amplified production of PCR purifying chromatography column purification; And use Big Dye terminator Cycle sequencing Ready Reaction Kit (Perkin Elmer; Cetus Norwalk, CT) directly order-checking.The PCR primer is used as sequencing primer; OS1 5 '-GCC TCA TTT TGTGGG TCA CCA TA-3 ' (nt 1408-1430) [SEQ ID NO:3]; TTA3 5 '-AAATTC GCA GTC CCC AAA-3 ' (nt 2128-2145) [SEQ ID NO:4]; JM5 '-TTG GGG TGG AGC CCT CAG GCT-3 ' is [SEQ IDNO:5] (nt1676-1696); TTA4 5 '-GAA AAT TGG TAA CAGCGG-3 ' is [SEQ ID NO:6] (nt2615-2632), OS2 5 '-TCT CTG ACA TACTTT CCA AT 3 ' (nt 2798-2817) [SEQ ID NO:7], the sequence of the interior region of mensuration PCR product.

Embodiment 5

The analysis of HBV DNA

Patient A: detected rtL180M and the rtM204V sudden change (table 3) of anti-LMV by the 199th day through order-checking.In the double blinding stage of Entecavir and LMV treatment, the rtV173L sudden change also is detected.A unique sudden change rtI169T is detected at the rtL180M of B structural domain and the rtM204 sudden change in rtM173L sudden change and C-structure territory with other two at the B structural domain.Many other unique variations also are detected (table 4, Fig. 4,5 and 6) in polysaccharase He in the eclipsed env gene.The change that these are unique and from each canonical sequence of seven genotype A-G and from the consensus sequence of sample before the treatment relatively to confirm unique change.

Patient B: the 532nd day sample of ETV treatment checked order and with the ETV treatment before sample comparison (Fig. 8,9 and 10).In this sample, detect several polymerase mutations, comprise rtA21S, rtA38E, rtY54H, rtN76D, rtL91I, rtF122L, rtY124H, rtT128N, rtQ130P, rtL180M, rtT184G, rtS202I, rtM204V, rtH248N, rtY252L.In the beginning of ETV treatment, the patient is using the LMV treatment and is detecting rtL80M and M204V sudden change (Fig. 8,9 and 10).LMV sudden change (rtL180M and rtM204V) even during the ETV treatment, be detected under the LMV selective pressure not having, and these sudden changes also can be played the effect of anti-ETV.In the virus outbreak period of ETV, LMV select A-G sudden change and above the sudden change listed still exist.The sudden change that all are listed and from seven genotypic each canonical sequences and from the consensus sequence of the sample before the treatment relatively to confirm unique change.

Patient B is that HBeAg is negative and suddenly change at preceding core genes encoding G1896A from the isolating HBV of this patient, causes the terminator codon in precore protein precoreW28Stop.Other regional sudden change and the sudden change in the pol gene influence the susceptibility of hbv replication suitability and enantiopathy cytotoxic drug together in the genome that the G1896A of core suddenlys change before comprising.

Embodiment 6

The analyzed in vitro of Entecavir resistance

Use reorganization HBV/ baculovirus that the susceptibility/resistance character of the Entecavir of HBV two mutants is detected.Analyzing the method for resistance character summarizes among the embodiment 7-14 below.

Embodiment 7

Cell cultures

The Sf21 insect cell further add 10% v/v heat inactivation foetal calf serum (GibcoBRL, Gaithersburg, in additional Grace ' s insect substratum MD) at 28 ℃ moistening CO ₂Cultivate in the incubator.The HepG2 cell is cultivated in the MEM (MEM-FBS) that replenishes 10% heat inactivation foetal calf serum.The HepG2 cell is at 37 ℃ moistening 5%v/v CO ₂Incubator in grow.

Embodiment 8

Preparation with HBV/ baculovirus transfer vector of special point mutation

The reorganization HBV/ rhabdovirus system that is used for antiviral check was described (Delaney etc., Antimicrob Agents Chemother 45 (6): 1705-1013,2001) in the past.Briefly, comprise 1.3 * HBV genome through cutting-out and make up the fragment of body and be cloned into baculovirus vector pBlueBac4.5 that (polyclone district CA) is to produce recombinant transfer vector for Invitrogen, Carlsbad.(QuikChange, Stratagene) the commodity in use test kit produces point mutation through fixed-point mutation method according to manufacturer's specification sheets.The HBV recombinant chou of coding reversed transcriptive enzyme sudden change rtI169T+rtV173L+rtL180M+rtM204V.Specification sheets (Perkin Elmer according to the manufacturer; Cetus Norwalk CT) uses ABI Prism Big DyeTerminator Cycle Sequencing Ready Reaction Kit to prove conclusively to the nucleotide sequence of plasmid with by the point mutation that fixed-point mutation method produces through order-checking.

Embodiment 9

Comprise the generation of the recombinant baculovirus of 1.3HBV construct

Use available from Invitrogen (Carlsbad, BacNBlue transfection reagent box CA) with purified recombinant transfer vector and linear AcMNPV baculovirus DNA cotransfection in the Sf21 cell; Guide according to the manufacturer separates recombinant virus through the plaque test.Through infecting the Sf21 cell in the 100-mm petridish, a series of recombinant virus obtains amplification from isolating plaque.Use standard method, from the virus of amplification, extract viral DNA.Viral DNA with Restriction Enzyme digestion purifying separates through the 1%v/v agarose gel electrophoresis then.Carry out the Souhtern trace to confirm to contain the virus isolated strain of complete 1.3HBV construct.(Indianapolis IN) produces [P with Boehringer Mannhein Random Prime DNA Labeling test kit ³²] probe of labelled with radioisotope.The double-stranded HBV genome of total length is used as the template of all labelled with radioisotope probes.Use has adopted primer 5 '-GCC TCA TTT TGT GGG TCA CCA TA-3 ' [SEQ IDNO:3]; (Nucleotide 1408-1430; According to HBVGenebank searching number M38454) and antisense primer 5 '-TCT CTG ACA TAC TTT CCA AT-3 ' [SEQ ID NO:6] (Nucleotide 2817-2798 is according to HBVGenebank searching number M38454) catalytic domain of polysaccharase is carried out pcr amplification with conclusive evidence viral DNA sequence.Following primer is used for measuring sequence 5 '-TGC ACG ATT CCT GCT CAA-3 ' [SEQ ID NO:8] (the Nucleotide 2345-2362 of inner area; According to HBVGenebank searching number M38454) and 5 '-TTT CTCAAA GGT GGA GAC AG-3 ' [SEQ ID NO:9] (Nucleotide 1790-1810 is according to HBVGenebank searching number M38454).

Embodiment 10

Amplification and the purifying of preparation type baculovirus

The Sf21 cell suspension culture that infects logarithmic phase with 0.5pfu/ cell infection intensity (moi) baculovirus of increasing.Make to infect and proceed to most cells cell performance visible infection characteristic (4-5 days) in the culturing bottle.Through from the Sf21 substratum that infects, precipitating at the centrifugal virion that makes of 80,000 * g, and through 20-60%w/v saccharose gradient purifying.The virus of purifying is diluted in the Sf21 cell with the titration of quadruple form through terminal point.The portion of each high titre liquid storage is used for DNA extraction.Pol gene is increased and checks order proves conclusively the existence of the rite-directed mutagenesis among the embodiment 9.

Embodiment 11

Infect the HepG2 cell with the reorganization HBV that expresses baculovirus

The inoculation when the degree of converging of about 20-40% of HepG2 cell, and before infection, grew 16-24 hour.On the same day of infecting, cell is used trypan blue to get rid of and confirms viable count with hemocytometer by trysinization in three flat boards.Calculate average cell counting and be used for confirming shown in moi under the volume of the necessary infectious titer liquid storage of cells infected.Use serum-free MEM washing HepG2 cell once to remove micro-serum.Use volume be 1.0,0.5 and 0.25ml infect 100-mm respectively, 60-mm and 35-mm petridish, baculovirus is diluted among the serum-free MEM to obtain suitable moi.Baculovirus was adsorbed to the HepG2 cell 1 hour at 37 ℃, and gentleness was shaken to guarantee that inoculum distributes equably in per 15 minutes.Sucking-off inoculum and with phosphate buffered saline buffer washing HepG2 cell twice has or does not have the MEM-FBS of different concns medicine again then.

Embodiment 12

The antigenic analysis of excretory HBV

(Abbott Park, IL, test kit USA) carry out the detection of HBeAg (HbeAg) through radioimmunoassay and particulate enzyme immunoassay available from the Abbott laboratory in use.Collect the HepG2 cell culture fluid, 6, centrifugally under the 000g transfer in the clean test tube, and be stored in 20 ℃ up to analysis to remove cell debris.The multiple of the positive contrast of HBeAg value representation.Media samples suitably dilution makes the radioimmunoassay result be lower than HBeAg positive control value.

Embodiment 13

The detection of time multiplexed cell system intermediate product

From the cytoplasm fraction of cracked HepG2 cell among 0.5%w/v NP-40, separate the HBV core particle.The tenuigenin extract is adjusted to 10mmol/l McC12, does not protect DNA through hatching to remove in 1.5 hours with 37 ℃ of 500g/ml Proteinase Ks.Commodity in use DNA extraction test kit (for example Qiagen (DNA extraction)) or use phenol successively and the extractive self-control method of chloroform is extracted the HBV DNA in the sample then, and reclaim nucleic acid through ethanol sedimentation.Nucleic acid is resuspended in 50 μ l/l TE (10mmol/l Tris; The 1mmol/1 YD 30); Through the OD260 stdn, with 100g/ml RNA enzyme (Boehringer Mannheim, Indianapolis; IN) 37 ℃ digested 1 hour, used PCR in real time or electrophoresis and Southern engram analysis then.Behind the Southern engram analysis, use BioRad GS-670 photodensitometer and analysis of molecules expert software (BioRad, Hecules California) to analyze the suitable exposure of Southern trace.Use makes spectrodensitometry data fitting log10 dose response curve from the TableCurve2D software package of Jandel Scientific.The log10 dose reaction equation is used for calculating the IC of variation ₅₀And IC ₉₀The relation conefficient of value and variation.

Embodiment 14

PCR in real time

For based on the HBV of PCR in real time check, use QIAamp DNA trace quantity reagent kit from 200 μ l serum, to extract HBV DNA according to manufacturer's guide (QIAGENGmbH, Hildens, Germany).The design of primer and molecular marker HBV is genomic before the conservative nucleotide sequence in the core area to increase and to detect 216 Nucleotide products (Fig. 1).Amplification is carried out in the reaction mixture of 50-μ l, and reaction mixture comprises 1.0 Taqman buffer A (AppliedBiosystems, Foster City; CA); 3.0mM magnesium chloride, every kind of primer of 0.4pmol/ μ l, forward primer; PC1 (5 ' GGGAGGAGATTAGGTTAA3 ' [SEQ IDNO:10] and reverse primer; PC2 (5 ' GGCAAAAACGAGAGTAACTC3 ' [SEQID NO:11], the special molecular marker of HBV of 0.4pmol/ μ l, (5 ' FAM-CGCGTCCTACTGTTCAAGCCTCCAAGCTGTGACGCG-DABCYL-3 ' [SEQ ID NO:12]; FAM represents fluorophore 6-Fluoresceincarboxylic acid and DABCYL here, 4-dimethylamino phenyl azobenzoic acid, a kind of cancellation fluorophore) and the AmpliTaq Gold archaeal dna polymerase (Perkin-Elmer) of 1.25U.Use ABI PRISM 7700 fluorescence spectrophotometry thermal cyclers (Applied Biosysterms) and carry out PCR.The PCR program is made up of initial cycles (95 ℃, 10 minutes) and 45 amplification cycles subsequently (94 ℃, 15 seconds, 50 ℃, 30 seconds, 72 ℃, 30 seconds).Machine detects and notes the fluorescence spectrum in each reaction tubes of annealing stage.

(Hershey Medical Center, Hershey PA) sets up external perimysium reference to arrive the pBlueBac plasmid vector through the wild-type HBV plasmid (genotype D) that connects 1.3kB.Quantitatively confirming of the DNA concentration of plasmid through spectrophotometry.From 10 ⁸Two parts of identical plasmids of continuous 10 times of dilutions of copy/ml-100 copy/ml be included in each take turns in to set up typical curve.Threshold cycle number (the C of copy number through obtaining of each experiment reaction _T) in push away definite.

Embodiment 15

The ETV treatment

ETV is resuspended in the sterilized water, packing and freezing to avoid freezing repeatedly of medicine molten at-20 ℃.The substratum that comprises ETV uses fresh 3TC packing to prepare as required every day.ETV treats in the initial experiment, with the ETV that makes concentration shown in the HepG2 cells contacting behind the HBV baculovirus infection immediately behind virus infection.In the experiment of using the ETV pretreat; Before the HBV baculovirus infection; Give the substratum 16 hours that cell includes ETV, the HBV baculovirus infection also carries out in comprising the substratum of ETV, and infect with the washing process completion after give the substratum that cell comprises ETV immediately again.

Embodiment 16

The antiviral detection that the HBV/ baculovirus with coding rtI169T+rtv173L+rtL180M+rtM204V of use wild-type carries out

Application is with respect to the quantitative PCR in real time result of wild-type virus who is grown in no ETV (0 μ M ETV), and ETV representes in Fig. 1 the pattern analysis of the dosage effect of the HBV of wild-type and quadruple sudden change.As the intermediate product of the hbv replication of the quantitative PCR detection of all ETV detectable levels reduction proved, ETV has the most significantly effect to the wild-type hbv replication.On the contrary, coding quadruple sudden change (rtI169T+rtV173L+rtL180M+rtM204V) reorganization HBV especially has the sensitivity of reduction to ETV when ETV concentration reaches 0.5 μ M.

Embodiment 17

ETV

ETV (being BMS-200475 or SQ-34676 in the past) is the strong suppressor factor of hbv replication.ETV has anti-hepadnavirus of having of biological taking orally characteristic and the active cyclopentyl desalination of simplexvirus guanosine analogue.The structure of ETV shown in Fig. 3 and the synthetic of it describe by (Bioorg.Med.Chem.Lit.7:127-132,1997) such as Bisacchi.Preclinical study is illustrated in (Innaimo etc., 1997, supra in the check based on enzyme and cell; Siefer etc., 1998, supra; Yamanaka etc., 1999, supra.) Entecavir is the suppressor factor of very strong HBV.ETV was described as BMS-200475 and SQ-34676 in the past.

Be appreciated that to those skilled in the art invention described herein is suitable for except to variation or change those of special description.Should be appreciated that and the present invention includes all this variation or changes.The present invention also comprise that all are mentioned in this manual or shown in step, characteristic, compsn and compound, individually or jointly, and any or all combination of any two or more described step or characteristic.

Reference:

Allen et al.，Hepatology 27(6)：1670-1677，1998；

Aye et al.，J Hepatol.26：1148-53，1997；

Bartholomeusz et al.，Intervirology 40(5-6)：337-342 1997；

Bisacchi et al.(Bioorg.Med.Chem.Lit.7：127-132，1997；

Boyd et al.，Antiviral Chem Chemother.32：358-363，1987；

Colonno et al.，JID 184：1236-45 2001；

Das et al.，J.Virol. 75(10)：4771-4779，2001；

Delaney et al.，Antimicrob Agents Chemother 45(6)：1705-1013，2001；

Dienstag et al.，New England J Med 333：1657-1661，1995；

Gaillard et al.，Antimicrob Agents Chemother.46(4)：1005-1013，2002；

Genovesi et al.，Antimicrobiol Agent Chem 42：3209-3217，1998；

Hendricks DA，et al.，Am J Clin Pathol 104：537-46，1995；

Innaimo et al.，Antimicrobiol Agent Chem 44：1441-1448，1997；

Kruger et al.，Hepatology 22：219A，1994；

Main et al.，J.Viral Hepatitis 3：211-215，1996；

Norder et al.，J.Gen.Virol.74：341-1348，1993；

Ren and Nassal，J.Virol.75(3)：1104-1116，2001；

Severini et al.，Antimicrobial Agents Chemother 39：1430-1435，1995；

Siefer et al.，Antimicrobiol Agent Chem 28：3200-3208，1998；

Stuyver et al.，Hepatology 33：751-757，2001；

Summers and Mason，Cell 29：403-415，1982；

Vere Hodge，Antiviral Chem Chemother 4：67-84，1993；

Xiong et al.，Hepatology.28(6)：1669-73，1998；

Yamanaka et al.，Antimicrobiol Agent Chem 43：190-193，1999.

Sequence table

<110>Melbourne Health(all states except US)

Austin and Repatriation Medical Centre(all states except US)

Southern Health(all states except US)

Bartholomeusz，Angeline(US only)

Locarnini，Stephen(US only)

Ayres，Anna(US only)

Angus，Peter(US only)

Sievert，William(US only)

< 120>nucleoside analog had the viral variants and the application thereof of the susceptibility of change

<130>2609536/EJH

<140>Not yet available

<141>2003-02-07

<150>AU PS0370

<151>2002-02-07

<150>AU PS1269

<151>2002-03-21

<160>36

<170>PatentIn version 3.1

<210>1

<211>76

<212>PRT

< 213>synthetic

<220>

< 221>MISC_ characteristic

<222>(2)..(2)

< 223>X=L or R or I

<220>

< 221>MISC_ characteristic

<222>(3)..(3)

< 223>X=E or D

<220>

< 221>MISC_ characteristic

<222>(9)..(9)

< 223>X=T or D or A or N or Y

<220>

< 221>MISC_ characteristic

<222>(10)..(10)

< 223>X=E or D

<220>

< 221>MISC_ characteristic

<222>(13)..(13)

< 223>X=E or K or Q

<220>

< 221>MISC_ characteristic

<222>(15)..(15)

< 223>X=H or R or N

<220>

< 221>MISC_ characteristic

<222>(18)..(18)

< 223>X=I or T

<220>

< 221>MISC_ characteristic

<222>(23)..(23)

< 223>X=A or S

<220>

< 221>MISC_ characteristic

<222>(26)..(26)

< 223>X=T or R

<220>

< 221>MISC_ characteristic

<222>(40)..(40)

< 223>X=A or T or S

<220>

< 221>MISC_ characteristic

<222>(43)..(43)

< 223>X=R or T

<220>

< 221>MISC_ characteristic

<222>(45)..(45)

< 223>X=V or G

<220>

< 221>MISC_ characteristic

<222>(55)..(55)

< 223>X=S or I or T or N or V

<220>

< 221>MISC_ characteristic

<222>(56)..(56)

< 223>X=T or S or H or Y

<220>

< 221>MISC_ characteristic

<222>(57)..(57)

< 223>X=R or H or K or Q

<220>

< 221>MISC_ characteristic

<222>(69)..(69)

< 223>X=Q or P

<220>

< 221>variant

<222>(76)..(76)

< 223>S is appointed as amino acid 74

<400>1

Leu Xaa Xaa Asp Trp Gly Pro Cys Xaa Xaa His Gly Xaa His Xaa Ile

1 5 10 15

Arg Xaa Pro Arg Thr Pro Xaa Arg Val Xaa Gly Gly Val Phe Leu Val

20 25 30

Asp Lys Asn Pro His Asn Thr Xaa Glu Ser Xaa Leu Xaa Val Asp Phe

35 40 45

Ser Gln Phe Ser Arg Gly Xaa Xaa Xaa Val Ser Trp Pro Lys Phe Ala

50 55 60

Val Pro Asn Leu Xaa Ser Leu Thr Asn Leu Leu Ser

65 70 75

<210>2

<211>181

<212>PRT

< 213>synthetic

<220>

< 221>variant

<222>(1)..(1)

< 223>S=amino acid 75

<220>

< 221>MISC_ characteristic

<222>(2)..(2)

< 223>X=N or D

<220>

< 221>MISC_ characteristic

<222>(17)..(17)

< 223>X=I or P

<220>

< 221>MISC_ characteristic

<222>(29)..(29)

< 223>X=I or V

<220>

< 221>MISC_ characteristic

<222>(35)..(35)

< 223>X=S or D

<220>

< 221>MISC_ characteristic

<222>(44)..(44)

< 223>X=T or N

<220>

< 221>MISC_ characteristic

<222>(46)..(46)

< 223>X=R or N

<220>

< 221>MISC_ characteristic

<222>(47)..(47)

< 223>X=N or I

<220>

< 221>MISC_ characteristic

<222>(48)..(48)

< 223>any amino acid of X=

<220>

< 221>MISC_ characteristic

<222>(50)..(50)

< 223>X=N or Y or H

<220>

< 221>MISC_ characteristic

<222>(52)..(52)

< 223>X=H or Y

<220>

< 221>MISC_ characteristic

<222>(53)..(53)

< 223>X=G or R

<220>

< 221>MISC_ characteristic

<222>(54)..(56)

< 223>any amino acid of X=

<220>

< 221>MISC_ characteristic

<222>(57)..(57)

< 223>X=D or N

<220>

< 221>MISC_ characteristic

<222>(60)..(60)

< 223>X=D or N

<220>

< 221>MISC_ characteristic

<222>(61)..(61)

< 223>X=S or Y

<220>

< 221>MISC_ characteristic

<222>(65)..(65)

< 223>X=N or Q

<220>

< 221>MISC_ characteristic

<222>(71)..(71)

< 223>X=L or M

<220>

< 221>MISC_ characteristic

<222>(75)..(75)

< 223>X=K or Q

<220>

< 221>MISC_ characteristic

<222>(77)..(77)

< 223>X=Y or F

<220>

< 221>MISC_ characteristic

<222>(79)..(79)

< 223>X=R or W

<220>

< 221>MISC_ characteristic

<222>(84)..(84)

< 223>X=Y or L

<220>

< 221>MISC_ characteristic

<222>(85)..(85)

< 223>X=S or A

<220>

< 221>MISC_ characteristic

<222>(89)..(89)

< 223>X=I or V

<220>

< 221>MISC_ characteristic

<222>(95)..(95)

< 223>X=I or L

<220>

< 221>MISC_ characteristic

<222>(99)..(99)

< 223>X=V or G

<220>

< 221>MISC_ characteristic

<222>(114)..(114)

< 223>X=C or L

<220>

< 221>MISC_ characteristic

<222>(115)..(115)

< 223>X=A or S

<220>

< 221>MISC_ characteristic

<222>(116)..(116)

< 223>X=V or M

<220>

< 221>MISC_ characteristic

<222>(117)..(117)

< 223>X=V or T

<220>

< 221>MISC_ characteristic

<222>(118)..(118)

< 223>X=R or C

<220>

< 221>MISC_ characteristic

<222>(122)..(122)

< 223>X=F or P

<220>

< 221>MISC_ characteristic

<222>(125)..(125)

< 223>X=L or V

<220>

< 221>MISC_ characteristic

<222>(126)..(126)

< 223>X=A or V

<220>

< 221>MISC_ characteristic

<222>(128)..(128)

< 223>X=S or A

<220>

< 221>variant

<222>(130)..(130)

< 223>M=amino acid 204

<220>

< 221>MISC_ characteristic

<222>(133)..(133)

< 223>X=V or L or M

<220>

< 221>MISC_ characteristic

<222>(138)..(138)

< 223>X=K or R

<220>

< 221>MISC_ characteristic

<222>(139)..(139)

< 223>X=S or T

<220>

< 221>MISC_ characteristic

<222>(140)..(140)

< 223>X=V or G

<220>

< 221>MISC_ characteristic

<222>(141)..(141)

< 223>X=Q or E

<220>

< 221>MISC_ characteristic

<222>(143)..(143)

< 223>X=L or S or R

<220>

< 221>MISC_ characteristic

<222>(145)..(145)

< 223>X=S or F

<220>

< 221>MISC_ characteristic

<222>(147)..(147)

< 223>X=F or Y

<220>

< 221>MISC_ characteristic

<222>(148)..(148)

< 223>X=T or A

<220>

< 221>MISC_ characteristic

<222>(149)..(149)

< 223>X=A or S

<220>

< 221>MISC_ characteristic

<222>(150)..(150)

< 223>X=V or I

<220>

< 221>MISC_ characteristic

<222>(151)..(151)

< 223>X=T or C

<220>

< 221>MISC_ characteristic

<222>(152)..(152)

< 223>X=N or S

<220>

< 221>MISC_ characteristic

<222>(153)..(153)

< 223>X=F or V

<220>

< 221>MISC_ characteristic

<222>(156)..(156)

< 223>X=S or D

<220>

< 221>MISC_ characteristic

<222>(157)..(157)

< 223>X=L or V

<220>

< 221>MISC_ characteristic

<222>(164)..(164)

< 223>X=N or Q

<220>

< 221>MISC_ characteristic

<222>(179)..(179)

< 223>X=V or I

<400>2

Ser Xaa Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His

1 5 10 15

Xaa Pro Leu His Pro Ala Ala Met Pro His Leu Leu Xaa Gly Ser Ser

20 25 30

Gly Leu Xaa Arg Tyr Val Ala Arg Leu Ser Ser Xaa Ser Xaa Xaa Xaa

35 40 45

Asn Xaa Gln Xaa Xaa Xaa Xaa Xaa Xaa Leu His Xaa Xaa Cys Ser Arg

50 55 60

Xaa Leu Tyr Val Ser Leu Xaa Leu Leu Tyr Xaa Thr Xaa Gly Xaa Lys

65 70 75 80

Leu His Leu Xaa Xaa His Pro Ile Xaa Leu Gly Phe Arg Lys Xaa Pro

85 90 95

Met Gly Xaa Gly Leu Ser Pro Phe Leu Leu Ala Gln Phe Thr Ser Ala

100 105 110

Ile Xaa Xaa Xaa Xaa Xaa Arg Ala Phe Xaa His Cys Xaa Xaa Phe Xaa

115 120 125

Tyr Met Asp Asp Xaa Val Leu Gly Ala Xaa Xaa Xaa Xaa His Xaa Glu

130 135 140

Xaa Leu Xaa Xaa Xaa Xaa Xaa Xaa Xaa Leu Leu Xaa Xaa Gly Ile His

145 150 155 160

Leu Asn Pro Xaa Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met

165 170 175

Gly Tyr Xaa Ile Gly

180

<210>3

<211>23

<212>DNA

< 213>artificial sequence

<220>

< 223>primer (OS1)

<400>3

gcctcatttt gtgggtcacc ata 23

<210>4

<211>18

<212>DNA

< 213>artificial sequence

<220>

< 223>primer (TTA3)

<400>4

aaattcgcag tccccaaa 18

<210>5

<211>21

<212>DNA

< 213>artificial sequence

<220>

< 223>primer (JM)

<400>5

ttggggtgga gccctcaggc t 21

<210>6

<211>18

<212>DNA

< 213>artificial sequence

<220>

< 223>primer (TTA4)

<400>6

gaaaattggt aacagcgg 18

<210>7

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>primer (OS2)

<400>7

tctctgacat actttccaat 20

<210>8

<211>18

<212>DNA

< 213>artificial sequence

<220>

< 223>primer

<400>8

tgcacgattc ctgctcaa 18

<210>9

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>primer

<400>9

tttctcaaag gtggagacag 20

<210>10

<211>18

<212>DNA

< 213>artificial sequence

<220>

< 223>forward primer PC1

<400>10

gggaggagat taggttaa 18

<210>11

<211>20

<212>DNA

< 213>artificial sequence

<220>

< 223>reverse primer PC2

<400>11

ggcaaaaacg agagtaactc 20

<210>12

<211>42

<212>DNA

< 213>artificial sequence

<220>

< 223>HBV specific molecular sign primer

<220>

< 221>misc_ characteristic

<222>(42)..(42)

<223>N＝L

<400>12

cgcgtcctac tgttcaagcc tccaagctgt gacgcgdabc yn 42

<210>13

<211>644

<212>DNA

<213>TR2

<220>

< 221>misc_ characteristic

<222>(619)..(620)

< 223>any Nucleotide of N=

<220>

< 221>misc_ characteristic

<222>(624)..(624)

< 223>any Nucleotide of N=

<220>

< 221>misc_ characteristic

<222>(631)..(631)

< 223>any Nucleotide of N=

<400>13

ccctcccgtt ctccaacttg tcctggttat cgctggatgt gtctgcggcg ttttatcata 60

ttcctcttca tcctgctgct atgcctcatc ttcttgttgg ttcttctgga ctatcaaggt 120

atgttgcccg tctgtcctct aattccagga tcttcaacca ccagcgcggg accatgcaga 180

acctgcacga ctactgctca aggaacctct atgtatccct cctgttgctg taccaaacct 240

tcggacggaa attgcacctg tattcccatc ccatcatctt gggctttcgg aaaattccta 300

tgggagtggg cctcagcccg tttctcatgg ctcagtttac tagygccatt tgttcagtgg 360

ttcgtagggc tttcccccac tgtttggctt ttagttatrt ggatgatgtg gtattggggg 420

ccaagtctgt acagcacctt gagtcccttt ttaccgctgt taccaatttt cttttgtctt 480

tgggtataca tttaaaccct aacaaaacta aaagatgggg ttattcctta aatttcatgg 540

gctatgtcat tggatgttat gggtcattgc cacaagatca catcatacag aaaatcaaag 600

aatgttttag gaaacttcnn gtgngcggga ntggaacaga tcca 644

<210>14

<211>593

<212>DNA

<213>TR3

<400>14

ctgtcctcca acttgtcctg gttatcgctg gatgtgtctg cggcgtttta tcatattcct 60

cttcatcctg ctgctatgcc tcatcttctt gttggttctt ctggactatc aaggtatgtt 120

gcccgtctgt cctctaattc caggatcttc aaccaccagc gcgggaccat gcagaacctg 180

cacgactact gctcaaggaa cctctatgta tccctcctgt tgctgtacca aaccttcgga 240

cggaaattgc acctgtattc ccatcccatc atcttgggct ttcggaaaat tcctatggga 300

gtgggcctca gcccgtttct catggctcag tttactagyg ccatttgttc agtggttcgt 360

agggctttcc cccactgttt ggctttcagt tatgtggatg atgtggtatt gggggccaag 420

tctgtacagc accttgagtc cctttttacc gctgttacca attttctttt gtctttgggt 480

atacatttaa accctaacaa aactaaaaga tggggttatt ccttaaattt catgggctat 540

gtcattggat gttatgggtc attgccacaa gatcacatca tacagaaaat caa 593

<210>15

<211>605

<212>DNA

<213>TR3

<400>15

ctgtcctcca acttgtcctg gttatcgctg gatgtgtctg cggcgtttta tcatattcct 60

cttcatcctg ctgctatgcc tcatcttctt gttggttctt ctggactatc aaggtatgtt 120

gcccgtctgt cctctaattc caggatcttc aaccaccagc gcgggaccat gcagaacctg 180

cacgactact gctcaaggaa cctctatgta tccctcctgt tgctgtacca aaccttcgga 240

cggaaattgc acctgtattc ccatcccatc atcttgggct ttcggaaaat tcctatggga 300

gtgggcctca gcccgtttct catggctcag tttactagtg ccatttgttc agtggttcgt 360

agggctttcc cccactgttt ggctttyagt tatgtggatg atgtggtatt gggggccaag 420

tctgtacagc accttgagtc cctttttacc gctgttacca attttctttt gtctttgggt 480

atacatttaa accctaacaa aactaaaaga tggggttatt ccttaaattt catgggctat 540

gtcattggat gttatgggtc attgccacaa gatcacatca tacagaaaat caaagaatgt 600

tttag 605

<210>16

<211>614

<212>DNA

<213>TR4

<400>16

gtcctccaac ttgtcctggt tatcgctgga tgtgtctgcg gcgttttatc atattcctct 60

tcatcctgct gctatgcctc atcttcttgt tggttcttct ggactatcaa ggtatgttgc 120

ccgtctgtcc tctaattcca ggatcttcaa ccaccagcgc gggaccatgc agaacctgca 180

cgactactgc tcaaggaacc tctatgtatc cctcctgttg ctgtaccaaa ccttcggacg 240

gaaattgcac ctgtattccc atcccatcat cttgggcttt cggaaaattc ctatgggagt 300

gggcctcagc ccgtttctca tggctcagtt tactagtgcc atttgttcag tggttcgtag 360

ggctttcccc cactgtttgg ctttcagtta tgtggatgat gtggtattgg gggccaagtc 420

tgtacagcac cttgagtccc tttttaccgc tgttaccaat tttcttttgt ctttgggtat 480

acatttaaac cctaacaaaa ctaaaagatg gggttattcc ttaaatttca tgggctatgt 540

cattggatgt tatgggtcat tgccacaaga tcacatcata cagaaaatca aagaatgttt 600

taggaaactt cctg 614

<210>17

<211>607

<212>DNA

<213>TR5

<400>17

gtcctccaac ttgtcctggt tatcgctgga tgtgtctgcg gcgttttatc atattcctct 60

tcatcctgct gctatgcctc atcttcttgt tggttcttct ggactatcaa ggtatgttgc 120

ccgtctgtcc tctaattcca ggatcttcaa ccaccagcgc gggaccatgc agaacctgca 180

cgactactgc tcaaggaacc tctatgtatc cctcctgttg ctgtaccaaa ccttcggacg 240

gaaattgcac ctgtattccc atcccatcat cttgggcttt cggaaaattc ctatgggakt 300

gggcctcagc ccgtttctca tggctcagtt tactagtgcc atttgttcag tggttcgtag 360

ggctttcccc cactgtttgg ctttcagtta tgtggatgat gtggtattgg gggccaagtc 420

tgtacagcac cttgagtccc tttttaccgc tgttaccaat tttcttttgt ctttgggtat 480

acatttaaac cctaacaaaa ctaaaagatg gggttattcc ttaaatttca tgggctatgt 540

cattggatgt tatgggtcat tgccacaaga tcacatcata cagaaaatca aagaatgttt 600

taggaaa 607

<210>18

<211>1028

<212>DNA

<213>TR6

<220>

< 221>misc_ characteristic

<222>(12)..(12)

< 223>any Nucleotide of N=

<220>

< 221>misc_ characteristic

<222>(27)..(27)

< 223>any Nucleotide of N=

<400>18

gggggccgca gncagataca aaccttngcc aggaatcctc cttcctgcat ctaccaatcg 60

ccagtcagga aggcagccta ccccgctgtc tccacctttg agagactctc atcctcaggc 120

catgcagtgg aactccacaa ctttccacca aactctgcaa gatcccaggg tgaggggcct 180

gtatctccct gctggtggct ccagttcagg aacagtaaac cctgttccga ctactgcctc 240

tcccatatcg tcaatcttct cgaggattgg ggaccttgcg ctgaacatgg agaacatcac 300

atcaggattc ctaggacccc tgctcgtgtt acaggcgggg tttttcttgt tgacaagaat 360

cctcacaata ccgcagagtc tagactcgtg gtggacttct ctcaattttc tagggggaac 420

caccgtgtgt cttggccaaa attcgcagtc cccaacctcc aatcactcac caacctcctg 480

tcctccaact tgtcctggtt atcgctggat gtgtctgcgg cgttttatca tattcctctt 540

catcctgctg statgcctca tcttcttgtt ggttcttctg gactatcaag gtatgttgcc 600

cgtctgtcct ctaattccag gatcttcaac caccagcgcg ggaccatgca gaacctgcac 660

gactactgct caaggaacct ctatgtatcc ctcctgttgc tgtaccaaac cttcggacgg 720

aaattgcacc tgtattccca tcccatcatc ttgggctttc ggaaaactcc tatgggattg 780

ggcctcagcc cgtttctcat ggctcagttt actagtgcca tttgttcagt ggttcgtagg 840

gctttccccc actgtttggc tttcagttat gtggatgatg tggtattggg ggccaagtct 900

gtacagcacc ttgagtccct ttttaccgct gttaccaatt ttcttttgtc tttgggtata 960

catttaaacc ctaacaaaac taaaagatgg ggttattcct taaatttcgt gggctatgtc 1020

attggatg 1028

<210>19

<211>181

<212>PRT

< 213>the Pol Trans of TR1

<220>

< 221>misc_ characteristic

<222>(130)..(130)

< 223>any amino acid of X=

<400>19

Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His

1 5 10 15

Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser

20 25 30

Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Phe

35 40 45

Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys Ser Arg

50 55 60

Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg Lys

65 70 75 80

Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro

85 90 95

Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser Ala

100 105 110

Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser

115 120 125

Tyr Xaa Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu Glu

130 135 140

Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His

145 150 155 160

Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met

165 170 175

Gly Tyr Val Ile Gly

180

<210>20

<211>187

<212>PRT

< 213>the Pol Trans of TR2

<400>20

Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe

1 5 10 15

Tyr His Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly

20 25 30

Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg

35 40 45

Ile Phe Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys

50 55 60

Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly

65 70 75 80

Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys

85 90 95

Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr

100 105 110

Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala

115 120 125

Phe Ser Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His

130 135 140

Leu Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly

145 150 155 160

Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn

165 170 175

Phe Met Gly Tyr Val Ile Gly Cys Tyr Gly Ser

180 185

<210>21

<211>185

<212>PRT

< 213>the Pol Trans of TR3

<400>21

Leu Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe

1 5 10 15

Tyr His Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly

20 25 30

Ser Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg

35 40 45

Ile Phe Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys

50 55 60

Ser Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly

65 70 75 80

Arg Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys

85 90 95

Ile Pro Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr

100 105 110

Ser Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala

115 120 125

Phe Ser Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His

130 135 140

Leu Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly

145 150 155 160

Ile His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn

165 170 175

Phe Met Gly Tyr Val Ile Gly Cys Tyr

180 185

<210>22

<211>184

<212>PRT

< 213>the Pol Trans of TR4

<400>22

Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr

1 5 10 15

His Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser

20 25 30

Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile

35 40 45

Phe Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys Ser

50 55 60

Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg

65 70 75 80

Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile

85 90 95

Pro Met Gly Val Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser

100 105 110

Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe

115 120 125

Ser Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu

130 135 140

Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile

145 150 155 160

His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe

165 170 175

Met Gly Tyr Val Ile Gly Cys Tyr

180

<210>23

<211>184

<212>PRT

< 213>the Pol Trans of TR5

<220>

< 221>misc_ characteristic

<222>(100)..(100)

< 223>any amino acid of X=

<400>23

Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr

1 5 10 15

His Ile Pro Leu His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser

20 25 30

Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile

35 40 45

Phe Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys Ser

50 55 60

Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg

65 70 75 80

Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile

85 90 95

Pro Met Gly Xaa Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser

100 105 110

Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe

115 120 125

Ser Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu

130 135 140

Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile

145 150 155 160

His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe

165 170 175

Met Gly Tyr Val Ile Gly Cys Tyr

180

<210>24

<211>326

<212>PRT

< 213>the Pol Trans of TR6

<220>

< 221>misc_ characteristic

<222>(168)..(168)

< 223>any amino acid of X=

<400>24

Ile Tyr Gln Ser Pro Val Arg Lys Ala Ala Tyr Pro Ala Val Ser Thr

1 5 10 15

Phe Glu Arg Leu Ser Ser Ser Gly His Ala Val Glu Leu His Asn Phe

20 25 30

Pro Pro Asn Ser Ala Arg Ser Gln Gly Glu Gly Pro Val Ser Pro Cys

35 40 45

Trp Trp Leu Gln Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu

50 55 60

Ser His Ile Val Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu His

65 70 75 80

Gly Glu His His Ile Arg Ile Pro Arg Thr Pro Ala Arg Val Thr Gly

85 90 95

Gly Val Phe Leu Val Asp Lys Asn Pro His Asn Thr Ala Glu Ser Arg

100 105 110

Leu Val Val Asp Phe Ser Gln Phe Ser Arg Gly Asn His Arg Val Ser

115 120 125

Trp Pro Lys Phe Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu

130 135 140

Ser Ser Asn Leu Ser Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr

145 150 155 160

His Ile Pro Leu His Pro Ala Xaa Met Pro His Leu Leu Val Gly Ser

165 170 175

Ser Gly Leu Ser Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile

180 185 190

Phe Asn His Gln Arg Gly Thr Met Gln Asn Leu His Asp Tyr Cys Ser

195 200 205

Arg Asn Leu Tyr Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg

210 215 220

Lys Leu His Leu Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Thr

225 230 235 240

Pro Met Gly Leu Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Thr Ser

245 250 255

Ala Ile Cys Ser Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe

260 265 270

Ser Tyr Val Asp Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu

275 280 285

Glu Ser Leu Phe Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile

290 295 300

His Leu Asn Pro Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe

305 310 315 320

Val Gly Tyr Val Ile Gly

325

<210>25

<211>161

<212>PRT

< 213>the HBsAg Trans of TR1

<220>

< 221>misc_ characteristic

<222>(111)..(111)

< 223>any amino acid of X=

<220>

< 221>misc_ characteristic

<222>(129)..(129)

< 223>any amino acid of X=

<400>25

Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile Ile

1 5 10 15

Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu Leu

20 25 30

Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser Ser

35 40 45

Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala Gln Gly

50 55 60

Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly Asn

65 70 75 80

Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe Leu

85 90 95

Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Xaa Pro

100 105 110

Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Leu Val

115 120 125

Xaa Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr Leu Ser

130 135 140

Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr Ile

145 150 155 160

Asn

<210>26

<211>162

<212>PRT

< 213>the HBsAg Trans of TR2

<220>

< 221>misc_ characteristic

<222>(113)..(113)

< 223>any amino acid of X=

<400>26

Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe

1 5 10 15

Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val

20 25 30

Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly

35 40 45

Ser Ser Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala

50 55 60

Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp

65 70 75 80

Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys

85 90 95

Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu

100 105 110

Xaa Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu

115 120 125

Ser Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr

130 135 140

Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val

145 150 155 160

Tyr Ile

<210>27

<211>162

<212>PRT

< 213>the HBsAg Trans of TR3

<220>

< 221>misc_ characteristic

<222>(129)..(129)

< 223>any amino acid of X=

<400>27

Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe

1 5 10 15

Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val

20 25 30

Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly

35 40 45

Ser Ser Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala

50 55 60

Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp

65 70 75 80

Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys

85 90 95

Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu

100 105 110

Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu

115 120 125

Xaa Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr

130 135 140

Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val

145 150 155 160

Tyr Ile

<210>28

<211>161

<212>PRT

< 213>the HBsAg Trans of TR4

<400>28

Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile

1 5 10 15

Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu

20 25 30

Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser

35 40 45

Ser Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala Gln

50 55 60

Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly

65 70 75 80

Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe

85 90 95

Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Val

100 105 110

Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser

115 120 125

Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr Leu

130 135 140

Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr

145 150 155 160

Ile

<210>29

<211>161

<212>PRT

< 213>the HBsAg Trans of TR5

<220>

< 221>misc_ characteristic

<222>(99)..(99)

< 223>any amino acid of X=

<400>29

Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile

1 5 10 15

Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val Leu

20 25 30

Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser

35 40 45

Ser Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala Gln

50 55 60

Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly

65 70 75 80

Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Phe

85 90 95

Leu Trp Xaa Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Val

100 105 110

Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser

115 120 125

Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr Leu

130 135 140

Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr

145 150 155 160

Ile

<210>30

<211>305

<212>PRT

< 213>the HBsAg Trans of TR6

<220>

< 221>misc_ characteristic

<222>(168)..(168)

< 223>any amino acid of X=

<400>30

Ser Thr Asn Arg Gln Ser Gly Arg Gln Pro Thr Pro Leu Ser Pro Pro

1 5 10 15

Leu Arg Asp Ser His Pro Gln Ala Met Gln Trp Asn Ser Thr Thr Phe

20 25 30

His Gln Thr Leu Gln Asp Pro Arg Val Arg Gly Leu Tyr Leu Pro Ala

35 40 45

Gly Gly Ser Ser Ser Gly Thr Val Asn Pro Val Pro Thr Thr Ala Ser

50 55 60

Pro Ile Ser Ser Ile Phe Ser Arg Ile Gly Asp Leu Ala Leu Asn Met

65 70 75 80

Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln Ala

85 90 95

Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Gln Ser Leu Asp

100 105 110

Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr Thr Val Cys Leu

115 120 125

Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser Cys

130 135 140

Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe Ile

145 150 155 160

Ile Phe Leu Phe Ile Leu Leu Xaa Cys Leu Ile Phe Leu Leu Val Leu

165 170 175

Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly Ser

180 185 190

Ser Thr Thr Ser Ala Gly Pro Cys Arg Thr Cys Thr Thr Thr Ala Gln

195 200 205

Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp Gly

210 215 220

Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys Leu

225 230 235 240

Leu Trp Asp Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Leu Val

245 250 255

Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu Ser

260 265 270

Val Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Thr Leu

275 280 285

Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val Tyr

290 295 300

Ile

305

<210>31

<211>945

<212>DNA

<213>pre ETV

<400>31

gccataacct tccaccaaac tctgcaagmt ccccctgctg gtggctccag ttccggaaca 60

gtaaaccctg ttccgactac tgcctctcac atatcgtcaa tcttctcgag gattggggac 120

cctgcgctga atatggagaa catcacatca ggattcctag gaccccttct cgtgttacag 180

gcggggtttt tcttgttgac aagaatcctc acaataccgm agagtctaga ctcgtggtgg 240

acttctctca attttctagg gggaaccacc gtgtgtcttg gccaaaattc gcagtcccca 300

acctccaatc actcaccaac ctcctgtcct ccgacttgac ctggttatcg ctggatgtgt 360

ctgcggcgtt ttatcatatt cctcttcatc ctgctgctat gcctcatctt cttgttggtt 420

cttctggact atcaaggtat gttgcccgtt tgtcctctaa ttccaggatc ctcaaccacc 480

agcacgggaa catgccgaac ttgcacgact cctgctcaag gaacctctat gtatccctcc 540

tgttgctgta ccaaaccttc ggacggaaat tgcacctgta ttcccatccc atcatcctgg 600

gctttcggaa aattcctatg ggagtgggcc tcagcccgtt tctcatggct cagtttasta 660

gtgccatttg ttcagtggtt cgtagggctt tcccccactg tttggctttc agttatgtgg 720

atgatgtggt attgggggcc aagtctgtac agcatcttga gtcccttttt accgctgtta 780

ccaattttct tttgtctctg ggtatacatt tgaaccctaa caaaacaaag agatggggtt 840

actccctaaa ttttatgggc tatgtcattg gatgttatgg gtccttgcca caagaacaca 900

tcgtacataa aatcaaagaa tgttttagaa aacttcctgt taaca 945

<210>32

<211>1245

<212>DNA

<213>on ETV

<400>32

tgcctcattt tgtgggtcac catattcttg ggaacaagat ctacagcatg gggcagaatc 60

tttccaccag caatcctctg ggattctttc ccgaccacca gttggatcca gccttcagag 120

caaacaccgc aaatccagat tgggacttca atcccaacaa ggacacctgg ccagacgcca 180

acaaggtagg agctggagca ttcgggctgg gtttcacccc accgcacgga ggccttttgg 240

ggtggagccc tcaggctcag ggcatactac aaactttgcc agcaaagccg cctcctgcct 300

ccaccaatcg ccagtcagga cggcagccta ccccgctgtc tccacctttg agagacactc 360

atcctcaggc gcagtggaaa cccacaacct tccaccaaac tgtgcaagct ccacctgctg 420

gtggctccag ttccggaaca gtaaaccctg ttccgactac tgcctctcac atatcgtcaa 480

tcttctcgag gattggggac cctgcgctga atatggagaa catcacatca ggattcctag 540

gaccccttct cgtgttacag gcggggtttt tcttgttgac aagaatcctc acaataccga 600

agagtctaga ctcgtggtgg acttctctca attttctagg gggaaccacc gtgtgtcttg 660

gccaaaattc gcagtcccca acctccaatc actcaccaac ctcctgtcct ccgacttgtc 720

ctggttatcg ctggatgtgt ctgcggcgtt ttatcatatt cctcttcatc ctgctgctat 780

gcctcatctt cttgttggtt cttctggact atcaaggtat gttgcccgtt tgtcctctaa 840

ttccaggatc ctcaaccacc agcacgggaa catgccgaac ttgcacgact cctgctcaag 900

gaacctctat gtatccctcc tgttgctgta ccaaaccttc ggacggaaat tgcacctgta 960

ttcccatccc atcatcctgg gctttcggaa aattcctatg ggagtgggcc tcagcccgtt 1020

tctcatggct cagtttggta gtgccatttg ttcagtggtt cgtagggctt tcccccactg 1080

tttggctttc atttatgtgg atgatgtggt attgggggcc aagtctgtac agcatcttga 1140

gtcccttttt accgctgtta ccaattttct tttgtctctg ggtatacatt tgaaccctaa 1200

caaaacaaag agatggggtt actccctaaa ttttatgggg ctatg 1245

<210>33

<211>290

<212>PRT

<213>pre ETV

<220>

< 221>misc_ characteristic

<222>(9)..(9)

< 223>any amino acid of X=

<220>

< 221>misc_ characteristic

<222>(73)..(73)

< 223>any amino acid of X=

<220>

< 221>misc_ characteristic

<222>(219)..(219)

< 223>any amino acid of X=

<400>33

His Asn Leu Pro Pro Asn Ser Ala Xaa Ser Pro Cys Trp Trp Leu Gln

1 5 10 15

Phe Arg Asn Ser Lys Pro Cys Ser Asp Tyr Cys Leu Ser His Ile Val

20 25 30

Asn Leu Leu Glu Asp Trp Gly Pro Cys Ala Glu Tyr Gly Glu His His

35 40 45

Ile Arg Ile Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val Phe Leu

50 55 60

Val Asp Lys Asn Pro His Asn Thr Xaa Glu Ser Arg Leu Val Val Asp

65 70 75 80

Phe Ser Gln Phe Ser Arg Gly Asn His Arg Val Ser Trp Pro Lys Phe

85 90 95

Ala Val Pro Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asp Leu

100 105 110

Thr Trp Leu Ser Leu Asp Val Ser Ala Ala Phe Tyr His Ile Pro Leu

115 120 125

His Pro Ala Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser

130 135 140

Arg Tyr Val Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn His Gln

145 150 155 160

His Gly Asn Met Pro Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr

165 170 175

Val Ser Leu Leu Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu

180 185 190

Tyr Ser His Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val

195 200 205

Gly Leu Ser Pro Phe Leu Met Ala Gln Phe Xaa Ser Ala Ile Cys Ser

210 215 220

Val Val Arg Arg Ala Phe Pro His Cys Leu Ala Phe Ser Tyr Val Asp

225 230 235 240

Asp Val Val Leu Gly Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe

245 250 255

Thr Ala Val Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro

260 265 270

Asn Lys Thr Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met Gly Tyr Val

275 280 285

Ile Gly

290

<210>34

<211>251

<212>PRT

<213>on ETV

<400>34

Glu Asp Trp Gly Pro Cys Ala Glu Tyr Gly Glu His His Ile Arg Ile

1 5 10 15

Pro Arg Thr Pro Ser Arg Val Thr Gly Gly Val Phe Leu Val Asp Lys

20 25 30

Asn Pro His Asn Thr Glu Glu Ser Arg Leu Val Val Asp Phe Ser Gln

35 40 45

Phe Ser Arg Gly Asn His Arg Val Ser Trp Pro Lys Phe Ala Val Pro

50 55 60

Asn Leu Gln Ser Leu Thr Asn Leu Leu Ser Ser Asp Leu Ser Trp Leu

65 70 75 80

Ser Leu Asp Val Ser Ala Ala Phe Tyr His Ile Pro Leu His Pro Ala

85 90 95

Ala Met Pro His Leu Leu Val Gly Ser Ser Gly Leu Ser Arg Tyr Val

100 105 110

Ala Arg Leu Ser Ser Asn Ser Arg Ile Leu Asn His Gln His Gly Asn

115 120 125

Met Pro Asn Leu His Asp Ser Cys Ser Arg Asn Leu Tyr Val Ser Leu

130 135 140

Leu Leu Leu Tyr Gln Thr Phe Gly Arg Lys Leu His Leu Tyr Ser His

145 150 155 160

Pro Ile Ile Leu Gly Phe Arg Lys Ile Pro Met Gly Val Gly Leu Ser

165 170 175

Pro Phe Leu Met Ala Gln Phe Gly Ser Ala Ile Cys Ser Val Val Arg

180 185 190

Arg Ala Phe Pro His Cys Leu Ala Phe Ile Tyr Val Asp Asp Val Val

195 200 205

Leu Gly Ala Lys Ser Val Gln His Leu Glu Ser Leu Phe Thr Ala Val

210 215 220

Thr Asn Phe Leu Leu Ser Leu Gly Ile His Leu Asn Pro Asn Lys Thr

225 230 235 240

Lys Arg Trp Gly Tyr Ser Leu Asn Phe Met Gly

245 250

<210>35

<211>110

<212>PRT

<213>pre ETV

<220>

< 221>misc_ characteristic

<222>(8)..(8)

< 223>any amino acid of X=

<220>

< 221>misc_ characteristic

<222>(72)..(72)

< 223>any amino acid of X=

<400>35

Thr Phe His Gln Thr Leu Gln Xaa Pro Pro Ala Gly Gly Ser Ser Ser

1 5 10 15

Gly Thr Val Asn Pro Val Pro Thr Thr Ala Ser His Ile Ser Ser Ile

20 25 30

Phe Ser Arg Ile Gly Asp Pro Ala Leu Asn Met Glu Asn Ile Thr Ser

35 40 45

Gly Phe Leu Gly Pro Leu Leu Val Leu Gln Ala Gly Phe Phe Leu Leu

50 55 60

Thr Arg Ile Leu Thr Ile Pro Xaa Ser Leu Asp Ser Trp Trp Thr Ser

65 70 75 80

Leu Asn Phe Leu Gly Gly Thr Thr Val Cys Leu Gly Gln Asn Ser Gln

85 90 95

Ser Pro Thr Ser Asn His Ser Pro Thr Ser Cys Pro Pro Thr

100 105 110

<210>36

<211>226

<212>PRT

<213>post ETV

<400>36

Met Glu Asn Ile Thr Ser Gly Phe Leu Gly Pro Leu Leu Val Leu Gln

1 5 10 15

Ala Gly Phe Phe Leu Leu Thr Arg Ile Leu Thr Ile Pro Lys Ser Leu

20 25 30

Asp Ser Trp Trp Thr Ser Leu Asn Phe Leu Gly Gly Thr Thr Val Cys

35 40 45

Leu Gly Gln Asn Ser Gln Ser Pro Thr Ser Asn His Ser Pro Thr Ser

50 55 60

Cys Pro Pro Thr Cys Pro Gly Tyr Arg Trp Met Cys Leu Arg Arg Phe

65 70 75 80

Ile Ile Phe Leu Phe Ile Leu Leu Leu Cys Leu Ile Phe Leu Leu Val

85 90 95

Leu Leu Asp Tyr Gln Gly Met Leu Pro Val Cys Pro Leu Ile Pro Gly

100 105 110

Ser Ser Thr Thr Ser Thr Gly Thr Cys Arg Thr Cys Thr Thr Pro Ala

115 120 125

Gln Gly Thr Ser Met Tyr Pro Ser Cys Cys Cys Thr Lys Pro Ser Asp

130 135 140

Gly Asn Cys Thr Cys Ile Pro Ile Pro Ser Ser Trp Ala Phe Gly Lys

145 150 155 160

Phe Leu Trp Glu Trp Ala Ser Ala Arg Phe Ser Trp Leu Ser Leu Val

165 170 175

Val Pro Phe Val Gln Trp Phe Val Gly Leu Ser Pro Thr Val Trp Leu

180 185 190

Ser Phe Met Trp Met Met Trp Tyr Trp Gly Pro Ser Leu Tyr Ser Ile

195 200 205

Leu Ser Pro Phe Leu Pro Leu Leu Pro Ile Phe Phe Cys Leu Trp Val

210 215 220

Tyr Ile

225

Claims

1. in order to confirm HBV, promptly " the receive examination virus " method of the susceptibility that performance descends to Entecavir whether, described method comprises:

From the described virus screening nucleic acid molecule that tried, said nucleic acid molecule contains the nucleotide sequence of reversed transcriptive enzyme (rt) structural domain of the relevant archaeal dna polymerase that suddenlys change of coding, and said sudden change causes the replacement of rtI169T+rtV173L+rtL180M+rtM204V;

Wherein, the existence of said sudden change indication is tried the virus susceptibility that performance descends to Entecavir, and wherein said method is not the diagnosis or the treat-ment of disease.

2. according to the process of claim 1 wherein that the described virus of being tried further shows the susceptibility of decline to lamivudine.