CN101374515B

CN101374515B - Inhibitors of akt activity

Info

Publication number: CN101374515B
Application number: CN200680020507.7A
Authority: CN
Inventors: D·J·阿姆斯特隆; E·H·胡; M·J·凯利三世; M·E·莱顿; Y·李; J·梁; K·J·罗兹纳克; M·A·罗西; P·E·桑德森; J·王
Original assignee: Schering Corp
Current assignee: Merck Sharp and Dohme LLC
Priority date: 2005-06-10
Filing date: 2006-06-07
Publication date: 2013-01-09
Anticipated expiration: 2026-06-07
Also published as: ZA200709762B; SI1898903T1; UA87929C2; MA35215B1; CN101374515A

Abstract

The instant invention provides for substituted naphthyridine compounds that inhibit AKT activity. In particular, the compounds disclosed selectively inhibit one or two of the AKT isoforms. The invention also provides for compositions comprising such inhibitory compounds and methods of inhibiting AKT activity by administering the compound to a patient in need of treatment of cancer.

Description

The AKT activity inhibitor

Background of invention

The present invention relates to the naphthyridine compounds replaced, the inhibitor of the activity that described compound is one or more Akt serine/threonine kinases (also being called PKB, hereinafter referred to as " Akt ") isozyme.The method that the invention still further relates to the pharmaceutical composition that contains described compound and use the compounds of this invention treatment cancer.

Apoptosis (programmed cell death) is at fetal development, and plays an important role in the pathogeny of various diseases such as degeneration neuronal disease, cardiovascular disease and cancer.Recent research has caused participating in adjusting or the various short apoptogene product of execution and the confirmation of anti-apoptotic genes expression product of programmed cell death.Anti-apoptotic genes expression is Bcl2 or Bcl-x for example _LExpression, suppress the apoptotic cell death induced by various stimulations.On the other hand, the expression of short apoptogene such as Bax or Bad can cause programmed cell death (Adams etc., Science, 281:1322-1326 (1998)).The execution of programmed cell death is to be mediated by the protease relevant to Caspase-1, comprise (the Thornberry etc. such as Caspase-3, Caspase-7, Caspase-8 and Caspase-9, Science, 281:1312-1316 (1998)).

Phosphatidylinositols 3 '-OH kinases (PI3K)/Akt approach is exchanged ganglion cell's survival/cell death seem very important (Kulik etc., Mol.Cell.Biol.17:1595-1606 (1997); Franke etc., Cell, 88:435-437 (1997); Kauffmann-Zeh etc., Nature 385:544-548 (1997); Hemmings, Science, 275:628-630 (1997); Dudek etc., Science, 275:661-665 (1997)).Survival factors, for example platelet derived growth factor (PDGF), nerve growth factor (NGF) and insulin-like growth factor-i (IGF-1), by inducing the activity of PI3K, promote the survival (Kulik etc. of cell under various conditions, 1997, Hemmings 1997).The PI3K of activation causes phosphatidylinositols (3,4,5)-triphosphoric acid (PtdIns (3,4,5)-P3) produces, phosphatidylinositols (3,4,5)-triphosphoric acid is combined with the serine/threonine kinase Akt that contains platelet leukocyte C kinase substrate (pleckstrin) homology (PH) domain then, and promotes its activation (Franke etc., Cell, 81:727-736 (1995); Hemmings Science, 277:534 (1997); Downward, Curr.Opin.CellBiol.10:262-267 (1998); Alessi etc., EMBO is (1996) J.15:6541-6551).PI3K specific inhibitor or dominant Akt mutant have destroyed these somatomedin or cytokine promotes the activity of surviving.Disclose already PI3K inhibitor (LY294002 or wortmannin) by the activation of upstream kinases blocking-up Akt.In addition, at cell, normally experience under the condition of apoptotic cell death, the importing of constitutive activity PI3K or Akt mutant can promote cell survival (Kulik etc., 1997, Dudek etc., 1997).

Identify 3 members of the serine/threonine protein kitase Akt subfamily of second message,second messenger's adjusting, and be referred to as Akt1/PKB α, Akt2/PKB β and Akt3/PKB γ (being called hereinafter " Akt1 ", " Akt2 " and " Akt3 ").Described isozyme is homology, particularly in the zone of encoding catalyst structure domain.Akt is activated by the phosphorylation occurred when responding the PI3K signal.PI3K makes film lipositol phosphorylation, produces second message,second messenger's phosphatidyl-inositol 3,4,5-triphosphoric acid and phosphatidylinositols 3, and the 4-diphosphonic acid, phosphatidyl-inositol 3,4,5-triphosphoric acid and phosphatidylinositols 3, the 4-diphosphonic acid is attached on the PH domain of Akt.The updated model prompting that Akt activates, raise enzyme on film by 3 '-phosphorylation phosphoinositide, and pass through the upstream kinases on film, produces phosphorylation (B.A.Hemmings, the Science 275:628-630 (1997) of Akt regulatory site; B.A.Hemmings, Science 276:534 (1997); J.Downward, Science 279:673-674 (1998)).

The Akt1 phosphorylation occurs in two regulatory sites, i.e. Thr on catalyst structure domain activation ring ³⁰⁸With the Ser near c-terminus ⁴⁷³(D.R.Alessi etc., EMBO is (1996) and R.Meier etc. J.15:6541-6551, J.Biol.Chem.272:30491-30497 (1997)).Equal adjusting phosphorylation site also occurs on Akt2 and Akt3.In activation ring site, the upstream kinases of Akt phosphorylation is cloned, is called as 3 '-phosphoinositide deopendent protein kinase 1 (PDK1).PDK1 not only makes the Akt phosphorylation, and kinases (SGK) and the Protein kinase C phosphorylation that can make p70 Ribosomal S6 kinase, p90RSK, serum and glucocorticoid regulate.The upstream kinases not yet is confirmed to the phosphorylation of the Akt regulatory site of nearly c-terminus, but the effect of kinases (ILK-1), serine/threonine protein kitase or autophosphorylation that recent report points out this enzyme to connect for integrin.

To the analysis showed that of Akt level in human tumor, at numerous ovarian cancer (J.Q.Cheng etc., Proc.Natl.Acad.Sci.U.S.A.89:9267-9271 (1992)) and cancer of pancreas (J.Q.Cheng etc., Proc.Natl.Acad.Sci.U.S.A.93:3636-3641 (1996)) in, the Akt2 overexpression.Equally also find in breast cancer cell line and prostate cancer cell line Akt3 overexpression (Nakatani etc., J.Biol.Chem.274:21528-21532 (1999)).

Tumor inhibitor PTEN, one species specificity is removed PtdIns (3,4,5) protein of 3 ' phosphoric acid and lipid phosphatase in-P3 are negative regulator person (Li etc., the Science 275:1943-1947 (1997) of PI3K/Akt approach, Stambolic etc., Cell 95:29-39 (1998), Sun etc., Proc.Natl.Acad.Sci.U.S.A.96:6199-6204 (1999)).The germ line mutation of PTEN is to cause the syndromic reason of human cancer, such as Cowden sick (Liaw etc., Nature Genetics 16:64-67 (1997)).PTEN disappearance in the human tumor of significant proportion, the tumor cell line of non-functional PTEN shows the level rising (Li etc. of activation Akt, ibid, Guldberg etc., CancerResearch 57:3660-3663 (1997), Risinger etc., Cancer Research 57:4736-4738 (1997)).

These observed results show, in tumor occurs, the PI3K/Akt approach is played an important role in regulating cell survival or apoptosis.

By using inhibitor such as LY294002 and wortmannin to suppress PI3K, can obtain the inhibition to Akt activation and Akt activity.For example, but PI3K suppresses not affect not only all 3 Akt isozymes with making any distinction between, and impact depends on the signaling molecule that contains other PH domain of PdtIns (3,4,5)-P3, the Tec family of tyrosine kinase.In addition, once having report to disclose Akt can be activated by the growth signals had nothing to do with PI3K.

Perhaps, can suppress the Akt activity by the activity of blocking-up upstream kinases PDK1.There is no the report of specificity PDK1 inhibitor.Moreover, suppress PDK1 and may cause suppressing the protein kinase that a plurality of its activity depend on PDK1, for example, atypia PKC isozyme, SGK and S6K (Williams etc., Curr.Biol.10:439-448 (2000)).

An object of the present invention is to provide new compound, this compound is the Akt inhibitor.

Another object of the present invention is to provide pharmaceutical composition, and said composition comprises the noval chemical compound as the Akt inhibitor.

Another purpose of the present invention is to provide the method for the treatment of cancer, and the method comprises and gives such Akt activity inhibitor.

Summary of the invention

The invention provides the naphthyridine compounds of the replacement that suppresses the Akt activity.Specifically, disclosed compound selective ground suppresses one or both Akt isozymes.The present invention also provides the compositions that contains described inhibition compound, and by needing to treat the described compound of patient of cancer to suppress the method for Akt activity.

Detailed Description Of The Invention

Compound of the present invention can be used for suppressing the activity of serine/threonine kinase Akt.In first embodiment of the present invention, the inhibitor of Akt activity is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula A:

Wherein:

E, F, G, H, I, J, K, L and M independently selected from: C or N, wherein E, F, G, H, I, J, K, L and M are separately optionally by R ¹Replace;

A is 0 or 1; B is 0 or 1; M is 0,1 or 2; P is 0,1,2,3,4 or 5 independently;

Ring Z is selected from: (C ₃-C ₈) cycloalkyl, aryl, heteroaryl and heterocyclic radical;

R ¹Be selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace;

R ²Independently selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, SH, S (O) _mNR ⁷R ⁸, S (O) _m-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace;

R ³Independently selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace;

R ⁶For: (C=O) _aO _bC ₁-C ₁₀Alkyl, (C=O) _aO _bAryl, C ₂-C ₁₀Thiazolinyl, C ₂-C ₁₀Alkynyl, (C=O) _aO _bHeterocyclic radical, CO ₂H, halogen, CN, OH, O _bC ₁-C ₆Perfluoroalkyl, O _a(C=O) _bNR ⁷R ⁸, oxo, CHO, (N=O) R ⁷R ⁸, S (O) _mNR ⁷R ⁸, SH, S (O) _m(C ₁-C ₁₀) alkyl or (C=O) _aO _bC ₃-C ₈Cycloalkyl, described alkyl, aryl, thiazolinyl, alkynyl, heterocyclic radical and cycloalkyl are optionally by one or more R that are selected from ^6aSubstituent group replace;

R ^6aBe selected from: (C=O) _aO _b(C ₁-C ₁₀) alkyl, O _a(C ₁-C ₃) perfluoroalkyl, (C ₀-C ₆) alkylidene-S (O) _mR ^a, SH, oxo, OH, halogen, CN, (C ₂-C ₁₀) thiazolinyl, (C ₂-C ₁₀) alkynyl, (C ₃-C ₆) cycloalkyl, (C ₀-C ₆) alkylidene-aryl, (C ₀-C ₆) alkylidenyl-heterocyclic base, (C ₀-C ₆) alkylidene-N (R ^b) ₂, C (O) R ^a, (C ₀-C ₆) alkylidene-CO ₂R ^a, C (O) H and (C ₀-C ₆) alkylidene-CO ₂H, described alkyl, thiazolinyl, alkynyl, cycloalkyl, aryl and heterocyclic radical optionally are selected from R by maximum three ^b, OH, (C ₁-C ₆) alkoxyl, halogen, CO ₂H, CN, O _a(C=O) _b(C ₁-C ₆) alkyl, oxo and N (R ^b) ₂Substituent group replace;

R ⁷And R ⁸Independently selected from: H, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, (C=O) _aO _b-aryl, (C=O) _aO _b-heterocyclic radical, (C ₂-C ₁₀) thiazolinyl, (C ₂-C ₁₀) alkynyl, SH, SO ₂R ^a(C=O) _aNR ^b ₂, described alkyl, cycloalkyl, aryl, heterocyclic radical, thiazolinyl and alkynyl are optionally by one or more R that are selected from ^6aSubstituent group replace, or R ⁷And R ⁸Form each ring together with the nitrogen that can connect with it for the 3-7 ring and optionally contain one or two other heteroatomic monocycle or bicyclic heterocycle of being selected from N, O and S except containing described nitrogen, described monocycle or bicyclic heterocycle are optionally by one or more R that are selected from ^6aSubstituent group replace;

R ^aFor (C ₁-C ₆) alkyl, (C ₃-C ₆) cycloalkyl, aryl or heterocyclic radical; With

R ^bBe independently: H, (C ₁-C ₆) alkyl, aryl, heterocyclic radical, (C ₃-C ₆) cycloalkyl, (C=O) _aO _b(C ₁-C ₆) alkyl or S (O) _mR ^a.

In second embodiment of the present invention, the inhibitor of Akt activity is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula B:

Wherein

Be selected from:

R ¹Be selected from: H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace;

All other substituent groups and variable are as defined in first embodiment.

In the 3rd embodiment of the present invention, the inhibitor of Akt activity is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula C:

Wherein:

Q is 0,1,2,3 or 4; R is 0,1,2,3,4 or 5; T is 2,3,4,5 or 6;

Q is independently selected from oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ^6aSubstituent group replace;

R ⁴And R ⁵Independently selected from: H, (C ₁-C ₆) alkyl and (C ₁-C ₆) perfluoroalkyl, or R ⁴And R ⁵Be connected to form-(CH ₂) _t-, wherein one of carbon atom optionally is selected from O, S (O) _m,-N (R ^b) C (O)-and-N (COR ^a)-Partial Replacement;

All other substituent groups and variable are as defined in second embodiment.

In the 4th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula D:

Wherein:

All other substituent groups and variable are as defined in the 3rd embodiment.

In the 5th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula E:

Wherein:

A is 0 or 1; B is 0 or 1; M is 0,1 or 2;

R ³Be selected from: H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace;

R ⁶For: (C=O) _aO _bC ₁-C ₁₀Alkyl, (C=O) _aO _bAryl, C ₂-C ₁₀Thiazolinyl, C ₂-C ₁₀Alkynyl, (C=O) _aO _bHeterocyclic radical, CO ₂H, halogen, CN, OH, O _bC ₁-C ₆Perfluoroalkyl, O _a(C=O) _bNR ⁷R ⁸, oxo, CHO, (N=O) R ⁷R ⁸, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl or (C=O) _aO _bC ₃-C ₈Cycloalkyl, described alkyl, aryl, thiazolinyl, alkynyl, heterocyclic radical and cycloalkyl are optionally by one or more R that are selected from ^6aSubstituent group replace;

In the 6th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula F:

Wherein:

R ⁴And R ⁵Be independently: H and (C ₁-C ₆) alkyl, wherein said alkyl is optionally replaced by maximum three substituent groups that are selected from OH and halogen; And R wherein ⁴And R ⁵Can be connected to form (C ₃-C ₇) cycloalkyl;

All other substituent groups and variable are as defined in the 5th embodiment.

In the 7th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by formula F:

Wherein:

R ¹Be selected from: H, NH ₂, OH and (C ₁-C ₆) alkyl;

R ⁴And R ⁵Be independently: H and (C ₁-C ₆) alkyl.

In the 8th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula G:

Wherein:

A is 0 or 1; B is 0 or 1; M is 0,1 or 2;

Q is selected from: heterocyclic radical, it is optionally by one or more R that are selected from ^6aSubstituent group replace;

R ⁴And R ⁵Be independently: H, (C ₁-C ₆) alkyl, (C ₁-C ₆) thiazolinyl, (C ₁-C ₆) alkynyl, wherein said alkyl is optionally replaced by maximum three substituent groups that are selected from OH and halogen, and R wherein ⁴And R ⁵Can be connected to form (C ₃-C ₇) cycloalkyl, wherein said cycloalkyl optionally is selected from R by maximum three ⁶Substituent group replace;

In the 9th embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula H:

Wherein:

R ¹For heterocyclic radical, described heterocyclic radical optionally is selected from (C by 1-3 ₁-C ₆) alkyl, OH, halogen and NH ₂Substituent group replace;

R ^6aBe selected from:

In the of the present invention ten embodiment, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula H:

Wherein:

R ¹Be selected from

All other substituent groups and variable are as defined in the 9th embodiment.

In the 11 embodiment of the present invention, inhibitor of the present invention is compound or pharmaceutically acceptable salt thereof or the stereoisomer meaned by following formula J:

Wherein:

A is 0 or 1; B is 0 or 1; M is 0,1 or 2;

R ¹Be selected from: CF ³, H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical optionally are selected from R by 1-6 ⁶Substituent group replace;

R ³' and R ³" independently selected from: CF ³, H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical optionally are selected from R by 1-5 ⁶Substituent group replace; Perhaps R ³' and R ³" form piperidines or pyrrolidine together with the nitrogen that can connect with it, piperidines or pyrrolidine can optionally be selected from R by 1-5 ⁶Substituent group replace;

R ⁶For: CF ³, (C=O) _aO _bC ₁-C ₁₀Alkyl, (C=O) _aO _bAryl, C ₂-C ₁₀Thiazolinyl, C ₂-C ₁₀Alkynyl, (C=O) _aO _bHeterocyclic radical, CO ₂H, halogen, CN, OH, O _bC ₁-C ₆Perfluoroalkyl, O _a(C=O) _bNR ⁷R ⁸, oxo, CHO, (N=O) R ⁷R ⁸, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl or (C=O) _aO _bC ₃-C ₈Cycloalkyl, described alkyl, aryl, thiazolinyl, alkynyl, heterocyclic radical and cycloalkyl optionally are selected from R by 1-5 ^6aSubstituent group replace;

R ^6aBe selected from: CF ³, (C=O) _aO _b(C ₁-C ₁₀) alkyl, O _a(C ₁-C ₃) perfluoroalkyl, (C ₀-C ₆) alkylidene-S (O) _mR ^a, SH, oxo, OH, halogen, CN, (C ₂-C ₁₀) thiazolinyl, (C ₂-C ₁₀) alkynyl, (C ₃-C ₆) cycloalkyl, (C ₀-C ₆) alkylidene-aryl, (C ₀-C ₆) alkylidenyl-heterocyclic base, (C ₀-C ₆) alkylidene-N (R ^b) ₂, (C=O) _aNR ^b ₂, C (O) R ^a, (C ₀-C ₆) alkylidene-CO ₂R ^a, C (O) H and (C ₀-C ₆) alkylidene-CO ₂H, described alkyl, thiazolinyl, alkynyl, cycloalkyl, aryl and heterocyclic radical optionally are selected from R by maximum three ^b, OH, (C ₁-C ₆) alkoxyl, halogen, CO ₂H, CN, O _a(C=O) _b(C ₁-C ₆) alkyl, oxo and N (R ^b) ₂Substituent group replace;

R ⁷And R ⁸Independently selected from: CF ³, H, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, (C=O) _aO _b-aryl, (C=O) _aO _b-heterocyclic radical, (C ₂-C ₁₀) thiazolinyl, (C ₂-C ₁₀) alkynyl, SH, SO ₂R ^a(C=O) _aNR ^b ₂, described alkyl, cycloalkyl, aryl, heterocyclic radical, thiazolinyl and alkynyl optionally are selected from R by 1-5 ^6aSubstituent group replace; Perhaps R ⁷And R ⁸Form each ring together with the nitrogen that can connect with it for the 3-7 ring and optionally contain one or two other heteroatomic monocycle or bicyclic heterocycle of being selected from N, O and S except containing described nitrogen, described monocycle or bicyclic heterocycle optionally are selected from R by 1-6 ^6aSubstituent group replace;

R ^aFor (C ₁-C ₆) alkyl, NR ^b ₂, (C ₃-C ₆) cycloalkyl, aryl or heterocyclic radical; With

R ^bBe independently: H, (C ₁-C ₆) alkyl, NH ₂, aryl, heterocyclic radical, (C ₃-C ₆) cycloalkyl, (C=O) _aO _b(C ₁-C ₆) alkyl or S (O) _mR ^a.

Particular compound of the present invention comprises:

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (1-4);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-alcohol (1-5);

9-phenyl-8-(4-{[4-(4-pyridine-2-base-1H-imidazoles-1-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-mercaptan (1-7);

3-methyl-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-2);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-3);

3-(chloromethyl)-9-phenyl-8-(4-{[4-(4-pyridine-2-base-1H-imidazoles-1-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-4);

The 3-[(4-methylpiperazine-1-yl) methyl]-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-5); With

2-([9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methyl } amino) ethanol (2-6);

Or its officinal salt and stereoisomer.

The example of compound of the present invention comprises the tfa salt of following compound:

The 3-[(4-methylpiperazine-1-yl) methyl]-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-5);

3-(3-methyl isophthalic acid H-1,2,4-triazole-5-yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-9);

3-imidazo [2,1-b] [1,3] thiazole-6-base-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-10);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-11);

3-imidazo [1,2-a] pyridine-2-base-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-12);

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (13-3);

5-[({4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } amino) methyl] pyridine-2-alcohol (13-8);

N ¹, N ¹, 2,2-tetramethyl-N ³-4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] and benzyl } propane-1,3-diamidogen (13-9);

N ³-4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl }-N ¹-(4-hydroxy phenyl)-beta-amino propionic acid amide. (14-6);

1-[4-(9-phenyl-3-pyridine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-13);

4-[3-(1-methyl-5-phenyl-1H-pyrazoles-4-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-41);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydrochysene-1-benzothiophene-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-42);

1-{4-[3-(1-isopropyl-1H-pyrazoles-4-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-43);

1-{4-[9-phenyl-3-(Isosorbide-5-Nitrae, 5,6-tetrahydro cyclopentyl alkane is [c] pyrazole-3-yl also) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-44);

1-[4-(3-cyclopropyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-48);

1-{4-[9-phenyl-3-(trifluoromethyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-49);

1-{4-[3-(5-methyl isophthalic acid H-pyrazole-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-50);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-51);

4-[3-(1H-indole-2-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-52);

1-{4-[3-(1-methyl isophthalic acid H-imidazoles-2-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-53);

1-{4-[3-(3-methyl-2H-3 λ ⁵-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-54);

4-[3-(6-chlorine imidazo [1,2-a] pyridine-2-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-55);

1-{4-[3-(1H-benzimidazolyl-2 radicals-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-56);

4-[3-(5-cyclopropyl-4H-pyrazole-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-57);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydrochysene-1H-indazole-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-58);

4-[9-phenyl-3-(3-phenyl-1H-pyrazoles-5-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-59);

1-(4-{9-phenyl-3-[3-(trifluoromethyl)-1H-pyrazoles-5-yl] [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl } phenyl) methylamine (16-60);

1-[4-(9-phenyl-3-pyrazolo [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-61);

1-{4-[3-(1-benzyl-1H-pyrazoles-4-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-62);

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-63);

4-[9-phenyl-3-(1-phenyl-1H-pyrazoles-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-64);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydrochysene-2-benzothiophene-1-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-65);

1-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } ethane-1,2-glycol (16-68);

4-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } imidazolidin-2-one (16-69);

(2R)-2-amino-2-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } ethanol (16-70);

(2R)-2-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl }-2-(methylamino) ethanol (16-71);

1-[4-(3-ethyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (17-6);

1-[4-(9-phenyl-3-propyl group [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (17-7);

1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] cyclopropylamine (33-5);

1-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } cyclopropylamine (33-6);

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] cyclopropylamine (33-7);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-5-pyridin-4-yl-2-furoamide (39-2);

(3-methyl-9-phenyl-8-(4-{1-[(pyridin-3-yl acetyl group) amino] cyclopropyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-43);

3-methyl-9-phenyl-8-(4-{1-[(quinoline-3-base carbonyl) amino] cyclopropyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-44);

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{1-[(pyridin-3-yl acetyl group) amino] cyclopropyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-46);

1-[4-(9-ethyl-2-phenyl [1,2,4] triazol [4 ', 3 ': 1,6] pyrido [2,3-b] pyrazine-3-yl) phenyl] cyclopropylamine (42-6); With

1-[4-(9-ethyl-3-phenyl [1,2,4] triazol [4 ', 3 ': 1,6] pyrido [2,3-b] pyrazine-2-yl) phenyl] cyclopropylamine (42-7);

Or its stereoisomer.

The example of compound of the present invention comprises the formates of following compound:

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (1-4); With

Or its stereoisomer.

Particular compound of the present invention comprises:

8-(4-amino methyl-phenyl)-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-3-alcohol (3-8);

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (4-3);

4-(3-methyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzyl amine (5-3);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-2);

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (7-4); With

9-phenyl-8-{4-[4-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl }-[1,2,4] triazols [3,4-f] [1,6] naphthyridines (8-10);

Or its officinal salt or stereoisomer.

The example of compound of the present invention comprises the HCl salt of following compound:

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-2); With

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (7-4);

3-(1H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-5);

[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methyl carbamic acid tertiary butyl ester (9-6);

[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methanol (9-7);

5-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl]-2,4-dihydro-3H-1,2,4-triazole-3-ketone (9-8);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,4-triazole-5-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-13);

3-(1H-benzimidazole-6-yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-14);

3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-1 5);

3-imidazo [1,2-a] pyrimidine-2-base-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-16);

5-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] pyridine-2-amine (9-17);

9-phenyl-3-pyrazolo [1,5-a] pyrimidin-3-yl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-18);

3-(5-methyl isophthalic acid H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-19);

3-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] pyridine-2-amine (9-20);

4-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] phenol (9-21);

3-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] phenol (9-22);

2-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] phenol (9-23);

1-{4-[3-(5-oxo-4,5-dihydro-1H-1,2,4-triazole-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } piperidines-4-Methanamide (9-24);

1-[4-(3-imidazo [1,2-a] pyridine-2-base-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] piperidines-4-Methanamide (9-25);

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (13-4);

N-[2-(4-methyl isophthalic acid H-imidazoles-2-yl) ethyl]-N-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } amine (13-5);

N ¹-(2-hydroxy phenyl)-N ³-4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl }-beta-amino propionic acid amide. (13-6);

1-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } piperidines-4-Methanamide (13-7);

3-hydroxyl-2,2-dimethyl-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-10);

The fluoro-3-hydroxy-n of 2--[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-11);

The fluoro-3-hydroxy-n of 2,2-bis--[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-12);

2,3-dihydroxy-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-13);

4-hydroxy-n-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] cyclohexylamine (13-14);

4-hydroxy-n-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] cyclohexylamine (13-15);

3-hydroxyl-2,2-dimethyl-N-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } third-1-amine (13-16);

3-hydroxyl-2, and 2-dimethyl-N-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-17);

3-hydroxyl-2,2-dimethyl-N-[4-(9-phenyl-3-pyrazolo [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] third-1-amine (13-18);

3-hydroxyl-2,2-dimethyl-N-{4-[9-phenyl-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } third-1-amine (13-19);

N-{4-[3-(amino (ammonio) methyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl }-3-hydroxyl-2,2-dimethyl propylene-1-amine (13-21);

N ³-4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl }-N ¹-(2-hydroxy phenyl)-beta-amino propionic acid amide. (14-4);

(8-{4-[(cyclohexyl amino) methyl] phenyl }-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl) methanol (14-5);

[9-phenyl-8-(4-{[4-(5-pyridin-3-yl-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methanol (14-7);

1-{4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } piperidines-4-Methanamide (14-8);

1-{4-[3-(1-pyridine oxide-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-4);

1-[4-(3,9-diphenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-5);

1-{4-[3-(4-fluorophenyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (1 6-6);

4-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } benzonitrile (16-7);

4-(9-phenyl-3-pyrimidine-4-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl amine (16-8);

1-{4-[3-(1-pyridine oxide-2-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-9);

5-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } pyridine-2-alcohol (16-10);

1-[4-(9-phenyl-3-pyridin-3-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-11);

4-(9-phenyl-3-pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl amine (16-12);

1-[4-(9-phenyl-3-pyrazine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-14);

1-{4-[9-phenyl-3-(1H-1,2,4-triazole-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-15);

1-{4-[9-phenyl-3-(1,3-thiazoles-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-16);

1-{4-[9-phenyl-3-(1H-pyrazoles-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-17);

1-{4-[3-(3-methyl isophthalic acid H-pyrazoles-4-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-18);

1-{4-[3-(3-methyl isophthalic acid H-1,2,4-triazole-5-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-19);

1-{4-[3-(1-methyl isophthalic acid H-pyrazoles-4-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-20);

1-{4-[9-phenyl-3-(1,2,5-thiadiazoles-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-21);

1-{4-[9-phenyl-3-(1,2,3-thiadiazoles-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-22);

1-[4-(9-phenyl-3-pyrazolo [1,5-a] pyrimidin-3-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-23);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methylamine (16-24);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol (16-25);

1-{4-[9-phenyl-3-(2,2,2-trifluoroethyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-26);

1-{4-[9-phenyl-3-(1H-TETRAZOLE-1-ylmethyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-27);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-Methanamide (16-28);

1-{4-[3-(1H-imidazoles-1-ylmethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-29);

1-(4-{3-[(methyl sulphonyl) methyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl } phenyl) methylamine (16-30);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } acetonitrile (16-31);

2-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } ethanol (16-32);

N-(8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methyl) acetamide (16-33);

1-[4-(3-imidazo [1,2-a] pyridine-2-base-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-36);

1-[4-(3-imidazo [2,1-b] [1,3] thiazole-6-base-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-38);

1-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-40);

1-(4-{9-phenyl-3-[(2R)-pyrrolidin-2-yl] [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl } phenyl) methylamine (16-44);

1-(4-{9-phenyl-3-[(2S)-pyrrolidin-2-yl] [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl } phenyl) methylamine (16-45);

4-[3-(1-amino-ethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-46);

1-{4-[3-(1H-imidazoles-2-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-47);

1-{4-[9-phenyl-3-(5,6,7,8-imidazolidine is [1,2-a] pyridine-2-yl also) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-66);

2-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } third-2-amine (16-67);

(the 5-ethyl is different for 1-{4-[3-

Azoles-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-72);

5-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl }-2,4-dihydro-3H-1,2,4-triazole-3-ketone (16-73);

6-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl }-4,5-dihydrogen dazin-3 (2H)-one (16-74);

6-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } pyridazine-3 (2H)-one (16-75);

N-(4-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } phenyl) acetamide (16-76);

1-{4-[3-(4-Phenoxyphenyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-77);

1-{4-[3-(1H-benzimidazole-5-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-78);

(4-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } phenyl) methanol (16-79);

4-[3-(4-cyclohexyl phenyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-80);

4-{8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl }-1,3-dihydro-2 H-imidazol-2-one (16-81);

1-{4-[3-(4-methyl isophthalic acid H-imidazoles-5-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-82);

4-[9-phenyl-3-(1-propyl group-1H-imidazol-4 yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-83);

1-{4-[3-(1-isopropyl-1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-84);

1-{4-[3-(1-butyl-1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-85);

1-[4-(3-imidazo [1,2-a] pyrimidine-2-base-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-86);

1-(6-methoxypyridine-3-yl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] methylamine (17-4);

N-[(2-methoxy pyrimidine-5-yl) methyl]-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amine (17-5);

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (21-4);

1-{4-[9-phenyl-3-(3H-1 λ ⁴, 3-thiazole-5-yl) and [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (22-4);

1-{4-[9-phenyl-3-(1H-pyrazole-3-yl)-2H-4 λ ⁵-[1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (22-5);

1-{4-[9-phenyl-3-(1,3-thiazoles-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (22-6);

1-{4-[3-(azetidine-1-ylmethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (26-3);

1-(8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methyl) piperidines-4-Methanamide (26-4);

1-{4-[3-(morpholine-4-ylmethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (26-5);

2-[({8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methyl) amino] ethanol (26-6);

1-(4-{3-[(4-methylpiperazine-1-yl) methyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl } phenyl) methylamine (26-7);

4-[9-phenyl-3-(piperazine-1-ylmethyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (26-8);

N-(8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methyl)-N-methyl amine (26-9);

N-(8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methyl)-N, N-dimethyl amine (26-10);

3-methyl-9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (31-1);

1-{4-[9-phenyl-3-(5,6,7,8-imidazolidine is [1,2-a] pyridine-2-yl also) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } cyclopropylamine (33-8);

1-[4-(9-phenyl-3-pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] cyclopropylamine (33-9);

1-{4-[3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } cyclopropylamine (33-10);

(1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (34-5);

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (34-6);

(1R)-1-{4-[9-phenyl-3-(5-pyridine-2-base-1H-pyrazole-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethamine (35-1);

(1R)-1-{4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethamine (35-2);

(1R)-1-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethamine (35-3);

(1R)-1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (35-4);

(1R)-1-[4-(3-imidazo [2,1-b] [1,3] thiazole-6-base-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (35-5);

(1R)-1-[4-(9-phenyl-3-pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (35-6);

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-1-amine (36-1);

2-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine (37-4);

2-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine (38-1);

3-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine (39-1);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-5-pyridin-3-yl-2-furoamide (39-3);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-5-pyridin-3-yl-1H-pyrrole-3-carboxamide (39-4);

4-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) morpholine (39-7);

2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-2-oxo ethamine (39-8);

4-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine (39-9);

2,4-dihydroxy-6-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyrimidine (39-10);

2-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine (39-11);

3-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine (39-12);

3-methyl-9-phenyl-8-[4-({ [(pyridin-3-yl amino) carbonyl] amino } methyl) phenyl] [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-14);

3-methyl-9-phenyl-8-(4-{[(pyridin-3-yl carbonyl) amino] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-20);

3-methyl-9-phenyl-8-(4-{[(quinoline-3-base carbonyl) amino] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-26);

8-(4-{[(1H-benzimidazole-1-base acetyl group) amino] methyl } phenyl)-3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-29);

8-(4-{[(1H-benzimidazolyl-2 radicals-Ji acetyl group) amino] methyl } phenyl)-3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-30);

3-methyl-8-[4-({ [(6-morpholine-4-yl pyridines-3-yl) carbonyl] amino } methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-34);

3-methyl-9-phenyl-8-(4-{[(3-pyridin-3-yl propiono) amino] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-37);

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[(pyridin-3-yl acetyl group) amino] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-38);

9-phenyl-3-pyrazolo [1,5-a] pyrimidin-3-yl-8-(4-{[(pyridin-3-yl acetyl group) amino] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-39);

N-{ (1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl }-2-pyridin-3-yl acetamide (39-47); With

N-((1R)-1-{4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethyl)-2-pyridin-3-yl acetamide (39-49);

Or its stereoisomer.

Further concrete compound of the present invention comprises:

9-phenyl-8-(4-{[4-(4-pyridine-2-base-1 H-imidazoles-1-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (1-6);

9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-4);

3-(1,5-dimethyl-1H-pyrazole-3-yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-15);

9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (10-4);

9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (11-4);

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (12-1);

{ [8-(4-{[(3-hydroxyl-2,2-dimethyl propyl) amino] methyl } phenyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methyl } carbamic acid tertiary butyl ester (13-20);

[9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methanol (14-3);

8-[4-(the amino cyclopropyl of 1-) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol (15-2);

1-[4-(9-phenyl-3-pyridin-4-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-3);

1-{4-[3-(4-fluorophenyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-6);

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol (16-25)

4-[3-(glyoxal ethyline is [1,2-a] pyridin-3-yl also)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (16-34);

1-[4-(9-phenyl-3-pyrazolo [1,5-a] pyridin-3-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-35);

1-{4-[9-phenyl-3-(4,5,6,7-tetrahydrochysene-1,2-benzisoxa

Azoles-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-37);

1-{4-[3-(1-methyl isophthalic acid H-imidazoles-5-yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (16-39);

(the 5-ethyl is different for 1-{4-[3-

5-({ [4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) pyridine-2-alcohol (17-3);

N-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (1 8-1);

4-({ [4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) phenol (19-1);

1-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methylamine (20-1);

1-{4-[3-(1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (22-3);

4-[9-phenyl-3-(pyrrolidin-1-yl methyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (26-2);

[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methanol (28-1);

4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] and phenyl } methanol (28-2);

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethanol (29-2);

9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (30-1);

9-phenyl-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-alcohol (32-1);

2-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine (37-4)

2-hydroxy-n-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-5);

(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) carbamic acid tertiary butyl ester (39-6);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-2-pyrazine-2-yl acetamide (39-13);

2-(2-hydroxy phenyl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-15);

2-(3-hydroxy phenyl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-16);

2-(4-hydroxy phenyl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-17);

2-(3,4-dihydroxy phenyl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-18);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-2-phenyl-acetamides (39-19);

2-hydroxy-n-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] Benzoylamide (39-21);

2-(4-hydroxy phenyl)-2-methyl-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] propionic acid amide. (39-22);

4-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-4-ketobutyric acid methyl ester (39-23);

The 2-hydroxy-n-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) Benzoylamide (39-24);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-2-(5-phenyl-4H-1,2,4-triazole-3-yl) acetamide (39-25);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-2-(4-oxo quinazoline-3 (4H)-yl) acetamide (39-27);

N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl]-2-(2-oxo-1,3-benzo

Azoles-3 (2H)-yl) acetamide (39-28);

2-(4-methyl isophthalic acid, 2,5-

Diazole-3-yl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-31);

2-(1H-indazole-1-yl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-32);

2-(5,6-dimethyl-4-oxo thieno [2,3-d] pyrimidine-3 (4H)-yl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-33);

2-(6-chloropyridine-3-yl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-35);

3-cyano group-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] propionic acid amide. (39-36);

N-(3-hydroxyl-2,2-dimethyl propyl)-N-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (39-40);

N-(3-hydroxyl-2, the 2-dimethyl propyl)-N-{4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines-8-yl] benzyl }-2-(4-oxo quinazoline-3 (4H)-yl) acetamide (39-41);

2-[[4-(3-{[(tertbutyloxycarbonyl) amino] methyl }-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines-8-yl) benzyl] (3-hydroxyl-2,2-dimethyl propyl) amino]-the 2-oxoethyl } carbamic acid tertiary butyl ester (39-42);

3-methyl-9-phenyl-8-(4-{1-[(pyridin-3-yl acetyl group) amino] cyclopropyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (39-43);

N-{1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] cyclopropyl }-2-(4-oxo quinazoline-3 (4H)-yl) acetamide (39-45);

N-{ (1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl }-2-pyridin-3-yl acetamide (39-47);

N-{ (1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } acetamide (39-48);

N-{1-methyl isophthalic acid-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } acetamide (39-50); With

N-{1-methyl isophthalic acid-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } acetamide (39-51);

Or its officinal salt or stereoisomer.

The compounds of this invention can have asymmetric center, chiral axis and chirality face (referring to E.L.Eliel and S.H.Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, the 1119-1190 page), with racemic modification, racemic mixture and with the form of single diastereomer, exist, together with all possible isomer and composition thereof, comprise optical isomer, all these stereoisomers all comprise in the present invention.

In addition, the form that compound disclosed herein can tautomer exists, although only described a kind of tautomeric structure, two kinds of forms of tautomer all comprise within the scope of the invention.For example, following form place is within the scope of the invention:

Tetrazolium exists with the form of 1H/2H tautomers mixture.The change form of tetrazolium part also within the scope of the invention.

Any variable (R for example ²Deng) number of times that occurs in any composition is while surpassing one time, definition when definition when it occurs at every turn all is independent of other each time and occurs.This combination also allows the combination of substituent group and variable, as long as can produce stable compound.Drawn into the lines in ring system and meaned by substituent group, represented key can be connected with any commutable annular atoms.If ring system is dicyclo, refer to that this key is connected with any suitable atom on any ring in dicyclo.

Much less those skilled in the art can be incorporated into one or more silicon (Si) atom in compound of the present invention and replace one or more carbon atoms, so that chemically stable compound to be provided, and by technology known in the art, can be by holding easily synthetic this compound of facile raw material.When C-element like comparing class during with Si-element key the covalent radius of carbon and silicon different to cause bond distance and space multistory to be arranged different, these difference cause when with carbon ratio than the time silicon-containing compound the trickle change of size and shape.The difference that it will be appreciated by those skilled in the art that size and shape can cause in effect, dissolubility, the active trickle or significant (Diass of change that lacks, packs the aspects such as character departs from objectives, J.O. etc., Organometallics (2006) 5:1188-1198; Showell, G.A. etc., Bioorganic & Medicinal Chemistry Letters (2006) 16:2555-2558).

Much less those skilled in the art can select substituent group and the replacement mode of the compounds of this invention, so that chemically stable compound to be provided, and by technology known in the art and following method, can be by holding facile raw material synthetic this compound easily.If substituent group self is replaced by a more than group, think that these a plurality of groups can be on identical or different carbon as long as produce rock-steady structure.Phrase " is optionally replaced by one or more substituent groups " and is interpreted as being equivalent to " optionally being replaced by least one substituent group ", and has in preferred embodiments 0-4 substituent group, has in a more preferred embodiment 0-3 substituent group.

" alkyl " used herein refers to the radical of saturated aliphatic hydrocarbyl group that contains the regulation carbon number that comprises side chain and straight chain.For example, " C ₁-C ₁₀Alkyl " in C ₁-C ₁₀Refer to and comprise the group that contains 1,2,3,4,5,6,7,8,9 or 10 carbon atom with the straight or branched arrangement.For example, " C ₁-C ₁₀Alkyl " specifically comprise methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, the tert-butyl group, isobutyl group, amyl group, hexyl, heptyl, octyl group, nonyl, decyl etc.

Term " cycloalkyl " refers to the monocycle radical of saturated aliphatic hydrocarbyl group that contains the regulation carbon number.For example, " cycloalkyl " comprises cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl-cyclobutyl, 2-ethyl-cyclopenta, cyclohexyl etc.

" alkoxyl " means the cyclic alkyl of indicating carbon number or the non-annularity alkyl that connect by oxo bridge.Therefore, " alkoxyl " comprises the definition of abovementioned alkyl and cycloalkyl.

If the number of carbon atom is not described, the non-aromatic alkyl of straight chain, side chain or ring-type that term " thiazolinyl " refers to contain 2-10 carbon atom and at least 1 carbon-carbon double bond.Preferably there is 1 carbon-carbon double bond, and may have 4 non-aromatic carbon-carbon double bonds at the most.Therefore, " C ₂-C ₁₀Thiazolinyl " refer to the thiazolinyl that contains 2-10 carbon atom.Thiazolinyl comprises vinyl, acrylic, cyclobutenyl, 2-methyl butene base and cyclohexenyl group.The straight chain of thiazolinyl, side chain or annulus can comprise two keys, and if explanation be substituted alkenyl can be substituted.

Term " alkynyl " refers to the alkyl of the straight chain, side chain or the ring-type that contain 2-10 carbon atom and at least 1 carbon carbon ginseng key.May there be three carbon carbon ginseng keys at the most.Therefore, " C ₂-C ₁₀Alkynyl " refer to the alkynyl that contains 2-10 carbon atom.Alkynyl comprises acetenyl, propinyl, butynyl, 3-methyl butynyl etc.The straight chain of alkynyl, side chain or annulus can comprise carbon carbon ginseng key, and if explanation be substituted alkynyl can be substituted.

In some cases, the available scope definition substituent group that comprises zero carbon, for example (C ₀-C ₆) alkylidene-aryl.If aryl refers to phenyl, this definition can comprise phenyl itself and-CH ₂Ph ,-CH ₂CH ₂Ph, CH (CH ₃) CH ₂CH (CH ₃) Ph etc.

" aryl " used herein refers in its each ring any stable monocycle carbocyclic ring or the bicyclic carbocyclic of 7 atoms at the most, and wherein at least one ring is aromatic ring.The example of this type of aryl comprises phenyl, naphthyl, tetrahydrochysene-naphthyl, indanyl and xenyl.In the situation that aryl substituent is that dicyclo and a ring are non-aromatic ring, be commonly considered as connecting by aromatic ring.

Term heteroaryl used herein represents stable monocycle or bicyclo-, in each ring, has maximum 7 atoms, and wherein at least one ring is aromatic ring and contains 1-4 hetero atom that is selected from O, N and S.Heteroaryl in this range of definition includes but not limited to: acridinyl, carbazyl, cinnolines base, quinoxalinyl, pyrazolyl, indyl, benzotriazole base, furyl, thienyl, benzothienyl, benzofuranyl, quinolyl, isoquinolyl, Azoles base, different

Azoles base, indyl, pyrazinyl, pyridazinyl, pyridine radicals, pyrimidine radicals, pyrrole radicals, tetrahydroquinoline.Definition as following heterocycle, it is also understood that " heteroaryl " comprises the N-oxide derivative of any heteroaryl that contains nitrogen.When the heteroaryl substituent group is bicyclo-, and ring is non-aromatic or during containing hetero atom, should be appreciated that connection is respectively via aromatic ring or contains heteroatomic ring.For substituent group Q, such heteroaryl moieties includes but not limited to: 2-benzimidazolyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 1-isoquinolyl, 3-isoquinolyl and 4-isoquinolyl.

Term used herein " heterocycle " or " heterocyclic radical " refer to and contain 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, also comprise bicyclic radicals.Therefore, " heterocyclic radical " comprises above-mentioned heteroaryl, with and dihydro analog and tetrahydrochysene analog.Other example of " heterocyclic radical " includes but not limited to following radicals: benzimidazolyl, benzimidazole ketone group, benzofuranyl, benzofuraxan base, benzopyrazoles base, benzotriazole base, benzothienyl, benzo

Azoles base, carbazyl, carbolinyl, cinnolines base, furyl, imidazole radicals, indolinyl, indyl, indolizine base (indolazinyl), indazolyl, isobenzofuran-base, isoindolyl, isoquinolyl, isothiazolyl, different

Azoles base, naphthopyridine base (naphthpyridinyl),

Di azoly,

The azoles base,

Azoles quinoline, different

Azoles quinoline, oxetanyl, pyranose, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridine base, pyridazinyl, pyridine radicals, pyrimidine radicals, pyrrole radicals, quinazolyl, quinolyl, quinoxalinyl, THP trtrahydropyranyl, tetrazole radical, tetrazolo pyridine radicals, thiadiazolyl group, thiazolyl, thienyl, triazolyl, azetidinyl, Isosorbide-5-Nitrae-dioxane base, six hydrogen azepines

Base, piperazinyl, piperidyl, pyridin-2-ones base, pyrrolidinyl, morpholinyl, thio-morpholinyl, dihydrobenzo imidazole radicals, dihydro benzo furyl, dihydrobenzo thienyl, dihydrobenzo

Azoles base, dihydrofuran base, glyoxalidine base, indolinyl, dihydro are different

Azoles base, dihydro isothiazolyl, dihydro

Di azoly, dihydro

Azoles base, dihydro pyrazinyl, pyrazoline base, dihydropyridine base, dihydro-pyrimidin base, pyrrolin base, dihydroquinoline base, dihydro tetrazole radical, thiodiazoline base, dihydro-thiazolyl, dihydro-thiophene base, dihydro triazolyl, dihydro azetidinyl, methylene-dioxy benzoyl, tetrahydrofuran base and tetrahydro-thienyl, and their N-oxide.The heterocyclic radical substituent group can connect by carbon atom or hetero atom.

Known in the art technology people, " halogen " used herein or " halogen " comprise chlorine (Cl), fluorine (F), bromine (Br) and iodine (I).

In the embodiment of formula A, B, C or D, the part illustrated by following formula:

Comprise following structure, these structures are only exemplary and nonrestrictive:

In another embodiment of formula A, B, C or D, the part illustrated by following formula:

For:

In one embodiment, ring Z is selected from: phenyl and heterocyclic radical.

In another embodiment, ring Z is selected from:

In another embodiment, ring Z is phenyl.

In one embodiment, p is 0,1,2 or 3 independently.

In another embodiment, p is 0,1 or 2 independently.

In another embodiment, p is 1 independently.

In one embodiment, r is 0,1,2 or 3.

In another embodiment, r is 0,1 or 2.

In another embodiment, r is 1.

In one embodiment, Q is selected from: benzimidazolyl, benzimidazole ketone group, benzofuranyl, benzofuraxan base, benzopyrazoles base, benzotriazole base, benzothienyl, benzo

Azoles base, carbazyl, carbolinyl, cinnolines base, furyl, imidazole radicals, indolinyl, indyl, indolizine base, indazolyl, isobenzofuran-base, isoindolyl, isoquinolyl, isothiazolyl, different Azoles base, naphthopyridine base,

Di azoly,

The azoles base,

Azoles quinoline, different Azoles quinoline, oxetanyl, pyranose, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridine base, pyridazinyl, pyridine radicals, pyrimidine radicals, pyrrole radicals, quinazolyl, quinolyl, quinoxalinyl, THP trtrahydropyranyl, tetrazole radical, tetrazolo pyridine radicals, thiadiazolyl group, thiazolyl, thienyl, triazolyl, azetidinyl, Isosorbide-5-Nitrae-dioxane base, six hydrogen azepines

Azoles base, dihydro isothiazolyl, dihydro

Di azoly, dihydro

Azoles base, dihydro pyrazinyl, pyrazoline base, dihydropyridine base, dihydro-pyrimidin base, pyrrolin base, dihydroquinoline base, dihydro tetrazole radical, thiodiazoline base, dihydro-thiazolyl, dihydro-thiophene base, dihydro triazolyl, dihydro azetidinyl, methylene-dioxy benzoyl, tetrahydrofuran base and tetrahydro-thienyl; and their N-oxide, optionally by 1-3, be selected from R ^6aSubstituent group replace.The heterocyclic radical substituent group can connect by carbon atom or hetero atom.

In another embodiment, Q is selected from the 2-azepine

Ketone, benzimidazolyl, benzimidazole ketone group, 2-diaza

Ketone, imidazole radicals, 2-imidazolidinone, indyl, isoquinolyl, morpholinyl, piperidyl, piperazinyl, pyridine radicals, pyrrolidinyl, 2-piperidones, 2-pyrimidone, 2-Pyrrolidone, quinolyl, tetrazole radical, tetrahydrofuran base, tetrahydro isoquinolyl and thienyl, optionally be selected from R by 1-3 ^6aSubstituent group replace.The heterocyclic radical substituent group can connect by carbon atom or hetero atom.

In another embodiment, when Q is heterocyclic radical, Q is selected from:

It optionally is selected from R by 1-3 ^6aSubstituent group replace.

In another embodiment, when Q is heterocyclic radical, Q is selected from:

With

It optionally is selected from R by one ^6aSubstituent group replace.

In one embodiment, R ¹Be selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) ₂NR ⁷R ⁸, SH, S (O) ₂-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by R ^6aReplace.

In another embodiment, R ¹Be selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, CO ₂H, halogen, OH, CN, (C ₁-C ₆) alkoxyl, S (O) ₂NR ⁷R ⁸, SH, S (O) ₂-(C ₁-C ₁₀) alkyl, O (C=O) (C ₁-C ₆) alkyl and N (R ^b) ₂, described alkyl is optionally by R ^6aReplace.

In another embodiment, R ¹Be selected from: oxo, NH ₂, OH, SH, O _a(C ₁-C ₆) alkyl, described alkyl is optionally by R ^6aReplace.

In one embodiment, R ¹Be selected from: H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) ₂NR ⁷R ⁸, SH, S (O) ₂-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by R ^6aReplace.

In another embodiment, R ¹Be selected from: H, oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, CO ₂H, halogen, OH, CN, (C ₁-C ₆) alkoxyl, S (O) ₂NR ⁷R ⁸, SH, S (O) ₂-(C ₁-C ₁₀) alkyl, O (C=O) (C ₁-C ₆) alkyl and N (R ^b) ₂, described alkyl is optionally by R ^6aReplace.

In another embodiment, R ¹Be selected from: H, oxo, NH ₂, OH, SH, O _a(C ₁-C ₆) alkyl, described alkyl is optionally by R ^6aReplace.

In one embodiment, R ²Be selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-aryl, (C=O) _aO _b(C ₂-C ₁₀) thiazolinyl, (C=O) _aO _b(C ₂-C ₁₀) alkynyl, CO ₂H, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) ₂NR ⁷R ⁸, S (O) ₂-(C ₁-C ₁₀) alkyl and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by R ^b, OH, (C ₁-C ₆) alkoxyl, halogen, CO ₂H, CN, O (C=O) (C ₁-C ₆) alkyl, oxo and N (R ^b) ₂Replace.

In another embodiment, R ²Be selected from: oxo, (C=O) _aO _b(C ₁-C ₁₀) alkyl, CO ₂H, halogen, OH, CN, (C ₁-C ₆) alkoxyl, O (C=O) (C ₁-C ₆) alkyl, (C ₂-C ₁₀) thiazolinyl and N (R ^b) ₂, described alkyl is optionally by R ^b, OH, (C ₁-C ₆) alkoxyl, halogen, CO ₂H, CN, O (C=O) (C ₁-C ₆) alkyl, oxo and N (R ^b) ₂Replace.

In one embodiment, R ³Be selected from: H, oxo, O _b(C ₁-C ₁₀) alkyl, O _b-aryl, O _b(C ₂-C ₁₀) thiazolinyl, O _b(C ₂-C ₁₀) alkynyl, halogen, OH, O _b(C ₁-C ₆) perfluoroalkyl, (C=O) _aNR ⁷R ⁸, CN, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace.

In another embodiment, R ³Be selected from: (C ₁-C ₁₀) alkyl, aryl, (C ₂-C ₁₀) thiazolinyl, (C ₂-C ₁₀) alkynyl, halogen, NR ⁷R ⁸, CN, (C ₃-C ₈) cycloalkyl, S (O) _mNR ⁷R ⁸, SH, S (O) _m-(C ₁-C ₁₀) alkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, aryl, thiazolinyl, alkynyl, cycloalkyl and heterocyclic radical are optionally by one or more R that are selected from ⁶Substituent group replace.

In another embodiment, R ³Be selected from: (C ₁-C ₁₀) alkyl, described alkyl optionally is selected from NH by 1-3 ₂, OH, oxo and halogen substituent group replace.

In another embodiment, R ⁴And R ⁵For H.

In one embodiment, as Q by R ^6aDuring replacement, described R ^6aBe heterocyclic radical, this heterocyclic radical optionally is selected from R by maximum three ^b, OH, (C ₁-C ₆) alkoxyl, halogen, CO ₂H, CN, O _a(C=O) _b(C ₁-C ₆) alkyl, oxo and N (R ^b) ₂Substituent group replace.

In another embodiment, as Q by R ^6aDuring replacement, described R ^6aBe selected from:

It optionally is selected from oxo, OH, N (R by 1-3 ^b) ₂, halogen and O _a(C ₁-C ₆) substituent group of alkyl replaces.

In one embodiment, R ^bIndependently selected from H and (C ₁-C ₆) alkyl.

In the embodiment of formula J, R ⁴And R ⁵Be independently: H and CH ₃, or R ⁴And R ⁵Can be connected to form cyclopropyl.

The free form of formula A compound with and officinal salt and stereoisomer comprise in the present invention.The protonated salt that the particular compound of separation more cited herein is amines.Term " free form " refers to the amines of salt-independent shape.The officinal salt comprised not only comprise for illustrate particular compound described herein through isolated salt, and comprise all typical officinal salt of formula A compound free form.Available technical point known in the art is from the free form of described concrete salt compound.For example, with suitable dilute alkaline aqueous solution, for example rare NaOH, potassium carbonate, ammonia and sodium bicarbonate aqueous solution, process salt and make described free form regeneration.Free form can be slightly different on some physical property from their salt forms separately, the dissolubility in polar solvent for example, but for the present invention, hydrochlorate and alkali salt and their free forms separately pharmaceutically are equal to.

Can, by conventional chemical method, by the compounds of this invention that contains basic moiety or acidic moiety, synthesize the officinal salt of the compounds of this invention.Usually, or prepare by ion exchange chromatography, or in suitable solvent or various mixed solvent, make free alkali and stoichiometric or excessive required salify mineral acid or organic acid reaction, prepare the salt of alkali compounds.Equally, by the inorganic base with suitable or organic base, react, form the salt of acid compound.

Therefore, the officinal salt of the compounds of this invention comprises the nontoxic salts of the compounds of this invention routine, this salt is by preparing alkaline the compounds of this invention and mineral acid or organic acid reaction, for example, conventional nontoxic salts comprises the salt derived from mineral acid, described mineral acid is hydrochloric acid for example, hydrobromic acid, sulphuric acid, sulfamic acid, phosphoric acid, nitric acid etc., and the salt prepared by organic acid, described organic acid is acetic acid for example, propanoic acid, succinic acid, glycolic, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pamoic acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, sulfanilic acid, 2-acetoxyl group-benzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethionic acid, oxalic acid, isethionic acid, trifluoroacetic acid (TFA) etc.

When the compounds of this invention is acidity, suitable " officinal salt " refers to the salt prepared from pharmaceutically acceptable nontoxic alkali (comprising inorganic base and organic base).Salt derived from inorganic base comprises aluminum salt, ammonium salt, calcium salt, mantoquita, iron salt, ferrous salt, lithium salts, magnesium salt, manganous salt, manganese salt, potassium salt, sodium salt, zinc salt etc.Particularly preferred is ammonium salt, calcium salt, magnesium salt, potassium salt and sodium salt.The salt that comprises following material derived from the salt of pharmaceutically acceptable organic nontoxic alkali: primary amine, secondary amine and tertiary amine; Replace amine, comprise naturally occurring replacement amine, cyclammonium and deacidite, for example arginine, betanin, caffeine, choline, N, N ¹-dibenzyl-ethylenediamin, diethylamine, 2-diethylaminoethanol, DMAE, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glycosamine (glucamine), glucosamine (glucosamine), histidine, sea bar amine (hydrabamine), 2-aminopropane., lysine, methylglucosamine, morpholine, piperazine, piperidines, polyamino resin, procaine, purines, theobromine, triethylamine, trimethylamine, tripropyl amine (TPA), trometamol etc.

The preparation of above-mentioned officinal salt and other typical officinal salt is at Berg etc., and " Pharmaceutical Salts, " J.Pharm.Sci., have more detailed description in 1977:66:1-19.

It is also noted that, the compounds of this invention may be inner salt or amphion, because under physiological condition, in compound for example the deprotonation acidic moiety of carboxyl can be anion, this electron charge then can by protonated alkalescence part or alkylation basic moiety for example the cationic charge of quaternary nitrogen atoms in internal balance, fall.

Purposes

The compounds of this invention is the inhibitor of Akt activity, therefore is used for the treatment of cancer, the particularly treatment cancer relevant with the active disorder of Akt and Akt downstream cellular targets.These cancers include but not limited to ovarian cancer, cancer of pancreas, breast carcinoma and carcinoma of prostate, and the cancer (comprising glioblastoma) that tumor inhibitor PTEN undergos mutation therein (Cheng etc., Proc.Natl.Acad.Sci. (1992) 89:9267-9271; Cheng etc., Proc.Natl.Acad.Sci. (1996) 93:3636-3641; Bellacosa etc., Int.J.Cancer (1995) 64:280-285; Nakatani etc., J.Biol.Chem. (1999) 274:21528-21532; Graff, Expert.Opin.Ther.Targets (2002) 6 (1): 103-113; And Yamada and Araki, J.Cell Science. (2001) 114:2375-2382; Mischel and Cloughesy, Brain Pathol. (2003) 13 (1): 52-61).

Compound provided in this article, compositions and method, be regarded as being used in particular for treating cancer.Can include but not limited to by the cancer of the compounds of this invention, compositions and method treatment: The heart Dirty: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell cancer, undifferentiated small cell carcinoma, do not break up large cell carcinoma, adenocarcinoma), alveolar (bronchioles) cancer, bronchial adenoma, sarcoma, lymphoma, cartilage hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell carcinoma, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (cancer, lymphoma, leiomyosarcoma), pancreas (duct adenocarcinoma, insulinoma, glucagonoma, gastrinoma, carcinoid tumor, vasoactive intestinal polypeptide tumor), small intestinal (adenocarcinoma, lymphoma, carcinoid tumor, Kaposi sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large intestine (adenocarcinoma, canalicular adenoma, villous adenoma, hamartoma, leiomyoma), colon, colorectum, rectum; Urogenital tract: kidney (adenocarcinoma, wilms' tumor [embryoma of kidney], lymphoma, leukemia), bladder and urethra (squamous cell carcinoma, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (spermocytoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, Interstitial cell cancer, fibroma, fibroadenoma, adenomatoid tumor, lipoma); Liver: hepatoma (hepatocarcinoma), cancer of biliary duct, hepatoblastoma, angiosarcoma, hepatic cell adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrohistiocytoma, chondrosarcoma, Ewing's sarcoma, malignant lymphoma (reticulosarcoma), multiple myeloma, pernicious giant cell tumor chordoma, osteochondroma (osteocartilaginous exostosis), optimum chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma and giant cell tumor; Nervous system: head (osteoma, hemangioma, granuloma, vitiligoidea, osteitis deformans), meninges (meningioma, meningosarcoma, neurogliosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], glioblastoma multiforme, oligodendroglioma, schwannoma, retinoblastoma, congenital tumor), intraspinal cord neurinomas, meningioma, glioma, sarcoma); Gynecological: uterus (carcinoma of endometrium), cervix uteri (cervix uteri abnormal development before cervical cancer, tumor), ovary (ovarian cancer [serous cystadenocarcinoma, mucous cystoadenocarcinoma, unfiled cancer], granulosa cell tumor, Sai-Lai glucagonoma, dysgerminoma, malignant teratoma), vaginal orifice (squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell carcinoma, Fructus Vitis viniferae bunch sample sarcoma (embryonal rhabdomyosarcoma), fallopian tube (cancer); The hematology: blood (myelogenous leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative disease, multiple myeloma, myelodysplastic syndrome), Hodgkin, non-Hodgkin′s lymphomas [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell carcinoma, Kaposi sarcoma, mole dysplastic nevus, lipoma, hemangioma, dermatofibroma, keloid, psoriasis; With The adrenal gland: neuroblastoma.Therefore, term described herein " cancerous cell " comprises the cell that is subject to any torment in above-mentioned the assert patient's condition.

The cancer that can be treated by the compounds of this invention, compositions and method includes but not limited to: breast carcinoma, carcinoma of prostate, colon cancer, colorectal carcinoma, pulmonary carcinoma, the brain cancer, carcinoma of testis, gastric cancer, cancer of pancreas, skin carcinoma, carcinoma of small intestine, colorectal cancer, laryngeal carcinoma, head and neck cancer, oral cancer, osteocarcinoma, hepatocarcinoma, bladder cancer, renal carcinoma, thyroid carcinoma and leukemia.

The cancer that can be treated by the compounds of this invention, compositions and method includes but not limited to: breast carcinoma, carcinoma of prostate, colon cancer, ovarian cancer, colorectal carcinoma and pulmonary carcinoma.

The cancer that can be treated by the compounds of this invention, compositions and method includes but not limited to: breast carcinoma, colon cancer, (colorectal carcinoma) and pulmonary carcinoma.

The cancer that can be treated by the compounds of this invention, compositions and method includes but not limited to: lymphoma and leukemia.

A plurality of committed steps in Akt Signal Regulation angiogenesis (Shiojima and Walsh, Circ.Res. (2002) 90:1243-1250).Angiogenesis inhibitor in treatment in cancer to be applied in documents and materials on the books, referring to such as J.Rak etc., Cancer Research, 55:4575-4580,1995 and Dredge etc., Expert Opin.Biol.Ther. (2002) 2 (8): 953-966.The effect of angiogenesis in cancer obtained showing in following kinds cancer and organization type: breast carcinoma (G.Gasparini and A.L.Harris, J.Clin.Oncol., 1995,13:765-782; M.Toi etc., Japan.J.Cancer Res., 1994,85:1045-1049); Bladder cancer (A.J.Dickinson etc., Br.J.Urol., 1994,74:762-766); Colon cancer (L.M.Ellis etc., Surgery, 1996,120 (5): 871-878) and mouth neoplasm (J.K.Williams etc., Am.J.Surg., 1994,168:373-380).Other cancer comprises late tumor, hairy cell leukemia, melanoma, late period head and neck cancer, metastatic renal cell cancer, the non-Hodgkin′s lymphomas, the transitivity breast carcinoma, breast carcinoma, late period melanoma, cancer of pancreas, gastric cancer, glioblastoma, pulmonary carcinoma, ovarian cancer, nonsmall-cell lung cancer, carcinoma of prostate, small cell lung cancer, renal cell carcinoma, various solid tumors, multiple myeloma, metastatic prostate cancer, glioblastoma, renal carcinoma, lymphoma, the intractable metastatic disease, the intractable multiple myeloma, cervical cancer, Kaposi sarcoma, become glioma and transitivity colon cancer (Dredge etc. between recurrent, Expert Opin.Biol.Ther. (2002) 2 (8): 953-966).Thus, the disclosed Akt inhibitor of the application also can be used for the treatment of the cancer that these angiogenesis are relevant.

The tumor that has experienced neovascularization shows the metastatic potential raise.In fact, angiogenesis is vital (S.P.Cunningham etc., Can.Research, 61:3206-3211 (2001)) to growth and metastasis of tumours.Therefore, disclosed Akt inhibitor also can be for the transfer of prevention or reduction tumor cell in this application.

What also be included in the scope of the invention is the method that treatment or prevention relate to the disease of angiogenesis, and the method comprises to the compounds of this invention of the mammal drug treatment effective dose of the described treatment of needs.Eye neovascularization disease is an example (announcing on June 2nd, 00/30651,2000 referring to WO) of the symptom of the wherein most tissues infringement abnormal infiltration that can be attributed to the ophthalmic blood vessel.The infiltration of not expecting can be caused by ischemic retinopathy (such as by diabetic retinopathy, prematureness retinopathy, retinal vein occlusion etc.) or degenerative disease (such as the Choroid neovascularization of observing in age related macular degeneration).Therefore, can prevent vessel invasion by giving the compounds of this invention to the inhibitory action of angiogenic growth, and can prevent or treat the disease that relates to angiogenesis, such as Retinal neovascularization, diabetic retinopathy, age related macular degeneration etc.

Also comprise within the scope of the present invention be the method for nonmalignant disease that treatment or prevention relate to angiogenesis, described disease includes but not limited to: (Dredge etc., Expert Opin.Biol.Ther. (2002) 2 (8): 953-966) for ophthalmic (such as Retinal neovascularization, diabetic retinopathy and age related macular degeneration), atherosclerosis, arthritis, psoriasis, obesity and Alzheimer.In another embodiment, the method for disease that treatment or prevention relate to angiogenesis comprises: ophthalmic (for example Retinal neovascularization, diabetic retinopathy and age related macular degeneration), atherosclerosis, arthritis and psoriasis.

Also comprise within the scope of the present invention be the method for overmedication proliferative disorders, for example restenosis, inflammation, autoimmune disease and allergy/asthma.

What also be included in the scope of the present invention is the purposes of the compounds of this invention for drug delivery medical device, and the compounds of this invention is used for the treatment of and/or the purposes (WO 03/032809) of prevention of restenosis on coated support thus.

What also be included in the scope of the present invention is the purposes (WO 03/035048) that the compounds of this invention is used for the treatment of and/or prevents osteoarthritis.

Also comprise within the scope of the present invention be the treatment hyperinsulinemia method.

The compounds of this invention can also be for the preparation of the medicine that is used for the treatment of above-mentioned disease (particularly cancer).

In one embodiment of the present invention, the compounds of this invention is selective depressant, and it suppresses effect and depends on the PH domain.In this embodiment, described compound shows as the vitro inhibition activity decreased to the truncate Akt albumen that lacks the PH domain or without the vitro inhibition activity.

In another embodiment, the compounds of this invention is selected from the selective depressant of Akt1, the selective depressant of Akt2 and the selective depressant of Akt1 and Akt2.

In another embodiment, the compounds of this invention is selected from the selective depressant of two kinds of Akt in the selective depressant of selective depressant, Akt3 of selective depressant, the Akt2 of Akt1 and above-mentioned three kinds of Akt isozymes.

In another embodiment, the selective depressant that the compounds of this invention is all three kinds of Akt isotypes, but be not through disappearance PH domain, disappearance hinge region or not only lacked the PH domain but also lacked both a kind, 2 kinds or inhibitor of all these Akt isotypes after modifying of hinge region.

The invention still further relates to the method that suppresses the Akt activity, the method comprises the compounds of this invention that the mammal of needs pharmacy effective dose is arranged.

The compounds of this invention also can be put into practice according to standard drug, to the mammal administration that comprises the people, or individually dosed, or, with the form of pharmaceutical composition, wherein is added with pharmaceutically suitable carrier, excipient or diluent.This compound can be taken orally or parenteral, comprises intravenous, intramuscular, intraperitoneal, subcutaneous, internal rectum and the route of administration such as local.

The pharmaceutical composition that contains active component can be the oral form that is suitable for, for example, and tablet, dragee, lozenge, aqueous suspension or oiliness suspensoid, dispersion powder or granule, Emulsion, hard rubber wafer or soft balsam wafer, syrup or elixir.Can be according to the method preparation of any pharmaceutical compositions known in the art for oral compositions, these compositionss can comprise one or more be selected from sweeting agent, correctives, coloring agent and antiseptic become to be grouped into, so that agreeable to the taste pharmaceutical preparation attractive in appearance to be provided.Tablet comprises the active component with nontoxic pharmaceutically acceptable mixed with excipients, and this excipient is suitable for the preparation of tablet.These excipient can be for example inert diluent, for example calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; Granulation agent and disintegrating agent, for example microcrystalline Cellulose, cross-linking sodium carboxymethyl cellulose, corn starch or alginic acid; Binding agent, for example starch, gelatin, polyvinylpyrrolidone or Radix Acaciae senegalis; And lubricant, for example magnesium stearate, stearic acid or Pulvis Talci.Tablet is coating not, or available known technology coating to be to cover the uncomfortable taste of medicine, or postpones disintegrate and absorption in gastrointestinal tract, thereby continuous action is provided in a long time.For example, can use the water solublity taste to cover up material, for example hydroxypropyl emthylcellulose or hydroxypropyl cellulose, or, can use time delay material for example ethyl cellulose, acetylbutyrylcellulose.

Oral formulations also can be hard-gelatin capsules, and wherein active component mixes with inert solid diluent such as calcium carbonate, calcium phosphate or Kaolin; Be perhaps Gelseal, wherein active component mixes with water dissolvable carriers such as Polyethylene Glycol, or mixes with Oleum Arachidis hypogaeae semen, liquid paraffin or Fructus Canarii albi wet goods oil medium.

Aqueous suspension contains the active material with the mixed with excipients that is suitable for preparing aqueous suspension.Described excipient is suspending agent, dispersant or wetting agent, and suspending agent is Sodium Tvlose, methylcellulose, hydroxypropyl emthylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and Radix Acaciae senegalis for example; Dispersant or wetting agent can be natural phospholipid, lecithin for example, or the condensation product of alkylene oxide and fatty acid, Myrj 45 for example, or the condensation product of oxirane and long-chain fatty alcohol, 17 ethyleneoxy group hexadecanol for example, or the condensation product of oxirane and fatty acid and the derivative partial ester of hexitol, polyoxyethylene 80 sorbitan monooleate for example, or the condensation product of oxirane and fatty acid and the derivative partial ester of hexitan, for example polyoxyethylene sorbitan monooleate dehydration.Aqueous suspension can also comprise one or more antiseptic (for example ethylparaben or P-hydroxybenzoic acid n-propyl), one or more coloring agent, one or more correctivess and one or more sweeting agents (for example sucrose, glucide or aspartame).

The oiliness suspensoid can for example, for example, by being suspended in active component preparation in vegetable oil (Oleum Arachidis hypogaeae semen, olive oil, Oleum sesami or Oleum Cocois) or mineral oil (liquid paraffin).Described oiliness suspensoid can comprise thickening agent, for example Cera Flava, hard paraffin or spermol.Can also add wherein such as sweeting agent as above and correctives so that agreeable to the taste oral formulations to be provided.These compositionss can for example, be preserved by adding antioxidant (butylated hydroxyanisole or alpha-tocopherol).

By in the dispersion powder to being suitable for preparing aqueous suspension and granule, adding water, so that the mixture of active component and dispersant or wetting agent, suspending agent and one or more antiseptic to be provided.Suitable dispersant or wetting agent and suspending agent are as above-mentioned illustrations.Wherein also can there is other excipient, for example sweeting agent, correctives and coloring agent.These compositionss can for example, be preserved by adding antioxidant (ascorbic acid).

Pharmaceutical composition of the present invention can also be the form of oil in water emulsion.Described oil phase can be vegetable oil (for example olive oil or Oleum Arachidis hypogaeae semen), mineral oil (for example liquid paraffin) or its mixture.Suitable emulsifying agent can be naturally occurring phospholipid, for example soybean lecithin, for example also can be, from fatty acid and derivative ester or the partial ester of hexitan, dehydrated sorbitol mono-fatty acid ester, for example, with the condensation product of described partial ester and oxirane, polyoxyethylene sorbitan monooleate dehydration.Described Emulsion also can comprise sweeting agent, correctives, antiseptic and antioxidant.

Syrup and elixir can utilize sweeting agent to be prepared, for example glycerol, propylene glycol, sorbitol or sucrose.Described preparation also can comprise demulcent, antiseptic, correctives and coloring agent, and antioxidant.

Described pharmaceutical composition can be the form of aseptic injection aqueous pharmaceutical.Operable acceptable carrier and solvent comprise water, Ringer's mixture and isotonic sodium chlorrde solution.

Described aseptic injection preparation can also be the aseptic injection oil-in-water microemulsion, and wherein active component is dissolved in oil phase.For example, can at first active component be dissolved in the mixture of soybean oil and lecithin.Then, oily solution is mixed in the mixture of water and glycerol, thereby preparation forms microemulsion.

Described injection or injection microemulsion can be incorporated in the patient vessel by local bolus injection.In addition, can also be advantageously to keep mode administration described solution or the microemulsion of the compounds of this invention in constant circulation composition.In order to keep this constant density, can use constant vein drug delivery systems.The example of described device is Deltec CADD-PLUS ^TM5400 type venous pumps.

Described pharmaceutical composition can be for the aseptic injection aqueous suspensoid of intramuscular and subcutaneous administration or oiliness suspensoid.Described suspensoid can, according to technology known in the art, be used above-mentioned suitable dispersant or wetting agent and suspending agent to be prepared.Described aseptic injection preparation can also be aseptic injectable solution agent or suspensoid, wherein contains the acceptable diluent of nontoxic parenteral or solvent, for example the solution of 1,3 butylene glycol.In addition, usually aseptic fixedly oil is used as to solvent or suspension media.For this purpose, the fixedly oil of any brand be can use, synthetic glycerine monoesters or synthetic triglyceride comprised.In addition, can also use fatty acid (such as oleic acid) in the injection preparation.

Formula A compound can also carry out administration for the suppository form of drop rectum with drug.These compositionss can be by being prepared medicine and suitable non-stimulated mixed with excipients, and wherein said excipient is solid at normal temperatures, but under rectal temperature, is liquid, therefore can in rectum, melt the release medicine.This class material comprises Polyethylene Glycol mixture and the cithrol of cocoa butter, glycerol gelatin, hydrogenated vegetable oil, various molecular weight.

Use for part, can use (for the application, local use should comprise collutory and gargarism) such as ointment, ointment, gel, solution or suspensoids of containing formula A compound.

The compounds of this invention can be by the suitable intranasal carrier of topical application and drug delivery systems with the intranasal form administration, and the percutaneous skin patch form percutaneous approach that maybe can know by application those of ordinary skills carries out administration.When the form administration with the percutaneous delivery system, dosed administration will be continuous rather than intermittent certainly in whole dosage regimen.The all right suppository dosing of the compounds of this invention, described suppository is used such as the mixture of the Polyethylene Glycol of cocoa butter, glycerol gelatin, hydrogenated vegetable oil, various molecular weight and the base material of cithrol.

When compositions of the present invention is administered to human subjects, its daily dose will be determined by the prescriber usually, and described dosage usually will be along with the order of severity of the reaction of age, body weight and individual patient and patient's symptom and change.

Utilize the dosage regimen of compound of the present invention to be selected according to various factors, described various factors comprises type, species, age, weight, sex and is treated the type of cancer; The order of severity of cancer to be treated (being the stage); Route of administration; Patient's kidney merit and liver function; And the specific compound or its salt that use.General experienced doctor or veterinary can easily determine and output the prescription of the medicine of effective dose, be used for the treatment of, for example, for prevention, inhibition (completely or partially) or prevention advancing of disease.

For example, compound of the present invention can be up to total daily dose administration of 10,000mg.Compound of the present invention can be administered once (QD) in one day, or is divided into repeatedly medication every day, as twice of every day (BID), and every day three times (TID).Compound of the present invention can be up to 10,000mg, for example, 2,000mg, 3,000mg, 4,000mg, 6,000mg, total daily dose administration of 8,000mg or 10,000mg, described dosage can maybe can be divided into repeatedly medication every day as mentioned above once a day.

For example, compound of the present invention can be up to total daily dose administration of 1,000mg.Compound of the present invention is administered once (QD) in one day, or is divided into repeatedly medication every day, as twice of every day (BID), and every day three times (TID).Compound of the present invention can be up to 1,000mg, for example, 200mg, 300mg, 400mg, 600mg, total daily dose administration of 800mg or 1,000mg, described dosage can maybe can be divided into repeatedly medication every day as mentioned above once a day.

In addition, administration can be continuous (being administration every day) or intermittence.Term used herein " intermittently " or " off and on " refer to rule or irregular spacing and stop and starting.For example, the administration at intermittence of the compounds of this invention can be weekly administration 1-6 days, or it can refer to that cyclical administration (for example administration every day, continuously in 2-8 week, be then the rest period of the not administration of maximum 1 week) or its refer to administration every other day.

In addition, compound of the present invention can continue medication several weeks according to above-described any scheme, is then the rest period.For example, compound of the present invention can continue medication 2-8 week according to above-described arbitrary scheme, is then the rest period of 1 week, or is administered twice every day with 100-500mg dosage, 1 week 3-5 days.In other particular, compound of the present invention can be administered three times every day, continues 2 weeks, is then the rest period of 1 week.

Any or multiple given dose of the compounds of this invention and dosage regimen are also applicable to any or multiple therapeutic agent that will use in therapeutic alliance (hereinafter referred to as " the second therapeutic agent ").

In addition, can further the changing with dosage regimen of the given dose of this second therapeutic agent, and dose,optimum, dosage regimen and route of administration will be that basis is determined according to specific the second therapeutic agent used.

Natural, the route of administration of the route of administration of the compounds of this invention and the second therapeutic agent is irrelevant.In one embodiment, the administration of the compounds of this invention is oral administration.In another embodiment, the administration of the compounds of this invention is intravenous administration.Therefore, according to these embodiments, the administration of the compounds of this invention is oral or intravenous administration, and the administration of the second therapeutic agent can be oral, parenteral, intraperitoneal, intravenous, intra-arterial, transdermal, Sublingual, intramuscular, rectum, per os cheek, intranasal, liposome mode, by suction, vagina, ophthalmic, by conduit or support local delivery, subcutaneous, fat, in intraarticular, sheath or agent for slow releasing type route of administration.

In addition, compound of the present invention and the second therapeutic agent can be by identical form of medication administrations, that is, two kinds of medicines are by for example oral or IV administration.Yet also being in the scope of the invention is by a kind of administering mode compound as of the present invention as oral administration, by another kind of administering mode as IV or at above-described any other administering mode administration the second therapeutic agent.

The first therapeutic process (administration of the compounds of this invention) can carry out before in the second therapeutic process (i.e. the administration of the second therapeutic agent), after the treatment of using the second therapeutic agent, carry out, with the second therapeutic agent, treated simultaneously, or their combination.For example, can determine total course for the treatment of of the compounds of this invention.The second therapeutic agent can administration before starting with compounds for treating of the present invention, or administration after using compounds for treating of the present invention.In addition, anticancer therapy can carry out during the administration of the compounds of this invention, but carries out in during the whole treatment of the compounds of this invention.

Compound of the present invention also can be used for combining with therapeutic agent, chemotherapeutics and anticarcinogen.Compound disclosed by the invention is combined within the scope of the invention with therapeutic agent, chemotherapeutics and anticarcinogen.These medicines can be at the Cancer Principles andPractice of V.T.Devita and S.Hellman (editor) of Oncology, sixth version (February 15,2001), Lippincott Williams & In Wilkins Publishers, find.Those skilled in the art can according to the characteristic of related medicine and cancer distinguish which kind of medication combined will be useful.These medicines comprise following: estrogenic agents, androgen receptor modifier, the retinoid receptor modulators, cytotoxic agent/cytostatics, antiproliferative agents, isopentene group-protein transferase inhibitor, HMG-CoA reductase inhibitor and other angiogenesis inhibitors, the hiv protease inhibitor, reverse transcriptase inhibitors, cell proliferation and survival signal transduction inhibitor, bisphosphonates, aromatase inhibitor, the siRNA therapeutic agent, inhibitors of gamma-secretase, disturb the medicine of receptor tyrosine kinase (RTKs) and the medicine at the interference cell cycle outpost of the tax office.Compound of the present invention is particularly useful when jointly giving with radiotherapy.

" estrogenic agents " is no matter refer to the compound which kind of mechanism to disturb or to suppress estrogen and receptors bind by.The example of estrogenic agents includes but not limited to, tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-1-oxopropoxy-4-methyl-2-[4-[2-(piperidino) ethyoxyl] phenyl]-2H-1-.alpha.-5:6-benzopyran-3-yl)]-phenyl 2,2-dimethyl propylene acid esters, 4,4 '-dihydroxy benaophenonel-2,4-dinitrophenylhydrazone and SH646.

" androgen receptor modifier " is no matter refer to the compound which kind of mechanism to disturb or to suppress androgen and receptors bind by.The example of androgen receptor modifier comprises finasteride and other 5α-reductase inhibitor, nilutamide, flutamide, bicalutamide, liarozole and Abiraterone acetate.

" retinoid receptor modulators " is no matter refer to the compound which kind of mechanism to disturb or to suppress retinoid and receptors bind by.The example of these retinoid receptor modulators comprises bexarotene, tretinoin, the cis-tretinoin of 13-, RETINOIC ACID, alpha-difluoromethyl ornithine, ILX23-7553, trans-N-(4 '-hydroxy phenyl) looks yellow amide and the N-4-carboxyl phenyl is looked yellow amide.

" cytotoxic agent/cytostatics " refers to mainly and causes cell death or suppress cell proliferation by the direct interference cell function, perhaps suppress or the maiotic compound of interference cell, comprise alkylating agent, tumor necrosis factor, intercalator, but hypoxia activated compounds, microtubule inhibitors/microtubule stabilizer, mitotic kinesin inhibitors, histone deacetylase inhibitors, participate in the inhibitors of kinases of mitosis process, participate in the inhibitors of kinases of somatomedin and cytokine signaling approach, antimetabolite, biological response modifier, hormone/hormone antagonist medicine, hemopoietic growth factor, the monoclonal antibody target therapeutic agent, topoisomerase enzyme inhibitor, the albuminous body inhibitor, ubiquitin ligase inhibitor and aurora inhibitors of kinases.

The example of cytotoxic agent/cytostatics includes but not limited to sertenef, cachectin (cachectin), ifosfamide, tasonermin, lonidamine, carboplatin, altretamine, prednimustine, mitolactol, Ranimustine, fotemustine, nedaplatin, oxaliplatin, the temozolomide, Eptaplatin, estramustine, a Tosi acid improsulfan, trofosfamide, nimustine, dibrospidium chloride, pumitepa, lobaplatin, Satraplatin, porfiromycin (profiromycin), cisplatin, Yiluo husband's literary composition, right ifosfamide, cis-amine dichloro (2-methyl-pyridine) closes platinum, the benzyl guanine, glufosfamide, GPX100, tetrachloro (trans, trans, trans)-bis--μ-(hexane-1,6-diamidogen)-μ-[diamidogen-platinum (II)] two [diamidogen (chlorine) platinum (II)], two aziridinyl spermine, arsenic trioxide, 1-(11-dodecyl amino-10-hydroxyl undecyl)-3,7-dimethylxanthine, zorubicin, idarubicin, daunorubicin, bisantrene, mitoxantrone, pirarubicin, pinafide, valrubicin, amrubicin, antineoplaston, 3 '-deaminizating-3 '-morpholino-13-deoxidation generation-10-hydroxyl carminomycin, liposome anthracycline (annamycin), galarubicin, elinafide, MEN10755, 4-demethoxylation-3-deaminizating-3-aziridinyl-4-methyl sulphonyl-daunorubicin (referring to WO 00/50032), Raf inhibitors of kinases (for example Bay43-9006) and mTOR inhibitors (for example CCI-779 of Wyeth company).

But an example of hypoxia activated compounds is tirapazamine.

The example of albuminous body inhibitor includes but not limited to lactacystin and MLN-341 (Velcade).

The example of microtubule inhibitors/microtubule stabilizer comprises paclitaxel, vindesine sulfate, 3 ', 4 '-bis-dehydrogenations-4 '-deoxidation-8 '-navelbine, docetaxel, rhizomycin, dolastatin, according to western sour mivobulin, Ao Litating (auristatin), Cemadotin, RPR109881, BMS184476, vinflunine, depsipeptide class antineoplastic agent (cryptophycin), 2, 3, 4, 5, the fluoro-N-of 6-five (the fluoro-4-methoxyphenyl of 3-) benzsulfamide, F 81097, N, N-dimethyl-L-valyl-L-valyl-N-methyl-L-valyl-L-prolyl-L-PROLINE-t-butyl carboxamide, TDX258, Epothilones is (referring to for example United States Patent (USP) 6, 284, 781 and 6, 288, 237) and BMS188797.In one embodiment, microtubule inhibitors/microtubule stabilizer does not comprise the Macrolide antineoplastic agent.

Some examples of topoisomerase enzyme inhibitor are hycamtin, hycaptamine, irinotecan, rubitecan, 6-ethoxy-c acyl group-3 ', outside 4 '-O--benzal-chartreusin, 9-methoxyl group-N, N-dimethyl-5-nitropyrazole is [3,4,5-kl] acridine-2-(6H) propionic acid amide. also, 1-amino-9-ethyl-5-is fluoro-2,3-dihydro-9-hydroxy-4-methyl-1H, 12H-benzo [de] furo [3 ', 4 ': b, 7]-indolizino [1,2b] quinoline-10,13 (9H, 15H) diketone, lurtotecan, 7-[2-(N-isopropylamino) ethyl]-(20S) camptothecine, BNP1350, BNPI1100, BN80915, BN80942, etoposide phosphate, teniposide, sobuzoxane, 2 '-dimethylamino-2 '-deoxidation-etoposide, GL331, N-[2-(dimethylamino) ethyl]-9-hydroxyl-5,6-dimethyl-6H-pyrido [4,3-b] carbazole-1-Methanamide, asulacrine, (5a, 5aB, 8aa, 9b)-9-[2-[N-[2-(dimethylamino) ethyl]-the N-methylamino] ethyl]-5-[4-hydroxyl-3, the 5-Dimethoxyphenyl]-5, 5a, 6,8,8a, 9-hexahydro furyl also (3 ', 4 ': 6,7) naphtho-(2,3-d)-1,3-dioxole-6-ketone, 2,3-(methylene dioxy base)-5-methyl-7-hydroxyl-8-methoxyl group benzo [c]-phenanthridines

, 6, two [(2-amino-ethyl) amino] benzo [g] isoquinolin-5 of 9-, 10-diketone, 5-(3-aminopropan amino)-7,10-dihydroxy-2-(2-hydroxyethylamino methyl)-6H-pyrazolo [4,5,1-de] acridine-6-ketone, N-[1-[2 (diethylamino) ethylamino]-7-methoxyl group-9-oxo-9H-thioxanthene-4-ylmethyl] Methanamide, N-(2-(dimethylamino) ethyl) acridine-4-carboxamide, 6-[[2-(dimethylamino) ethyl] amino]-3-hydroxyl-7H-indeno [2,1-c] quinoline-7-ketone and dimesna.

The example of mitotic kinesin inhibitors, particularly the example of mankind's mitotic kinesins KSP is described in following PCT publication: WO03/039460, WO03/050064, WO03/050122, WO03/049527, WO03/049679, WO03/049678, WO04/039774, WO03/079973, WO03/099211, WO03/105855, WO03/106417, WO04/037171, WO04/058148, WO04/058700, WO04/126699, WO05/018638, WO05/019206, WO05/019205, WO05/018547, WO05/017190, US2005/0176776.In one embodiment, the inhibitor of mitotic kinesins comprises but is not limited to KSP inhibitor, MKLP1 inhibitor, CENP-E inhibitor, MCAK inhibitor and Rab6-KIFL inhibitor.

The example of " histone deacetylase inhibitors " includes but not limited to SAHA, TSA, oxamflatin, PXD 101, MG98 and scriptaid.Other histone deacetylase inhibitors further related to can be found in in Publication about Document: Miller, the J.Med.Chem.46 such as T.A. (24): 5097-5116 (2003).

" participate in the inhibitors of kinases of mitosis process " and include but not limited to aurora inhibitors of kinases, Polo sample inhibitors of kinases (PLK; PLK-1 inhibitor particularly), bub-1 inhibitor and bub-R1 inhibitor.The example of " aurora inhibitors of kinases " is VX-680.

" antiproliferative agents " comprises antisense rna oligonucleotide and antisense DNA oligonucleotide, such as G3139, ODN698, RVASKRAS, GEM231 and INX3001, also comprise antimetabolite, such as enocitabine, carmofur, ftorafur, pentostatin, doxifluridine, trimetrexate, fludarabine, capecitabine, galocitabine, Cytarabine ocfosfate, amifostine (fosteabine) sodium hydrate, Raltitrexed, paltitrexid, emitefur, thiazole furan quinoline, decitabine, 2-Amino-6-methyl-5-(pyridin-4-ylsulfanyl)-3H-quinazolin-4-one, pemetrexed, Nei Zhala shore (nelzarabine), 2 '-deoxidation-2 '-methylene cytidine, 2 '-fluorine methylene-2 '-deoxycytidine, N-[5-(2,3-dihydro-benzofuranyl) sulfonyl]-N '-(3,4-Dichlorobenzene base) urea, N6-[4-deoxidation-4-[N2-[2 (E), 4 (E)-tetradecane diene acyls] glycyl amino]-L-glyceryl-B-L-mannose group-pyrans heptose base] adenine, Ah pyrrole's profit fourth (aplidine), Ecteinascidin 858 (ecteinascidin), troxacitabine, 4-[2-amino-4-oxo-4,6,7,8-tetrahydrochysene-3H-pyrimido [5,4-b] [Isosorbide-5-Nitrae] thiazine-6-base-(S)-ethyl]-2,5-Thenoyl-Pidolidone, aminopterin, 5-fluorouracil, alanosine, acetic acid 11-acetyl group-8-(carbamyl oxygen ylmethyl)-4-formoxyl-6-methoxyl group-14-oxa--1,11-diaza Fourth Ring (7.4.1.0.0)-14 carbon-2,4,6-triolefin-9-base ester, (-)-Swainsonine (swainsonine), lometrexol, dexrazoxane, methioninase, 2 '-cyano group-2 '-'-deoxy-n 4-palmityl-1-B-D-arabinofuranosyl adenin glycosyl cytosine, Trianpine and trastuzumab.

The example of monoclonal antibody target therapeutic agent comprises that those have cytotoxic agent or the radioisotopic therapeutic agent that connects cancerous cell monoclonal antibody specific or target cell monoclonal antibody specific.The example comprises Bexxar.

" HMG-CoA reductase inhibitor " refers to 3-hydroxy-3-methylglutaric acid list acyl coenzyme A reductase inhibitor.The example of operable HMG-CoA reductase inhibitor includes but not limited to lovastatin (MEVACOR

, referring to United States Patent (USP) 4,231,938,4,294,926 and 4,319,039), simvastatin (ZOCOR

, referring to United States Patent (USP) 4,444,784,4,820,850 and 4,916,239), pravastatin (PRAVACHOL

, referring to United States Patent (USP) 4,346,227,4,537,859,4,410,629,5,030,447 and 5,180,589), fluvastatin (LESCOL

, referring to United States Patent (USP) 5,354,772,4,911,165,4,929,437,5,189,164,5,118,853,5,290,946 and 5,356,896), atorvastatin (LIPITOR

, referring to United States Patent (USP) 5,273,995,4,681,893,5,489,691 and 5,342,952) and cerivastatin (also claim thunder to cut down its spit of fland and BAYCHOL

, referring to United States Patent (USP) 5,177,080).M.Yalpani, " CholesterolLowering Drugs ", Chemistry & Industry, in 85-89 page (on February 5th, 1996) the 87th page, and United States Patent (USP) 4,782, describe these HMG-CoA reductase inhibitors in 084 and 4,885,314 and can be used for the structural formula of the HMG-CoA reductase inhibitor of using method of the present invention with other.Term HMG-CoA reductase inhibitor used herein comprises the form of all pharmaceutically acceptable lactones and open chain acid (being that its lactonic ring is opened the formation free acid), the form that also comprises salt and the ester of the compound with HMG-CoA reductase active, thereby the purposes of this type of salt, ester, open chain acid and lactone form all comprises within the scope of the invention.

" isopentene group-protein transferase inhibitor " refers to the compound of any in inhibition isopentene group-protein transferase or any combination, comprise farnesyl-protein transferase (FPTase), geranyl geranyl protein transferase I type (GGPTase-I) and geranyl geranyl protein transferase II type (GGPTase-II also claims Rab GGPTase).

The example of isopentene group-protein transferase inhibitor can be found in following discloses text and patent: WO 96/30343, WO 97/18813, WO 97/21701, WO 97/23478, WO97/38665, WO 98/28980, WO 98/29119, WO 95/32987, United States Patent (USP) 5,420,245, United States Patent (USP) 5,523,430, United States Patent (USP) 5,532,359, United States Patent (USP) 5,510,510, United States Patent (USP) 5,5 89,485, United States Patent (USP) 5,602,098, European patent publication number 0,618 221, European patent publication numbers 0 675 112, European patent publication numbers 0 604 181, European patent publication numbers 0 696 593, WO 94/19357, WO 95/08542, WO 95/11917, WO 95/12612, WO 95/12572, WO 95/10514, United States Patent (USP) 5,661,152, WO95/10515, WO 95/10516, WO 95/24612, WO 95/34535, WO 95/25086, WO 96/05529, WO 96/06138, WO 96/06193, WO 96/16443, WO96/21701, WO 96/21456, WO 96/22278, WO 96/24611, WO 96/24612, WO 96/05168, WO 96/05169, WO 96/00736, United States Patent (USP) 5,571,792, WO96/17861, WO 96/33159, WO 96/34850, WO 96/34851, WO 96/30017, WO 96/30018, WO 96/30362, WO 96/30363, WO 96/31111, WO96/31477, WO 96/31478, WO 96/31501, WO 97/00252, WO 97/03047, WO 97/03050, WO 97/04785, WO 97/02920, WO 97/17070, WO97/23478, WO 97/26246, WO 97/30053, WO 97/44350, WO 98/02436 and United States Patent (USP) 5,532,359.Isopentene group-protein transferase inhibitor to the example of the effect of angiogenesis referring to European J.of Caner, the 35th volume, the 9th phase, 1394-1401 page (1999 years).

" angiogenesis inhibitor " is no matter refer to the compound which kind of mechanism to suppress neovascularization by.The example of angiogenesis inhibitor includes but not limited to: tyrosine kinase inhibitor (for example tyrosine kinase receptor Flt-1 (VEGFR1) and Flk-1/KDR (VEGFR2) inhibitor), epidermis derivative growth factor inhibitor, fibroblast derivative growth factor inhibitor or platelet derived growth factor inhibitor, MMP (matrix metalloproteinase) inhibitor, the integrin blocker, interferon-' alpha ', IL-12, poly-sulphuric acid pentosan, cyclooxygenase-2 inhibitor (comprises non-steroidal anti-inflammatory agents (NSAIDs), such as aspirin and ibuprofen, and the selectivity epoxy enzyme-added-inhibitor 2, such as celecoxib and rofecoxib) (PNAS, the 89th volume, the 7384th page (1992), JNCI, the 69th volume, the 475th page (nineteen eighty-two), Arch.Opthalmol., the 108th volume, the 573rd page (nineteen ninety), Anat.Rec., the 238th volume, the 68th page (1994), FEBS Letters, the 372nd volume, the 83rd page (nineteen ninety-five), Clin, Orthop. the 313rd volume, the 76th page (nineteen ninety-five), J.Mol.Endocrinol., the 16th volume, the 107th page (1996), Jpn.J.Pharmacol., the 75th volume, the 105th page (1997), Cancer Res., the 57th volume, the 1625th page (1997), Cell, the 93rd volume, the 705th page (1998), Intl.J.Mol.Med., the 2nd volume, the 715th page (1998 pages), J.Biol..Chem., the 274th, the 9116th page (1999)), steroid anti-inflammatory agent (corticosteroid for example, the mineralocorticosteroid sterin, dexamethasone, prednisone, prednisolone, methylprednisolone, betamethasone), Carboxyamidotraiazol(, combretastatin A-4, Squalamine, 6-O-chloracetyl-carbonyl-aspergillus fumigatus cedrol, Thalidomide, angiostatin, troponin-1, angiotensin-ii antagonist is (referring to Fernandez etc., J.Lab.Clin.Med.105:141-145 (1985)) and VEGF antibody (referring to Nature Biotechnology, the 17th volume, 963-968 page (in October, 1999), Kim etc., Nature, 362,841-844 (1993), WO 00/44777 and WO 00/61186).

Other adjusting or suppress angiogenesis and also can combine the therapeutic agent of use with the compounds of this invention, comprise the reagent (referring to the summary in Clin.Chem.La.Med.38:679-692 (2000)) of regulating or suppressing coagulation system and fibrinolytic system.The example that the reagent of approach and fibrinolysis approach is solidified in described adjusting or inhibition includes but not limited to: heparin (referring to Thromb.Haemost.80:10-23 (1998)), low molecular weight heparin and Carboxypeptidase U inhibitor (also claiming fibrinolysis inhibitor [TAFIa] inhibitor that active enzyme thrombin activates) (referring to Thrombosis Res.101:329-354 (2001)).The TAFIa inhibitor is described in United States serial 60/310,927 (submission on August 8 calendar year 2001) and 60/349,925 (submission on January 18th, 2002).

" medicine at the interference cell cycle outpost of the tax office " refers to the protein kinase that suppresses transducer cell cycle pass card signal, thereby makes cancerous cell to DNA damage agent sensitivity.Described reagent comprises ATR inhibitor, ATM inhibitor, CHK11 and CHK12 inhibitors of kinases, reaches cdk and cdc inhibitors of kinases, and instantiation wherein is 7-hydroxyl staurosporin, flavopiridol (flavopiridol), CYC202 (Cyclacel) and BMS-387032.

" medicine of interfering receptor tyrosine kinase (RTKs) " refers to inhibition RTKs and therefore suppresses to participate in the compound of the mechanism of tumor generation and lump progress.This type of medicine comprises the inhibitor of c-Kit, Eph, PDGF, Flt3 and c-Met.Further medicine comprises as Bume-Jensen and Hunter, Nature, 411:355-365,2001 described RTK inhibitor.

" cell proliferation and survival signal transduction pathway inhibitor " refers to the compound that suppresses cell surface receptor signal transduction cascade system downstream.This type of inhibitor comprises that the serine/threonine kinase inhibitor (includes but not limited to for example at WO 02/083064, WO 02/083139, WO02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO03/086404, WO 03/086279, WO 03/086394, WO 03/084473, WO03/086403, WO 2004/041162, WO 2004/096131, WO 2004/096129, WO2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, the Akt inhibitor of describing in 60/652737 and 60/670469), Raf inhibitors of kinases (for example BAY-43-9006), mek inhibitor (for example CI-1040 and PD-098059), mTOR inhibitors (for example Wyeth CCI-779) and PI3K inhibitor (for example LY294002).

As mentioned above, with the application related to combining of NSAID as the NSAID of effective cox 2 inhibitor.For this description, if record by cell or microsome the IC that a NSAID suppresses COX-2 ₅₀Be 1 μ M or lower, it is effective.

The present invention also comprises and the combining of NSAID as cox 2 inhibitor optionally.For this description, when having, NSAID suppresses COX-2 when suppressing COX-1 and surpass the specificity of at least 100 times, and this NSAID is defined as optionally cox 2 inhibitor, and this specificity can be measured by cell or microsome, measure the IC of COX-2 ₅₀IC with COX-1 ₅₀recently estimate.This compounds includes but not limited to the disclosed compound of Publication about Document: United States Patent (USP) 5, 474, 995, United States Patent (USP) 5, 861, 419, United States Patent (USP) 6, 001, 843, United States Patent (USP) 6, 020, 343, United States Patent (USP) 5, 409, 944, United States Patent (USP) 5, 436, 265, United States Patent (USP) 5, 536, 752, United States Patent (USP) 5, 550, 142, United States Patent (USP) 5, 604, 260, United States Patent (USP) 5, 698, 584, United States Patent (USP) 5, 710, 140, WO 94/15932, United States Patent (USP) 5, 344, 991, United States Patent (USP) 5, 134, 142, United States Patent (USP) 5, 380, 738, United States Patent (USP) 5, 393, 790, United States Patent (USP) 5, 466, 823, United States Patent (USP) 5, 633, 272 and United States Patent (USP) 5, 932, 598, they all are hereby incorporated by.

The cox 2 inhibitor be particularly useful in Therapeutic Method of the present invention is: 3-phenyl-4-(4-(mesyl) phenyl)-2-(5H)-furanone; With the chloro-3-of 5-(4-mesyl) phenyl-2-(2-methyl-5-pyridine radicals) pyridine; Perhaps its officinal salt.

Be described to specific C OX-2 inhibitor and thereby for the present invention's compound, include but not limited to: parecoxib, BEXTRA

And CELEBREX

Perhaps its officinal salt.

Other example of angiogenesis inhibitor includes but not limited to: endostatin (endostatin), ukrain, ranpirnase, IM862, (chloracetyl) carbamic acid 5-methoxyl group-4-[2-methyl-3-(3-methyl-2-butene base) Oxyranyle]-1-oxaspiro [2, 5] suffering-6-base ester, acetyl dinanaline, 5-amino-1-[[3, the chloro-4-of 5-bis-(4-chlorobenzene formacyl) phenyl] methyl]-1H-1, 2, 3-triazole-4-Methanamide, CM 101, Squalamine, combretastatin, RPI4610, NX31838, sulphation phosphoric acid manna pentose, 7, 7-(carbonyl-bis-[imino group-N-methyl-4, 2-pyrrolo-carbonyl imino group [N-methyl-4, 2-pyrroles]-the carbonyl imino group]-bis--(1, the 3-napadisilate) and 3-[(2, 4-dimethyl pyrrole-5-yl) methylene]-2-dihydroindolone (SU5416).

Above applied " integrin inhibitor " refers to optionally antagonism, inhibition or antagonism physiology part and α _vβ ₃The compound of integrin combination; Optionally antagonism, inhibition or antagonism physiology part and α _vβ ₅The compound of integrin combination; Antagonism, inhibition or antagonism physiology part and α _vβ ₃Integrin and α v β ₅The compound of both combinations of integrin; And the compound of the special integrin activity of antagonism, inhibition or the expression of antagonism capillary endothelial cell.This term also refers to α _vβ ₆, α _vβ ₈, α ₁β ₁, α ₂β ₁, α ₅β ₁, α ₆β ₁And α ₆β ₄The antagonist of integrin.This term also refers to α _vβ ₃, α _vβ ₅, α _vβ ₆, α _vβ ₈, α ₁β ₁, α ₂β ₁, α ₅β ₁, α ₆β ₁And α ₆β ₄The antagonist of any combination in integrin.

Some instantiations of tyrosine kinase inhibitor comprise: N-(trifluoromethyl)-5-methyl is different

azoles-4-Methanamide, 3-[(2,4-dimethyl pyrrole-5-yl) methylene (methylidenyl)] Indolin-2-one, the nor-oxygen geldanamycin of 17-(allyl amino)-17-, 4-(the chloro-4-fluoroanilino of 3-)-7-methoxy-6-[3-(4-morpholinyl) propoxyl group] quinazoline, N-(3-ethynyl phenyl)-6, two (2-the methoxy ethoxy)-4-quinazoline amine of 7-, BIBX1382, 2,3,9,10,11,12-, six hydrogen-10-(methylol)-10-hydroxyl-9-methyl-9,12-epoxy-1H-bis-indole are [1,2,3-fg:3 ', 2 ', 1 '-kl] pyrrolo-[3,4-i] [1,6] benzodiazocine-1-ketone also, SH268, genistein, STI571, CEP2563, 4-(3-chlorphenyl amino)-5,6-dimethyl-7H-pyrrolo-[2,3-d] pyrimidine methane sulfonate, 4-(the bromo-4-hydroxyphenyl of 3-) amido-6,7-dimethoxy quinazoline, 4-(4 '-hydroxyphenyl) amido-6,7-dimethoxy quinazoline, SU6668, STI571A, N-4-chlorphenyl-4-(4-pyridylmethyl)-1-phthalazines amine and EMD121974.

With the combining of other compound except anticancer compound, be also included within method of the present invention.For example, the claimed compound of the application can be used for treating some malignant disease with combining of PPAR-gamma agonist and PPAR-delta agonists.PPAR-γ and PPAR-δ are core peroxisome proliferation-activated receptors γ and core Peroxisome proliferator-activated receptor δ.Expression and the participation angiogenesis thereof of PPAR-γ on endotheliocyte obtained report in the literature (referring to J.Cardiovasc.Pharmacol.1998; 31:909-913; J.Biol.Chem.1999; 274:9116-9121; Invest.Ophthalmol Vis.Sci.2000; 41:2309-2317).Recently, there is report explanation PPAR-gamma agonist to suppress in vitro the angiogenesis reaction to VEGF; In mice, maleic acid troglitazone and rosiglitazone maleate both suppress the growth (Arch.Ophthamol.2001 of retina neovascularization; 119:709-717).The example of PPAR-gamma agonist and PPAR-γ/alfa agonists includes but not limited to thiazolidinediones (for example DRF2725, CS-011, troglitazone, rosiglitazone and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, NN2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926,2-[(5,7-dipropyl-3-Trifluoromethyl-1, the 2-phenyl is different

Azoles-6-yl) oxygen base]-2 Methylpropionic acid (is disclosed in USSN 09/782, in 856) and 2 (R)-7-(3-(the chloro-4-of 2-(4-fluorophenoxy) phenoxy group) propoxyl group)-2-ethyl benzodihydropyran-2-formic acid (be disclosed in USSN60/235, in 708 and 60/244,697).

Another embodiment of the invention is existing disclosed compound and the use in conjunction that is used for the treatment of the gene therapy of cancer.The overview of the gene strategy of relevant treatment cancer is referring to Hall etc. (Am.J.Hum.Genet.61:785-789,1997) and Kufe etc. (Cancer Medicine, the 5th edition, the 876-889 page, BC Decker, Hamilton 2000).Gene therapy can be used for transmitting any tumor suppressor gene.The example of this genoid includes but not limited to p53, the gene transfer that p53 can mediate by recombinant virus transmitted (referring to, for example United States Patent (USP) 6,069,134), uPA/uPAR antagonist (" Adenovirus-Mediated Delivery of a uPA/uPAR AntagonistSuppresses Angiogenesis-Dependent Tumor Growth and Dissemination inMice ", Gene Therapy, in August, 1998,5 (8): 1105-13) and interferon gamma (J.Immunol.2000; 164:217-222).

The compounds of this invention can also with intrinsic multidrug resistance (MDR) inhibitor, particularly the MDR inhibitor drug combination relevant with the transport protein high level expression.This type of MDR inhibitor comprises the inhibitor of p-glycoprotein (P-gp), for example LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar).

Thereby the compounds of this invention can be combined with Bendectin use treatment n or V, comprise acute vomiting, postpone vomiting, vomiting in late period and vomiting in advance, describedly feel sick or vomiting may be because of use the compounds of this invention separately or use and cause together with radiotherapy.In order to prevent or treat vomiting, the compounds of this invention can be combined use with other Bendectin, particularly with following Bendectin, combines use: antagonists of neurokinine-1 receptor; 5HT3 receptor antagonist, for example ondansetron, granisetron, tropisetron and zatosetron; GABAB receptor stimulating agent, for example baclofen; Corticosteroid, for example Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or other are disclosed in United States Patent (USP) 2,789,118,2,990,401,3,048,581,3,126,375,3,929,768,3,996,359,3,928,326 and 3,749, corticosteroid in 712, dopamine antagonist medicines such as phenothiazines (as prochlorperazine, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol.In another embodiment, with the conjoint therapy that is selected from the Bendectins such as antagonists of neurokinine-1 receptor, 5HT3 receptor antagonist and corticosteroid, obtained openly, it is used for the treatment of or prevents the vomiting caused owing to giving the compounds of this invention.

With the antagonists of neurokinine-1 receptor of the compounds of this invention coupling, in following patent, obtained comprehensively openly, for example, U.S. patent Nos.5,162,339,5,232,929,5,242,930,5,373,003,5,387,595,5,459,270,5,494,926,5,496,833,5,637,699,5,719,147, the open Nos.EP 0 360 390 of European patent, 0 394 989, 0 428 434, 0 429366, 0 430 771, 0 436 334, 0 443 132, 0 482 539, 0 498 069, 0 499 313, 0512 901, 0 512 902, 0 514 273, 0 514 274, 0 514 275, 0 514 276, 0 515 681, 0 517 589, 0 520 555, 0 522 808, 0 528 495, 0 532 456, 0 533 280, 0 536817, 0 545 478, 0 558 156, 0 577 394, 0 585 913, 0 590 152, 0 599 538, 0610 793, 0 634 402, 0 686 629, 0 693 489, 0 694 535, 0 699 655, 0 699 674, 0 707 006, 0 708 101, 0 709 375, 0 709 376, 0 714 891, 0 723 959, 0 733 632 and 0 776 893, the open Nos.WO 90/05525 of pct international patent, 90/05729, 91/09844, 91/18899, 92/01688, 92/06079, 92/12151, 92/15585, 92/17449, 92/20661, 92/20676, 92/21677, 92/22569, 93/00330, 93/00331, 93/01159, 93/01165, 93/01169, 93/01170, 93/06099, 93/09116, 93/10073, 93/14084, 93/14113, 93/18023, 93/19064, 93/21155, 93/21181, 93/23380, 93/24465, 94/00440, 94/01402, 94/02461, 94/02595, 94/03429, 94/03445, 94/04494, 94/04496, 94/05625, 94/07843, 94/08997, 94/10165, 94/10167, 94/10168, 94/10170, 94/11368, 94/13639, 94/13663, 94/14767, 94/15903, 94/19320, 94/19323, 94/20500, 94/26735, 94/26740, 94/29309, 95/02595, 95/04040, 95/04042, 95/06645, 95/07886, 95/07908, 95/08549, 95/11880, 95/14017, 95/15311, 95/16679, 95/17382, 95/18124, 95/18129, 95/19344, 95/20575, 95/21819, 95/22525, 95/23798, 95/26338, 95/28418, 95/30674, 95/30687, 95/33744, 96/05181, 96/05193, 96/05203, 96/06094, 96/07649, 96/10562, 96/16939, 96/18643, 96/20197, 96/21661, 96/29304, 96/29317, 96/29326, 96/29328, 96/31214, 96/32385, 96/37489, 97/01553, 97/01554, 97/03066, 97/08144, 97/14671, 97/17362, 97/18206, 97/19084, 97/19942 and 97/21702, and the open Nos.2 266 529,2 268 931,2 269 170,2 269590,2 271 774,2 292 144,2 293 168,2 293 169 of British patent, and 2 302 689.The preparation full disclosure of described compound is in above-mentioned patent and Publication Specification, and they all are hereby incorporated by.

In one embodiment, for being selected from the antagonists of neurokinine-1 receptor of the compounds of this invention coupling: 2-(R)-(1-(R)-(3, two (trifluoromethyl) phenyl of 5-) ethyoxyl)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-1H, 4H-1,2,4-triazol) methyl) morpholine, perhaps its officinal salt, related content is described in United States Patent (USP) 5,719, in 147.

The compounds of this invention also can administration together with the therapeutic agent that is used for the treatment of anemia.Described treatment for anemia agent is that for example, erythrocyte generates receptor activators (for example Epoetin Alfa) continuously.

The compounds of this invention also can administration together with the therapeutic agent that is used for the treatment of neutrophilic granulocytopenia.The therapeutic agent of described neutrophilic granulocytopenia is, for example, regulates the formation of neutrophil cell and the hemopoietic growth factor of function (such as, human myelomonocyte colony-stimulating factor (G-CSF)).The example of G-CSF comprises filgrastim.

The compounds of this invention also can with administration together with the immunostimulant of for example levamisole, inosine pranobex and Zadaxin (Zadaxin).

Compound compound of the present invention also can be used for and the therapeutic alliance of P450 inhibitor or prophylaxis of cancer, and described P450 inhibitor comprises: xenobiotic medicine (xenobiotics), quinidine, tyramine, ketoconazole, testosterone, quinine, Metopirone (methyrapone), caffeine, phenelzine, doxorubicin, triacetyloleandomycin, cyclobenzaprine, erythromycin, cocaine, furafylline (furafyline), Cimetidine, dextromethorphan, ritonavir, indinavir, amprenavir, diltiazem

, terfenadine, verapamil, hydrocortisone, itraconazole, mibefradil, nefazodone and viracept see nelfinaivr.

Compound of the present invention also can be used for and Pgp and/or the therapeutic alliance of BCRP inhibitor or prophylaxis of cancer, Pgp and/or BCRP inhibitor comprise: cyclosporin A, PSC833, GF120918, cremophor EL (cremophorEL), FTC, Ko132, Ko134, Iressa, imatinib mesylate, EKI-785, C11033, novobiocin, diethylstilbestrol, tamoxifen, reserpine (resperpine), VX-710, his spit of fland (tryprostatin) A of color third, flavonoid, ritonavir, Saquinavir, viracept see nelfinaivr, omeprazole, quinidine, verapamil, terfenadine, ketoconazole, nifedipine, FK506, amiodarone, XR9576, indinavir, amprenavir, hydrocortisone, testosterone, LY335979, OC144-093, erythromycin, vincristine, digoxin and talinolol.

Compound of the present invention can also be combined and be used for the treatment of or prophylaxis of cancer with bisphosphonates (be interpreted as and comprise bisphosphonates, diphosphate, two phosphonic acids and di 2 ethylhexyl phosphonic acid), comprises osteocarcinoma.The example of diphosphonate includes but not limited to: etidronate (Didronel), pamldronate (Aredia), fosamax (Fosamax), Risedronate (Actonel), zoledronate (Zometa), ibandronate (ibandronate) (Boniva), incadronate (incadronate) or clodronate salt (cimadronate), clodronate, EB-1053, YM 529 (minodronate), neridronic acid salt (neridronate), NE 97221 (piridronate) and Tiludronate (tiludronate), comprise its any and all pharmaceutically acceptable salts, derivant, hydrate and their mixture.

Compound of the present invention also can be used for and aromatase inhibitor therapeutic alliance or Breast Cancer Prevention.The example of aromatase inhibitor includes but not limited to: Anastrozole, letrozole and exemestane.

Compound of the present invention also can be used for and the therapeutic alliance of siRNA therapeutic agent or prophylaxis of cancer.

Compound of the present invention also can with inhibitors of gamma-secretase and/or NOTCH signal transduction inhibitor administering drug combinations.These inhibitor comprise at WO 01/90084, WO 02/30912, WO01/70677, WO 03/013506, WO 02/36555, WO 03/093252, WO 03/093264, WO 03/093251, WO 03/093253, WO 2004/039800, WO 2004/039370, WO2005/030731, WO 2005/014553, USSN 10/957, 251, WO 2004/089911, WO 02/081435, WO 02/081433, WO 03/018543, WO 2004/031137, WO2004/031139, WO 2004/031138, WO 2004/101538, compound (comprising LY-450139) described in WO 2004/101539 and WO 02/47671.

As WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO 03/086279, WO03/086394, WO 03/084473, WO 03/086403, WO 2004/041162, WO2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US2005/43361, 60/734188, 60/652737, disclosed Akt inhibitor in 60/670469, comprise the compounds of this invention, also can be used for and potassium salt, magnesium salt, beta blocker (such as atenolol) and endothelium peptide-a (ETa) antagonist combination are used, purpose is to keep cardiovascular dynamic equilibrium.

As WO 02/083064, WO 02/083139, WO 02/083140, US 2004-0116432, WO 02/083138, US 2004-0102360, WO 03/086404, WO03/086279, WO 03/086394, WO 03/084473, WO 03/086403, WO2004/041162, WO 2004/096131, WO 2004/096129, WO 2004/096135, WO 2004/096130, WO 2005/100356, WO 2005/100344, US 2005/029941, US 2005/44294, US 2005/43361, 60/734188, 60/652737, disclosed Akt inhibitor in 60/670469, comprise the compounds of this invention, also can with insulin, Insulin secretagogues, the PPAR-gamma agonist, metformin, somatostatin receptor agonist is such as octreotide, the DPP4 inhibitor, sulfonylureas and Alpha-glucosidase inhibitor are combined use, purpose is to keep glucose dynamic equilibrium.

Compound of the present invention also can be used for and the therapeutic alliance of PARP inhibitor or prophylaxis of cancer.

Compound of the present invention also can be used for that (Plenaxis stores agent with following treated with combined medication cancer: abarelix

); Aldesleukin (Prokine

); Aldesleukin (Proleukin

); Alemtuzumabb (Campath

); Alitretinoin (Panretin

); Allopurinol (Zyloprim

); Hemel (Hexalen

); Amifostine (Ethyol

); Anastrozole (Arimidex

); Arsenic trioxide (Trisenox

); L-Asparaginasum (Elspar ); Azacitidine (Vidaza ); Bevacuzimab (Avastin ); Bexarotene capsule (Targretin ); Bexarotene gel (Targretin

); Bleomycin (Blenoxane

); Bortezomib (Velcade ); Busulfan iv formulation (Busulfex

); Busulfan oral agents (Myleran

); Calusterone (Methosarb

); Capecitabine (Xeloda

); Carboplatin (Paraplatin

); BCNU (BCNU

, BiCNU

); BCNU (Gliadel

); BCNU+Polifeprosan 20 implants (Gliadel Wafer

); Sai-Mi-Xi-Bu (Celebrex

); Cetuximab (Erbitux

); Chlorambucil (Leukeran

); Cis-platinum (Platinol

); Cladribine (Leustatin

, 2-CdA

); Agent clofarabine (clofarabine) (Clolar

); Endoxan (Cytoxan

, Neosar

); Endoxan (Cytoxan parenteral solution

); Endoxan (Cytoxan sheet

); Cytarabine (Cytosar-U ); Cytarabine liposome (DepoCyt

); Dacarbazine (DTIC-Dome

); The D-D actinomycin D, actinomycin D (Cosmegen

); α-Darbepoetin (Aranesp

); Daunorubicin liposome (DanuoXome ); Daunorubicin, daunomycin (Daunorubicin ); Daunorubicin, daunomycin (Cerubidine

); Denileukin diftitox (Denileukin diftitox) (Ontak

); Dexrazoxane (Zinecard

); Docetaxel (Taxotere

); Doxorubicin (Adriamycin PFS

); Doxorubicin (Adriamycin

, Rubex

); Doxorubicin (Adriamycin PFS parenteral solution

); Mycocet (Doxil

); Dromostanolone propionate (dromostanolone ); Dromostanolone propionate (masterone parenteral solution

); Elliott ' s B solution (Elliott ' s B solution

); Epirubicin (Ellence

); Epoetin Alfa (epogen

); Erlotinib (Tarceva

); Estramustine (Emcyt

); Etoposide phosphate (Etopophos

); Etoposide, VP-16 (Vepesid

); Exemestane (Aromasin ); Filgrastim (Neupogen

); Azauridine (in artery) (FUDR

); Fludarabine (Fludara

); Fluorouracil, 5-FU (Adrucil

); Fulvestrant (Faslodex

); Gefitinib (gefitinib) (Iressa

); Gemcitabine (Gemzar

); Gemtuzumab Ozogamicin (Mylotarg

); Goserelin acetate (Zoladex implant

); Goserelin acetate (Zoladex

); Histrelin acetate (Histrelin implant

); Hydroxycarbamide (Hydrea

); IbritumomabXiuxetan (Zevalin

); Idarubicin (Idamycin

); Ifosfamide (IFEX ); Imatinib mesylate (imatinib) (Gleevec

); Intederon Alpha-2a (Roferon A

); Interferon Alpha-2b (Intron A

); Irinotecan (Camptosar

); Lenalidomide (Revlimid ); Letrozole (Femara

); Folinic acid (Wellcovorin

, Leucovorin ); The bright interior Rayleigh (Eligard of acetic acid Acetate acetic acid

); Levamisol (Ergamisol

); Lomustine, CCNU (CeeBU

); Dema (meclorethamine), mustargen (Mustargen

); Megestrol acetate (Megace

); Melphalan, L-PAM (Alkeran

); Mercaptopurine, 6-MP (Purinethol

); Mesna (Mesnex

); Mesna (Mesnex tabs

); Methotrexate (MTX) (Methotrexate

); Methoxsalen (Uvadex

); Mitomycin C (Mutamycin

); Mitotane (Lysodren ); Mitoxantrone (Novantrone ); Nandrolone Phenylpropionate (nandrolone phenpropionate) (Durabolin-50

); Nelarabine (Arranon

); Nofetumomab (VeRluma

); Oprelvekin (Neumega

); Oxaliplatin (Eloxatin

); Taxol (Paxene

); Taxol (Taxol

); Taxol combined with protein particle (Abraxane ); Pa Lifuming (palifermin) (Kepivance

); Pamidronate (Aredia

); Pegademase (Adagen (pegademase bovine)

); Pegaspargase (Oncaspar

); Pegfilgrastim (Neulasta

); Pemetrexed disodium (Alimta

); Pentostatin (Nipent

); Pipobroman (Vercyte

); Plicamycin, mithramycin (Mithracin

); Porfimer Sodium (Photofrin

); Procarbazine (Matulane

); Mepacrine (Atabrine

); Rasburicase (Elitek

); Anti-(the Rituxan in the appropriate Xidan of profit ); Sargramostim (Leukine ); Sargramostim (Prokine

); Sorafenib (Nexavar

); Streptozotocin (Zanosar

); Maleic acid Sutent (sunitinib) (Sutent

); Talcum (Sclerosol ); TAM (Nolvadex

); Temozolomide (Temodar

); Teniposide, VM-26 (Vumon ); Ketone (Teslac in testis

); Thioguanine, 6-TG (Thioguanine

); Phosphinothioylidynetrisaziridine (Thioplex

); TPT (Hycamtin

); Toremifene (Fareston ); Tosi is established monoclonal antibody (Bexxar

); Tosi is established monoclonal antibody/I-131 Tosi and is established monoclonal antibody (Bexxar

); Herceptin (Herceptin

); Vitamin A acid, ATRA (Vesanoid

); Uracil mustard (Uracil Mustard capsule

); Cut down as than star (valrubicin) (Valstar

); Vincaleukoblastinum (Velban

); Vincristine (Oncovin

); Vinorelbine (Navelbine

); And zoledronate (Zometa

).

Therefore, scope of the present invention comprises the claimed compound of the present invention and the use in conjunction that is selected from the second following compound: estrogenic agents, androgen receptor modifier, the retinoid receptor modulators, cytotoxic agent/cytostatics, antiproliferative agents, isopentene group-protein transferase inhibitor, the HMG-CoA reductase inhibitor, the HTV protease inhibitor, reverse transcriptase inhibitors, angiogenesis inhibitor, the PPAR-gamma agonist, the PPAR-delta agonists, intrinsic multidrug resistance inhibitor, Bendectin, the medicine that is used for the treatment of anemia, the medicine that is used for the treatment of neutropenia, immunostimulant, cell proliferation and survival signal transduction inhibitor, bisphosphonates, aromatase inhibitor, the siRNA therapeutic agent, inhibitors of gamma-secretase, disturb the medicine of receptor tyrosine kinase (RTKs), the medicine at the interference cell cycle outpost of the tax office, and above-listed any therapeutic agent.

For example, refer to compound or compound prodrug are incorporated in the animal system that needs treatment about the term " administration " of the compounds of this invention and distortion (" giving " compound) thereof.When the compounds of this invention or other activating agent of its prodrug and one or more (such as cytotoxic agent etc.) being combined while providing, " administration " and distortion thereof can be interpreted as separately and comprise simultaneously and order is introduced compound or its prodrug and other reagent.

Term " compositions " refers to the product of the predetermined component that contains ormal weight as used herein, and any product directly or indirectly obtained by the predetermined component that combines ormal weight.

Term used herein " treatment effective dose " refers to by research worker, veterinary, medical doctor or other clinicist are determined and causes biology or the reactive compound of medical response or the amount of medicine at tissue, system, animal or human's apoplexy due to endogenous wind.

Term " treatment cancer " or " treatment of cancer " refer to that the mammal to suffering from the carcinous patient's condition carries out administration, and relate to the effect be suppressed to alleviate the effect of the carcinous patient's condition, also to relate to the growth that makes cancer and/or transfer by kill cancer cell.

In one embodiment, the angiogenesis inhibitor used as the second compound is selected from tyrosine kinase inhibitor, epidermis derivative growth factor inhibitor, fibroblast derivative growth factor inhibitor, the platelet derived growth factor inhibitor, MMP (matrix metalloproteinase) inhibitor, the integrin blocker, interferon-' alpha ', IL-12, poly-sulphuric acid pentosan, cyclooxygenase-2 inhibitor, Carboxyamidotraiazol(, combretastatin A-4, Squalamine, 6-O-chloracetyl-carbonyl)-aspergillus fumigatus cedrol, Thalidomide, angiostatin, troponin-1 or VEGF antibody.In one embodiment, estrogenic agents is tamoxifen or raloxifene.

Claimed scope also comprises the method for the treatment of cancer, the method comprises with radiotherapy and/or the second compound combines the compounds of this invention for the treatment of effective dose, described the second compound is selected from: estrogenic agents, androgen receptor modifier, the retinoid receptor modulators, cytotoxic agent/cytostatics, antiproliferative agents, isopentene group-protein transferase inhibitor, the HMG-CoA reductase inhibitor, the hiv protease inhibitor, reverse transcriptase inhibitors, angiogenesis inhibitor, the PPAR-gamma agonist, the PPAR-delta agonists, intrinsic multidrug resistance inhibitor, Bendectin, the medicine that is used for the treatment of anemia, the medicine that is used for the treatment of neutrophilic granulocytopenia, immunostimulant, cell proliferation and survival signal transduction inhibitor, bisphosphonates, and aromatase inhibitor, the siRNA therapeutic agent, inhibitors of gamma-secretase, disturb the medicine of receptor tyrosine kinase (RTKs), the medicine at the interference cell cycle outpost of the tax office, and above-listed any therapeutic agent.

Another embodiment of the invention is the method for the treatment of cancer, comprises the compound of the present invention with paclitaxel or Herceptin administering drug combinations treatment effective dose.

The present invention further comprises the method for the treatment of or prophylaxis of cancer, comprises compound of the present invention and the cox 2 inhibitor of drug treatment effective dose.

The present invention also comprises the pharmaceutical composition that can be used for treatment or prophylaxis of cancer, this pharmaceutical composition comprises the compound of the present invention for the treatment of effective dose and is selected from the second following compound: estrogenic agents, androgen receptor modifier, the retinoid receptor modulators, cytotoxic agent/cytostatics, antiproliferative agents, isopentene group-protein transferase inhibitor, the HMG-CoA reductase inhibitor, the hiv protease inhibitor, reverse transcriptase inhibitors, angiogenesis inhibitor, the PPAR-gamma agonist, the PPAR-delta agonists, cell proliferation and survival signal transduction inhibitor, bisphosphonates, aromatase inhibitor, the siRNA therapeutic agent, inhibitors of gamma-secretase, disturb the medicine of receptor tyrosine kinase (RTKs), the medicine at the interference cell cycle outpost of the tax office, and above-listed any therapeutic agent.

All patents, open and review patent application and be incorporated to this paper as a reference.

The abbreviation of using in chemistry diagram and embodiment explanation is as follows: AEBSF (to amino-ethyl benzenesulfonyl fluorine); BSA (bovine serum albumin); BuLi (n-BuLi); CDCl ₃(chloroform-d); CuI (Copper diiodide); CuSO ₄(copper sulfate); DCE (dichloroethanes); DCM (dichloroethanes); DEAD (diethylazodicarboxylate); DMF (DMF); DMSO (dimethyl sulfoxide); DTT (dithiothreitol, DTT); EDTA (ethylenediamino tetraacetic acid); EGTA (ethylene glycol-tetraacethyl); EtOAc (ethyl acetate); EtOH (ethanol); HOAc (acetic acid); HPLC (high performance liquid chromatography); HRMS (high resolution mass spec); LCMS (liquid chromatograph-mass spectrometer); LHMDS (two (trimethyl silyl) Lithamide .); LRMS (Algorithm); MeOH (methanol); MP-B (CN) H ₃(macropore cyano group boron hydride); NaHCO ₃(sodium bicarbonate); Na ₂SO ₄(sodium sulfate); Na (OAc) ₃BH (sodium triacetoxy borohydride); NH ₄OAC (ammonium acetate); NBS (N-bromosuccinamide); NMR (nuclear magnetic resonance, NMR); PBS (phosphate buffered saline (PBS)); PCR (polymerase chain reaction); Pd (dppf) ([1,1 '-bis-(diphenyl phosphine) ferrocene] palladium); Pd (Ph ₃) ₄(palladium (O) four-triphenylphosphine); POCl ₃(phosphorus oxychloride); PS-DIEA (polystyrene diisopropyl ethyl amine); PS-PPh ₃(polystyrene-triphenylphosphine); TBAF (tetrabutyl ammonium fluoride); THF (oxolane); TFA (trifluoroacetic acid); TMSCH ₂N ₂(trimethyl silyl Azimethylene .) and Ac (acetyl group); BOC (tertbutyloxycarbonyl); Bu (butyl); Cal (value of calculation); Calc ' d (value of calculation); DIEA (diisopropyl ethyl amine); DMAP (4-dimethylaminopyridine); EDC (N-ethyl-N '-(3-dimethylaminopropyl) carbodiimide); Eq (equivalent); Et (ethyl); HOBT (hydroxybenzotriazole); IPA (isopropyl alcohol); LC/MS (liquid chromatograph-mass spectrometer); Me (methyl); MeCN (acetonitrile); NMP (N-Methyl pyrrolidone); Pr (propyl group); Pyr (pyridine); Sat (saturated) and Tosic (p-methyl benzenesulfonic acid).

Except known or other standard operation of experimental technique illustrated, can prepare by adopting the reaction described in following reaction scheme by compound of the present invention in the literature.Therefore, the compound that following illustrative reaction scheme is not enumerated or any concrete substituent restriction of using for the illustrative purpose.Substituent group shown in reaction scheme numbering not must in claim, use those are relevant, usually for easy, a plurality of substituent groups that allow under the definition of above-mentioned formula A are expressed as the independent substituent group be connected with this compound.

The initial of the compounds of this invention synthesized as shown in reaction scheme I-IX.Can be used for preparing the end reaction of the compounds of this invention as shown in reaction scheme X-XIV.

The reaction scheme summary

Following reaction scheme, reaction scheme I-IX, provide the dicyclo for preparing the compounds of this invention useful details partly.

Must can on market, buy in some cases by intermediate, or can make according to the document process.As shown in reaction scheme I, the phenylacetylene compound suitably replaced can react with Copper diiodide the corresponding cupfic acetylide I-1 of formation (for example, referring to Sonogashira, K.; Toda, Y.; Hagihara, N.Tetrahedron Lett.1975,4467).Then intermediate compound I-1 can with the electrophilic partial reaction of suitable replacement, the I-2 of Asymmetrical substitute is provided.Then I-2 reacts hydrolysis with NBS, obtain I-3 (for example, referring to Yusybov, M.S.; Filimonov, V.D.; Synthesis 1991,2, and 131).Permitted polysubstituted and unsubstituted aryl and heterocyclyl compounds and also be can be used as the commodity acquisition.

Reaction scheme II has illustrated from the II-1 of suitable replacement and has started to prepare compound.This intermediate can react intermediate II-2 are provided with the amine of suitable replacement, the regional isomer intermixture that II-2 can provide the compounds of this invention with suitable aryl or heteroaryl diamine reactant, and it separates by chromatography usually.

Reaction scheme III has illustrated the synthetic of another kind of bicyclic heterocyclic radical.

Reaction scheme IV has illustrated that 4-amino from suitable replacement-3-nitrobenzonitrile IV-I prepares compound.Then this intermediate can experience [3+2] cycloaddition reaction that microwave promotes and obtains tetrazolium IV-II.The alkylation of this acidity tetrazolium and electrophilic reagent such as iodomethane obtains the 2-methyl (IV-III) of alkylation tetrazolium/1-methyl (IV-IV) mixture, and this mixture can separate by column chromatography.The Ra-ni-mh of IV-III obtains diamidogen IV-V.Further synthetic described in above-mentioned reaction scheme.

Reaction scheme V has illustrated the synthetic of compound.The blue moral cyclic condensation of the Fred of the aryl suitably replaced or heteroaryl amino formaldehyde and the suitable ketone replaced obtains the intermediate of formula V-1.Carboxylic functionality obtains intermediate V-2 to the conversion of aldehyde degree of functionality, and by well known to a person skilled in the art that method completes.Obtain the compound of formula V-3 with the reductive alkylation of the amine of suitable replacement.

Reaction scheme VI has illustrated the another kind of synthetic schemes of intermediate V-2.

Reaction scheme VII illustrated from ketone VII-1 and started synthetic compound, and ketone VII-1 is according to document preparation (Renault, O.; Dallemagne, P.; And Rault, S.Org.Prep.Proced.Int., 1999,31,324).VII-1 and the condensation of DMF dimethyl acetal obtain ketone-enamine VII-2, and ketone-enamine VII-2 and the cyclisation of 2-cyanoacetamide obtain pyridone VII-3.Process VII-3 with phosphorus oxychloride and obtain chloro-pyridine VII-4.The group bromination, then obtain amine VII-5 with the amine displacement suitably replaced.Chloro nicotinic acid nitrile VII-5 subsequently obtains cyclized structure VII-6 with reacting of various double nucleophiles.

Reaction scheme VIII has illustrated the preparation of 1,6-naphthyridines-6 (5H)-one compound.Start to synthesize from commercially available carboxylic acid (VIII-1), VIII-1 is changed into to Weinreb amide (VIII-2).Described amide and aryl lithium (lithium by aromatic bromide and n-BuLi-halogen exchange reaction obtains) react, and obtain ketone (VIII-3).The amino cigarette aldehyde of the ketone of this replacement and 4-(nicotinaldehyde), in for example condensation under the existence of sodium hydroxide or Feldalat NM of alkali, obtains 1,6-naphthyridines (VIII-4).R substituent group on phenyl can be as the hydroxymethyl of (silicyl) protection, the functional group of sheltering aldehyde (being acetal) or carboxylic acid.By this Substance Transformation, be essential aldehyde VIII-4.When the R group is hydroxymethyl, use the reagent oxidation such as activated manganese dioxide to obtain aldehyde VIII-4.When R is acetal, the weak acid water solution obtains aldehyde.The hydroxy-acid group reduction of carrying out with the borohydride reduction mixed anhydride also obtains aldehyde VIII-4.Then the amine of this aldehyde and the different series piperidines that for example 4-replaces and boron hydride carry out reduction amination and obtain 1,6-naphthyridines-5 (H)-one (VIII-5).Process (VIII-5) with pyridine hydrochloride and obtain end product (VIII-6) under 150 ℃.

Reaction scheme IX has illustrated the alternative strategy of another kind of introducing heterocycle in the C3 position.This reaction from commercially available dichloro benzopyrazines, itself and aryl boric acid coupling under the existence of palladium catalyst (Suzuki reacts).Then, repeating this with other heterocyclic boronic acids under identical reaction condition reacts and obtains end product.

Reaction scheme I

Reaction scheme II

Reaction scheme III

Reaction scheme IV

Reaction scheme V

Reaction scheme VI

Reaction scheme VII

Reaction scheme VIII

Reaction scheme IX

The final summary of reaction scheme

Following reaction scheme, i.e. reaction scheme X-XIV, provide the useful details of three loop sections that prepare the compounds of this invention.

Must can on market, buy in some cases by intermediate, or can make according to the document process.Use POCl ₃Process the aryl of suitably replacement or the intermediate that heteroaryl intermediate X-1 obtains formula X-2.The chlorine degree of functionality obtains intermediate X-3 to the conversion of hydrazides degree of functionality, and by well known to a person skilled in the art that method completes.Provide the compound of formula X-4 with suitable diimidazole precursor cyclisation.

Reaction scheme XI has illustrated the alternative strategy of another kind of the compound of synthesis type X-4.

Reaction scheme XII has illustrated the synthetic of formula XII-2 compound.X-3 and suitable trimethoxy chloracetate condensation obtain chloromethyl intermediate X II-1, and it obtains structure XII-2 by nucleophilic displacement.

Reaction scheme XIII has illustrated the preparation of triazol naphthyridine compounds.The synthetic naphthyridones (XIII-1) known from document/patent, under refluxad use POCl ₃Be translated into naphthyridines chloride (XIII-2) after processing.XIII-2 under refluxad reacts and obtains hydrazides (XIII-3) with pure hydrazine, and it is as the key intermediate of synthetic triazol naphthyridine compounds.Shown in this hydrazides (XIII-4) is converted into to essential triazol naphthyridine compounds under condition, thereby complete the synthetic of expectation.R substituent group on the triazol part can be the functional group as amino, oxo base or thiol.

Reaction scheme XIV has illustrated alternative strategy of introducing the triazol part in the left-hand part of molecule.From previous synthetic intermediate hydrazides (XIII-3), start to synthesize, its available trimethoxy ortho-acetate is processed and is obtained required end product triazol naphthyridine compounds (XIV-1).R substituent group on the triazol part can be the functional group as proton, simple alkyl, chloromethyl or functionalised alkyl.

Reaction scheme XV has illustrated by three kinds of different reduction amination methods and has introduced in benzylic positions the compound that primary amine carrys out synthesis type XV-1.Described method also is applicable to other aldehyde, all compounds suc as formula XVII-1.

Reaction scheme XVI has illustrated the compound that uses the variant synthesis type XVI-2 of the cyclic condensation condition as shown in reaction scheme VIII.Use aprotic solvent and alkali to obtain the chloro naphthyridines of structure XVI-2.

Reaction scheme XVII has illustrated compound synthetic of formula XVII-4.In this case, introduce methyl substituents via sulfonamide XVII-2 in benzylic positions.Other substituent group can be used organometallic reagent to introduce such as Grignard reagent.Use acid the t-butyl sulfonamide cracking can be removed and obtained amine such as HCl.

Reaction scheme XVIII has illustrated the synthetic of formula XVIII-2 compound, and it is the synthetic variant of the triazole described in reaction scheme XI.In this case, hydrazine XVIII-1 and carboxylic acid coupling under the acid catalysis condition, the triazole that the cyclisation of intermediate acid hydrazide obtains condensing.

Reaction scheme XIX has illustrated compound synthetic of formula XIX-2, wherein from the synthetic cyclopropylamine of nitrile XIX-1.

Reaction scheme XX has illustrated under the reduction amination condition of standard from the compound of the amine synthesis type XX-2 of formula XX-1.

Reaction scheme X

Reaction scheme XI

Reaction scheme XII

Reaction scheme XIII

Reaction scheme XIV

Reaction scheme XV

Reaction scheme XVI

Reaction scheme XVII

Reaction scheme XVIII

Reaction scheme XIX

Reaction scheme XX

Embodiment

It is in order to help further to understand the present invention that embodiment and diagrammatic purpose are provided.Concrete material, material and the condition used are in order to further illustrate the present invention rather than zone of reasonableness of the present invention to be construed as limiting.

Reaction scheme 1

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (1-4)

The chloro-3-phenyl-2-of 5-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (1-2)

Add 3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1 in the 25mL RB flask that is equipped with stirring rod, 2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines-5 (6H)-one (0.86g, 1.6mmol), then add anhydrous POCl ₃(8mL).Mixture is heated to 120 ℃ and stirring and refluxing 4 hours.After cool to room temperature will be reacted, reactant mixture is joined to cold saturated NaHCO carefully ₃In the mixture of aqueous solution (20mL) and EtOAc (20mL).Keeping the PH of water layer in whole quenching process is about PH 8-9.Aqueous solution further uses EtOAc (15mL) to extract twice, MeOH for residue (20mL) washing, merge organic facies vacuum concentration, obtain the chloro-3-phenyl-2-of 5-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (1-2) is (900mg).Crude product directly is used in later step without being further purified.

5-diazanyl-3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (1-3)

Add the chloro-3-phenyl-2-of 5-(4-{[4-(5-pyridine-2-base-1H-1 in the 25mL RB flask that is equipped with stirring rod, 2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (1-2) (900mg, 1.6mmol), then add anhydrous NH ₂NH ₂(8mL).Suspension is heated to 110 ℃ and stirring and refluxing 5 hours, after will reacting cool to room temperature, the reactant mixture vacuum concentration is obtained to micro-yellow powder (900mg).Crude product is directly used in later step without being further purified.

To the 5-diazanyl in DMF (1.5mL)-3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (1-3) (70mg, 0.126mmol) in add document known 1,1-bis--1H-imidazoles-1-ylmethyl imines (102mg, 0.633mmol).Reactant mixture stirs 4 hours at 85 ℃, vacuum concentration, chromatographic isolation obtains required 9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazol [3,4-f]-1,6-naphthyridines-3-amine (1-4) (46mg), is trifluoroacetate. ¹HNMR：(500MHz，CDCl ₃)δ 8.76(s，1H)，8.74(d，J＝4.3Hz，1H)，8.29-8.27(m，2 H)，8.19(m，1H)，7.67(m，1H)，7.54-7.53(m，2H)，7.48-7.46(m，2H)，7.47(d，J＝7.7Hz，1H)，7.34-7.26(m，5H)，4.43(s，2H)，3.65(br d，J＝10.9Hz，2H)，3.46(br s，1H)，3.27-3.19(m，2H)，2.50-2.42(m，2H)，2.10-2.06(m，2H)。

Compound in following table 1 is with the similar fashion preparation shown in diagram 1 and reaction scheme one joint.

Table 1

Reaction scheme 2

3-methyl-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (2-2)

To the 5-diazanyl in DMF (1.0mL)-3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (2-1) (55mg, 0.101mmol) the middle trimethyl orthoacetate (0.63mL, 5.04mmol) that adds.Reactant mixture stirs 3 hours at 100 ℃, then vacuum concentration, and chromatographic isolation, obtain required 3-methyl-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazol [3,4-f]-1,6-naphthyridines (2-2) (28 mg) is trifluoroacetate. ¹H NMR：(500MHz，CDCl ₃)δ8.87(s，1H)，8.65(d，J＝6.4Hz，1H)，8.33(d，J＝7.5Hz，1H)，8.11(d，J＝7.8Hz，1H)，7.92(t，J＝7.8Hz，1H)，7.49-7.41(m，3 H)，7.36-7.30(m，8H)，3.61(s，2H)，3.02-3.00(m，2H)，3.00-2.84(m，1H)，2.25-2.21(m，2H)，2.10-1.83(m，4H)，1.97(s，3H)。

Compound in following table 2 is with the similar fashion preparation shown in diagram 2 and reaction scheme one joint.

Table 2

Reaction scheme 3

8-(4-amino methyl-phenyl)-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-3-alcohol (3-8)

Steps A: (the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester (3-1)

4-Amino-2-Chloropyridine (1.28gm, 10mmol) He two dimethyl dicarbonate butyl ester (2.21gm, 10.1mmol) solution in THF (20mL) is cooled to 0 ℃, slowly add two (trimethyl silyl) Lithamide .s of 1 M at THF (20mL when keeping temperature lower than 0 ℃, solution 20mmol), made to react the room temperature of rising again in 1 hour, then by adding aqueous ammonium chloride solution (15mL) the quencher reaction of 1.5 N, stir after several hours, reactant is extracted in ethyl acetate, use the salt water washing, organic layer is through super-dry (Na ₂SO ₄), filter and evaporation.Residue and ether grind, and obtain pure (2-chloropyridine-4-yl) carbamic acid tertiary butyl ester.Mother solution separates by silica gel chromatography, with 25-45% ethyl acetate/hexane eluting, obtains more voluminous thing.

Under inert atmosphere, the solution of (2-chloropyridine-4-yl) carbamic acid tertiary butyl ester (1.14gm, 5mmol) in anhydrous THF (20mL) is cooled to-70 ℃, and slowly adds 1.7M tert-butyl lithium/pentane (8mL, 13.5mmol).Reaction is stirred 2 hours, then adds dry DMF (1.2mL 15.5mmol), makes the sluggish room temperature of rising again in 3 hours, 3 N HCl (12mL) quenchers reactant mixture for, and dilute ether layer NaHCO with ether ₃Solution washing, dry (Na ₂SO ₄), filter and evaporate, residue and cold diethyl ether grind, and obtain pure (the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester.Mother solution separates by silica gel chromatography, with 15-20% ethyl acetate/hexane eluting, obtains more voluminous thing.1H-NMR(500MHz，CDCl ₃)：δ11.0(1H，br s)，10.52(1H，s)，8.38(1H，d，J＝6Hz)，8.31(1H，d，J＝6 Hz)，1.54(9H，s)；m/e(m+1)：257.2。

Step B:1-[4-(1,3-dioxolane-2-yl) phenyl]-2-Phenyl ethyl ketone (3-2)

Add p-methyl benzenesulfonic acid (300mg) to 4-cyanobenzaldehyde (20.0g, 152.5mmol) and ethylene glycol (25.5mL, 457.5mmol) in solution in toluene (250mL).Flask is equipped with dean stark trap, and mixture is heated to reflux.After 5 hours, that mixture is concentrated, residue is dissolved in ethyl acetate, use saturated NaHCO ₃, water (2x) and salt water washing, organic layer is through super-dry (Na ₂SO ₄), filter and concentrate, obtaining 4-(1,3-dioxolane-2-yl) benzonitrile is transparent grease, it solidifies under vacuum: 1H-NMR (500MHz, CDCl ₃): δ 7.67 (2H, d, J=8.06Hz), 7.59 (2H, d, J=8.30Hz), 5.85 (1H, s), 4.13-4.05 (4H, m).

0 ℃ to slowly add in the solution of 4-(1,3-dioxolane-2-yl) benzonitrile (5.0g, 28.54mmol) in anhydrous THF (100mL) benzylmagnesium chloride (36mL, the THF solution of 20%wt, 43mmol).The room temperature of after 1 hour, mixture being risen again, after 4 hours be cooled to mixture 0 ℃ and use saturated NH ₄The Cl quencher.By rise again room temperature extract (3x) by ethyl acetate of mixture, the organic layer of merging is through super-dry (MgSO ₄), filter and concentrate, dodge column chromatography and separate (10% ethyl acetate/hexane), obtain 1-[4-(1,3-dioxolane-2-yl) phenyl]-the 2-Phenyl ethyl ketone, be faint yellow solid: 1H-NMR (500MHz, CDCl ₃): δ 8.02 (2H, d, J=8.30Hz), 7.57 (2H, d, J=8.30Hz), 7.38-7.24 (%H, m), 5.86 (1H, s), 4.29 (2H, s), 4.28-4.09 (4H, m).

The chloro-2-of step C:5-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines (3-3)

At room temperature to (the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester (3-1; 30.5g; 118.9mmol) and 1-[4-(1; 3-dioxolane-2-yl) phenyl]-2-Phenyl ethyl ketone (3-2; 29.0g; 108.1mmol) in solution in anhydrous THF (300mL) continuous adding LHMDS (1M, in THF, 248mL).Reactant mixture at room temperature stirs and spends the night, and then refluxes 24 hours, and it is cooling and be condensed into slurry, and uses NaHCO ₃(saturated, 50mL) and water (300mL) process, obtain solid, solid collected by filtration, by solid drying, with the ether washing, further, with the methylbenzene azeotropic drying, obtain title compound.LRMS m/z (M+1) value of calculation: 389.1, measured value: 389.1.

Step D:[2-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines-5-yl]-hydrazine (3-4)

Chloro-2-(the 4-[1 of 5-, 3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines (3-3,5.2g, 13.4mmol) and the suspension of anhydrous hydrazine (5mL) in anhydrous Isosorbide-5-Nitrae-dioxane (15mL) in microwave reactor 100 ℃ the heating 5 minutes, reaction mixture, concentrated and with the methylbenzene azeotropic drying, obtain title compound, be solid.LRMS m/z (M+1) value of calculation: 385.2, measured value: 385.3.

Step e: 8-(4-[1,3] dioxolane-2-base-phenyl)-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-3-alcohol (3-5)

At 0 ℃ to [2-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines-5-yl]-hydrazine (3-4,5.3g, 13.8mmol) is at CH ₂Cl ₂(anhydrous, add triethylamine (9.7mL, 68.9mmol) in the solution in 40mL), then be added on rapidly the phosgene (2M, 7.6mL) in toluene.Stirring at room 10 minutes, enriched mixture also added water (30mL), collect solid and with the methylbenzene azeotropic drying, obtain title compound, its for later step without being further purified.LRMS m/z (M+1) value of calculation: 411.1, measured value: 411.2.

Step F: 4-(3-hydroxyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzaldehyde (3-6)

8-(4-[1,3] dioxolane-2-base-phenyl)-9-phenyl-[1,2,4] triazol [3,4-f] [1,6] naphthyridines-3-alcohol (3-5,2.7g 6.6mmol) suspension in dioxane (20mL) and 2N HCl (20mL) was stirring at room 20 minutes.It is concentrated to remove most of dioxane at 25 ℃, the residue impouring, with in ice-cooled water, is obtained to brown solid, solid collected by filtration, with the methylbenzene azeotropic drying, obtain title compound.LRMS m/z (M+1) value of calculation: 367.1, measured value: 367.1.

Step G:8-(4-amino methyl-phenyl)-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-3-alcohol (3-8)

4-(3-hydroxyl-9-phenyl-[1,2,4] triazol [3,4-f] [1,6] naphthyridines-8-yl)-benzaldehyde (3-6,2.4g, 6.6mmol) with 2-amino-2,4-dimethyl valeric acid (3-7,1.9g, 13.1mmol) suspension in DMF (25mL) is 150 ℃ of heating 20 minutes, and reactant mixture is cooling, with dioxane (50mL) and 2N HCl (50mL), dilute, then 100 ℃ of heating 30 minutes, mixture is cooling and by reversed-phase HPLC (0-60% acetonitrile/water) purification, obtain title compound after evaporating solvent, be yellow solid.HRMS m/z (M+1) value of calculation: 368.1506, measured value: 368.1504.

¹H-NMR(CD ₃OD)δ8.72(s，1H)，7.98(d，1H)，7.52(d，2H)，7.46(d，2H)，7.24-7.38(m，5H)，7.12(d，1H)，4.14(s，2H)。

Reaction scheme 4

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (4-3)

Steps A: 8-[4-(1,3-dioxolane-2-yl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (4-1)

To [2-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines-5-yl]-hydrazine (3-4,1.6g, 4.2mmol) and toluenesulfonic acid monohydrate (79mg, 0.4mmol) add trimethyl orthoformate (0.58mL, 12.5mmol) in solution in the toluene of 3: 1: MeOH (16mL).Mixture is heated to 100 ℃ and continues 1 hour in microwave reactor, then by the reactant mixture vacuum concentration, collect solid and with the methylbenzene azeotropic drying, obtain title compound, its for later step without being further purified.LRMS m/z (M+1) value of calculation: 395.1, measured value: 395.2.

Step B:4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzaldehyde (4-2)

8-[4-(1,3-dioxolane-2-yl) phenyl]-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines (4-1,0.80g, 2.0mmol) suspension in dioxane (10mL) and 3N HCl (10mL) at room temperature stirs 15 minutes, mixture is concentrated to remove most dioxane at 25 ℃.By the residue impouring with in ice-cooled water, obtaining brown solid, by solid collected by filtration, and with methylbenzene azeotropic dry (x2), obtain title compound.LRMS m/z (M+1) value of calculation: 351.1, measured value: 351.2.

Step C:1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (4-3)

4-(9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines-8-yl) benzaldehyde (4-2,0.80g, 2.3mmol) with 2-amino-2,4-dimethyl valeric acid (3-7,0.340g, 2.3mmol) suspension in DMF (10mL) is 150 ℃ of heating 30 minutes, and reactant mixture is cooling, solvent removed in vacuo.Thick residue is dissolved in 3N HCl (8mL) and at 100 ℃ and heats 30 minutes.Mixture is cooling, and by reversed-phase HPLC purification (the 5-65% acetonitrile/water, in 15 minutes), evaporating solvent obtains title compound, is yellow solid.

¹H-NMR(CD ₃OD)δ9.60(s，1H)，8.98(s，1H)，8.73(d，1H)，7.75(d，1H)，7.60(d，2H)，7.46(d，2H)，7.39-7.36(m，5H)，4.15(s，2H)。

Reaction scheme 5

4-(3-methyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzyl amine (5-3)

Steps A: 8-[4-(1,3-dioxolane-2-yl) phenyl]-3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (5-1)

To [2-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines-5-yl]-hydrazine (3-4,0.35g, 0.91mmol) and toluenesulfonic acid monohydrate (17mg, 0.09mmol) add trimethyl orthoacetate (0.157mL, 1.23mmol) in solution in the toluene of 3: 1: MeOH (4mL).Mixture is heated to 100 ℃ and continues 75 minutes in microwave reactor, then by the reactant mixture vacuum concentration, collect solid and with the methylbenzene azeotropic drying, obtain title compound, its for later step without being further purified.LRMS m/z (M+1) value of calculation: 409.2, measured value: 409.2.

Step B:4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzaldehyde (5-2)

8-[4-(1,3-dioxolane-2-yl) phenyl]-3-methyl-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines (5-1,0.30g, 0.73mmol) suspension in dioxane (5mL) and 3N HCl (5mL) at room temperature stirs 15 minutes, mixture is concentrated to remove most dioxane at 25 ℃.By the residue impouring with in ice-cooled water, obtaining brown solid, by solid collected by filtration, and with methylbenzene azeotropic dry (x2), obtain title compound.LRMS m/z (M+1) value of calculation: 365.1, measured value: 365.2.

Step C:4-(3-methyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzyl amine (5-3)

4-(3-methyl-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines-8-yl) benzaldehyde (13,0.25g, 0.69mmol) with 2-amino-2,4-dimethyl valeric acid (3-7,0.101g, 0.69mmol) suspension in DMF (3mL) is 150 ℃ of heating 30 minutes, and reactant mixture is cooling, solvent removed in vacuo.Thick residue is dissolved in 3N HCl (2.5mL) and at 100 ℃ and heats 30 minutes.Mixture is cooling, and by reversed-phase HPLC purification (the 5-65% acetonitrile/water, in 15 minutes), evaporating solvent obtains title compound, is yellow solid.HRMS m/z (M+1) value of calculation: 366.1713, measured value: 366.1715.

Reaction scheme 5 (alternative synthetic schemes)

Steps A: 4-(the chloro-3-phenyl of 5--[1,6] naphthyridines-2-yl)-benzaldehyde (A)

At 0 ℃ of 3N HCl (25.7mmol) that adds 8.5mL to 3-3 (5.0g, 12.9mmol) in the solution in Isosorbide-5-Nitrae-dioxane (30mL).Make rise again room temperature stirring 1.3 hours of mixture.Reaction NaHCO ₃(saturated) quencher is until pH=7-8.EtOAc for mixture (x3) extracts.The organic layer salt water washing merged, use MgSO ₄Drying, and concentrated, obtain yellow solid, be required product A.LC/MS measured value: M+1=345.1.

Step B:[4-(the chloro-3-phenyl of 5--[1,6] naphthyridines-2-yl)-benzyl]-carbamic acid tertiary butyl ester (C)

Add triethyl silicane (8.5g, 73mmol) to A (2.8g, 8.1mmol) and B (1.1g, 8.9mmol) in solution in the anhydrous MeCN of 15mL, then add trifluoroacetic acid (3.7g, 32.5mmol).Mixture at room temperature stirs 3 hours, then will in mixture impouring sodium bicarbonate aqueous solution (30mL) and with EtOAc, extract (x3).The organic layer salt water washing merged, use MgSO ₄Drying, except desolventizing the time, residue, by dodging the column chromatography purification, obtains required product C.LC/MS measured value: M+1=446.1.

Step C:[4-(5-diazanyl-3-phenyl-[1,6] naphthyridines-2-yl)-benzyl]-carbamic acid tertiary butyl ester (D)

Drip hydrazine (6.1g, 189.1mmol) in solution to C (3.7g, 8.3mmol) in 22mL Isosorbide-5-Nitrae-dioxane.Mixture heats 5 minutes at 100 ℃ in microwave reactor.Except after desolventizing, be dissolved in EtOAc by residue and use saturated NaHCO ₃Solution washing.Organic layer salt water washing, use MgSO ₄Dry and concentrated, obtain required product D, its step for back is without being further purified.LC/MS measured value: M+1=442.2.

Step D:[4-(3-methyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzyl]-carbamic acid tertiary butyl ester (E)

Add trimethyl orthoacetate (1.4g, 11.6mmol) to D (3.8g, 8.6mmol) and p-methyl benzenesulfonic acid monohydrate (0.08g, 0.4mmol) in solution in 20mL toluene and methanol (3: 1).Solution heats 35 minutes at 100 ℃ in microwave reactor.Reaction NaHCO ₃(0.5g) solid quencher.The organic layer process is concentrated, and, dodging purification (100%EtOAc is to 10%MeOH/90%EtOAc, in 35 minutes) on column chromatography, obtains required product E.LC/MS measured value: M+1=466.2.

Step e: 4-(3-methyl-9-phenyl-[1,2,4] triazol [3,4-f[1,6] naphthyridines-8-yl)-benzyl amine (5-3)

To E (4.1g, 8.7mmol) at 80mL CH ₂Cl ₂In solution in drip 40mL TFA.Mixture at room temperature stirs 15 minutes, except desolventizing, and residue NaHCO ₃(saturated) processed until pH=9.Mixture extracts (x6) with EtOAc, and the organic layer of merging, through concentrated, is used MgSO ₄Drying, except after desolventizing, obtain required product 5-6, is yellow solid.LC/MS measured value: M+1=366.1. ¹H-NMR(CD ₃OD)δ8.95(s，1H)，8.66(d，1H)，7.82(d，1H)，7.60(d，2H)，7.45(d，2H)，7.42-7.34(m，5H)，4.15(s，2H)，3.00(s，3H)。

Reaction scheme 6

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-2)

Steps A: 8-[4-(1,3-dioxolane-2-yl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-1)

Add Bromine cyanide. (5M is in MeCN for 0.104mL, 0.52mmol) in anhydrous EtOH (1mL), then add sodium carbonate (96mg, 0.91mmol).Add [2-(4-[1,3] dioxolane-2-base-phenyl)-3-phenyl-[1,6] naphthyridines-5-yl]-hydrazine (3-4,100mg, 0.26mmol), mixture stirs 3 hours, the reactant mixture vacuum concentration, the solid obtained is directly used without being further purified.LRMS m/z (M+1) value of calculation: 410.2, measured value: 410.1.

Step B:8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-2)

Use process (5-1 is to 5-3) described in diagram 5, from 8-[4-(1,3-dioxolane-2-yl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine (6-1) prepares title compound.LRMS m/z (M+1) value of calculation: 367.2, measured value: 367.1.

Reaction scheme 7

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (7-4)

Steps A: 2-methyl-N-{ (1E)-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methene base } propane-2-sulfenamide (7-2)

Racemic 2-methyl-2-propane-sulfenamide (7-1,647mg, 5.3mmol), copper sulfate (1.70g, 7.30mmol) and aldehyde 4-2 (511mg, 1.45mmol) in dichloromethane (10mL), at 50 ℃, stir 5 days, after cool to room temperature, mixture passes through diatomite filtration, be concentrated into minimum volume, and (0-10%MeOH, at CH by the automatic silica gel chromatogram purification ₂Cl ₂In, in 30 minutes), obtain title compound, be the brown foam.LRMS m/z (M+1) value of calculation: 454.2, measured value: 454.2.

Step B:2-methyl-N-{1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } propane-2-sulfenamide (7-3)

At-78 ℃ by methyl-magnesium-bromide solution (13.5mL, 1.4 the solution in 3: 1 toluene/THF of M, 19mmol) add the 2-methyl-N-{ (1E) of stirring-[4-(9-phenyl [1 to, 2, 4] triazol [3, 4-f]-1, 6-naphthyridines-8-yl) phenyl] the methene base } propane-2-sulfenamide (7-2, 298mg, 0.66mmol) in solution in dichloromethane (5mL), the solution room temperature of rising again, after 18 hours, reaction saturated ammonium chloride solution quencher, by ethyl acetate, extract, use the salt water washing, use dried over mgso, filter and concentrate, obtain amber foam, it separates (0-10% methanol/CH by silica gel chromatography ₂Cl ₂, in 30 minutes), obtain title compound, be yellow foam.LRMS m/z (M+1) value of calculation: 470.2, measured value: 470.3.

Step C:1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (7-4)

To 2-methyl-N-{1-[4-(9-phenyl [1,2, the 4] triazol [3 stirred, 4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } add dense HCl (1.5mL) in the propane-solution of 2-sulfenamide (7-3,180mg, 0.38mmol) in methanol (6mL).After 1 hour, add water, the mixture washed with dichloromethane.Water alkalizes with saturated sodium carbonate solution, and uses dichloromethane extraction.Add 2N HCl (5mL) in organic layer, mixture is concentrated into minimum volume.Crude product is used anti-phase preparative HPLC purification, obtains title compound, is faint yellow solid.LRMS m/z (M+1) value of calculation: 366.2, measured value: 366.3.

Reaction scheme 8

9-phenyl-8-{4-[4-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl }-[1,2,4] triazols [3,4-f] [1,6] naphthyridines (8-10)

(the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester (8-1)

By 4-Amino-2-Chloropyridine (1.28g, 10mmol) He two dimethyl dicarbonate butyl ester (2.21g, 10.1mmol) solution in THF (20mL) is cooled to 0 ℃, and slowly add two (trimethyl silyl) Lithamide .s (20mL, 20mmol) in THF of 1M when keeping temperature lower than 0 ℃.Made the mixture room temperature of rising again in 1 hour, then, by adding aqueous ammonium chloride solution (15mL) the quencher reaction of 1.5N, mixture is extracted in ethyl acetate, use the salt water washing, organic layer is through super-dry (Na ₂SO ₄), filter and evaporation.Residue and ether grind, and obtain pure (2-chloropyridine-4-yl) carbamic acid tertiary butyl ester.Mother solution separates by silica gel chromatography, with 25-45% ethyl acetate/hexane eluting, obtains more voluminous thing.

Under inert atmosphere, the solution of (2-chloropyridine-4-yl) carbamic acid tertiary butyl ester (1.14g, 5mmol) in anhydrous THF (20mL) is cooled to-70 ℃, slowly adds 1.7M tert-butyl lithium/pentane (8mL, 13.5mmol).Reaction is stirred 2 hours, then adds dry DMF (1.2mL, 15.5mmol), makes the sluggish room temperature of rising again in 3 hours, and 3N HCl (12mL) quencher for reactant mixture, dilute with ether.Ether layer NaHCO ₃Solution washing, dry (Na ₂SO ₄), filter and evaporate.Residue and cold diethyl ether grind and obtain pure (the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester.Mother solution separates by silica gel chromatography, with 15-20% ethyl acetate/hexane eluting, obtains more voluminous thing.1H-NMR(500MHz，CDCl ₃)：δ11.0(1H，br s)，10.52(1H，s)，8.38(1H，d，J＝6Hz)，8.31(1H，d，J＝6Hz)，1.54(9H，s)；m/e(m+1)：257.2。

1-[4-(1,3-dioxolane-2-yl) phenyl]-2-Phenyl ethyl ketone (8-2)

Add p-methyl benzenesulfonic acid (300mg) to 4-cyanobenzaldehyde (20.0g, 152.5mmol) and ethylene glycol (25.5mL, 457.5mmol) in solution in toluene (250mL).Flask is equipped with dean stark trap, and mixture is heated to reflux.After 5 hours, that mixture is concentrated, residue is dissolved in ethyl acetate, use saturated NaHCO ₃, water (2x) and salt water washing, organic layer is through super-dry (MgSO ₄), filter and concentrate, obtain 4-(1,3-dioxolane-2-yl) benzonitrile, be colorless oil, it solidifies under vacuum: 1H-NMR (500MHz, CDCl ₃): δ 7.67 (2H, d, J=8.06Hz), 7.59 (2H, d, J=8.30Hz), 5.85 (1H, s), 4.13-4.05 (4H, m).

0 ℃ to slowly add in the solution of 4-(1,3-dioxolane-2-yl) benzonitrile (5.0g, 28.54mmol) in anhydrous THF (100mL) benzylmagnesium chloride (36mL, the THF solution of 20%wt, 43mmol).The room temperature of after 1 hour, mixture being risen again, after 4 hours, be cooled to 0 ℃ and use saturated NH by mixture ₄The Cl quencher.By rise again room temperature extract (3x) by ethyl acetate of mixture, the organic layer of merging is through super-dry (MgSO ₄), filter and concentrate, dodge column chromatography and separate (10% ethyl acetate/hexane), obtain 1-[4-(1,3-dioxolane-2-yl) phenyl]-the 2-Phenyl ethyl ketone, be faint yellow solid: 1H-NMR (500MHz, CDCl ₃): δ 8.02 (2H, d, J=8.30Hz), 7.57 (2H, d, J=8.30Hz), 7.38-7.24 (5H, m), 5.86 (1H, s), 4.29 (2H, s), 4.28-4.09 (4H, m).

2-[4-(1,3-dioxolane-2-yl) phenyl]-5-methoxyl group-3-phenyl-1,6-naphthyridines (8-3)

To 1-[4-(1; 3-dioxolane-2-yl) phenyl]-2-Phenyl ethyl ketone (997mg; 3.72mmol) and (the chloro-3-formoxyl of 2-pyridin-4-yl) carbamic acid tertiary butyl ester (924mg; 3.6mmol) add 25 in part solution in absolute methanol (14mL), wt% Feldalat NM/methanol (2.5mL, 11.4mmol).Reactant mixture was 65 ℃ of heating 4 hours, and cooling reaction mass is through concentrated to remove methanol, and residue distributes between water and ethyl acetate.Organic layer is through super-dry (Na ₂SO ₄), filter and evaporation, residue and cold diethyl ether grind, and obtain pure 2-[4-(1,3-dioxolane-2-yl) phenyl]-5-methoxyl group-3-phenyl-1, the 6-naphthyridines.Mother solution, by the silica gel chromatography separation and purification, with 20-40% ethyl acetate/hexane eluting, obtains more voluminous thing.1H-NMR(500MHz，CDCl ₃)：δ8.54(1H，s)，8.23(1H，d，J＝5.9Hz)，7.55(1H，d，J＝5.9Hz)，7.48(2H，d，J＝8Hz)，7.40(2H，d，J＝8Hz)，7.29-7.30(3H，m)，7.22-7.25(2H，m)，4.16(3H，s)，4.02-411(4H，2m).m/e(m+1)：385.1。

4-(5-methoxyl group-3-phenyl-1,6-naphthyridines-2-yl) benzaldehyde (8-4)

To 2-[4-(1,3-dioxolane-2-yl) phenyl]-5-methoxyl group-3-phenyl-1, the molten middle interpolation 1N HCl (6mL) of 6-naphthyridines (760mg, 1.98mmol) in THF (8mL), solution stirring 3 hours.Add ethyl acetate, mixture Na ₂CO ₃The aqueous solution alkalization.Organic layer is through super-dry (Na ₂SO ₄), filter and evaporating solvent.Residue and ether grind, and obtain pure product.Mother solution, by silica gel chromatography, with 10-30% ethyl acetate/hexane eluting, obtains more voluminous thing.1H-NMR(500MHz，CDCl ₃)：δ10.10(1H，s)，8.60(1H，s)，8.26(1H，d，J＝6Hz)，7.81(2H，d，J＝8.3Hz)，7.62(2H，d，J＝8.3Hz)，7.56(1H，d，J＝6.1Hz)，7.30-7.32(3H，m)，7.21-7.23(2H，m)，4.17(3H，s).m/e(m+1)：341.1。

2-(3-piperidin-4-yl-1H-1,2,4-triazole-5-yl) pyridine dihydrochloride (8-5)

Add in the solution of 1-(tertbutyloxycarbonyl)-piperidines-4-carboxylic acid (4.59g, 20mmol) in dichloromethane (50mL) by carbonyl dimidazoles (3.57g, 22mmol) and stir 2 hours until stop gas and emit.Then add hydrazine (0.8mL ,～26mmol) in reaction, reaction is at room temperature stirred other 2 hours, and more dichloromethane dilution for reaction, use saturated NaHCO ₃Solution washing.The organic layer anhydrous Na ₂SO ₄Drying, filter and evaporating solvent, obtains the residue of thickness, and itself and ether grind, and obtain 4-(diazanyl carbonyl)-piperidines-1-carboxylic acid tertiary butyl ester, are pale solid.1H NMR(500MHz，CDCl ₃)：

6.77(1H，br s)，4.15(2H，br s)，3.90(2H，v br s)，2.75(2H，b s)，2.22(1H，m)，1.78(2H，br d，J＝11.9Hz)，1.66(2H，br q，J＝12.2Hz，J＝27.5Hz)，1.47(9H，s)。

This material (2.43g, 10mmol) is dissolved in anhydrous cellosolvo (20mL) and in solution and adds 2-cyanopyridine (1.14g, 11mmol).Add 25wt% Feldalat NM/methanol (1.1mL ,～5mmol), mixture is heated to 130 ℃ and continues 16 hours, and cooling reaction mass is with the acetic acid neutralization and at descendants' ethyl ester and NaHCO ₃Between aqueous solution, distribute, organic layer is through Na ₂SO ₄Drying, remove by filter salt, vacuum evaporating solvent, and residue and ether grind, and obtain 4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid tertiary butyl ester, are white solid.1HNMR(500MHz，CDCl ₃)：δ8.70(1H，d，J＝3.9Hz)，8.19(1H，d，J＝7.9Hz)，7.87 (1H，d t，J＝1.7Hz，J＝8Hz)，7.40(1H，m)，4.20(2H，br s)，3.03(1H，m)，2.95(2H，br s)，2.09(2H，br d，J＝12Hz)，1.86(2H，br q，J＝4.2Hz)，1.49(9H，s)；m/e(m+1)：330.2。

This material (2.68g, 8.14mmol) is suspended in 4N HCl/ dioxane, and reactant mixture at room temperature stirs 16 hours, and then, with the ether dilution, the isolated by filtration solid, clear up the hygroscopicity solid in acetonitrile.The isolated by filtration solid, partly be dissolved in it in hot methanol, cooling after, add some ether in solution, 2-(3-piperidin-4-yl-1H-1,2,4-triazole-5-yl) pyridine is precipitated out with the form of dihydrochloride lentamente.1H NMR(500MHz，DMSO-d6)：

9.10(1H，br s)，8.92(1H，br s)，8.73(1H，d，J＝4.9Hz)，8.10-8.20(2H，m)，7.64(1H，t，J＝5.7Hz)，3.33(2H，br d，J＝12.7Hz)，3.16(1H，m)，3.05(2H，brq，J＝11.9Hz，J＝21.8Hz)，2.18(2H，br d，J＝11.5Hz)，1.99(2H，br q，j＝11.0Hz，J＝22.2Hz)：m/e(m+1)：230.3。

5-methoxyl group-3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-l, 2,4-triazole-3-yl) piperidin-1-yl] methyl) phenyl-1,6-naphthyridines (8-6)

To 2-(3-piperidin-4-yl-1H-1,2,4-triazole-5-yl) pyridine dihydrochloride (542mg, 1.80mmol) and 4-(5-methoxyl group-3-phenyl-1,6-naphthyridines-2-yl) benzaldehyde (560mg, 1.65mmol) add triethylamine (0.83mL, 6mmol) in solution in dry DMF (6mL).After stirring 10 minutes, add acetic acid (1.03mL, 18mmol), mixture at room temperature stirs and spends the night, then disposable interpolation sodium triacetoxy borohydride (367mg, 1.73mmol), and stir 6 hours, with after the LC/MS monitoring, determine that reaction does not complete, add in the back the sodium triacetoxy borohydride (2 * 90mg) of other umber in several hours, now reacted.Mixture dilutes by ethyl acetate, adds Na ₂CO ₃Aqueous solution.Separate organic layer and wash twice with water, dry (Na ₂SO ₄), and evaporating solvent.Residue is cleared up in acetonitrile, filtered to isolate solid product when cooling.This solid suspension is also slowly added in hot ethyl acetate to methanol, until dissolve fully.Then make the solvent boiling that its volume is reduced, and cooling until pure product crystallization.The mother solution silica gel chromatography, with 1-7% methanol/ethyl acetate eluting, obtain more voluminous thing.1H NMR(500MHz，CDCl ₃)： 8.66(1H，d，J＝4.7Hz)，8.54(1H，s)，8.23(1H，d，J＝6Hz)，8.16(1H，d，J＝7.8Hz)，7.83(1H，dt，J＝1.7Hz，J＝7.8Hz)，7.56(1H，d，J＝6Hz)，7.40(2H，d，J＝8Hz)，7.36(1H，dd)，7.28-7.30(3H，m)，7.23-7.25(2H，m)，4.16 (3H，s)，3.54(2H，s)，2.96(2H，br d，J＝11.5Hz)，2.85(1H，t，J＝3.7Hz)，2.06-2.17(4H，m)，1.92-2.01(2H，m).m/e(m+1)：554.3，277.9[(m+2)/2]。

3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines-5 (6H)-one (8-7)

5-methoxyl group-3-phenyl-2-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl) phenyl)-1,6-naphthyridines (725mg, 1.31mmol) and pyridine hydrochloride (6.9gm,～60mmol) mixture, 150 ℃ of heating 1 minute, is dissolved in cooling residue in the water of minimum, uses NaHCO ₃The aqueous solution neutralization.Filter the solid that collecting precipitation goes out, and by silica gel chromatography, with 1-14% acetonitrile/ethyl acetate (saturated NH ₄OH) eluting, the product of separation is cleared up in methanol/acetonitrile, obtains pure products.1H NMR(500MHz，DMSO-d6)：

11.58(1H，d，J＝4.8Hz)，8.68(1H，br s)，8.39(1H，s)，8.03(1H，d，J＝7.3Hz)，7.50(2H，t，J＝6.5Hz)，7.31-7-33(5H，m)，7.24-7.25(4H，m)，6.79(2H，d，J＝7.3Hz)，3.50(2H，s)，2.84(2H，br d，J＝10.5Hz)，2.72(1H，m)，2.08(2H，br t，J＝11Hz)，1.95(2H，br d，J＝11.6Hz)，1.77(2H，m).m/e(m+1)：540.3，270.9[(m+2)/2]。

The chloro-3-phenyl-2-{4-[4-of 5-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl)-[1,6] naphthyridines (8-8)

8-7 (5.5g, 10.2mmol) and POCl ₃(50.0g, 326.1mmol) and DMF (0.3g, 4.1mmol) were 130 ℃ of reflux 3 hours, and reactant mixture is cooling and concentrated to remove POCl ₃.Add 40mL toluene concentrated, obtain solid, to the H that adds 50mL in solid ₂The NaHCO of O and 40mL ₃The 1N NaOH of (saturated) and 20mL, until pH=9.Mixture, through stirring to be settled out solid, filters and collects this solid, is required product 8-8.Its water and CH ₃CN washing, and vacuum drying.LC/MS：M+1＝59.09。

(3-phenyl-2-{4-[4-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl)-[1,6] naphthyridines-5-yl)-hydrazine (8-9)

The suspension of 8-8 (4.3g, 7.7mmol) in 30mL Isosorbide-5-Nitrae-dioxane and hydrazine (7.4g, 231.1mmol) heats 5 minutes at 100 ℃ in microwave reactor, and mixture is cooling and concentrated to remove desolventizing.Add toluene 40mL (x3), and vacuum is removed residual hydrazine.Obtaining required product 8-9, is solid.LC/MS：M+1＝554.4。

9-phenyl-8-{4-[4-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl)-[1,2,4] triazols [3,4-f] [1,6] naphthyridines (8-10)

Add trimethyl orthoformate (3.5g, 32.5mmol) and toluenesulfonic acid (0.1g, 0.8mmol) in solution to 8-9 (4.5g, 8.1mmol) in 20mL methanol and 60mL toluene.Mixture refluxes 10 hours, and except after desolventizing, residue separates (100%CHCl by dodging column chromatography ₃To 50%CHCl ₃With 50% methanol), obtain required product 8-10.

HRMS:M+1 (value of calculation)=564.2619; Measured value=564.2589.

1H NMR(500MHz，CD ₃OD)：

9.35(1H，s)，8.96(1H，s)，8.72(1H，d)，8.59(1H，d)，8.28-8.10(2H，m)，7.68-7.48(6H，m)，7.40-7.30(5H，m)，4.40(2H，s)，3.68-3.20(5H，m)，2.50-2.10(4H，m)。

Reaction scheme 9

9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (9-4)

4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) benzaldehyde (9-1)

Add 3N HCl (27mL) at 0 ℃ in the solution of 3-3 (16g, 41.1mMol) in anhydrous Isosorbide-5-Nitrae-dioxane (75mL) stirred.Then make to react and rise again room temperature and continue stir about 3 hours, after having reacted, the saturated NaHCO of reaction ₃The solution quencher is until pH>7.Product is extracted to (3 * 150mL) in ethyl acetate, and the salt water washing of the organic layer of merging, use Na ₂SO ₄And MgSO ₄Drying, filter and vacuum concentration, obtains 4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) benzaldehyde 9-1, is the sepia solid.LC/MS (M+1) value of calculation: 345.8; Measured value: 345.0.

The chloro-3-phenyl-2-of 5-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (9-2)

To the 9-1 (4.9g stirred, 14.2mMol) and 8-5 (4.2g, 15.6mMol) add triethylamine (6mL in solution in NMP (50mL), 42.6mMol), then add acetic acid (1.6mL, 28.4mMol), after the ambient temperature stirring is spent the night, portioning adds sodium triacetoxy borohydride (3.6g, 17mMol).After completing, ethyl acetate dilution for reaction, and use saturated NaHCO ₃Washing, then water and salt water washing.Organic layer Na ₂SO ₄And MgSO ₄Drying, filter and vacuum concentration.The hurried chromatogram purification of thick residue use silica gel (gradient elution: 0% to 10% methanol, at CHCl ₃In, in 25 minutes), obtain 9-2, be orange solids.LC/MS (M+1) value of calculation: 559.1; Measured value: 559.2.

5-diazanyl-3-phenyl-2-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (9-3)

Add hydrazine (5.9mL, 188.1mMol) in the solution of 9-2 (5g, 8.9mMol) in anhydrous Isosorbide-5-Nitrae-dioxane (20mL) stirred.Solution is heated to 100 ℃ and continues 5 minutes in microwave reactor, solvent removed in vacuo, and with dry 3 times of methylbenzene azeotropic.Rough solid and saturated NaHCO ₃Solution grinds 20 minutes.Suspension filters and uses enough water washings, and dry three times of solid and methylbenzene azeotropic, obtain 9-3, is the sepia solid.LC/MS (M+1) value of calculation: 554.6; Measured value: 554.2.

To the 9-3 (2.0g stirred, 3.6mMol), HOBT (0.5g, 3.9mMol) and 1H-1,2,3-triazole-4-carboxylic acid (0.4g, 3.9mMol) add DIEA (1.2mL in solution in dry DMF (20mL), 7.2mMol), then add EDC (0.76g, 3.9mMol), solution stirs and spends the night at ambient temperature, solution is by the acetic acid treatment of 2mL and be heated to 80 ℃ and continue 3 hours, and after cool to room temperature, solution filters by syringe filter and purification on the C18 reversed-phase HPLC, obtaining 9-4, is solid.(M+1) value of calculation: 631.2789 measured values: 631.2778.

The compound that following table (table 3) contains is used process in diagram 9 to make, and with suitable amine, replaces 8-9, with suitable carboxylic acid, replaces 1H-1,2,3-triazole-4-carboxylic acid.Compound 9-5 to 9-8 separates with HCl salt with 9-13 to 9-25.Compound 9-9 to 9-12 separates with tfa salt.

Table 3

Reaction scheme 10

9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl) phenyl } [1,2,4] triazols [3,4-f]-1,6-naphthyridines (10-4)

2-(3-piperidin-4-yl-1H-1,2,4-triazole-5-yl) pyrazine (10-1)

At room temperature to portioning in 1-(tertbutyloxycarbonyl) piperidines-solution of 4-carboxylic acid (120g, 520mmol) in DCM (250mL), add carbonyl dimidazoles (96g, 590mmol).After 30 minutes, reactant mixture is added in the solution of freshly prepd hydrazine (27g, 840mmol) in DCM (100mL).After 30 minutes, saturated solution of sodium carbonate, salt water washing for reaction, dried over sodium sulfate, filter and concentrate.The solid suspension obtained also filters in ether, obtains 4-(diazanyl carbonyl) piperidines-1-carboxylic acid tertiary butyl ester, is white solid. ¹H NMR(400MHz，DMSO-d ₆)：δ9.00(s，1H)，4.15-4.10(s，2H)，3.95-3.90(m，2H)，2.80-2.60(m，2H)，2.25-2.20(m，1H)，1.62-1.55(m，2H)，1.40(s，9H)。

At room temperature, pyrazine formonitrile HCN (2.0g, 19mmol) Feldalat NM (25wt%, 1.3mL, 5.7mmol) of the solution in methanol (20mL) in being used in methanol processed, after 30 minutes, add 4-(diazanyl carbonyl) piperidines-solution of 1-carboxylic acid tertiary butyl ester (4.6g, 19mmol) in methanol (20mL), reaction reflux 19 hours, reactant mixture is through concentrated, is dissolved in ethoxy ethanol (50mL) and reflux 22 hours.To react cool to room temperature, and with acetic acid (0.38mL, 6.6mmol) quencher concentrated, residue will be suspended in ether and filters, and obtain 4-(5-pyrazine-2-base-1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid tertiary butyl ester, be solid.HRMS (M+H ⁺): measured value=331.1876, value of calculation=331.1877; ¹H NMR (400MHz, CD ₃OD): δ 9.29 (d, J=1.6Hz, 1H), 8.70 (dd, J=2.4,1.6Hz, 1H), 8.64 (d, J=24Hz, 2H), 4.19-4.15 (m, 2H), (3.15-3.09 m, 1H), 2.97 (m, 2H), (2.07-2.03 m, 2H), 1.84-1.75 (m, 2H), 1.48 (s, 9H).

4-(5-pyrazine-2-base-1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid tertiary butyl ester (6.0g, 18mmol) solution in trifluoroacetic acid (25mL) is in stirring at room, and after 1 hour, reaction is through concentrated, the solid suspension obtained is in ethyl acetate and methanol, filtering, obtain 10-1, is tfa salt, this salt is dissolved in to 1: 1 acetonitrile: in water, be loaded on SCX ion exchange resin, use the acetonitrile rinsing, use 10%NH ₃-ethanol elution, obtain 10-1, is solid. ¹H NMR(400MHz，CDCl ₃)：δ9.28-9.26(m，1H)，8.70-8.68(m，1H)，8.60-8.58(m，1H)，3.35-3.22(m，2H)，3.15-3.05(m，1H)，2.90-2.85(m，2H)，2.15-2.08(m，2H)，1.95-1.90(m，2H)。

The chloro-3-phenyl-2-of 5-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (10-2)

Add triethylamine (0.8mL, 5.8mMol) in the 9-1 (1g, 2.9mMol) stirred and the solution of 10-1 (1.09g, 3.2mMol) in NMP (10mL), add subsequently acetic acid (0.3mL, 5.8mMol).After the ambient temperature stirring is spent the night, portioning adds sodium triacetoxy borohydride (0.6g, 2.9mMol), and after completing, ethyl acetate dilution for reaction, use saturated NaHCO ₃Washing, then water, salt water washing.Organic layer Na ₂SO ₄And MgSO ₄Drying, filter and vacuum concentration, and thick residue is used silica gel sudden strain of a muscle chromatogram purification, and (gradient: 0%-10%MeOH is at CHCl ₃In, in 25 minutes), obtain 10-2, be solid.LC/MS (M+1) value of calculation: 560.1; Measured value: 560.2.

5-diazanyl-3-phenyl-2-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (10-3)

Add hydrazine (0.56mL, 17.8mMol) in the solution of 10-2 (0.5g, 0.9mMol) in anhydrous Isosorbide-5-Nitrae-dioxane (5mL) stirred.Solution is heated to 100 ℃ and continues 5 minutes in microwave reactor, solvent removed in vacuo, and with dry 3 times of methylbenzene azeotropic.Rough solid and saturated NaHCO ₃Solution grinds 20 minutes.Suspension filters and uses enough water washings, and dry three times of solid and methylbenzene azeotropic, obtain 10-3, is brown solid.LC/MS (M+1) value of calculation: 555.6; Measured value: 555.2.

9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (10-4)

3: 1 toluene to the 10-3 (0.5g, 0.9mMol) stirred at 16mL: add trimethyl orthoformate (0.3g, 2.7mMol) and p-methyl benzenesulfonic acid monohydrate (0.017g, 0.09mMol) in the solution in methanol.Reaction is heated to 100 ℃ and continues 1 hour in microwave reactor, after cool to room temperature, and removal of solvent under reduced pressure, product is purification on the C18 reversed-phase HPLC, obtains 10-4, is solid.Quality (M+1) value of calculation: 565.2571 measured values: 565.2523.

Reaction scheme 11

9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (11-4)

2-(3-piperidin-4-yl-1H-1,2,4-triazole-5-yl) pyrimidine (11-1)

4-(diazanyl carbonyl) piperidines-1-carboxylic acid tertiary butyl ester (10.1g, 41.5mmol) and 2-cyanopyrimidine (4.36 g, 41.5mmol) mixture reflux in n-butyl alcohol (20mL) 48 hours, mixture, through concentrated, is suspended in ether, filters, obtain 4-(5-pyrimidine-2-base-1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid tertiary butyl ester, be solid.MS (M+H ⁺): measured value=331.2; ¹H-NMR (400MHz, CD ₃OD): δ 8.92 (d, J=4.0Hz, 2H), 7.52 (t, J=4.0Hz, 1H), (4.18-4.15 m, 2H), 3.14-3.08 (m, 1H), 2.98 (br.s, 2H), (2.07-2.01 m, 2H), 1.85-1.77 (m, 2H), 1.48 (s, 9H).

To 4-(5-pyrimidine-2-base-1H-1,2,4-triazole-3-yl) add the saturated solution of anhydrous HCl in ethyl acetate (60mL) in the solution of piperidines-1-carboxylic acid tertiary butyl ester (13.6g, 41.1mmol) in methanol (30mL) and DCM (15mL).After 2 hours, reaction is through concentrated, and the solid suspension obtained is in ethyl acetate and methanol, and filtration, obtains 11-1, is HCl salt.This salt is dissolved in to 1: 1 acetonitrile: in water, be loaded on SCX ion exchange resin, use the acetonitrile rinsing, use 10%NH ₃-ethanol elution, obtain 11-1, is solid.MS(M+H)：231.2。

The chloro-3-phenyl-2-of 5-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (11-2)

Add triethylamine (0.3mL, 2.2mMol) in the 9-1 (0.25g, 0.73mMol) stirred and the solution of 11-1 (0.23g, 0.87mMol) in NMP (5mL), then add acetic acid (0.082mL, 1.5mMol).After the ambient temperature stirring is spent the night, add sodium triacetoxy borohydride (0.18g, 0.87mMol).After completing, ethyl acetate dilution for reaction, use saturated NaHCO ₃Washing, then water, salt water washing.Organic layer Na ₂SO ₄And MgSO ₄Drying, filter and vacuum concentration, obtains 11-2.LC/MS value of calculation: 559.1; Measured value: 559.3.

5-diazanyl-3-phenyl-2-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (11-3)

Add hydrazine (0.45mL, 14.5mMol) in the solution of 11-2 (0.4g, 0.7mMol) in anhydrous Isosorbide-5-Nitrae-dioxane (3mL) stirred.Solution is heated to 100 ℃ and continues 5 minutes in microwave reactor, solvent removed in vacuo and with dry three times of methylbenzene azeotropic, obtain 11-3.LC/MS (M+1) value of calculation: 555.6; Measured value: 555.4.

9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (1 1-4)

To the 11-3 (0.2g stirred, 0.36mMol), HOBT (0.05g, 0.4mMol) and 1H-1,2, add DIEA (0.18mL, 1.1mMol) in the solution of 3-triazole-4-carboxylic acid (0.05g, 0.4mMol) in dry DMF (2mL), then add EDC (0.08g, 0.4mMol).Solution in microwave reactor 80 ℃ of heating 30 minutes, then solution with the acetic acid treatment of 0.5mL and in microwave reactor, be heated to 80 ℃ lasting 10 minutes.After cool to room temperature, solution by syringe filter and on the C18 reversed-phase HPLC purification, obtain 11-4, be solid.Quality (M+1) value of calculation: 632.2742 measured values: 632.274.

Reaction scheme 12

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (12-1)

To the 11-3 (0.23g stirred, 0.4mMol), HOBT (0.06g, 0.45mMol) and 1-methyl isophthalic acid H-imidazoles-4-carboxylic acid (0.06g, 0.45mMol) add DIEA (0.13mL in solution in dry DMF (2mL), 0.8mMol), then add EDC (0.09g, 0.5mMol).Solution in microwave reactor 80 ℃ of heating 15 minutes, then solution with the acetic acid treatment of 0.2mL and in microwave reactor, be heated to 80 ℃ lasting 20 minutes.After cool to room temperature, solution by syringe filter and on the C18 reversed-phase HPLC purification, obtain 12-1, be solid.Quality (M+1) value of calculation: 632.2742 measured values: 632.274.

Reaction scheme 13

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (13-3)

8-[4-(1,3-dioxolane-2-yl) phenyl]-3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (13-1)

Add EDC (2.7g, 14.3mMol) in the 3-4 (5g, 13mMol), the HOBT (1.9g, 14.3mMol) that stir and the 1-methyl isophthalic acid H-imidazoles-solution of 4-carboxylic acid (2g, 15.6mMol) in dry DMF (100mL).Solution stirs and spends the night in ambient temperature, and then the acetic acid treatment of 24mL for solution then is heated to 80 ℃ and continues 5 hours in oil bath.After cool to room temperature, add the water of equivalent, the suspension obtained is through filtering, and with enough water washings, the solid of collection and methylbenzene azeotropic three times, obtain 13-1, is the sepia solid.Quality (M+1) value of calculation: 475.1877 measured values: 475.1871.

4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzaldehyde (13-2)

Add 1N HCl (32mL) in the solution of 13-1 (2g, 4.2mMol) in THF (32mL) stirred.Along with reacting at room temperature to stir, suspension appears in 1 hour, then the saturated NaHCO of 100mL for reaction ₃The solution quencher.Suspension filters and washes with water, and dry three times of the solid of collection and methylbenzene azeotropic, obtain 13-2, is the sepia solid.Quality (M+1) value of calculation: 431.1615 measured values: 431.1616.

Add triethylamine (0.33mL, 2.3mMol) in the 13-2 (0.5g, 1.2mMol) stirred and the solution of 8-5 (0.34g, 1.3mMol) in NMP (10mL), then add acetic acid (0.13mL, 2.3mMol).After stirred overnight at room temperature, portioning adds sodium triacetoxy borohydride (0.3g, 1.3mMol).Stir after 6 hours, solution by syringe filter, filter and on the C18 reversed-phase HPLC purification, obtain 13-3, be solid.Quality (M+1) value of calculation: 644.2993 measured values: 644.2988.

The compound that following table (table 4) contains is used the process of diagram 13 to make, and with suitable amine, replaces 8-5.Compound 13-4-13-7,13-10-13-19 and 13-21 are with the isolated in form of HCl salt.Compound 13-8 and 13-9 are with the isolated in form of tfa salt.

Table 4

Compound 13-4

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (13-4)

To the 13-2 (1.5g stirred, 3.5mMol) and 10-1 (1.4g, 4.0mMol) add triethylamine (1mL in solution in NMP (30mL), 7mMol), then add acetic acid (0.4mL, 7mMol), after stirred overnight at room temperature, portioning adds sodium triacetoxy borohydride (0.9g, 4.2mMol).Stir after 6 hours, add saturated NaHCO ₃Solution is until pH is greater than 7.The suspension obtained filters and washes with water.Solid and methylbenzene azeotropic drying 3 times are also used the hurried chromatogram purification of positive (gradient: 100%CHCl ₃Arrive 10%MeOH at CHCl ₃In, in 40 minutes), obtain 13-4, be white solid.Quality (M+1) value of calculation: 645.2946 measured values: 645.2946.

Reaction scheme 14

[9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methanol (14-3)

8-[4-(1,3-dioxolane-2-yl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol (14-1)

Add EDC (2.7g, 14.3mMol) in the 3-4 (5g, 13mMol), the HOBT (1.9g, 14.3mMol) that stir and the solution of hydroxyacetic acid (1.2g, 15.6mMol) in dry DMF (100mL).Solution stirs and to spend the night in ambient temperature, then solution with the glacial acetic acid of 5mL process and be heated in oil bath 80 ℃ lasting 2 hours.After cool to room temperature, ethyl acetate dilution for reaction, use NaHCO ₃(aqueous solution), water and salt water washing.Organic layer MgSO ₄Drying, filter and vacuum concentration, obtains 14-1, is red solid.LC/MS (M+1) value of calculation: 425.5; Measured value: 425.6.

4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzaldehyde (14-2)

Suspension to 14-1 (2.1g, 4.9mMol) in THF (50mL) adds 1N HCl (50mL).After at room temperature stirring 30 minutes, reaction is diluted and washes twice with water by ethyl acetate, then uses the salt water washing.Organic layer MgSO ₄And Na ₂SO ₄Drying, filter and vacuum concentration, obtains 14-2, is red solid.Quality (M+1) value of calculation: 381.1346 measured values: 381.1346.

Add triethylamine (0.04mL, 0.26mMol) to the 14-2 (0.05g, 0.1mMol) and the 10-1 (0.05g, 0.15mMol) that stir in NMP (1mL), then add acetic acid (0.01mL, 0.26mMol).After stirred overnight at room temperature, add sodium triacetoxy borohydride (0.03g, 0.2mMol).Stir after 6 hours, solution filters by syringe filter and passes through C18 reversed-phase HPLC purification, obtains 14-3, is solid.Quality (M+1) value of calculation: 595.2677 measured values: 595.2679.

The compound that following table (table 5) contains is used the process of diagram 14 to make, and with suitable amine, replaces 10-1.Compound 14-4,14-5,14-7 and 14-8 are with the isolated in form of HCl salt.Compound 14-6 is with the isolated in form of tfa salt.

Table 5

Reaction scheme 15

8-[4-(the amino cyclopropyl of 1-) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol (15-2)

4-[3-(hydroxymethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzonitrile (15-1)

To the dense NH that adds 3mL in the suspension of 14-2 (0.4g, 1.1mMol) in anhydrous THF (15mL) stirred ₄OH.Then for solution, iodine (0.4g, 1.6mMol) is processed, and in stirred overnight at room temperature, then uses saturated sodium thiosulfate solution (20mL) quencher, and product extracts and enters in ethyl acetate three times.The organic layer salt water washing merged, use Na ₂SO ₄Drying, filter and vacuum concentration, obtains 15-1, is the sepia solid.Quality (M+1) value of calculation: 378.135 measured values: 378.1345.

Will be at ether (0.4mL at-70 ℃, 1.2mMol, ethylmagnesium bromide 3M) is added 15-1 (0.1g to, 0.3mmol) and isopropyl titanate (IV) (0.17g, 0.6mMol) in solution in anhydrous THF (7mL), after 10 minutes, remove cooling bath, react the room temperature of rising again, stir after 1 hour, add more ethylmagnesium bromide (0.18mL in ether, 0.5mMol, 3M), then react and be cooled to 0 ℃ also with boron trifluoride etherate (0.18g in ice bath, 1.2mMol) process, reaction is stirred 30 minutes at 0 ℃, then the room temperature of rising again continues 1 hour, then 1N HCl quencher for reaction, then stir 3 hours, 1M NaOH alkalization for solution, use chloroform extraction, use Na ₂SO ₄drying, filter and vacuum concentration, and thick residue is dissolved in methanol, uses C18 reversed-phase HPLC purification, obtains 15-2, is solid.LC/MS (M+1) value of calculation: 408.4; Measured value: 408.0.

Reaction scheme 16

1-[4-(9-phenyl-3-pyridin-4-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (16-3)

4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) benzylamino formic acid tertiary butyl ester (16-1)

To the 9-1 (7g stirred, 20.2mMol) and the solution of carbamic acid tertiary butyl ester (2.6g, 22.3mMol) in anhydrous acetonitrile (35mL) in add triethyl silicane (29.1mL, 182mMol), then add trifluoroacetic acid (6mL, 81mMol).Stir after 3 hours, by solution impouring NaHCO ₃In aqueous solution, and extract and to enter in ethyl acetate 3 times.The organic layer water and the salt water washing that merge, then organic layer Na ₂SO ₄Drying, filter and vacuum concentration, uses the hurried chromatogram purification of silica gel.LC/MS (M+1) value of calculation: 446.9; Measured value: 446.1.

4-(5-diazanyl-3-phenyl-1,6-naphthyridines-2-yl) benzylamino formic acid tertiary butyl ester (16-2)

To the 16-1 (6.8g stirred, 15.2mMol) anhydrous 1, add hydrazine (10.8mL in solution in 4-dioxane (20mL), 343mMol), solution is heated to 100 ℃ and continues 5 minutes in microwave reactor, solvent removed in vacuo, thick residue is dissolved in ethyl acetate and uses NaHCO ₃Aqueous solution and salt water washing.Organic layer MgSO ₄Drying, filter and vacuum concentration, obtains 16-2, as orange solids.LC/MS (M+1) value of calculation: 442.5; Measured value: 442.2.

To 16-2 (0.08g, 0.2mMol), the HOBT (0.03g, 0.2mMol) and the .gamma.-pyridinecarboxylic acid (0.02g that stir, 0.2mMol) add DIEA (0.08mL in solution in dry DMF (1mL), 0.5mMol), then add EDC (0.04g, 0.2mMol).Solution in microwave reactor 80 ℃ of heating 12 minutes, then solution with the acetic acid treatment of 0.5mL and in microwave reactor, be heated to 80 ℃ lasting 30 minutes.After cool to room temperature, volatile matter evaporates in a vacuum, solution by syringe filter, filter and on the C18 reversed-phase HPLC purification, obtain 16-3, be solid.Quality (M+1) value of calculation: 429.1822 measured values: 429.1811.

The compound that following table (table 6) contains is used the process of diagram 16 to make, and with suitable carboxylic acid, replaces .gamma.-pyridinecarboxylic acid:

Table 6

Reaction scheme 17

5-({ [4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) pyridine-2-alcohol (17-3)

4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzylamino formic acid tertiary butyl ester (17-1)

The toluene of 3: 1 to the 16-2 (5g, 11.3mMol) stirred at 20mL: add trimethyl orthoacetate (1.8g, 15.3mMol) and p-methyl benzenesulfonic acid monohydrate (0.1g, 0.6mMol) in the solution in methanol.Reaction is heated to 100 ℃ and continues 35 minutes in microwave reactor, after cool to room temperature, and removal of solvent under reduced pressure, residue is used the hurried chromatogram purification of positive, obtains 17-1, is solid.LC/MS (M+1) value of calculation: 466.6 measured values: 466.2

1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine (5-3)

HCl (gas) bubbling continues 5 minutes by methanol (75mL), add 17-1 (7.5g in this solution, 16mmMol), solution at room temperature stirs 6 hours, after solvent removed in vacuo, the solid obtained and the ethyl acetate of 10: 1 and methanol solution grind 30 minutes, and suspension is through filtering and drying, obtaining 5-3, is HCl salt.Quality (M+1) value of calculation: 366.1713 measured values: 366.1694

6-hydroxyl cigarette aldehyde (17-2)

The 6-methoxyl group stirred-solution of 3-pyridine carboxaldehyde (0.45g, 3.3mMol) in 3N HCl (10mL) is heated to 100 ℃ and continues 30 minutes, cooling after, acicular crystal appears, filter and collect crystallization, obtain 17-2. ¹H-NMR(CD ₃OD)

9.64(s，1H)，δ 8.17-8.16(m，1H)，δ7.96-7.94(m，1H)，δ 6.58(d，1H)。

To the 5-3 (0.1g stirred, 0.3mMol) and triethylamine (0.08mL, 0.5mMol) add 17-2 (0.03g in solution in NMR (1mL), 0.3mMol) and acetic acid (0.03mL, 0.5mMol), then add sodium triacetoxy borohydride (0.12g, 0.5mMol).After at room temperature stirring and spending the night, reaction by syringe filter, filter and on the C18 reversed-phase HPLC purification, obtain 17-3, be HCl salt.Quality (M+1) value of calculation: 473.2085 measured values: 473.2092.

The compound that following table (table 7) contains is used the process of diagram 17 to make, and with suitable aldehyde, replaces 17-2.Compound 17-4 and 17-5 are with the isolated in form of HCl salt.Compound 17-6 and 17-7 are with the isolated in form of tfa salt.

Table 7

Reaction scheme 18

N-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide (18-1)

Add acetic anhydride (0.02mL, 0.2mMol) to 4-3 (0.02g, 0.06mMol) and triethylamine (0.02mL, 0.2mMol) in solution in absolute ethanol (0.5mL).Reaction completed after 10 minutes, and direct purification on the C18 reversed-phase HPLC, obtained 18-1, was solid.LC/MS (M+1) value of calculation: 394.5; Measured value: 394.2.

Reaction scheme 19

4-({ [4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) phenol (19-1)

To the 4-2 (0.05g, 0.14mMol) stirred and 4-(amino methyl) phenol (0.04,0.35mMol) in the solution in DMF (0.5mL), add acetic acid (0.04mL, 0.7mMol).After at room temperature stirring 2 hours, add sodium triacetoxy borohydride (0.06g, 0.3mMol), after stirring and spending the night, reaction by syringe filter, filter and on the C18 reversed-phase HPLC purification, obtain 19-1, be solid.LC/MS (M+1) value of calculation: 458.5; Measured value: 458.3.

Reaction scheme 20

1-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methylamine (20-1)

The solution of 9-6 (0.03g, 0.04mMol) in 30%TFA-dichloromethane (1mL, 30 volume %) at room temperature stirs 30 minutes, solvent removed in vacuo, thick residue be dissolved in methanol and on the C18 reversed-phase HPLC purification, obtain 20-1, be solid.Quality (M+1) value of calculation: 593.2884; Measured value: 593.2867.

Reaction scheme 21

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines (21-4)

4-(1H-1,2,4-triazole-3-yl) piperidines (21-1)

At room temperature, the Feldalat NM (25wt% in being added on methanol to 4-cyano group piperidines-1-carboxylic acid benzyl ester (20g, 82mmol) in the solution in methanol (150mL), 5.6mL, 25mmol), after 30 minutes, add formylhydrazine (4.9g, 82mmol) the solution in methanol (20mL), reaction reflux 24 hours, now be added on Feldalat NM (25wt%, 5.6mL in methanol, 25mmol) and formylhydrazine (4.9g, 82mmol).After 72 hours, the reaction cool to room temperature, with acetic acid (3.0mL, 49mmol) quencher concentrated, the residue obtained is dissolved in ethyl acetate, water, saturated sodium bicarbonate, salt water washing, dried over sodium sulfate, filter and concentrate, and residue is by the column chromatography purification, use the 1-35%IPA/DCM eluting, merge suitable fraction solvent removed in vacuo, obtain 4-(1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid benzyl ester, be solid.MS(M+H ⁺)：287.2； ¹H-NMR(400MHz，CDCl ₃)：δ11.13(s，1H)，8.06(s，1H)，7.36-7.31(m，5H)，5.15(s，2H)，4.24(br.s，2H)，3.06-2.98(m，3H)，2.07-2.04(m，2H)，1.84-1.78(m，2H)。

To 4-(1H-1,2,4-triazole-3-yl) piperidines-1-carboxylic acid benzyl ester (7.3g, 25mmol) in the solution in ethanol (100mL), the carbon of interpolation 10% carries palladium (500mg), reaction vessel stirs 3 hours with hydrogen purge and under nitrogen atmosphere, reaction, through filtering and concentrating, obtains 21-1, is solid.MS(M+H ⁺)：153.2； ¹H-NMR(400MHz，DMSO-d ₆)：δ7.99(s，1H)，2.98-2.94(m，2H)，2.82-2.74(m，1H)，2.57-2.50(m，2H)，1.82-1.78(m，2H)，1.60-1.50(m，2H)。

The chloro-3-phenyl-2-of 5-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (21-2)

To the 9-1 (0.25g stirred, 0.73mMol) and 21-1 (0.13g, 0.87mMol) add triethylamine (0.3mL in solution in NMP (5mL), 2.2mMol), then add acetic acid (0.082mL, 1.5mMol), after stirring is spent the night at ambient temperature, add sodium triacetoxy borohydride (0.18g, 0.87mMol).After completing, ethyl acetate dilution for reaction, use saturated NaHCO ₃Washing, then water, salt water washing.Organic layer Na ₂SO ₄And MgSO ₄Drying, filter and vacuum concentration, obtains 21-2.LC/MS (M+1) value of calculation: 482.0; Measured value: 482.2.

5-diazanyl-3-phenyl-2-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-1,6-naphthyridines (21-3)

Add hydrazine (0.45mL, 14.5mMol) in the solution of 21-2 (0.4g, 0.8mMol) in anhydrous Isosorbide-5-Nitrae-dioxane (3mL) stirred.Solution is heated to 100 ℃ and continues 5 minutes in microwave reactor, solvent removed in vacuo and with dry three times of methylbenzene azeotropic, obtain 21-3.LC/MS (M+1) value of calculation: 477.6; Measured value: 477.3.

To the 21-3 (0.2g stirred, 0.36mMol), HOBT (0.05g, 0.4mMol) and 1H-1,2, add DIEA (0.18mL, 1.1mMol) in the solution of 3-triazole-4-carboxylic acid (0.05g, 0.4mMol) in dry DMF (2mL), then add EDC (0.08g, 0.4mMol).Solution in microwave reactor 80 ℃ of heating 12 minutes, then solution with the acetic acid treatment of 0.5mL and in microwave reactor, be heated to 80 ℃ lasting other 10 minutes.After cool to room temperature, solution by syringe filter and on the C18 reversed-phase HPLC purification, obtain 21-4, be HCl salt.Quality (M+1) value of calculation: measured value: LC/MS (M+1) value of calculation: 554.6; Measured value: 554.3.

Reaction scheme 22

1-{4-[3-(1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine (22-3)

8-[4-(1,3-dioxolane-2-yl) phenyl]-3-(1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines (22-1)

To 3-4 (0.2g, 0.5mmol), 1H-imidazoles-4-carboxylic acid (0.06g, 0.5mmol), HOBT (0.06g, 0.5mmol) and DIEA (0.2ml, 1.4mmol) add EDC (0.1g, 0.6mmol) in solution in DMF (2ml).Solution at room temperature stirs and then heats 15 minutes at 80 ℃ in microwave reactor in 45 minutes, solvent removed in vacuo, residue is dissolved in DMF (0.5ml) and with glacial acetic acid (2.0ml) and processes, reactant mixture, 80 ℃ of heating 45 minutes, then reacts water (10ml) quencher and also extracts and enter EtOAc (3 * 20ml).The organic layer vacuum concentration merged, obtain 22-1, is the brown residue.MS M+H value of calculation: 461.5, measured value: 461.2.

4-[3-(1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzaldoxime (22-2)

To 22-1 (0.8g, 1.7mmol) drip 3N HCl (1.1ml, 3.4mmol) in solution in Isosorbide-5-Nitrae-dioxane (3ml) and stir 10 minutes after, the oxammonium hydrochloride. (0.5g, 6.9mmol) that solution is used in water (0.5ml) is processed.Mixture stirs 1 hour, then uses NaHCO ₃(solid) quencher is until pH=8.Except after desolventizing, residue is dissolved in water, filter and with the methylbenzene azeotropic drying, obtain 22-2, be solid.MS M+H value of calculation: 432.5, measured value: 432.2.

22-2 (0.06,0.1mmol) and the solution of Zn (solid) (0.02g, 0.3mmol) in anhydrous glacial acetic acid stirring at room 30 minutes, to the Zn (solid) (0.04g, 0.6mmol) that adds other 4 equivalents in this solution.Reactant mixture stirs other 1 hour, filters and, except after desolventizing, residue is dissolved in MeOH and with ammonium hydroxide and processes, and except after desolventizing, residue is purified with reversed-phase HPLC, obtains 22-3, is solid.MS M+H value of calculation: 418.5, measured value: 401.1 (M-NH ₂).

The compound that following table (table 8) contains is used the process of diagram 22 to make, with suitable acid substitution imidazoles-4-carboxylic acid.Compound in table 8 is separated with the form of HCl salt.

Table 8

Reaction scheme 23

5,6,7,8-imidazolidine is [1,2-a] pyridine-2-carboxylic acids (23-2) also

Add Pt in the 23-1 (0.1g, 0.7mmol) in EtOH (15ml) in dry flask ₂O (0.1g, 0.4mmol).Reactant mixture is placed under blanket of nitrogen and venting subsequently.Repeat this process three times, and reactant mixture is placed under nitrogen atmosphere.After 3 hours, reactant mixture, by diatomite filtration, except after desolventizing, obtains required product 23-2, is pale solid.MS M+H value of calculation: 167.2, measured value: 167.1.

Reaction scheme 24

4-methyl isophthalic acid H-imidazole-5-carboxylic acid (24-2)

Add 3N LiOH (2.2ml, 6.5mmol) in solution to 24-1 (0.5g, 2.4mmol) in EtOH (2ml).Reactant mixture, 80 ℃ of heating 1 hour, is reduced to 40 ℃ by temperature, and mixture stirs and spends the night.Then mixture was other 1.5 hours of 80 ℃ of heating.12N HCl neutralization vacuum concentration for reaction, residue and methylbenzene azeotropic drying, obtain required product 24-2, is solid.MS M+H value of calculation: 127.1, measured value: 127.1

Reaction scheme 25

1-propyl group-1H-imidazoles-4-carboxylate methyl ester (25-2)

In solution to the 25-1 (0.5g, 4.0mmol) in dry flask in anhydrous THF (15ml), portioning adds NaH (0.1g, 4.8mmol).After bubble phenomenon is calmed down, add iodopropane (0.8ml, 8.0mmol), and in stirred overnight at room temperature.Add the NaH of other 0.5eq and the iodopropane of 3eq in reactant mixture.Stir after 50 hours, add the NaH of other 0.5eq and the iodopropane of 2eq.Reactant mixture stirs other 20 hours, then uses ethanol (5ml) quencher, except desolventizing, obtains required product 25-2, is solid.MS M+H value of calculation: 169.2, measured value: 155.1 (M-CH ₂).

1-propyl group-1H-imidazoles-4-carboxylic acid (25-3)

Add 3NLiOH (2.6ml, 7.9mmol) in solution to 25-2 (0.6g, 3.6mmol) in anhydrous MeOH (2ml).Reactant mixture, 80 ℃ of heating 1 hour, is reduced to 40 ℃ by temperature, and mixture stirs and spends the night.Then mixture neutralizes also vacuum concentration subsequently with 12N HCl, and residue and methylbenzene azeotropic drying, obtain required product 25-3, is solid.MS M+H value of calculation: 155.2, measured value: 155.1.

The compound that following table (table 9) contains is used the process of diagram 25 to make, and has replaced suitable alkyl halide.

Table 9

Reaction scheme 26

4-[9-phenyl-3-(pyrrolidin-1-yl methyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine (26-2)

4-[3-(chloromethyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzylamino formic acid tertiary butyl ester (26-1)

To 16-2 (1.2g, 2.7mmol) at CH ₂Cl ₂(10ml) add DMAP (0.03g, 0.03mmol) and pyridine (0.4ml, 5.4mmol) in the suspension in, then add monochloroacetic acid anhydride (0.5g, 3.0mmol).Reactant mixture at room temperature stirs 2 hours, then adds other monochloroacetic acid anhydride (0.2g, 0.9mmol), after stirring other 10 minutes, and solvent removed in vacuo, residue is at saturated NaHCO ₃Between aqueous solution and EtOAc, distribute (3 * 30ml).The organic layer water, the salt water washing that merge, dry (Na ₂SO ₄/ MgSO ₄), except desolventizing obtains required product 26-1, be red powder.The MS value of calculation: 500.2, measured value: 500.1

Add pyrrolidine in solution to 26-1 (0.05g, 0.1mmol) in DMSO (1ml).Solution was 150 ℃ of heating 30 minutes.Reactant mixture is purified with reversed-phase HPLC, and residue is dissolved in MeOH (0.5ml) and with 1N HCl (0.4ml) and processes.Reactant mixture stirs 1 day at 35 ℃.Except desolventizing obtains required product 26-2, it is solid.MS value of calculation: 535.7,435.5.

The compound that following table (table 10) contains is used the process of diagram 26 to make, and with suitable amine, replaces pyrrolidine.Compound in table 10 is separated with the form of HCl salt.

Table 10

Reaction scheme 28

[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methanol (28-1)

Add sodium borohydride (0.033g, 0.870mmol) at 0 ℃ in 4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines-8-yl) solution of benzaldehyde (5-2,0.317g, 0.870mmol) in methanol (5mL).After 10 minutes, by in reactant mixture impouring ethyl acetate, saturated solution of sodium bicarbonate, water and salt water washing for organic layer, dried over sodium sulfate, filter and be evaporated to dry, by reversed phase chromatography purification (Waters Sunfire MSC18,1% acetonitrile/0.1% trifluoroacetic acid/water → 95% acetonitrile/0.1% trifluoroacetic acid/water), obtaining title compound, is solid.HRMS (M+H ⁺): value of calculation=367.1554, measured value=367.1547.

4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] and phenyl } methanol (28-2)

Prepare title compound according to the process of diagram 28 from 13-2; HRMS (M+H ⁺): value of calculation=433.1772, measured value=433.1761.

Reaction scheme 29

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethanol (29-2)

1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] ethanol (29-1)

At 0 ℃ to 4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) benzaldehyde (9-1,0.500g, 1.450mmol) add methyl-magnesium-bromide (2.072mL in solution in anhydrous methylene chloride (10mL), 2.9mmol, 1.4M, in toluene/oxolane (75: 25)).After 15 minutes, by reactant mixture impouring ethyl acetate, saturated solution of sodium bicarbonate, water and salt water washing for organic layer, dried over sodium sulfate, filter and be evaporated to dry, obtains title compound.MS (M+H ⁺): value of calculation=361.85, measured value=361.1.

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base] [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethanol (29-2)

Prepare title compound according to the process of diagram 9; HRMS (M+H ⁺): value of calculation=485.1833, measured value=485.1812.

Compound in following table 11, according to the process of diagram 13, makes from piperidines 21-1 and specified aldehyde.

Table 11

Reaction scheme 33

Trifluoroacetic acid 1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] encircle the third ammonium (33-5)

4-(2-benzyl-1,3-dioxolane-2-yl) benzonitrile (33-1)

1-(4-bromophenyl)-2-Phenyl ethyl ketone (5.0g, 18mmol), ethylene glycol (3.0mL, 54mmol) and p-methyl benzenesulfonic acid (0.04g, 0.2mmol) solution in toluene (30mL) uses the dean stark trap reflux 15 hours, to react cool to room temperature, by ethyl acetate, dilute, with saturated sodium bicarbonate, salt water washing, dried over sodium sulfate, filter and concentrate, obtain thick 2-benzyl-2-(4-bromophenyl)-1, the 3-dioxolane, be white solid.Add zinc cyanide (2.3g in crude product, 20mmol), tetrakis triphenylphosphine palladium (3.3g, 2.8mmol), DMF (20mL) and dioxane (20mL), nitrogen purging 15 minutes for the suspension obtained, then heat 100 ℃ and continue 15 hours.To react cool to room temperature, also filter in the impouring ether.Organic filtrate water, saturated bicarbonate, salt water washing, dried over sodium sulfate, filter and concentrate, and by silica gel chromatography purification (1% ethyl acetate/hexane → 50% ethyl acetate/hexane), obtains title compound, is solid.MS (M+H ⁺): value of calculation=265.31, measured value=266.1.

1-[4-(phenyl acetyl) phenyl] and cyclopropyl } carbamic acid tertiary butyl ester (33-2)

At-78 ℃ to 4-(2-benzyl-1,3-dioxolane-2-yl) benzonitrile (33-1,1.5g, 5.6mmol) add isopropyl titanate (1.8mL in solution in ether (25mL), 6.2mmol), then add ethylmagnesium bromide (4.2mL, 12mmol, 3M, in ether).After 10 minutes, the reaction room temperature of rising again is continued to 60 minutes, reaction is cooled to 0 ℃ and add boron trifluoride etherate (1.4mL, 11mmol).0 ℃ of reaction after 30 minutes, the reaction room temperature of rising again is continued to 1 hour, now will react use 1M HCl quencher acidify.Suspension is at room temperature stirred other 3 hours, now, mixture is alkalized and uses chloroform extraction with the NaOH of 1M.The organic layer dried over sodium sulfate merged, filter and concentrate.At room temperature add acetonitrile (15mL) and two dimethyl dicarbonate butyl ester (1.2g at once in crude product, 5.6mmol), after 12 hours, reaction is concentrated into dry, and by silica gel chromatography purification (1% ethyl acetate/hexane → 60% ethyl acetate/hexane), obtaining title compound, is white solid.MS (M+H ⁺): value of calculation=351.44, measured value=352.1.

1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] and cyclopropyl } carbamic acid tertiary butyl ester (33-3)

33-2 (0.64g, 2.5mmol), 3-1 (0.88g, 2.5mmol) and the solution of potassium carbonate (2.1g, 15mmol) in DMF (14mL) is heated to 120 ℃ and continues 4.5 hours, to react cool to room temperature, by ethyl acetate dilution, water, salt water washing, dried over sodium sulfate, filter and concentrate, by silica gel chromatography purification (1% ethyl acetate/hexane → 70% ethyl acetate/hexane), obtain title compound, be foam.MS (M+H ⁺): value of calculation=471.98, measured value=472.1.

1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] and cyclopropyl } carbamic acid tertiary butyl ester (33-4)

Prepare title compound according to the process of diagram 27 from 33-3; MS (M+H ⁺): value of calculation=491.58, measured value=492.1.

Prepare title compound according to the process of diagram 27; HRMS (M+H ⁺): value of calculation=392.1870, measured value=392.1893.

Compound in following table 12 makes according to the process of diagram 33.Compound 33-8-33-10 is separated with the HCl salt form.Compound 33-6 is separated with the form of tfa salt.

Table 12

Reaction scheme 34

Chlorination (1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] second ammonium (34-5)

N-{ (1E)-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] methylene }-2-methylpropane-2-sulfenamide (34-1)

4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) benzaldehyde (9-1,4.24g, 12.3mmol), S-(-)-2-methylpropane-2-sulfenamide (3.43mL, 28.3mmol) and the solution of copper sulfate (4.49g, 28.1mmol) in dichloromethane (20mL) reflux under blanket of nitrogen.After 18 hours, will react with saturated sodium bicarbonate, salt water washing, dried over mgso, filter and concentrate, and by silica gel chromatography purification (0% ethyl acetate/hexane → 45% ethyl acetate/hexane), obtains title compound, is orange foam.MS (M+H ⁺): value of calculation=447.99, measured value=448.2.

N-{ (1R)-1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] ethyl }-2-methylpropane-2-sulfenamide (34-2)

At-10 ℃ to N-{ (1E)-[4-(chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] methylene }-2-methylpropane-2-sulfenamide (34-1,4.53g, 10.1mmol) add methyl-magnesium-bromide (30mL in solution in dichloromethane (100mL), 42.0mmol, 1.4M, at 75: 25 toluene: in THF).After 30 minutes, react by add saturated ammonium chloride solution quencher (keeping temperature lower than 0 ℃) simultaneously, and use dichloromethane extraction.The organic layer water, the salt water washing that merge, dried over mgso, filter and concentrate, and obtains title compound, is light yellow solid.MS (M+H ⁺): value of calculation=464.03, measured value=464.2.

The tert-butyl group ((1R)-1-[4-(5-diazanyl-3-phenyl-1,6-naphthyridines-2-yl) phenyl] and ethyl } amino) oxygen sulfonium compound (sulfoniumolate) is (34-3)

To N-{ (1R)-1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl] ethyl }-solution in 2-methylpropane-2-sulfenamide (34-2,0.707g, 1.52mmol) and anhydrous hydrazine (15ml) is 115 ℃ of heating 1 hour.By in reactant mixture impouring ethyl acetate, saturated solution of sodium bicarbonate, water and salt water washing for organic layer, dried over mgso, filter and be evaporated to dry, obtains thick hydrazine adduct, is orange solids.MS (M+H ⁺): value of calculation=459.62, measured value=460.4.

The tert-butyl group ((1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] and ethyl } amino) oxygen sulfonium compound (34-4)

To the thick tert-butyl group ({ (1R)-1-[4-(5-diazanyl-3-phenyl-1,6-naphthyridines-2-yl) phenyl] ethyl } amino) oxygen sulfonium compound (34-3,1.06g, 2.31mmol), p-methyl benzenesulfonic acid (63mg, 0.36mmol) and trimethyl orthoacetate (1.0mL, 7.7mmol) in add dry toluene (10mL) and be heated to 110 ℃ and continue 48 hours, reactant mixture reduces and passes through silica gel chromatography purification (0-10% ethanol/methylene) under pressure, obtains orange foam.MS (M+H ⁺): value of calculation=483.64, measured value=484.2.

The tert-butyl group ({ (1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethyl } amino) oxygen sulfonium compound (34-4) is at room temperature processed 15 minutes with 4NHCl in dioxane.Reactant mixture reduces and passes through reversed phase chromatography purification (WatersSunfire MSC 18 under pressure, 1% acetonitrile/0.1% trifluoroacetic acid/water → 95% acetonitrile 10.1% trifluoroacetic acid/water) and be converted into HCl salt (add HCl the saturated solution (～4N) in ethyl acetate concentrated), obtaining title compound, is solid.MS (M+H ⁺): value of calculation=379.47, measured value=380.2.

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine (34-6)

Prepare title compound according to the process of diagram 34; MS (M+H ⁺): value of calculation=365.43, measured value=366.2.Compound 34-6 is separated with the form of HCl salt.

Diagram 35

(1R)-1-{4-[9-phenyl-3-(5-pyridine-2-base-1H-pyrazole-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethamine dihydrochloride (35-1)

To the tert-butyl group ({ (1R)-1-[4-(5-diazanyl-3-phenyl-1,6-naphthyridines-2-yl) phenyl] ethyl } amino) oxygen sulfonium compound (34-3,0.20g, 0.43mmol), EDC (0.11g, 0.57mmol), anhydrous HOBT (0.06g, 0.39mmol), DIPEA (0.17mL, 0.96mmol) and 5-pyridine-2-base-1H-pyrazoles-3-carboxylic acid (0.08g, 0.43mmol) the middle dry DMF (2mL) of adding, and at room temperature stir and spend the night, add HCl/ ether (1mL, 2N), reactant mixture at room temperature stirs 20 minutes, then 100 ℃ of microwave treatment 30 minutes.Solvent removed in vacuo, by reversed phase chromatography purification (WatersSunfire MSC 18,1% acetonitrile/0.1% trifluoroacetic acid/water → 95% acetonitrile/0.1% trifluoroacetic acid/water) and be converted into HCl salt (add HCl the saturated solution (～4N) in ethyl acetate concentrated), obtaining title compound, is solid.MS (M+H ⁺): value of calculation=508.58, measured value=509.1.

Compound in following table 13 makes according to the process in diagram 35.Compound in table 13 is separated with the form of HCl salt.

Table 13

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-1-amine (36-1)

Prepare title compound according to the process of diagram 34.MS (M+H ⁺): value of calculation=379.47, measured value=380.2.Compound 36-1 is separated with the form of HCl salt.

Reaction scheme 37

N-{1-methyl isophthalic acid-[4-(phenyl acetyl) phenyl] ethyl } acetamide (37-1)

N-(1-methyl isophthalic acid-phenylethyl) acetamide (21.3g, 121mmol), phenylacetyl chlorine (19.5g, 126mmol) and aluminum chloride (19g, 142mmol) solution in dichloromethane (140mL) at room temperature stirs and spends the night under blanket of nitrogen, reaction is poured into to ice on ice and stirs until then the ice melting separates each layer, saturated sodium bicarbonate, salt water washing for organic layer, dried over mgso, filter and concentrate.By the silica gel chromatography purification, obtain title compound.MS (M+H ⁺): value of calculation=295.38, measured value=296.1.

N-{1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl]-the 1-Methylethyl } acetamide (37-2)

Prepare title compound according to the process of diagram 3 from 37-1; MS (M+H ⁺): value of calculation=415.91, measured value=416.1.

1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl]-the 1-Methylethyl } carbamic acid tertiary butyl ester (37-3)

At 40 ℃ to N-{1-[4-(the chloro-3-phenyl-1 of 5-, 6-naphthyridines-2-yl) phenyl]-the 1-Methylethyl } acetamide (37-2,4.73g, 11.4mmol) add diphenyl silane (10.5ml in solution in anhydrous THF (120mL), 56.9mmol) and isopropyl titanate (16.6mL, 56.9mmol) continue 1 hour.Reactant mixture is removed from thermal source, and, by adding the saturated bicarbonate solution quencher, add dichloromethane and filter by Celite pad and magnesium sulfate, add two dimethyl dicarbonate butyl ester (3.08g in solution, 14.1mmol), then rotary evaporation is to minimum volume.Add anhydrous methylene chloride (140mL), two dimethyl dicarbonate butyl esters (4.1g, 18.8mmol) and TEA (4.0mL, 28.7mmol) and in stirred overnight at room temperature.Sodium bicarbonate, salt water washing for reactant mixture, dried over mgso, filter and concentrate, and by silica gel chromatography purification (the 0-40%EtOAc/ hexane, in 30 minutes), obtains title compound, is white foam.MS (M+H ⁺): value of calculation=473.99, measured value=474.1

2-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine hydrochlorate (37-4)

Prepare title compound according to the process of diagram 5 from 37-3; MS (M+H ⁺): value of calculation=393.48, measured value=394.1.

2-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine (38-1)

Prepare title compound according to the process of diagram 37; MS (M+H ⁺): value of calculation=421.51, measured value=422.3.Compound 38-1 is separated with the form of HCl salt.

Reaction scheme 39

Chlorination 3-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine

(39-1)

To 1-[4-(3-methyl-9-phenyl [1,2,4] triazol [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine hydrochloride (5-3,20mg, 0.050mmol), EDC (12mg, 0.065mmol), HOBT (10mg, 0.0650mmol), DIPEA (0.033ml, 0.199mmol) and the middle 0.6mL anhydrous dimethyl formamide that adds of pyridin-3-yl acetic acid hydrochloride (11mg, 0.0650mmol).Then reactant mixture heats 5 minutes at 100 ℃ under microwave irradiation, crude product mixture is by reversed phase chromatography purification (Waters Sunfire MSCl 8,1% acetonitrile/0.1% trifluoroacetic acid/water → 95% acetonitrile/0.1% trifluoroacetic acid/water) and change into HCl salt (add HCl the saturated solution (～4N) in ethyl acetate concentrated), obtaining title compound, is yellow solid.HRMS (M+H ⁺): value of calculation=243.1079, measured value=243.1083.

Compound in following table 14 from shown in amine according to the process of diagram 39 preparation (referring to the bracket on compound one hurdle).

Table 14

2-[{4-[3-(amino (ammonio) methyl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl } (3-hydroxyl-2,2-dimethyl propyl) amino]-2-oxo ethamine (39-52)

Prepare title compound according to the process of diagram 27 from 39-42; MS (M+H ⁺): value of calculation: 524.2769, measured value: 524.2777.Compound 39-52 is separated with the form of HCl salt.

Embodiment 1

The clone of people Akt isoform and Δ PH-Akt1

The pS2neo carrier (is preserved in ATCC April 3 calendar year 2001, preserving number is ATCCPTA-3253) preparation as follows: with BglII cutting pRmHA3 carrier (according to the method preparation of introducing in Nucl.AcidRes.16:1043-1061 (1988)), isolate the 2734bp fragment.Also, with BglII cutting pUChsneo carrier (according to J.4:167-171 (1985) middle method preparation of introducing of EMBO), isolate the 4029bp fragment.Isolated these two fragments of institute are coupled together to the generation carrier, be called as pS2neo-1.This plasmid contains polylinker between metallothionein promoter and alcoholdehydrogenase polyadenylic acid interpolation site.It also has the neo resistant gene of a heat shock promoters driven.With Psp5II and BsiWI cutting pS2neo-1 carrier.Synthetic two complementary oligonucleotides, then annealing (CTGCGGCCGC (SEQ.ID.NO.:1) and GTACGCGGCCGCAG (SEQ.ID.NO.:2)).PS2neo-1 through cutting is coupled together and produces second carrier, i.e. pS2neo with oligonucleotide through annealing.This gene conversion has added the NotI site, contributes to linearisation before being transfected into the S2 cell.

With following primer, people's spleen cDNA (Clontech) is passed through to PCR (Clontech) amplification people Akt1 gene: 5 ' primer:

5 ' CGCGAATTCAGATCTACCATGAGCGACGTGGCTATTGTG 3 ' (SEQ.ID.NO.:3) and 3 ' primer:

5’CGCTCTAGAGGATCCTCAGGCCGTGCTGCTGGC3’(SEQ.ID.NO.：4).

5 ' primer comprises EcoRI and BglII site.3 ' primer comprises XbaI and the BamHI site for cloning purpose.The PCR product of gained is subcloned in pGEM3Z (Promega) as EcoRI/Xba I fragment.For express/purification purpose, use the PCR primer:

5’GTACGATGCTGAACGATATCTTCG 3’(SEQ.ID.NO.：5).

T labelling in the middle of 5 ' end of total length Akt1 gene adds.The PCR product of gained comprises 5 ' KpnI site and 3 ' BamHI site, for contain biotin labeled insect cell expression carrier pS2neo together with meet the described fragment of frame ground sub-clone.

In order to express platelet leukocyte C kinase substrate framework territory (PH) disappearance model (the Δ aa 4-129 of Akt1, disappearance comprising an Akt1 hinge region part), as template, carry out the PCR deletion mutagenesis with the total length Akt1 gene in the pS2neo carrier.Carry out in two steps PCR, use overlapping inner primer

(5 ' GAATACATGCCGATGGAAAGCGACGGGGCTGAAGAGATGGAGGTG 3 ' (SEQ.ID.NO.:6), and

5’CCCCTCCATCTCTTCAGCCCCGTCGCTTTCCATCGGCATGTATTC 3’(SEQ.ID.NO.：7))，

This overlapping inner primer comprises disappearance; And 5 ' and 3 ' flank primer, this 5 ' and 3 ' flank primer has KpnI site and middle T labelling at 5 ' end.KpnI and SmaI digestion for final PCR product, and be connected to become pS2neo total length Akt1 KpnI/SmaI cut vector, effectively replace clone's 5 ' end by the disappearance form.

With aminoterminal oligomerization primer:

5 ' GAATTCAGATCTACCATGAGCGATGTTACCATTGTG 3 ' (SEQ.ID.NO.:8); With c-terminus oligomerization primer:

5’TCTAGATCTTATTCTCGTCCACTTGCAGAG 3’(SEQ.ID.NO.：9).

By the PCR of the brain cDNA (Clontech) that grows up, amplification people Akt3 gene.These primers comprise 5 ' EcoRI/BglII site and 3 ' the XbaI/BglII site for cloning purpose.EcoRI and XbaI site by the PCR product cloning of gained to pGEM4Z (Promega).For express/purification purpose, with the PCR primer, middle T labelling is added to total length Akt3 clone's 5 ' end, this PCR primer is:

5’GGTACCATGGAATACATGCCGATGGAAAGCGATGTTACCATTGTGAAG3’(SEQ.ID.NO.：10).

The PCR product of gained comprises 5 ' KpnI site, allows to be met frame ground clone with containing biotin labeled insect cell expression carrier pS2neo.

Use following primer, by the pcr amplification people Akt2 gene from people's thymus cDNA (Clontech): aminoterminal oligomerization primer

5 ' AAGCTTAGATCrACCATGAATGAGGTGTCTGTC 3 ' (SEQ.ID.NO.:11); With c-terminus oligomerization primer:

5’GAATTCGGATCCTCACTCGCGGATGCTGGC 3’(SEQ.ID.NO.：12).

These primers comprise 5 ' HindIII/BglII site and 3 ' the EcoRI/BamHI site for cloning purpose.The PCR product of gained can be subcloned into the HindIII/EcoRI site of pGem3Z (Promega).For express/purification purpose, use the PCR primer

5’GGTACCATGGAATACATGCCGATGGAAAATGAGGTGTCTGTCATCAAAG 3’(SEQ.ID.NO.：13).

Middle T labelling is added to the 5 ' end of total length Akt2.The PCR product of gained is subcloned in pS2neo carrier as above.

Embodiment 2

The expression of people Akt isoform and Δ PH-Akt1

Use the calcium phosphate method, by the DNA purification contained in the pS2neo expression vector through clone's Akt1, Akt2, Akt3 and Δ PH-Akt1 gene, and transfection fruit bat (Drosophila) S2 cell (ATCC).Select antibiotic (G418,500 μ g/ml) resisting cell aggregation.Cell is extended to 1.0L volume (approximately 7.0 * 10 ⁶/ ml), add biotin and CuSO ₄, make it final concentration and be respectively 50 μ M and 50mM.Cell is grown 72 hours under 27 ℃, by centrifugal results.It is stand-by that cell precipitation thing (paste) is placed in-70 ℃ of cold preservations.

Embodiment 3

The purification of people Akt isoform and Δ PH-Akt1

By the cell precipitation thing obtained in 1L S2 cell of describing in embodiment 2, in buffer A (leupeptin, aprotinin and pepstatin, 10% glycerol and the 1mM DTT of 50mM Tris pH 7.4,1mM EDTA, 1mM EGTA, 0.2mM AEBSF, 10 μ g/ml benzenecarboximidamides, each 5 μ g/ml) at 50ml containing 1%CHAPS, by supersound process, carry out cracking.The fast stream of G albumen agarose gel (Sepharose) (Pharmacia) column purification that the anti-middle T monoclonal antibody of 9mg/ml is housed for soluble part, the eluant solution with 75 μ M EYMPME (SEQ.ID.NO.:14) peptides in containing the buffer A of 25% glycerol.Merge the fraction that contains Akt/PKB, by SDS-PAGE, lipidated protein is estimated.Application standard Bradford scheme quantitative assay protein purification.With liquid nitrogen quick freezing protein purification, and be stored in-70 ℃.

Need to activate Akt and the Akt platelet leukocyte C kinase substrate framework territory disappearance of purification from the S2 cell.Akt and Akt platelet leukocyte C kinase substrate framework territory lack the (Alessi etc. that are activated in containing the reactant of following compositions, Current Biology 7:261-269): 10nM PDK1 (Upstate Biotechnology, Inc.), lipid vesicle (10 μ M phosphatidylinositols-3, 4, 5-triphosphoric acid (Metreya, Inc.), 100 μ M phosphatidylcholines and 100 μ M Phosphatidylserine (Avanti Polar lipids, and activate buffer (50mM Tris pH7.4 Inc.)), 1.0mMDTT, 0.1mM EGTA, 1.0 μ M microcystin-LR, 0.1mM ATP, 10mM MgCl ₂, 333 μ g/ml BSA and 0.1mM EDTA).Reactant is hatched 4 hours under 22 ℃.By aliquot quick freezing in liquid nitrogen.

Embodiment 4

The Akt kinase assays

With the derivative biotinylation peptide substrates of GSK, Akt isotype and the platelet leukocyte C kinase substrate framework territory disappearance construct of activation are measured.Can use the monoclonal antibody to the specific lanthanide (III) chelates of phosphoeptide (Lance) coupling, and (SA-APC) fluorogen of the allophycocyanin be connected with Succ-PEG-DSPE (allophycocyanin) that will be combined with biotin moiety on peptide, measure the degree of peptide phosphorylation by homogeneous phase time discrimination fluorescence (HTRF).When lanthanide (III) chelates and APC approach (being combined with same phosphoeptide molecule), produce non-radiative energy and shift from the lanthanide (III) chelates to APC, send utilizing emitted light at 665nm from APC subsequently.

Measure required material:

A. the Akt isozyme of activation or platelet leukocyte C kinase substrate framework territory lack construct;

B.Akt peptide substrates: GSK3 α (S21) peptide #3928 biotin-GGRARTSSFAEPG (SEQ.ID.NO.:15), MacromolecularResources;

The anti-phosphoric acid GSK3 alpha monoclonal antibodies of C.Lance labelling (Cell SignalingTechnology, clone #27);

D.SA-APC (Prozyme catalog number (Cat.No.) PJ25S lot number 896067);

E.Microfluor

Microtitration plate at the bottom of the B U-shaped (Dynex Technologies, catalog number (Cat.No.) 7205);

F.Discovery

HTRF minitype plate analyser, Packard InstrumentCompany;

G.100 * protease inhibitor cocktail (Protease Inhibitor Cocktail) is (PIC): 1mg/ml benzenecarboximidamide, 0.5mg/ml pepstatin, 0.5mg/ml leupeptin, 0.5mg/ml aprotinin;

H.10X measure buffer: 500mM HEPES, pH 7.5,1%PEG, mMEDTA, 1mM EGTA, 1%BSA, 20mM θ-glycerophosphate;

I. quencher buffer: 50mM HEPES pH 7.3,16.6mM EDTA, 0.1%BSA, 0.1%Triton X-100, the monoclonal antibody clone #27 of 0.17nM Lance labelling, 0.0067mg/ml SA-APC;

J.ATP/MgCl ₂Use liquid: 1X to measure buffer, 1mM DTT, 1X PIC, 125mM KCl, 5% glycerol, 25mM MgCl ₂, 375TM ATP;

K. enzyme is used liquid: 1X to measure buffer, 1mM DTT, 1X PIC, 5% glycerol, active A kt.Select final enzyme concentration, make and be determined in the linear response scope;

L. peptide is used liquid: 1X to measure buffer, 1mM DTT, 1X PIC, 5% glycerol, 2 TM GSK3 biotinylation peptide #3928.

Add 16TL ATP/MgCl at 96 hole microtitration plates in suitable hole ₂Use liquid, in order to set up reaction.Add inhibitor or vehicle (1.0Tl), add subsequently the 10Tl peptide to use liquid.Add the 13Tl enzyme use liquid and mix, reaction starts.Reaction is carried out 50 minutes, then adds 60Tl HTRF quencher buffer stopped reaction.At room temperature, hatch the reactant at least 30 minutes of stopped reaction, then reading on the Discovery instrument.

Be used for the quick plate method for measuring of streptavidin:

Step 1:

The 100%DMSO solution of 1 μ l test compounds is joined to 20 μ l 2X substrate solutions (20uM GSK3 peptide, 300 μ M ATP, 20mM MgCl ₂, 20 μ Ci/ml[γ ³³P] ATP, IX measures buffer, 5% glycerol, 1mM DTT, IX PIC, 0.1%BSA and 100mM KCl) in.By adding 19 μ l 2X enzymatic solution (6.4nM active A kt/PKB, 1X measures buffer, 5% glycerol, 1mM DTT, 1X PIC and 0.1%BSA), cause phosphorylation reaction.Then, at room temperature by above-mentioned reaction hatching 45 minutes.

Step 2:

By adding 170 μ l 125 mM EDTA, make reaction terminating.The reaction that 200 μ l are stopped is transferred to streptavidin Flashplate

In PLUS (NEN Life Sciences, catalog number (Cat.No.) SMP103).On oscillator plate, at room temperature by above-mentioned reaction hatching >=10 minutes.By the sucking-off from each hole of material in hole, and clean each hole twice with 200 μ l TBS/ holes.Then, with 200 Jiang Ge hole, μ l TBS/ hole washing 5 minutes, wash three times, in washing step, at room temperature plate is hatched on the platform agitator.

With band cover Packard TopCount that plate and utilization have a suitable setting in Flashplates [ ³³P] counted.

Be used for the method for measuring of streptavidin filter plate:

Step 1:

Carry out enzymatic reaction as above for the mode described in the step 1 of the quick plate analysis of streptavidin.

Step 2:

By adding the guanidine hydrochloride cessation reaction of 20 μ l 7.5M.The reactant transfer that 50 μ l are stopped enters streptavidin filter plate (SAM ^2TMBiotin Capture Plate, Promega, catalog number (Cat.No.) V7542) in, and, before applying vacuum, will react hatching 1～2 minute on filter.

Then, the vacuum manifold that utilizes as described below is washed plate: the 1) 2MNaCl in 4 * 200 μ l/ holes; 2) 2M NaCl and the 1%H in 6 * 200 μ l/ holes ₃PO ₄3) distilled water in 2 * 200 μ l/ holes; With 4) 95% ethanol in 2 * 100 μ l/ holes.Then, before adding scintillator, make film obtain fully air-dry.

Sealed bottom by white base band by plate, add the Microscint 20 in 30 μ l/ holes (PackardInstruments, catalog number (Cat.No.) 6013621) wherein.With transparent sealing band sealing plate top, then utilize and have [ ³³P] suitable setting and the Packard TopCount of liquid scintillator plate is counted.

The method for measuring of cellulose phosphate filter plate:

Step 1:

Mode described in the step 1 of the quick plate analysis of above-mentioned streptavidin is carried out enzymatic reaction, uses KKGGRARTSSFAEPG (SEQ.ID.NO.:16) to replace biotin-GGRARTSSFAEPG as substrate.

Step 2:

By adding 20 μ l 0.75%H ₃PO ₄Cessation reaction.The reactant transfer that 50 μ l are stopped enters filter plate (UNIFILTER ^TM, Whatman P81 strong cation exchanger, white polystyrene 96 orifice plates, Polyfiltronics, catalog number (Cat.No.) 7700-3312) in, and, before applying vacuum, will react hatching 1～2 minute on filter.

Then, the vacuum manifold that utilizes as described below is washed plate: the 1) 0.75%H in 9 * 200 μ l/ holes ₃PO ₄2) distilled water in 2 * 200 μ l/ holes.Sealed bottom by white base band by plate, add the Microscint 20 in 30 μ l/ holes wherein.With transparent sealing band sealing plate top, then utilize and have [ ³³P] suitable setting and the Packard TopCount of liquid scintillator plate is counted.

PKA measures:

Each independent PKA measures and is comprised of following ingredients:

A.5X PKA measures buffer (200mM Tris pH7.5,100mM MgCl ₂, 5mM θ-mercaptoethanol, 0.5mM EDTA);

B.50 the kemptide of μ M dilute with water (Kemptide) (Sigma) is store liquid;

C. pass through 1.0 μ l ³³P-ATP[10mCi/ml] be diluted to prepared by the unmarked ATP of 200 Tl 50 μ M storage liquid ³³P-ATP;

D.10 μ l is diluted to 70nM PKA catalytic subunit (UBI catalogue #14-114) the storage liquid of 0.5mg/ml BSA;

The E.PKA/ kemptide is used liquid: isopyknic 5X PKA measures buffer, kemptide solution and PKA catalytic subunit.

In 96 deep hole assay plate, reacted.To 10Tl ³³Add inhibitor or vehicle (10Tl) in P-ATP solution.In each hole, add 30Tl PKA/ kemptide to use liquid, reaction starts.Reactant, through mixing, is at room temperature hatched 20 minutes.Add 50Tl 100mM EDTA and 100mM tetrasodium pyrophosphate, mix, reaction stops.

Collect enzyme reaction product (phosphorylation kemptide) with p81 cellulose phosphate 96 hole filter plates (Millipore).In each hole of p81 filter plate, add 75mM phosphoric acid with making sheet.By evacuation at the bottom of plate, after filtration, emptying each hole.Add phosphoric acid (75mM, 170 μ l) in each hole.In the respective aperture of phosphoric acid filter plate, each that adds 30 μ l deciles be the PKA reactant of stopped reaction.After evacuation, peptide is trapped within on filter plate, uses 75mM phosphoric acid washing filter plate 5 times.After last washing, that filter plate is air-dry.Add scintillation solution (30 μ l) in each hole, above filter plate is counted at TopCount (Packard).

PKC measures:

Each PKC measures and is comprised of following ingredients:

A.10X the auxiliary activation buffer of PKC: 2.5mM EGTA, 4mM CaCl ₂

B.5X PKC activates buffer: 1.6mg/ml Phosphatidylserine, 0.16mg/ml diacylglycerol, 100mM Tris pH 7.5,50mM MgCl ₂, 5mM θ-mercaptoethanol;

C. by 1.0 μ l ³³P-ATP[10mCi/ml] be diluted to prepared by the unlabelled ATP of 100 μ l 100 μ M storage liquid ³³P-ATP;

D. the myelin basic protein of dilute with water (350 μ g/ml, UBI);

E. be diluted to the PKC (50ng/ml, UBI catalogue #14-115) of 0.5mg/ml BSA;

The F.PKC/ myelin basic protein is used liquid: the auxiliary activation buffer of PKC and each 5 times of volumes of myelin basic protein and PKC are activated to respectively 10 times of volume mixture and making of buffer and PKC.

In 96 deep hole assay plate, measured.At 5.0 μ l ³³Add inhibitor or vehicle (10Tl) in P-ATP.Add the PKC/ myelin basic protein to use liquid, mix, reaction starts.Reactant is hatched 20 minutes under 30 ℃.Add 50Tl 100mM EDTA and 100mM tetrasodium pyrophosphate, after mixing, stopped reaction.Collect the phosphorylation myelin basic protein on the pvdf membrane of 96 hole filter plates, by scinticounting, carry out quantitative assay.

Use above-mentioned algoscopy, particular compound of the present invention is measured, find the IC of described compound to one or more the have≤50 μ M in Akt1, Akt2 and Akt3 ₅₀.

Embodiment 5

Mensuration based on cell is in order to determine the inhibition of Akt/PKB

By cell, (for example tool activates LnCaP or the PTEN of Akt/PKB ^(-/-)Tumor cell line) be inoculated in the 100mM culture dish.When Growth of Cells converges to about 70-80%, then add the new culture medium of 5ml and test compound solution.Contrast comprises the cell that untreated cell, the cell of processing through vehicle and the LY294002 (Sigma) existed in order to 20 μ M or 200nM respectively or wortmannin (Sigma) are processed.Cell is hatched 2,4 or 6 hours, abandons culture medium.Cell washs with PBS, scrapes, and transfers in centrifuge tube.Make cell become granule, again wash with PBS.Finally, the cell granule is resuspended in to lysis buffer (20mM Tris pH8,140mM NaCl, 2mMEDTA, 1%Triton, 1mM tetrasodium pyrophosphate, 10mM θ-glycerophosphate, 10mM NaF, 0.5mM NaVO ₄, 1 μ M Microsystine and 1x protease inhibitor cocktail) in, on ice, place 15 minutes, gentle vortex makes lysis.Lysate is put into to the Beckman tabletop ultracentrifuge, 4 ℃ with 100,000 * g centrifugal 20 minutes.By standard Bradford scheme (BioRad), the protein in supernatant is carried out to quantitative analysis, be stored in-70 ℃ stand-by.

As follows, protein in cleared lysate is carried out to immunoprecipitation (IP): for Akt1/PKBI, lysate is mixed with the Santa Cruz sc-7126 (D-17) in NETN (100mM NaCl, 20mM Tris pH 8.0,1mMEDTA, 0.5%NP-40), add A/G albumen agarose gel (Santa Cruz sc-2003).For Akt2/PKB θ, lysate is mixed with the anti-Akt-2 agarose (Upstate Biotechnology#16-174) in NETN, as for kt3, lysate is mixed with the anti-Akt3 agarose (Upstate Biotechnology#16-175) in NETN.Immunoprecipitate (IP) is 4 ℃ of lower overnight incubation, and washing, separated with SDS-PAGE.

Use the total Akt of western blot analysis, pThr308 Akt1, pSer473 Akt1, and Akt2 and the upper corresponding phosphorylation site of Akt3, with the Akt downstream targets, wherein utilize specific antibody (Cell Signaling Technology) to carry out: anti-total Akt (catalog number (Cat.No.) 9272), anti-phosphoric acid Akt serine 473 (catalog number (Cat.No.) 9271) and anti-phosphoric acid Akt threonine 308 (catalog number (Cat.No.) 9275).Under 4 ℃, after suitable first antibody overnight incubation with PBS+0.5% defatted milk powder (NFDM) dilution, the washing trace, at room temperature with PBS+0.5%NFDM in the second antibody of horseradish peroxidase (HRP) labelling hatch 1 hour.Detect protein with ECL reagent (Amersham/PharmaciaBiotech RPN2134).

Embodiment 6

The Akt activation of adjusting albumen to stimulate

By the MCF7 cell, (be PTEN ^{+ /+}A kind of people's breast carcinoma system) with 1 * 10 ⁶Cell/100mM plate is inoculated in culture plate.When cell is 70-80% while converging, then add 5ml serum-free medium overnight incubation.In morning next day, add compound, and then incubated cell 1-2 hour adds and adjust albumen (inducing the activation of Akt) 30 minutes, with said method, cell is analyzed.

Embodiment 7

The inhibition of tumor growth

Effect in the body of growth of cancer cells inhibitor, can be determined by several schemes well-known in the art.

The 0th day, at (Harlan) left flank place of the female athymic mouse (male mice [10-14 age in week] is also for tumor of prostate xenotransplantation [LnCaP and PC3]) in age in 6-10 week, the subcutaneous injection human tumor cell line, this cell line has PI3K approach (such as LnCaP, PC3, C33a, OVCAR-3, MDA-MB-468, A2780 etc.) imbalance.At random mice is divided into to vehicle group, compound group or therapeutic alliance group.From first day, every day is through subcutaneous administration, and in experimentation successive administration.Perhaps, can select the continuous infusion pump, give the inhibitor test compound.Compound, compound combination or vehicle be take cumulative volume as the 0.2ml administration.Usually 4-5.5 week after the injection cell, when the infringement diameter of the animal of all vehicle treatment is 0.5-1.0cm, tumor resection is also weighed.Calculate the average weight of each cell line tumor of each treatment group.

Embodiment 8

Blurring drive test fixed (Spot Multiplex Assay)

The method has been described the sandwich immunoassay (sandwich immunoassay) for detection of a plurality of phosphorylating proteins in hole identical in 96 hole form plates.Cultured cell lysate in 96 orifice plates, on this 96 orifice plate, different capture antibodies spatially is arranged on the different speckles in same holes.Add phosphorylation-specificity rabbit polyclonal antibody, the anti-rabbit antibody test complex made marks by electricity consumption chemiluminescent labelling thing.

96 hole LNCaP plate +/-compounds:

In Beckman J6 with 1200rpm centrifugal 10 minutes, the sucking-off medium.Add 50 μ l/ hole: TBS (Pierce#28376-20mM Tris pH 7.5,150mM NaCl)+1%Triton X-100+ protease and inhibitors of phosphatases.Wrap in plastics package, be placed in-70 ℃ of cryoprobes before fully freezing.Multichannel (Multiplex) plate (Meso Scale Discovery, Gaithersburg, MD) of blockading in the Tris of 1X lavation buffer solution with 3% blocking agent A, 150 μ l/ holes.Cover with the plate band, at room temperature cultivate 2 hours (minimum 2 hours) on the Micromix agitator.With 1X RCM 51 (TTBS), wash.The cell pyrolysis liquid plate that thaws on ice, to the lysate/hole of adding 40 μ l in the plate of being blockaded.Cover with the plate band, cultivate at 4 ℃ of O/N on the Micromix agitator, with 1X RCM 51 washings.Dilute secondary antibody: anti-phosphoric acid AKT (T308) in 1X Tris lavation buffer solution at 1% blocking agent A, anti-phosphoric acid tuberin (Tuberin) (T1462), alone or in combination.Add 25 μ l/ holes, cover with the plate band, at room temperature cultivate on the Micromix agitator 3 hours, with 1X RCM 51 washings.Dilute Ru-GAR at 1% blocking agent A in 1X Tris lavation buffer solution.Add 25 μ l/ holes, cover with the plate band, at room temperature cultivate on the Micromix agitator 1 hour, with 1X RCM 51 washings.Water is diluted to 1X by 4X reading buffer T, adds the diluted reading buffer of every hole 200 μ l.

Reading on Sector 6000 imagers.

Protease and inhibitors of phosphatases:

Microcystin-LR, Calbiochem#475815 is to the ultimate density (storage liquid=500 μ M) of 1 μ M

Calbiochem#524624，100X Set I

Calbiochem#524625，100X Set H

Calbiochem#539134，100X Set III

Anti-phosphoric acid AKT (T308):

Cell Signalling Technologies#9275

Anti-phosphoric acid tuberin (T1462):

Covance Affinity Purified (rabbit MS 2731/2732)

Ru-GAR=ruthenium (Ruthenylated) goat anti-rabbit antibodies

10X Tris lavation buffer solution, blocking agent A and 4X reading buffer T

10X RCM 51(10X TTBS RCM 51)

1X=20mM Tris pH 7.5,140mM NaCl, 0.1% tween 20

Embodiment 9

Cell based (in body) test

The method has been described for the cell based of Akt serine/threonine kinase (in body) activity test.The endogenous Akt of activation can make biotinylated specificity Akt substrate (GSK3 β) peptide phosphorylation.By homogeneous phase time discrimination fluorescence (HTRF), use and europium Kryptate[Eu (K)] the phosphopeptide specific antibody of combination detected with the XL665 fluorogen be connected with Succ-PEG-DSPE (it is combined the biotin moiety on peptide).When [Eu (K)] and XL665 approach (when same phosphopeptide molecule is combined), non-radiative energy occurs from Eu (K) to XL665 to be shifted, then at 665nm from the XL665 utilizing emitted light.

If all there is separately specific antibody, this test can be used for detecting the inhibitor from all three kinds of Akt isozymes (Akt1, Akt2 and Akt3) of various different plant species.

Material and reagent

A.Cell Culture Microtiter Flat Bottom 96 orifice plates, CorningCostar, catalog number 3598

B.Reacti-Bind protein A coating 96 orifice plates, Pierce, catalog number 15130

C.Reacti-Bind Protein G coating 96 orifice plates, Pierce, catalog number 15131

D.Micromix 5 agitators

E.Microfluor

Microtitration plate at the bottom of the B U-shaped, DynexTechnologies, catalog number 7205

F.96 orifice plate scrubber, Bio-Tek Instruments, catalog number EL404

G.Discovery HTRF microtitration plate analyzer, PackardInstrument Company

Buffer

A.IP kinases cell lysis buffer solution: 1X TBS; 0.2% polysorbas20; 1X protease inhibitor cocktail III (storage liquid is 100X, Calbiochem, 539134); 1X inhibitors of phosphatases mixture I (storage liquid is 100X, Calbiochem, 524624); With 1X inhibitors of phosphatases mixtures II (storage liquid is 100X, Calbiochem, 524625).

B.10X measure buffer: 500mM Hepes pH 7.5; 1%PEG; 1mM EDTA; 1mM EGTA; With 20mM β-glycerophosphate.

C.IP kinase assay buffer: 1X measures buffer; 50mM KCl; 150 μ M ATP; 10mM MgCl ₂5% glycerol; 1mM DTT; Every 50ml measures 1 protease inhibitor cocktail of buffer; And 0.1%BSA.

D.GSK3 β substrate solution: IP kinase assay buffer; With 500nM biotinylation GSK3 β peptide.

E.Lance buffer: 50mM Hepes pH 7.5; 0.1%BSA; With 0.1%Triton X-100.

F.Lance stop buffer: Lance buffer; And 33.3mMEDTA.

G.Lance detects buffer: the Lance buffer; 13.3 μ g/ml SA-APC; With 0.665nM EuK Ab a-phosphoric acid (Ser-21) GSK3 β.

Multi-step immunoprecipitation Akt kinase assays

First day

A. inoculate C33a cell step: plate 60,000 C33a cells/well, at 96 hole microtitration plates.

B. at 37 ℃ of cultured cells, spend the night.

Second day

D. compound adds step: add the compound in fresh culture (α-MEM/10%FBS, room temperature) to above-mentioned 96 orifice plates and cultivate 5 hours in tissue culture's couveuse.

E. lysis step: sucking-off culture medium the IP kinases cell lysis buffer solution of adding 100 μ l.

F. at-70 ℃ of freezing 96 hole microtitration plates, (explain: this step can be carried out at least 1 hour or spend the night.)

The 3rd day

G. protein coating A/G 96 orifice plate steps: to the α that is added on the debita spissitudo in 100 μ l PBS in following hole-Akt antibody (Akt1, Akt2 or Akt3):

α-Akt1 (20g/ hole/100 μ l) B2>>>>>>the capable B-G/Akt1 plate of B10/

α-Akt2 (50ng/ hole/100 μ l) B2>>>>>>the capable B-G/Akt2 plate of B10/ rabbit-IgG (B11-G11 (Akt1 and Akt2)/100 μ l of 150ng/ hole on each plate):

H. on Micromix 5 between cold-room (+4 ℃) cultivate 4 hours (forms (Form) 20; Attitude (Attitude) 2) (explain: attitude is determined according to Micromix 5 machines).

I. sucking-off α-Akt antibody-solutions to adding the PBS of 100 μ l in each hole.

J.Akt immunoprecipitation step: to adding cell pyrolysis liquid that 5 μ l thaw in the PBS of the 100 μ l that derive from step (I) for the Akt1 plate and adding cell pyrolysis liquid that 10 μ l thaw for the Akt2 plate.Explain: cell pyrolysis liquid thaws on ice.Drew up and down 10 times by pipet and mix the lysate thawed before transferring to antibody panel.Preserve cell pyrolysis liquid on ice.After cell pyrolysis liquid is transferred to antibody panel at-70 ℃ of plates of frozen cell lysate again.

K. go up in cold room (+4 ℃) overnight incubation at Micromix 5 agitators (form 20, attitude 3).

The 4th day

L. immunoprecipitation plate washing step: use 96 orifice plates for scrubber TTBS (RCM 51,1X=2 circulation) wash 96 orifice plate 1X.Fill each hole and cultivate 10 minutes with TTBS.Wash 96 orifice plate 2X with TTBS.(explain: be ready to the plate scrubber before use: 1. check buffer container, guarantee that they fill, and 2. waste fluid containers that soar.

M. manual plate washing step: the IP kinase assay buffer that adds 180 μ l.

N. start the Akt enzyme reaction: the sucking-off supernatant.Add the GSK3 β substrate solution of 60 μ l.

O. on Micromix 5 agitators incubated at room temperature 2.5 hours.Explain: should adjust incubation time, make the ratio of post 10/ post 11 be not more than 10.

P. the Lance of 30 μ l is detected to the Lance stop buffer merging (60 μ l cumulative volume/hole) of buffer and 30 μ l, and add at the bottom of the Microfluor U-shaped in 96 hole black plates.

Q. stop the Akt enzyme reaction: the Akt enzyme reaction mixture of 40 μ l that will derive from a-protein/G 96 orifice plate origin of step (O) is transferred at the bottom of the Microfluor U-shaped that derives from step (P) in 96 hole black plates.

U. at room temperature cultivate 1-2 hour on Micromix 5 agitators (form 20, attitude 3), then use Discovery HTRF microplate analyzer reading for the Akt program.

IP kinases cell lysis buffer solution

100 μ l/ holes

	8ml (1 plate)		45ml (6 plates)
				1X TBS polysorbas20 1X protease inhibitor cocktail III 1X protease inhibitor cocktail I 1X protease inhibitor cocktail II microcystin LR (500 X)	7744μl 20μl 80μl 80μl 80μl		NA NA NA 450μl 450μl 450μl 90μl

The IP kinase assay buffer

100 μ l/ holes

	8ml (1 plate)		50ml (3 plates)
				10X measures buffer 1M KCl250mM ATP1M MgCl ₂Glycerol 1M DTT protease inhibitor cocktail 10%BSAdi dH ₂O	1/50ml of 800 μ l 400 μ l 4.8 μ l 80 μ l 400 μ l 8 μ l, 80 μ l 6227.2 μ l		5ml 2.5ml 30μl 500μl 2.5ml 50μl 1 500μl 38.9ml

GSK3 β substrate solution

60 μ l/ holes

	5ml (1 plate)		7ml
				IP kinase assay buffer 1mM GSK3 β peptide	5ml 2.5μl		- 3.5μl

The Lance stop buffer

30 μ l/ holes

	3ml (1 plate)	5ml	5ml
				1X Lance buffer EDTA 0.5M	2800.2μl 199.8μl

Lance detects buffer

30 μ l/ holes

	3ml (1 plate)		5ml
				SA-APC (1mg/ml, in ddH2O, dilutes 1/75.2 in the Lance buffer) EuK Aba-phosphoric acid (Ser 21) GSK3 β (680nM dilutes 1/1133 in the Lance buffer)	40μl 2.7μl		66.7μl 4.5μl

Claims

1. the compound or pharmaceutically acceptable salt thereof meaned by following formula J:

Wherein:

A is 0 or 1; B is 0 or 1; M is 0,1 or 2;

Dotted line represents optional two keys;

When optional two keys of this dotted line representative do not exist, R ¹It is oxo; Or

When optional two keys of this dotted line representative exist, R ¹Be selected from: CF ³, H, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-phenyl, halogen, OH, (C=O) _aNR ⁷R ⁸, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, SH and (C=O) _aO _b-heterocyclic radical, described alkyl, phenyl, cycloalkyl and heterocyclic radical optionally are selected from R by 1-6 ⁶Substituent group replace, wherein said heterocyclic radical refers to and contains 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, and comprises bicyclic radicals;

R ³' and R ³" independently selected from: H, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aNR ⁷R ⁸, (C=O) _aO _b(C ₃-C ₈) cycloalkyl, (C ₁-C ₆) alkyl-heterocyclic radical and (C=O) _aO _b-heterocyclic radical, described alkyl, cycloalkyl and heterocyclic radical optionally are selected from R by 1-5 ⁶Substituent group replace; Perhaps R ³' and R ³" form piperidines together with the nitrogen that can connect with it, piperidines can optionally be selected from R by 1-5 ⁶Substituent group replace, wherein said heterocyclic radical refers to and contains 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, and comprises bicyclic radicals;

R ⁴And R ⁵Be independently: H, (C ₁-C ₆) alkyl, and R wherein ⁴And R ⁵Can be connected to form (C ₃-C ₇) cycloalkyl, wherein said cycloalkyl optionally is selected from R by maximum three ⁶Substituent group replace;

R ⁶For: CF ³, (C=O) _aO _bC ₁-C ₁₀Alkyl, (C=O) _aO _bPhenyl, (C=O) _aO _bHeterocyclic radical, halogen, CN, OH, O _a(C=O) _bNR ⁷R ⁸, oxo, S (O) _m-(C ₁-C ₁₀) alkyl or (C=O) _aO _bC ₃-C ₈Cycloalkyl, described alkyl, phenyl, heterocyclic radical and cycloalkyl optionally are selected from R by 1-5 ^6aSubstituent group replace, wherein said heterocyclic radical refers to and contains 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, and comprises bicyclic radicals;

R ^6aBe selected from: (C=O) _aO _b(C ₁-C ₁₀) alkyl, OH, halogen, (C ₀-C ₆) alkylidene-phenyl, (C ₀-C ₆) alkylidenyl-heterocyclic base and (C=O) _aNR ^b ₂, described alkyl, phenyl and heterocyclic radical optionally are selected from R by maximum three ^b, OH and oxo substituent group replace, wherein said heterocyclic radical refers to and contains 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, and comprises bicyclic radicals;

R ⁷And R ⁸Independently selected from: H, (C=O) _aO _b(C ₁-C ₁₀) alkyl, (C=O) _aO _b-phenyl and (C=O) _aO _b-heterocyclic radical, described alkyl, phenyl and heterocyclic radical optionally are selected from R by 1-5 ^6aSubstituent group replace, wherein said heterocyclic radical refers to and contains 1-4 heteroatomic 3-10 unit's aromatic heterocycle or non-aromatic heterocyclic that is selected from O, N and S, and comprises bicyclic radicals; Perhaps R ⁷And R ⁸Form together with the nitrogen that can connect with it and optionally contain one or two other first monocycle of the heteroatomic 3-7 that is selected from N, O and S except containing described nitrogen, described monocycle optionally is selected from R by 1-6 ^6aSubstituent group replace;

R ^bBe independently: H.

2. be selected from following compound or pharmaceutically acceptable salt thereof:

9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine;

3-methyl-9-phenyl-8-(4-{[4-(5-pyridine-2-base-1H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

8-(4-amino methyl-phenyl)-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-3-alcohol;

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine;

4-(3-methyl-9-phenyl-[1,2,4] triazols [3,4-f] [1,6] naphthyridines-8-yl)-benzyl amine;

8-[4-(amino methyl) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-amine;

1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine;

9-phenyl-8-{4-[4-(5-pyridine-2-base-4H-[1,2,4] triazole-3-yl)-the piperidin-1-yl methyl]-phenyl }-[1,2,4] triazols [3,4-f] [1,6] naphthyridines;

9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl)-3-(1H-1,2,3-triazole-4-yl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyrimidine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

[9-phenyl-8-(4-{[4-(5-pyrazine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methanol;

8-[4-(the amino cyclopropyl of 1-) phenyl]-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl } methanol;

1-[4-(9-phenyl-3-pyridin-4-yl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methylamine;

5-({ [4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) pyridine-2-alcohol;

N-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] acetamide;

4-({ [4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino } methyl) phenol;

1-[9-phenyl-8-(4-{[4-(5-pyridine-2-base-4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-3-yl] methylamine;

9-phenyl-3-(1H-1,2,3-triazole-4-yl)-8-(4-{[4-(4H-1,2,4-triazole-3-yl) piperidin-1-yl] methyl } phenyl) [1,2,4] triazols [3,4-f]-1, the 6-naphthyridines;

1-{4-[3-(1H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } methylamine;

4-[9-phenyl-3-(pyrrolidin-1-yl methyl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] benzyl amine;

[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] methanol;

4-[3-(1-methyl isophthalic acid H-imidazol-4 yl)-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] and phenyl } methanol;

1-[4-(9-phenyl-3-[1,2,4] triazol [1,5-a] pyrimidine-2-base [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethanol;

1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] cyclopropylamine;

(1R)-1-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine;

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] ethamine;

(1R)-1-{4-[9-phenyl-3-(5-pyridine-2-base-1H-pyrazole-3-yl) [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl] phenyl } ethamine;

(1R)-1-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-1-amine;

2-[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine;

2-[4-(9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) phenyl] third-2-amine; With

3-(2-{[4-(3-methyl-9-phenyl [1,2,4] triazols [3,4-f]-1,6-naphthyridines-8-yl) benzyl] amino }-the 2-oxoethyl) pyridine.

3. pharmaceutical composition, the compound claimed in claim 1 that it comprises pharmaceutically suitable carrier and is dispersed in treatment effective dose wherein.

4. the purposes in the medicine of the cancer of the compound of claim 1 in the mammal that needs treatment for the preparation for the treatment of, described cancer is selected from ovarian cancer, cancer of pancreas, breast carcinoma, carcinoma of prostate and the glioblastoma relevant with the active disorder of Akt and Akt downstream cellular targets.