CN101327324A - Method and composition for treating autoimmunity disease - Google Patents

Abstract

The invention which belongs to the field of immunology, discloses the application of B cell-specific transcriptional coactivator OBF-1 gene or protein. The invention is used for preparing a composite which reduces or optionally reduces cells secreted by autoantibody. The invention also discloses the application of the agonist of an OBF-1 gene or protein, which is used for preparing a composite which reduces cells secreted by autoantibody. Besides, the invention also discloses an animal model which is suitable for studying self-immunity diseases related to OBF-1.

Description

The method and composition of treatment autoimmune disease

Technical field

The invention belongs to field of immunology, more specifically, the present invention relates to the purposes of OBF-1 gene or albumen or their antagonist, the invention still further relates to the method for screening immunoregulation medicament.

Background technology

Autoimmune disease is a class major disease.80 various autoimmune diseases have been identified clinically.According to the report of the America NI H Committee of Experts in 2002, autoimmune disease involves the crowd of 5-8%.The generation of autoantibody is the main or important reasons that development takes place many autoimmune diseasees.As common systemic lupus erythematosus (sle), autoimmune hemolytic anemia, myasthenia gravis, rheumatoid arthritis, Sjogren ' s syndrome etc.

Immunosuppressant and glucocorticoid are still the main means of present treatment autoimmune disease.Though this two classes medicine is control disease more effectively, because the function that their non-specific ground suppresses body's immunity and has a strong impact on other histoorgans comprehensively, longer application can cause serious toxic and side effects.At present, change this present situation and depend on the deep understanding that autoantibody is produced molecular mechanism.Find and identify that the medicine that can suppress or eliminate the autoimmune disease that key gene that autoantibody produces mediates the development anti self antibody is most important that this has become the common recognition of scientist, clinicist and the drugmaker of association area.

Therefore, this area presses for further research and with autoimmune disease the molecular mechanism relevant with development takes place, and finds these machine-processed key genes of participation.

Summary of the invention

The object of the present invention is to provide a kind of B cell-specific to transcribe co-activation factor OBF-1 gene or proteic purposes, can be used for preparing the compositions that reduces antibody secreting cell or screen the compositions that reduces antibody secreting cell.

Another object of the present invention is to provide the B cell-specific to transcribe the purposes of co-activation factor OBF-1 gene or proteic antagonist, be used to prepare the compositions that reduces antibody secreting cell.

Another object of the present invention is to provide a kind of B of preparation cell-specific to transcribe the method for the MRL-lpr mice of co-activation factor OBF-1 disappearance.

In a first aspect of the present invention, the purposes that provides a kind of B cell-specific to transcribe co-activation factor OBF-1 gene or proteic antagonist is used to prepare the material that reduces the autoantibody secretory cell.

In another preference, described antibody secreting cell is the IgG secretory cell.

In another preference, be used to prepare the material that reduces mammal autoantibody secretory cell.Preferred, described mammal is the people.

In another preference, the material of described minimizing autoantibody secretory cell also is used to reduce the generation of mammal autoantibody.

In another preference, the material of described minimizing autoantibody secretory cell does not influence substantially for the expression of plasma cell specific gene (as Blimp-1, Xbp-1, IRF-4).

In another preference, the material of described minimizing autoantibody secretory cell does not influence substantially for the B cells whose development.

In another preference, the material of described minimizing autoantibody secretory cell also is used to reduce CD4 ^-CD8 ^-B220 ⁺CD3 ⁺Cells accumulation.

In another preference, the material of described minimizing autoantibody secretory cell also is used to reduce the kidney immune complex deposit.

In another preference, the material of described minimizing autoantibody secretory cell also is used to prevent and treat glomerulonephritis.

In another preference, described antagonist is selected from: the B cell-specific is transcribed co-activation factor OBF-1 gene or proteic part, antibody, siRNA or antisense nucleotide.

In another preference, described siRNA is selected from:

SiRNA with sequence shown in the SEQ ID NO:21; Or

SiRNA with sequence shown in the SEQ ID NO:22.

In another preference, the material of described minimizing autoantibody secretory cell also is used to prepare the preparation of prevention or treatment autoimmune disease.

In another preference, described autoimmune disease comprises: systemic lupus erythematosus (sle), or the autoimmune disease such as the autoimmune hemolytic anemia of other autoantibody mediation, rheumatoid arthritis etc.

In a second aspect of the present invention, provide a kind of B cell-specific to transcribe co-activation factor OBF-1 gene or proteic purposes, be used to prepare the material that reduces the autoantibody secretory cell.

In another preference, the material of described minimizing autoantibody secretory cell is selected from (but being not limited to): antibody, siRNA, antisense nucleotide.

In a third aspect of the present invention, provide a kind of B cell-specific to transcribe co-activation factor OBF-1 gene or proteic purposes, be used to screen the material that reduces the autoantibody secretory cell.

In a fourth aspect of the present invention, a kind of method of screening the material that reduces the autoantibody secretory cell is provided, described method comprises step:

(a) candidate substances and expression B cell-specific are transcribed the proteic cells contacting of co-activation factor OBF-1; With

(b) detect candidate substances to the proteic influence of OBF-1;

Wherein, (preferably significantly reduce, as reduce by 20% or lower if described candidate substances can reduce; Preferred reduction by 40% or lower; Further preferred reduction by 60% or lower) proteic expression of OBF-1 or the proteic activity of inhibition OBF-1 show that then this candidate substances is to reduce the material of autoantibody secretory cell.

In another preference,

Step (a) comprising: in the test group, transcribe in the proteic cell culture of co-activation factor OBF-1 and add candidate substances expressing the B cell-specific; With

Step (b) comprises, detects expression or the activity of OBF-1, and with matched group relatively, wherein said matched group be do not add described candidate substances, express the proteic system of OBF-1.

In a fifth aspect of the present invention, provide a kind of B of preparation cell-specific to transcribe the method for the MRL-lpr mice of co-activation factor OBF-1 disappearance, described method comprises:

(1) MRL-lpr lupus mice and OBF-1 disappearance mice are hybridized, produce first filial generation mice (F1);

(2) with first filial generation mice pairing hybridization, produce second filial mice (F2); With

(3) identify second filial mice genotype, pick out the MRL-lpr mice of OBF-1 disappearance.

In another preference, in step (3) afterwards, also comprise step (4): the MRL-lpr mice and the parental generation MRL-lpr mice of OBF-1 disappearance are backcrossed; Hybridize-backcross 2-15 generation (preferred 4-10 generation, more preferably 6～8 generations), thereby obtain the MRL-lpr mouse model of the stable OBF-1 disappearance of lupus phenotype.

In another preference, come the identified gene type by design OBF-1 wild type, OBF-1 deletion form, Fas wild type, Fas deletion form Auele Specific Primer and PCR.

In another preference, the present invention also provides the purposes of the MRL-lpr mice of described OBF-1 disappearance, is used to study OBF-1 and participates in autoimmune disease mechanism.

In a sixth aspect of the present invention, the method of the excessive generation relevant disease of a kind of prevention or treatment autoantibody secretory cell is provided, and described method comprises: the B cell-specific that gives experimenter's effective dose is transcribed co-activation factor OBF-1 gene or proteic antagonist.

In another preference, the excessive generation relevant disease of described autoantibody secretory cell is an autoimmune disease.

Others of the present invention are because the disclosure of this paper is conspicuous to those skilled in the art.

Description of drawings

Fig. 1 has shown and has set up OBF-1 ^-/-Fas ^-/-The schematic flow sheet of mouse model.

Fig. 2 has shown the insertion sudden change sketch map of mice Fas genomic DNA intron 2.The top list structure is a wild type Fas allele; The bottom list structure is the saltant Fas allele that carries insert structure.

Fig. 3 has shown the genotypic result of PCR and electrophoresis evaluation mice.Shown and had following genotype OBF-1 ^-/-Fas ^-/-And OBF-1 ^{+ /+}Fas ^-/-The DNA of mice or the electrophoresis result of RNA PCR product.Wherein: A is that the PCR of Fas gene wild type and Fas Gene Deletion identifies; B is that the PCR of OBF-1 gene wild type and OBF-1 Gene Deletion identifies; C is that the RT-PCR of OBF-1 gene wild type and OBF-1 Gene Deletion identifies.OBF-1 ^{+ /+}, OBF-1 ^-/-Be used as contrast with MRL-lpr.

Fig. 4 has shown that ELISA detects the level of serum immune globulin and subclass thereof.Every group is detected 6 mices, and the serum that is used to detect is available from the 6-10 mice in age in week.

Fig. 5 has shown that ELISA detects anti-dsDNA antibody and antinuclear antibody (ANA) in the serum of genotype mice.Wherein, A is an IgG1 anti-ds dna antibody, and B is an IgG2a anti-dsDNA antibody, and C is a total IgG anti-dsDNA antibody, and D is total IgG anti-ANA detection of antibodies result.The serum that obtains from the Xid mice is used as negative control, blank (Blank) expression serum-free sample.The mice in 6 12-15 of every group analysis age in week.

Fig. 6 has shown that indirect immunofluorescence detects antinuclear antibody level in the mice serum.Wherein, left column is the OBF-1 of 1: 100 and 1: 500 dilution ^{+ /+}Fas ^-/-The OBF-1 that the testing result of the serum of mice, the right side were classified as 1: 100 and diluted at 1: 500 ^-/-Fas ^-/-The testing result of the serum of mice; Analyzed serum is available from the mice at 3 3-4 monthly ages.

Fig. 7 has shown that ELISPOT detects the antibody secreting cell of spleen and bone marrow, and the MRL-lpr mice of OBF-1 disappearance can not produce the IgG secretory cell.Wherein, A is 1 * 10 ⁵The amount of spleen IgG secretory cell in the spleen cell, B is the amount of the IgG secretory cell in each spleen, C is 1 * 10 ⁵The amount of IgG secretory cell in the medullary cell (BM).Every group of data are represented with meansigma methods and the standard deviation of 5 analyzed mices.

Fig. 8 has shown that RT-PCR detects B220 ⁺Gene expression in the splenocyte.Wherein, A has shown that total RNA is by the OBF-1 from equivalent ^{+ /+}MRL-lpr or OBF-1 ^-/-The B220 of MRL-lpr mice ⁺Separate in the cell, and detect Irf-4, Xbp-1, Blimp-1, Bcl-6, J chain, the beta-actin (expression of β-actin) by RT-PCR.B has shown that total RNA is by the OBF-1 from equivalent ^{+ /+}Or ^OBF-1-/-The B220 of mice ⁺Separate in the cell, and detect Jchain and beta-actin by RT-PCR.

Fig. 9 has shown that flow cytometry detects immature cell (IgM in the spleen ⁺CD19 ⁺) and mature cell (IgD ⁺CD19 ⁺).Every kind of genotypic spleen cell has provided the painted positive cell percent of list or double antibody, the result of 6 3-4 of data represented every kind of genotype monthly age mice with indicating the two dyeing of antibody and carrying out flow cytometry among the figure.

Figure 10 has shown that flow cytometry detects immature cell (IgM in the bone marrow ⁺CD19 ⁺) and mature cell (IgD ⁺CD19 ⁺).Medullary cell is with the two dyeing of indication antibody and carry out flow cytometry, the result of 6 3-4 of data represented every kind of genotype monthly age mice.

Figure 11 has shown flow cytometry CD3 and two spleen cell and the lymph-node cell of dying of B220.In the MRL-lpr mice, B220 in the OBF-1 deficiency ⁺CD3 ⁺Cell gather remarkable minimizing.Available from the cell of spleen (A) or lymph node (B) with the indication antibody staining and carry out flow cytometry.6 mices of every group analysis.

Figure 12 has shown the IgG of the immunofluorescence dyeing observation glomerule that kidney is cut into slices and the deposition of C3.Utilize the link coupled anti-mouse antibodies of FITC (being illustrated in the figure left side) to kidney section carrying out immunofluorescence dyeing.Identify OBF-1 ^{+ /+}The MRL-lpr mice has IgG and C3 deposition, but at OBF-1 of the same age ^-/-Do not deposit in the MRL-lpr mice.

Figure 13 has shown the PAS dyeing observation glomerulonephritis of kidney section.Paraffin full section carrying out PAS dyeing, OBF-1 ^{+ /+}And OBF-1 ^-/-Mice shows that glomerule is normal; OBF-1 ^{+ /+}The section of MRL-lpr mice shows that glomerule is undesired, has crescent to form, and the obvious enlargement of glomerule, and this is the symptom of serious inflammation; At OBF-1 ^-/-Visible inflammation does not take place in the kidney of MRL-lpr mice.

Figure 14 has shown the observation of mouse death rate.OBF-1 deficiency MRL-lpr mice has obvious length than OBF-1 wild-type mice life-span.All OBF-1 ^-/-MRL-lpr mice (n=13) all survived to 7 monthly ages, and the OBF-1 of 43.8% (16 merely hit 7) only ^{+ /+}MRL-lpr mice (n=16) survived to 7 monthly ages.The difference of survival rate is significant between two groups, p＜0.0001.

Figure 15 has shown that OBF-1 siRNA reduces OBF-1 gene expression and the effectively secretion of minimizing autoantibody.Wherein, A is for after utilizing OBF-1 siRNA and disturbing, the level of OBF-1 mRNA; B is the excretory result of IgG autoantibody.

The specific embodiment

The inventor is through extensive and deep research, find that first the B cell-specific transcribes co-activation factor OBF-1 in the aborning pivotal role of autoantibody, and the inhibition of OBF-1, downward modulation or disappearance can significantly reduce the generation of antibody secreting cell in the mammalian body.Because the excessive generation of antibody secreting cell is the key factor that causes autoimmune disease, therefore inhibition or downward modulation OBF-1 gene or proteic expression can prevent or treat autoimmune disease such as systemic lupus erythematosus (sle).Finished the present invention on this basis.

As used herein, " OBF-1 defective " or " OBF-1 disappearance " or " OBF-1 ^-/-" be used interchangeably, be meant all that in animal subject the OBF-1 gene is by silence.

As used herein, " Fas defective " or " Fas disappearance " or " Fas ^-/-" be used interchangeably, be meant all that in animal subject the Fas gene is by silence.The MRL-lpr mice shows as Fas ^-/-Genotype.

As used herein, described " OBF-1 gene or proteic antagonist " is meant any OBF-1 of inhibition gene or proteic activity, reduces the material of OBF-1 gene or proteic stability, inhibition or blocking-up OBF-1 gene or proteic signal path, inhibition OBF-1 gene or proteic expression, minimizing OBF-1 gene or albumen effective acting time or inhibition OBF-1 gene transcription or translation.Described " OBF-1 gene or proteic antagonist " includes but not limited to: OBF-1 gene or proteic inhibitor, blocker, following adjustment etc.

OBF-1

OBF-1 claims OCA-B or Bob-1 again, is a kind ofly extensively to be present in B cell-specific in the mammal, high conservative and to transcribe the co-activation factor.It can with Oct-1 or the proteic POU domain interaction of Oct-2, and then form trimer compositions with the octamer motif ATGCAAAT of immunoglobulin gene promoter and enhancer.In a plurality of stages of B cell development, the energy of rupture of OBF-1 gene target spot weakens its growth.

The MRL-lpr mouse model that the OBF-1 that utilizes the present invention to prepare lacks, the inventor is surprised to find that the disappearance of OBF-1 can significantly reduce the generation of autoantibody secretory cell in this mice body, it can also reduce the generation of autoantibody in this mice body.Particularly importantly, the inventor finds that also the disappearance of OBF-1 is for the not influence of expression of mice body entoplasm cell-specific gene (as Blimp-1, Xbp-1, IRF-4), for B cells whose development also not influence.The disappearance of OBF-1 also can reduce CD4 ^-CD8 ^-B220 ⁺CD3 ⁺Cells accumulation reduces the kidney immune complex deposit.

The purposes of OBF-1 or its antagonist

In order to prove the purposes of OBF-1, the inventor has set up the MRL-lpr lupus erythematosus mouse model of OBF-1 defective, observe the influence that OBF-1 antagonist secretory cell is grown, detect content and the anti-ds-DNA antibody and the antinuclear antibody level of immunoglobulin in the mice serum by ELISA, use immunofluorescence dyeing Hep-2 cell subsequently, detect the antinuclear antibody in the serum, further detect antibody or autoantibody secretory cell in mouse spleen and the bone marrow, and then observe the expression of mouse spleen B cell mesoplasmatocyte specific gene by RT-PCR with ELISPOT.For the mechanism that the MRL-lpr mice autoantibody of studying the OBF-1 defective produces, observed immaturity (CD19 in spleen and the bone marrow with flow cytometry ⁺IgM ⁺) and ripe (CD19 ⁺IgD ⁺) CD4 in B cells whose development and spleen and the lymph node ^-CD8 ^-B220 ⁺CD3 ⁺The situation of T cell.Observe the influence of OBF-1 defective to MRL-lpr mice glomerulonephritis then, immunofluorescence is observed the immune complex of kidney and the deposition of complement, and brightic inflammatory reaction is observed in PAS dyeing, and then research OBF-1 defective is to the influence of mice survival rate.Found that, with OBF-1 ^{+ /+}The MRL-lpr control mice compares, and the MRL-lpr mice IgG level of OBF-1 defective reduces, and anti-ds-DNA antibody (OD value=0.1 ± 0.02) and antinuclear antibody (OD value=0.12 ± 0.03) can not detect substantially; Exempt from fluorescence staining Hep-2 cell, OBF-1 defective MRL-lpr mice serum all can not detect antinuclear antibody through 1: 100 and 1: 500 two dilution factor, and this results suggest OBF-1 plays a crucial role to the generation of autoantibody; Antibody secreting cell obviously reduces in the MRL-lpr mouse spleen of ELISOPT detection discovery OBF-1 defective and the bone marrow.The MRL-lpr mice of OBF-1 defective significantly reduces except J chain mRNA expression, and Blimp-1, IRF-4, Xbp-1 and Bcl-6mRNA express and marked difference do not occur; Flow cytometry (FCAS) detects finds immature B cells and the not obviously minimizing of mature B cell number in spleen and the bone marrow, illustrates that the OBF-1 defective does not influence the growth of MRL-lpr mouse B cell; OBF-1 defective MRL-lpr mice CD4 ^-CD8 ^-B220 ⁺CD3 ⁺The T cell quantity significantly reduces, and points out this group T cell relevant with antibody-secreting.Mouse kidney is carried out pathological examination, and immunofluorescence shows the MRL-lpr mice of OBF-1 defective, and immune complex deposit disappears in the kidney; PAS dyeing finds not occur glomerulonephritis symptoms such as glomerule increase and crescent formation; OBF-1 defective MRL-lpr mice all can survive to age in July, and prompting OBF-1 defective can improve the survival rate of MRL-lpr mice.Above result shows: MRL-lpr mice OBF-1 defective can be eliminated autoantibody, suppresses lupoid acne glomerule inflammation.Therefore as seen, OBF-1 has important function to generation of autoantibody secretory cell and autoimmune development.

Therefore,, the invention provides OBF-1 gene or albumen or their agonist or go up the purposes of adjusting, be used to prepare the compositions (as the siRNA compositions) that reduces antibody secreting cell based on the inventor's new discovery; Or the compositions that is used to screen the minimizing antibody secreting cell.

Because the excessive generation of antibody secreting cell is the key factor that causes autoimmune disease, therefore inhibition or downward modulation OBF-1 gene or proteic expression can prevent or treat autoimmune disease.Described autoimmune disease includes, but is not limited to: systemic lupus erythematosus (sle), autoimmune hemolytic anemia, myasthenia gravis, rheumatoid arthritis, Sjogren ' s syndrome.

The antagonist purposes of OBF-1

The material of any OBF-1 of inhibition gene or proteic activity, reduction OBF-1 gene or proteic stability, inhibition or blocking-up OBF-1 gene or proteic signal path, inhibition OBF-1 gene or proteic expression, minimizing OBF-1 gene or albumen effective acting time or inhibition OBF-1 gene transcription or translation all can be used for the present invention, as the useful material of generation for the minimizing antibody secreting cell.

As optimal way of the present invention, described OBF-1 gene or proteic antagonist include, but is not limited to: OBF-1 gene or proteic specific antibody, part.In addition, well known in the artly be, can also adopt multiple method commonly used to suppress or disturb OBF-1 gene or proteic activity or expression, for example can design at OBF-1 gene or proteic siRNA (siRNA) etc.

Preferably, described OBF-1 gene or proteic specific antibody refer to that those can combine with OBF-1 gene outcome or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.And, described antibody be meant can in conjunction with and suppress the molecule of OBF-1.Described antibody not only comprises complete monoclonal or polyclonal antibody, but also comprises having immunocompetent antibody fragment, as Fab ' or (Fab) ₂Fragment; Heavy chain of antibody; Light chain of antibody; Genetically engineered strand Fv molecule; Or chimeric antibody.

Described antibody can be prepared by the known various technology of those skilled in that art.For example, the OBF-1 gene outcome of purification or its have antigenic fragment, can be applied to animal to induce the generation of polyclonal antibody.Described antibody also can be monoclonal antibody.This type of monoclonal antibody can utilize hybridoma technology to prepare that (see people such as Kohler, Nature 256; 495,1975; People such as Kohler, Eur.J.Immunol.6:511,1976; People such as Kohler, Eur.J.Immunol.6:292,1976; People such as Hammerling, In MonoclonalAntibodies and T Cell Hybridomas, Elsevier, N.Y., 1981).

In addition, also can adopt the reticent or downward modulation OBF-1 of antisense technology.Can design antisensenucleic acids at the DNA of OBF-1 or the sequence of mRNA.Usually, antisensenucleic acids has 20-25 base, and it can enter in the cell, combines with target gene, and target gene expression is suppressed.

For improving the localized transfection rate of antisensenucleic acids, enter in the cell with making its maximum, can the external source antisensenucleic acids be transferred to local cells by said method by certain delivery system.Common carrier has: liposome, viral lipid body delivery system, virus (mainly containing retrovirus and adenovirus) etc.

As preferred mode of the present invention, the inventor has designed multiple siRNA at the particular order on the OBF-1 gene, and the result has therefrom screened the siRNA that can effectively suppress OBF-1 gene expression.Therefore, the invention provides a kind ofly at OBF-1 gene or proteic siRNA, described siRNA is selected from: the siRNA with sequence shown in the SEQ ID NO:21; Or siRNA with sequence shown in the SEQ ID NO:22.Through checking, above-mentioned siRNA can obviously reduce the autoantibody level of T347 emiocytosis when effectively suppressing OBF-1 gene expression.

Screening reduces the method for the material of antibody secreting cell

After getting the influence of the described OBF-1 of cicada, can adopt several different methods well known in the art to screen the potential material of reducing the celliferous quantity of internal antibody by downward modulation OBF-1 for antibody secreting cell.Can from described potential material, find the material that can be used for preparing prevention or treat the medicine of autoimmune disease.

Therefore, the invention provides a kind of method of screening the material that reduces antibody secreting cell, described method comprises step: (a) candidate substances is transcribed the proteic system of co-activation factor OBF-1 with expression B cell-specific and contact; (b) detect candidate substances to the proteic influence of OBF-1; Wherein, if described candidate substances can reduce the proteic expression of OBF-1 or suppress the proteic activity of OBF-1, show that then this candidate substances is to reduce the material of antibody secreting cell.

In the present invention, described system is selected from (but being not limited to): solution system, cell system, subcellular fraction system, organizational framework, organ systems or animal system.

As optimal way of the present invention, said method comprising the steps of:

(a) in the test group, in comprising the proteic system of OBF-1, add candidate substances, and detect proteic expression of OBF-1 or activity, and, in matched group, do not add described candidate substances, comprise in the proteic system of OBF-1, detect proteic expression of OBF-1 or activity

(b) proteic expression of OBF-1 or activity in the proteic expression of OBF-1 in step (a) the test group or active and the matched group are compared,

(preferably significantly be lower than, if proteic expression of OBF-1 or activity are lower than statistically in the test group as low 25%; Preferred, low 40%) matched group, just show that this candidate substances is for reducing the antibody secreting cell effective substances.

On the other hand, the present invention also provides the material of the reduced antibody secreting cell quantity that adopts described screening technique acquisition.

The material that these Preliminary screening go out can constitute a screening storehouse, can or treat the useful material of the excessive generation relevant disease of antibody secreting cell (as autoimmune disease) for prevention so that people finally can therefrom filter out.

Compositions

The present invention also provides a kind of pharmaceutical composition, described pharmaceutical composition comprise effective dose described minimizing antibody secreting cell material and with the carrier of the substances compatible of described minimizing antibody secreting cell.Described carrier with the substances compatible that reduces antibody secreting cell needs not have excessive bad side reaction (as toxicity, stimulation and allergy) for people and/or animal in itself, the material that rational benefit/risk ratio is promptly arranged, and do not have effect with adenovirus preparation, any used targeting element and other composition in itself.As optimal way of the present invention, the material of described minimizing antibody secreting cell is the siRNA that can effectively suppress OBF-1 gene expression; More preferably, described siRNA is selected from: the siRNA with sequence shown in the SEQ ID NO:21; Or siRNA with sequence shown in the SEQ ID NO:22.

Described " effective dose " is meant and can produces function or amount active and that can be accepted by people and/or animal to people and/or animal.

Described " with the carrier of the substances compatible that reduces antibody secreting cell " refers to be used for the treatment of the carrier of agent administration, comprises various excipient and diluent.This term refers to some medicament carriers like this: they itself are not necessary active component, and do not have undue toxicity after using.Suitable carriers is well known to those of ordinary skill in the art.(Mack Pub.Co. can find discussing fully about pharmaceutically acceptable excipient in N.J.1991) at Remington ' s Pharmaceutical Sciences.Acceptable carrier can contain liquid on combination of Chinese medicine is learned, as water, saline, glycerol and ethanol.In addition, also may there be complementary material in these carriers, as filler, lubricant, fluidizer, wetting agent or emulsifying agent, pH buffer substance etc.

The present invention also provides a kind of method for the treatment of the excessive generation relevant disease of antibody secreting cell, comprises the material of the described minimizing antibody secreting cell that gives experimenter's effective dose.

Should be understood that the effective dose of the material of used minimizing antibody secreting cell can change with the order of severity of object to be treated when being used for prevention or the excessive generation relevant disease of treatment antibody secreting cell.Concrete condition decides according to experimenter's individual instances, and these factors are all in the scope that skilled practitioners or nutritionist can judge.

After the purposes of material of the described minimizing antibody secreting cell of cicada, can adopt several different methods well known in the art that the material of described minimizing antibody secreting cell or its encoding gene or its pharmaceutical composition are delivered medicine to mammal.Preferably, can adopt the means of gene therapy to carry out.Such as, can directly will reduce the material of antibody secreting cell by delivering medicine to the experimenter such as methods such as injections; Perhaps, to carry the expression of Substance unit's (such as expression vector or virus etc.) that reduces antibody secreting cell by certain approach is delivered on the target spot, and make it to express the material of activated minimizing antibody secreting cell, concrete condition need be decided on the type of the material of described minimizing antibody secreting cell, and these all are well-known to those skilled in the art.

Animal model

The present invention also provides a kind of and has participated in the very useful animal model of autoimmune disease mechanism and the preparation method of described animal model for research OBF-1.

Animal model of the present invention is based on MRL/MpJ-Fas ^Lpr/lpr(MRL-lpr) mice prepares, and MRL-lpr itself is a kind of animal model that is widely studied, and the spontaneous generation of energy is similar to the autoimmune disease of people's systemic lupus erythematosus (sle) (SLE).

The method for preparing described animal model may further comprise the steps:

(1) MRL-lpr lupus mice and OBF-1 disappearance mice are hybridized, produce first filial generation mice (F1);

(2) with the pairing of first filial generation mice, produce second filial mice (F2); With

(3) identify the second filial genotype, pick out the MRL-lpr mice of OBF-1 disappearance.

Preferably, in step (3) afterwards, also comprise step (4): the MRL-lpr mice and the parental generation MRL-lpr mice of OBF-1 disappearance are backcrossed; Hybridize-backcross 2-15 generation (preferred 4-10 generation, more preferably 6～8 generations), thereby obtain the MRL-lpr mouse model of the stable OBF-1 disappearance of lupus phenotype.

Usually, come the identified gene type by design OBF-1 wild type, OBF-1 deletion form, Fas wild type, Fas deletion form Auele Specific Primer and PCR.

OBF-1 wild type (being that OBF-1 is normal) MRL-lpr mice produces the antinuclear antibody of high titre, comprises anti-dsDNA antibody and anti-Sm antibody.The MRL-lpr mice of OBF-1 disappearance can not produce detectable antinuclear antibody.

Major advantage of the present invention is:

(1) confirm OBF-1 first in the aborning pivotal role of autoantibody secretory cell, and the inhibition of OBF-1, downward modulation or disappearance can significantly reduce the generation of autoantibody secretory cell in the mammalian body, prove that OBF-1 is a valuable drug target spot.

(2) prepared first and a kind ofly participated in the very useful animal model of autoimmune disease mechanism, provide valid approach for OBF-1 participates in the autoimmune disease Study on Mechanism for research OBF-1.

The foundation of embodiment 1 OBF-1 defective MRL-lpr lupus mouse model

In the present embodiment, MRL-lpr lupus mice and OBF-1 deficient mice are hybridized, produce first filial generation mice (F1), again the first filial generation mice is matched, produce second filial mice (F2), to the mutant gene (Fas gene and OBF-1 gene) of mice design wild type (WT) primer and sudden change/knock out type (Mutant/KO) primer, identify F2 for genotype with PCR respectively, picking out genotype is OBF-1 ^-/-Fas ^-/-Mice and parental generation mice MRL-lpr backcross.Through hybridizing-backcross 6～8 generations, thereby make up the stable OBF-1 defective MRL-lpr mouse model of lupus phenotype, i.e. OBF-1 ^-/-Fas ^-/-Mouse genotypes is chosen OBF-1 simultaneously ^{+ /+}Fas ^-/-Mice is used for experimental control.

1 material

The OBF-1 mice is available from Switzerland Friedrich Miescher institute, and the MRL-lpr mice is raised in Medical College, Shanghai Communication Univ.'s Animal House pathogen-free domestic environment available from U.S. Jackson laboratory.

Mus tail lysate: 100mM Tris-HCl, 5mM EDTA, 200mM NaCl, 0.2%SDS, pH 8.0.

Erythrocyte cracked liquid: 0.15M NH ₄Cl, 1mM KHCO ₃, 0.1mM EDTA pH7.2-7.4.

Proteinase K is available from German Merck company; TRIzol is an American I nvitrogen company product; ImProm-II ^TMRT System, Rnasin, MgCl ₂Be Shanghai Promega company product; 10 * TBE, the DEPC treating water, the Tris-HCl buffer of pH 8.5 is Shanghai bio-engineering corporation product; 250bp DNA marker is available from Shanghai JaRa biotech firm; Red taq polymerase, dNTP is available from match Parkson, Shanghai bio-engineering corporation.

2 methods

2.1 set up OBF-1 ^-/-Fas ^-/-Mouse model

With OBF-1 deficient mice (OBF-1 ^-/-) and MRL-lpr lupus mice (Fas ^-/-) copulation, with OBF-1 and the Fas genotype in primer (seeing 2.2.1) the evaluation filial generation.OBF-1 in F1 generation and Fas gene are the male of heterozygote and female mice copulation, the OBF-1 in the filial generation ^-/-Fas ^-/-Mice is backcrossed with MRL-lpr parental generation mice again, and idiographic flow such as Fig. 1 through hybridizing-backcross 6-8 after generation, screen following two kinds of genotypic mices and are used for experiment: OBF-1 ^-/-Fas ^-/-, OBF-1 ^{+ /+}Fas ^-/-The latter is used for experiment contrast.

2.2PCR identify the mice genotype

2.2.1 be used for the primer of genotype identification

The transposon that inserts about 4.7Kb according to the 2nd intron of MRL-lpr mice Fas gene causes sudden change (Fig. 2), and Fas gene wild type and saltant primer are identified in design; Identify mice OBF-1 gene wild type, saltant with the primer of having delivered.Concrete primer sequence such as table 1.

Table 1

The primer title	Sequence	SEQ ID NO：
			OBF-1 WT forward	5’-GCT CCC TGA CCA TTG AC-3’	1
OBF-1 WT is reverse	5’-TCC TGT CCC ATC CCC CTG TAA-3’	2
			OBF-1 KO forward	5’-GGC TTA GAC AAC AAA GCG TGT GTC C-3’	3
OBF-1 KO is reverse	5’-GCG TGC AAT CCA TCT TGT TCA ATG G-3’	4
			Fas WT forward	5’-CTC CAG ACT CTC TTG CTT TAC-3’	5
Fas WT is reverse	5’-GAC AAG AGA TTA GCC TCC AGG-3’	6
			Fas KO forward	5’-CTC CAG ACT CTC TTG CTT TAC-3’	7
Fas KO is reverse	5’-GAC ACC AGT TAT GAA GGA AGG-3’	8

2.2.2 the preparation of Mus coda gene group DNA

Clip 0.5～1cm Mus tail is managed as for Eppendorf, adds 0.5mL Mus tail lysate, adds 20mg/mLProteinase K 12.5 μ L again to final concentration 0.5mg/mL, 55 ℃ of water-bath digested overnight.Next day, the centrifugal 3min of 5000rpm gets supernatant, adds isopyknic phenol/chloroform/isoamyl alcohol (25: 24: 1) again, and tenderness is put upside down mixing, the centrifugal 5min of 12000rpm room temperature.Get the upper strata water, add the dehydrated alcohol of-20 ℃ of pre-coolings of 2 times of volumes, tenderness is put upside down the mixing room temperature and is left standstill 3min, and the centrifugal 10min of 12000rpm abandons supernatant, precipitates 1 time the centrifugal supernatant that goes with 1mL 70% washing with alcohol.After precipitation was dissolved with 200 μ L Tris-HCl buffer (pH8.0) ,-20 ℃ frozen.

2.2.3 the extracting of mouse spleen cell total rna

The experiment mice dislocation of cervical vertebra is put to death, and soaking disinfection in 75% ethanol is got spleen and is placed 70 μ m cell filter screens, adds PBS, the soft tissue abrasion of plunger, collecting cell suspension.Add 3～5mL erythrocyte cracked liquid, put upside down mixing fast.The centrifugal supernatant of abandoning, PBS washes secondary.Cell counting is adjusted cell concentration to 1 * 10 with PBS ⁷/ mL.

Get 5 * 10 ⁶Cell centrifugation disperses the hematocrit cell, adds TRIzol 1mL, and room temperature 5min makes the complete cracking of cell.Add 0.2mL chloroform thermal agitation 15S, room temperature leaves standstill 2～3min.4 ℃ of centrifugal 15min of 12000 * g get the colourless water in upper strata to another Ependorf pipe.Add the 0.5mL isopropyl alcohol, put upside down mixing, room temperature leaves standstill 10min.4 ℃ of centrifugal 15min of 12000 * g abandon supernatant.With 1mL 75% washing with alcohol precipitation, 4 ℃ of centrifugal 5min of 7500 * g abandon supernatant.Dry precipitation but can not parch, RNA precipitation is dissolved in DEPC water, hatch 10min for 55～60 ℃.Survey the O.D. value in 260nm, 280nm place, calculate rna content.

2.2.4 reverse transcription RNA synthesizes cDNA

According to the ImProm-II of Promega company ^TMRT System test kit requires operation: get the total RNA of 1 μ g, add 0.5 μ g/ μ L OligodT ₁₆1 μ L adds DEPC treating water to 5 μ L, 70 ℃ of 5min, ice bath 5min immediately again.Add buffer 15 μ L (25mM MgCl ₂2.4 μ L, 5 * Buffer, 4 μ L, 10mM dNTP 1 μ L, Rnasin 0.5 μ L, reverse transcriptase 1 μ L, H ₂O 6.1 μ L) mixing, 25 ℃ of annealing 15min, 42 ℃ are extended 60min.70 ℃ of 15min deactivation reverse transcriptases ,-20 ℃ frozen.

2.2.5PCR amplification

1) in the 50uL PCR reaction system: 10 * PCR buffer, 5 μ L; 25mM MgCl ₂4 μ L; 10mM dNTPs1 μ L; Red Taq (1U/ μ L) 2 μ L; 10 μ M forward primer, 1 μ L; 10 μ M downstream primers, 1 μ L; DMSO 5 μ L; Dna profiling (genomic DNA or cDNA) 2 μ L; H ₂O adds to 50 μ L.

2) PCR cyclic amplification program: Fas wild type and saltant fragment PCR amplification condition are: 94 ℃ of pre-degeneration 5min, and 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations altogether, and last 72 ℃ are extended 7min.OBF-1 wild type and saltant fragment PCR amplification condition are: 94 ℃ of pre-degeneration 5min, and 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations altogether, and last 72 ℃ are extended 7min.

2.2.5 agarose gel electrophoresis

Get 10 μ L PCR products, 1.2% agarose gel electrophoresis, electrophoretic buffer are 0.5 * TBE, 80V electrophoresis 20min, and gel imaging instrument scanning in multiple day is taken pictures.

3 results

The genotype identification of the MRL-lpr mouse model of OBF-1 defective the results are shown in Figure 3.As shown in Figure 3A, OBF-1 ^{+ /+}, OBF-1 ^-/-The mice genotype is the Fas wild type, only can amplify the Fas wild-type fragment through PCR; MRL-lpr/lpr mice genotype only can amplify Fas saltant fragment for the sudden change of Fas homozygote through PCR, illustrates with Fas wild type and two pairs of primers of saltant of inventor's design, can correctly carry out genotype identification to the Fas gene through PCR.By Fig. 3 B as seen, OBF-1 ^{+ /+}The mice genotype is the OBF-1 wild type, only can amplify OBF-1 wild type band through PCR; OBF-1 ^-/-The mice genotype only can amplify OBF-1 saltant band for the sudden change of OBF-1 homozygote through PCR, illustrates with OBF-1 wild type and two pairs of primers of saltant of inventor's design, can correctly carry out genotype identification to the OBF-1 gene through PCR.The mice genotype that the inventor will only amplify the Fas wild-type fragment is decided to be Fas wild type (Fas ^{+ /+}); To only can amplify the segmental mice genotype of Fas saltant and be decided to be Fas homozygote (Fas ^-/-); Can amplify the Fas wild-type fragment can amplify the segmental mice genotype of Fas saltant again and be decided to be Fas heterozygote (Fas ^+/-).Equally, can identify OBF-1 ^{+ /+}, OBF-1 ^+/-And OBF-1 ^-/-With both combinations, can carry out correct genotype identification to the Fas and the OBF-1 gene of experiment mice, and select OBF-1 ^{+ /+}Fas ^-/-, OBF-1 ^-/-Fas ^-/-Mice is used for experiment.

In order further to verify the system of genotype identification, except being sample is identified with Mus coda gene group DNA, the inventor is that sample carries out genotype identification to OBF-1 with the total RNA of mouse boosting cell also.Shown in Fig. 3 C, after the RT-PCR amplification, OBF-1 ^{+ /+}Mice and MRL-lpr mice only can amplify OBF-1 wild type band, are accredited as the OBF-1 wild type.With DNA is that sample identification is OBF-1 ^{+ /+}And OBF-1 ^-/-Mice, its RNA sample is increased through RT-PCR, be accredited as OBF-1 wild type, OBF-1 homozygote.The two qualification result unanimity.

For fear of cause the genotype identification mistake because of bust, all Mus tail DNA repeat PCR once, and twice PCR result just judges genotype when consistent.Through genotype identification, the inventor chooses following two kinds of genotypic mices and is used for subsequent experimental: OBF-1 ^{+ /+}Fas ^-/-, OBF-1 ^-/-Fas ^-/-The former is used for experiment contrast.

The MRL-lpr lupus mice autoantibody secretory cell research of embodiment 2 OBF-1 defectives

1. material and instrument

OBF-1 wild-type mice and OBF-1 deficient mice are available from Switzerland Friedrich Miescher institute; MRL-lpr mice (the OBF-1 of OBF-1 homozygote defective ^-/-Fas ^-/-) and contrast OBF-1 wild type MRL-lpr mice (OBF-1 ^{+ /+}Fas ^-/-) make up by embodiment 1, mice is all raised in Medical College, Shanghai Communication Univ.'s Animal House pathogen-free domestic environment; Hep-2 people's laryngeal carcinoma epithelial cell is available from Shanghai school of life and health sciences cell bank.

DU800 ultraviolet spectrophotometer (U.S. Beckman company); PTC-100PCR instrument (U.S. MJ company); High speed refrigerated centrifuge 5810R (German Eppendorf company); The long multi-functional microplate reader (Switzerland Tecan company) of Safire2 all-wave; Gel imaging instrument scanner (the multiple day company in Shanghai); Bioreader 4000ELISPOT reading apparatus (German Biosys company); 37 ℃ of incubators (Shellab company); BD FACSCalibur flow cytometer; The Leica freezing microtome.

Anti-Ig (H+L), IgM, IgA, IgG1, IgG2a, IgG2b, IgG3 standard substance; Anti-IgM-HRP, anti-IgA-HRP, anti-IgG1-HRP, anti-IgG2a-HRP, anti-IgG2b-HRP, anti-IgG3-HRP; Anti-mice Ig (H+L) antibody; Anti-B220-FITC, anti-IgM-biotin, anti-IgD-PE, anti-CD19-FITC, anti-CD19-PE, anti-CD3-FITC, anti-CD4-FITC, Streptavidine-FITC, Streptavidine-PE are all available from U.S. Southern Biotech company; Anti-B220-Biotin is available from BD pharmingen company; Mountain sheep anti mouse IgG-FITC is available from the magnificent company in Shanghai, and the anti-C3-FITC of goat is available from American I CN company; Mounting Medium is available from U.S. Vector company; Mouse anti antinuclear antibodies ELISA test kit is available from U.S. Alpha Diagnostic company; MultiscreenHTS-IP filterplates (MSIPS4510) is available from Millipore company; Mouse B cell sorting test kit is available from German Miltenyi company.

Red taq polymerase, dNTPs is available from match Parkson, Shanghai company; ImProm-II ^TMRT System, Rnasin, MgCl ₂Be Shanghai Promega company product; TRIzol is an American I nvitrogen company product; Agarose is available from Shen, Shanghai energy betting office; 250bp marker is available from Shanghai JaRa company.

SDS, Triton X-100, paraformaldehyde, citric acid, 10 * PBS, 5 * TBE gives birth to the worker available from Shanghai; ABTS, AEC, Salmon Sperm DNA is available from U.S. Sigma company; 30%H ₂O ₂Available from Tao Pu chemical plant, Shanghai; Tween 20 (Tween-20) is available from SERVA company; Used other reagent is homemade analytical reagent in the test; 0.25% pancreatin solution, 100 * close streptomycin is available from Invitrogen company; RIPM-1640, DMEM, hyclone is available from Hyclone company; 70 μ m cell filter screens are U.S. Falcon company product.

Erythrocyte cracked liquid: 0.15M NH ₄Cl, 1mM KHCO ₃, 0.1mM EDTA, pH7.2-7.4;

Citrate buffer solution: 1.05g citric acid/100mL H ₂O, 4.0,4 ℃ of preservations of pH;

ABTS stock solution: face with preceding fresh preparation, 15mg/mL H ₂O;

Substrate buffer solution: add 200 μ L ABTS stock solutions in every 10ml citrate buffer solution, add 10 μ L30%H2O2 mixings again, lucifuge is placed;

AEC solution: 20mgAEC/mL dimethylformamide (DMF);

AEC substrate buffer solution: 0.1M acetate buffer solution (0.1M acetic acid and 0.1M sodium acetate);

AEC substrate colour developing liquid: need fresh preparation: 200 μ L AEC solution/6mL AEC buffer/3 μ L 30%H ₂O ₂, mixing, 0.22 μ m membrane filtration, lucifuge is standby;

Dilution buffer liquid and confining liquid: 3%FCS/PBS;

Bag is cushioned liquid: 0.1M PBS pH7.2; 0.1M carbonate buffer solution pH 9.6;

Washing liquid: 0.05%Tween-20/PBS;

In conjunction with/cleaning buffer solution: 0.5%BSA/2mM EDTA/PBS, pH 7.2.

Primer: with the specific gene Blimp-1 of plasma cell, Xbp-1, Irf-4, with the gene Bcl-6 that germinal center forms, the primer sequence such as the table 2 of the J chain gene of immunoglobulin and confidential reference items beta-actin gene design.

Table 2

2 methods

2.1 detect mice serum immunoglobulin, anti-ds-DNA antibody and antinuclear antibody

2.1.1 the acquisition of mice serum

OBF-1 with the 3-4 monthly age ^-/-The MRL-lpr mice, through eye socket venous plexus blood sampling, the 0.2-0.3mL that at every turn can take a blood sample cuts off the thoracic cavity fast, treat that blood coagulation serum is separated out after, centrifuging and taking serum ,-80 ℃ frozen.Also the mice dislocation of cervical vertebra can be caused death, open the thoracic cavity fast, through heart blood sampling 0.5-1mL, treat that blood coagulation serum separates out the back separation of serum ,-80 ℃ frozen.The OBF-1 at 3-4 monthly age ^{+ /+}MRL-lpr, OBF-1 ^{+ /+}, OBF-1 ^-/-And Xid mice (available from U.S. Jackson laboratory) is through same operation separation of serum, in contrast.Lethal mice can be used for other test.Each genotype selects for use 6 mices to be used for test.

2.1.2ELISA detect the mice serum immunoglobulin

The anti-Mus Ig of 2 μ g (H+L) antibody dilutes with 100 μ L carbonate buffer solutions, and 37 ℃ of wrapper sheets spend the night, and 0.05%Tween-20/PBS washes 3 times, adds 3%FCS/PBS, 37 ℃ of sealing 1h.0.05%Tween-20/PBS washes 3 times, add IgM, IgA, IgG1, IgG2a, IgG2b, IgG3 standard substance (7.8,15.6,31.3,62.5,125,250,500ng/mL) and the suitable mice serum (OBF-1 of dilution ^{+ /+}MRL-lpr and OBF-1 ^-/-The serum dilution of MRL-lpr mice is as follows: detect IgM, serum dilution in 1: 5000; Detect IgA, serum dilution in 1: 1500; Detect IgG1, IgG2b, IgG3, serum dilution in 1: 20000; Detect IgG2a, serum dilution in 1: 80000, every sample two multiple holes; OBF-1 ^{+ /+}And OBF-1 ^-/-The dilution of mice serum is as follows: IgM, IgG1, serum dilution in 1: 3000; IgA, IgG2a, IgG2b, IgG3, serum dilution in 1: 500), hatch 2h for 37 ℃, 0.05%Tween-20/PBS washes 3 times, (anti-IgM-HRP, anti-IgA-HRP, anti-IgG3-HRP diluted with 1: 800 to add the enzyme conjugates that suitably dilutes, anti-IgG1-HRP, anti-IgG2a-HRP, anti-IgG2b-HRP diluted with 1: 2000), hatch 1h for 37 ℃.0.05%Tween-20/PBS washes plate 5 times, adds freshly prepared ABTS substrate buffer solution, and the room temperature lucifuge is hatched about 5min, when treating that comparatively ideal color gradient appears in standard curve, adds the 1%SDS cessation reaction.The long multi-functional microplate reader 405nm of Safire2 all-wave detects the OD value in the place.According to the OD value and the corresponding concentration of every kind of immunoglobulin subclass standard substance, make standard curve, thereby calculate the content of IgM, IgA, IgG1, IgG2a, IgG2b and IgG3 in the mice serum.

2.1.3ELISA detect the anti-ds-DNA antibody of mice serum

20 μ g Salmon Sperm DNA dilute with 100 μ L, 1 * PBS, and 37 ℃ of wrapper sheets spend the night.0.05%Tween-20/PBS washes 3 times, adds 3%FCS/PBS, 37 ℃ of sealing 2h.0.05%Tween-20/PBS washes 3 times, adds the mice serum (every sample two multiple holes) of dilution in 1: 100, hatches 2h for 37 ℃.0.05%Tween-20/PBS washes 2 times, adds ELIAS secondary antibody anti-IgG-HRP, and anti-IgG1-HRP, anti-IgG2a-HRP (dilution in 1: 1000) are hatched 1h for 37 ℃.0.05%Tween-20/PBS washes plate 5 times, adds freshly prepared ABTS substrate buffer solution, and the about 10min of incubated at room adds the 1%SDS cessation reaction.The OD value is detected at microplate reader 405nm place.

2.1.4 the detection of antinuclear antibody in the mice serum

With reference to mouse anti antinuclear antibodies ELISA test kit description operation, concrete steps are as follows: prediluted standard substance of 100 μ L and dilution mice serum (dilution in 1: 100) are added in the suitable hole with multiple hole, mix incubated at room 30min gently; Plank is dried, wash 3 times with 150 μ L washing liquids; Every hole adds the goat anti-mouse IgG-HRP of 100 μ L dilution, mix homogeneously, incubated at room 30min; Plank is dried, wash 5 times with 150 μ L washing liquids; Every hole adds 100 μ L TMB background color liquid, incubated at room 15min; Every hole adds 100 μ L stop buffers, and light absorption value is detected at microplate reader 450nm wavelength place.

2.1.5 indirect IF staining Hep-2 cell detection mice serum antinuclear antibody

Through the Hep-2 of trypsinization cell, wash 1 time with PBS, cell is resuspended among 3% paraformaldehyde/PBS incubated at room 30min.PBS washes 1 time, and cell is resuspended among the 1%Triton X-100/PBS, hatches 15min on ice.PBS washes 1 time, and cell is resuspended among the 3%FCS/PBS, transfers cell concentration to 1 * 10 ⁷/ mL, every pipe 100 μ L cell suspension are used for dyeing.With mice serum dilution (OBF-1 ^{+ /+}MRL-lpr and OBF-1 ^-/-MRL-lpr mice serum dilution 1: 50,1: 250), equal-volume joins in the Hep-2 cell suspension to whole dilution factor 1: 100,1: 500, hatches 1h for 4 ℃.PBS washes 2 times, adds goat anti-mouse IgG-FITC to final concentration 50 μ g/mL, and 4 ℃ of lucifuges are hatched 30mi n.PBS washes 3 times, and cell is resuspended among the 30 μ L 3%FCS/PBS, drips 1 Mounting Buffer mixing.Get 30 μ L cell suspension and be added to microscope slide, lid coverslip, nial polish mounting, fluorescence microscopy.

2.2ELISPOT detection antibody secreting cell

2.2.1 the preparation of spleen and bone marrow cell suspension

The preparation of bone marrow cell suspension: the mice dislocation of cervical vertebra is put to death, and soaking disinfection in 75% ethanol is got mouse femur, and an end of drawing PBS insertion femur is gone out medullary cell repeatedly towards medullary cavity, uses the erythrocyte cracked liquid lysed erythrocyte.Clean 2 times with PBS, and resuspended with 1mL 3%FCS/PBS.

The preparation of spleen cell suspension; Concrete grammar is referring to 2.2.3 among the embodiment 1.

With cell counting, adjust cell concentration 1 * 10 ⁷/ mL.And cell suspension done 2 times of gradient dilutions, initial concentration 2 * 10 ⁶/ mL.Cell suspension is placed standby on ice.Whole operation all needs to carry out under cryogenic conditions.

2.2.2ELISPOT detection antibody secreting cell

MultiscreenHTS-IP filter plates adds 15 μ L, 70% ethanol in advance and prewets, incubated at room 1 minute, and the ethanol that inclines is washed plate 3 times with PBS, every hole 150 μ L.Adding is the anti-Mus Ig of 20mg/mL (H+L) antibody 100 μ L with the concentration of PBS dilution, and 4 ℃ of wet box bags are spent the night.Sterile distilled water is washed plate 3 times, and every hole adds 37 ℃ of wet box sealings of 150 μ L3%FCS/PBS 2 hours.The deblocking liquid that inclines adds the splenocyte suspension (or bone marrow cell suspension) of 100 μ L gradient dilutions, and the starter hole cell number is 2 * 10 ⁵, 37 ℃ of wet boxes are hatched 12h, can not rock between incubation period or mobile ELISPOT plate.Get rid of cell, 0.05%Tween-20/PBS washes plate 5 times, every hole 150 μ L.Every hole adds the biotinylated mountain sheep anti-mouse igg antibody of 100 μ L dilution in 1: 2500, and 37 ℃ of wet boxes were hatched 2 hours.0.05%Tween-20/PBS washes plate 5 times, adds the Avidin 100 μ L of the HRP labelling of dilution in 1: 5000, and 37 ℃ of wet boxes are hatched 1h.0.05%Tween-20/PBS washes plate 5 times, and every hole adds AEC substrate colour developing liquid 100 μ L, and color development at room temperature is to clear speckle occurring.Liner is removed in the sterile distilled water flushing, and plate is dried at the flushing ELISPOT plate film back side.Count the speckle number and calculate 1 * 10 with Bioreader 4000ELISPOT reading apparatus ⁵The quantity of splenocyte and medullary cell antibody secreting cell, the room temperature lucifuge is stored the ELISPOT plate.

2.3 spleen B cytoplasm cell-specific expression of gene

2.3.1MACS separate mouse spleen B cell

Choose 3-4 monthly age OBF-1 ^-/-The MRL-lpr mice, dislocation of cervical vertebra is put to death, and makes the spleen single cell suspension by preceding method, and through cell counting, chooses 2 * 10 ⁷Splenocyte is used to separate the B cell.Press the negative choosing of Mouse B cell IsolationKit description operation and separate the B cell: 2 * 10 ⁷Add 80 μ L combination/cleaning buffer solutions in the hematocrit cell and carry out resuspendedly, add the mixtures of antibodies mixing of 20 μ L biotinylation labellings, hatch 10min for 4 ℃.Add 60 μ L combination/cleaning buffer solutions, add the magnetic bead and the mixing of the antibiotinization of 40 μ L again, hatch 15min for 4 ℃.Add 2mL combination/cleaning buffer solution, 4 ℃ of centrifugal 10min of 300 * g abandon supernatant, and cell is resuspended in 500 μ L combination/cleaning buffer solutions.On the MidiMACS magnet stand, place the LS post, add 3mL combination/cleaning buffer solution and wash post, 500 μ L cell suspension are added in the post, collect effusive B cell.For improving the B cell yield, reuse 1mL combination/cleaning buffer solution is washed post 4 times.To bear choosing obtains the B cell and gets 1 * 10 ⁶Cell carries out two dying with anti-CD3-FITC and anti-CD19-PE antibody, and method is seen 2.4.2, detects to bear and selects isolating B cell purity to reach more than 95%.Control mice OBF-1 ^{+ /+}MRL-lpr, OBF-1 ^{+ /+}, OBF-1 ^-/-The separation of mouse spleen B cell is undertaken by same operation.

2.3.2 the extraction of total RNA

Obtain spleen B cell through the MACS separation, get 5 * 10 ⁶Cell, the centrifugal supernatant that goes, PBS washes once, and the hematocrit cell is with the Trizol homogenate of 1mL, with reference to the method extracting RNA of Invitrogen company.Concrete grammar is seen the 2.2.3 of paper first, and the DU800 ultraviolet spectrophotometer carries out quantitatively extractive RNA.

2.3.3 reverse transcription RNA synthesizes cDNA

The 2 μ gRNA cDNA that reverses is according to the ImProm-II of Promega company ^TMRT System test kit requires operation, and concrete grammar is referring to the 2.2.4 of paper first.

2.3.4PCR the specific gene of amplification plasma cell

1) cDNA template: because various plasma cell specific gene mRNA expression differences, test Mus and the cDNA that contrasts Mus have been done the template of 3 identical concentration dilutions as PCR, so that the difference of significance to be arranged between guaranteeing to organize.

2) 50 μ L PCR reaction systems: 10 * PCR buffer, 5 μ L; 25mM MgCl ₂3 μ L; 10mM dNTPs1 μ L; Red Taq (1U/ μ L) 2 μ L; 10 μ M forward primer, 1 μ L; 10 μ M downstream primers, 1 μ L; CDNA1 μ L; H ₂O adds to 50 μ L.

2) PCR cyclic amplification program: 94 ℃ of pre-degeneration 5min, 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 30s carry out 35 circulations altogether, and last 72 ℃ are extended 7min.

2.3.5 agarose gel electrophoresis

Get 10 μ L PCR products, 1.2% agarose gel electrophoresis, electrophoretic buffer are 0.5 * TBE, 80V electrophoresis 20min, and gel imaging instrument scanning in multiple day is taken pictures.

2.4 detecting mouse B cell, flow cytometry grows

2.4.1 the preparation of spleen and bone marrow single cell suspension

The preparation of bone marrow cell suspension: method is the same; The preparation of spleen cell suspension: method is the same; The preparation of mesenteric lymph node cell: get the mice mesenteric lymph node, in 70 eye mesh screens, grind gently, resuspended with containing 3%FCS/PBS.

2.4.2 cellular immunofluorescence dyeing

Adjust spleen or medullary cell concentration to 1 * 10 ⁷/ mL adds 100 μ L cell suspension to Constar 96 hole U templates and is used for dyeing.Detect immature B cells and carry out that IgM, CD19 are two to be dyed, every hole adds 1 μ L anti-CD19-FITC and anti-IgM-biotin and mixing, and 4 ℃ of lucifuges are hatched 45min.PBS washes one time, and cell is resuspended among the 100 μ L 3%FCS/PBS, adds 1 μ L Streptavidine-PE again, mixing, and 4 ℃ of lucifuges are hatched 30min.PBS washes 2 times, and cell is resuspended among the 300 μ L 3%FCS/PBS; Detect mature cell and dye with IgD, CD19 are two, every hole adds 1 μ L anti-CD19-FITC and anti-IgD-PE and mixing, and 4 ℃ of lucifuges are hatched 45min, and PBS washes 2 times, and cell is resuspended among the 300 μ L 3%FCS/PBS; The distinctive T cell of Fas gene mutation dyes with CD3, B220 are two in detection spleen or the lymph node, adjusts cell concentration to 1 * 10 ⁷/ mL gets 100 μ L cell to 96 hole U templates and is used for dyeing, and every hole adds 1 μ L anti-B220-biotin and anti-CD3-FITC4 ℃ of lucifuge hatched 45min.PBS washes one time, and cell is resuspended among the 100 μ L 3%FCS/PBS, adds 1 μ LStreptavidine-PE again, mixing, and 4 ℃ of lucifuges are hatched 30min.PBS washes 2 times, and cell is resuspended among the 300 μ L3%FCS/PBS, and above-mentioned painted cell detects through BD FACScalibur flow cytometer, and analyzes with CellQuest software.

2.5 kidney pathological examination

2.5.1 kidney immunofluorescence dyeing

2.5.1.1 the preparation of kidney frozen section

The disconnected neck of mice is put to death and is got kidney, and kidney is put into the bottle closure of rubber that fills OCT, adds OCT again to the plug mouth, and-80 ℃ freezing.Refrigerated piece of tissue in the section of Leica freezing microtome inscribe into about 10 μ m, and is printed to it on slide that poly-D-lysine handled.For avoiding antigen to lose, place cold anhydrous propanone to soak 2-3min section, taking-up is dried, and-80 ℃ are frozen.

2.5.1.2 immunofluorescence original position dyeing

Take out frozen section and return to room temperature, drip 100 μ L 3%FCS/PBS in every section, room temperature sealing 30-60min.Anti-IgG-FITC or anti-C3-FITC suitably are diluted among the 3%FCS/PBS, every antibody (final concentration 20 μ g/mL) that drips 100 μ L dilution, 4 ℃ of wet boxes spend the night.Next day, PBS washed 3 times, each 5min.Take out slide, dry unnecessary liquid, add 1 of Mounting medium, lid coverslip, nial polish mounting, fluorescence microscopy.

2.5.2 kidney PAS dyeing

Renal tissue is fixed 1 day with 10% neutral formalin.Deliver to Shanghai Communications University's medical college Pathological Staff Room paraffin embedding, make paraffin section, carry out PAS dyeing.The gained stained preparation is taken pictures, is deposited at the Leica micro imaging system.

2.6 the research of mice survival rate

With OBF-1 defective MRL-lpr mice (13) and the wild MRL-lpr mice of OBF-1 (16), in the pathogen-free domestic environment, normally raise, observe two kinds of mouse survival condition in age in July.Survival Analysis adopts the Kaplan-Meier method, and survival curve difference is checked with Mantel-Cox log rank.P＜0.05 is thought statistically-significant difference.

3. result

3.1OBF-1 the MRL-lpr mice serum immunoglobulin level of defective reduces

In the OBF-1 of the research explanation in the past knock-out mice serum, except IgM, other immunoglobulin level all reduces.Can reduce the hypergammaglobulinemia that the MRL-lpr mice forms in order to measure the OBF-1 defective, the inventor have measured OBF-1 ^-/-Fas ^-/-And OBF-1 ^{+ /+}Fas ^-/-Immunoglobulin level in the mice serum.As seen from Figure 4, compare with OBF-1 wild type MRL-lpr mice, OBF-1 defective MRL-lpr mice serum Immunoglobulin IgG1, IgG2a, IgG2b, the IgG3 level obviously reduces, and the level of IgG subclass can compare with the level of OBF-1 deficient mice.These results show that the OBF-1 defective can be prevented the generation of MRL-lpr mice hypergammaglobulinemia.The level of IgA also reduces in this external OBF-1 defective MRL-lpr mice serum, but the amount that reduces does not have IgG obvious.What is interesting is that the generation of IgM also reduces in the MRL-lpr mice.This can reflect the effect of OBF-1 in polyclonal B cell-stimulating in the MRL-lpr mice.

3.2OBF-1 the MRL-lpr mice of defective can not produce autoantibody

The MRL-lpr mice can produce the multiple pathogenic autoantibody of anti-nucleic acid and protein molecule, and autoantibody plays an important role in development lupus disease.In these antibody, anti-dsDNA antibody and anti-sm antibody are considered to the specific autoantibody of systemic lupus erythematosus (sle).In order to study OBF-1 in the aborning effect of MRL-lpr mice autoantibody, the inventor at first detects the level of the anti-dsDNA antibody in the serum with the ELISA method.Shown in Fig. 5 A and B, OBF-1 wild type MRL-lpr mice can be developed the anti-double-chain DNA autoantibody of IgG1 or IgG2a type.Be that OBF-1 defective MRL-lpr mice can not detect the anti-double-chain DNA autoantibody that produces IgG1 or IgG2a type significantly.The O.D. value of the MRL-lpr mice serum of OBF-1 defective is similar with the negative control that does not contain serum.

Then, the inventor has detected the anti-dsDNA antibody of total IgG type.Shown in Fig. 5 C, do not detect the antibody of the anti-double-chain DNA of IgG type in the MRL-lpr mice serum of OBF-1 defective.The inventor also obtains similar conclusion with the MRL-lpr mice serum of OBF-1 defective even with dilution in 1: 5.(the O.D. value: 0.12 ± 0.02, n=6).Further, the inventor has measured antinuclear antibody, and it has comprised anti-double-chain DNA, single stranded DNA, Sm, SS-A, SS-B, RNP, Histone, the mixture of autoantibodys such as Jo-1 and Scl-70.Consistent with the result of anti-double-chain DNA, OBF-1 defective MRL-lpr mice can not produce the antinuclear antibody of anti-total IgG, and O.D. value and immunodeficiency Xid mice are similar, see Fig. 5 D.These results prove that the MRL-lpr mice that lacks OBF-1 can be eliminated the generation of autoantibody.

The inventor further uses immunofluorescence dyeing Hep-2 cell, observe the antinuclear antibody in the serum, as seen from Figure 6, compare with OBF-1 wild type MRL-lpr mice, OBF-1 defective MRL-lpr mice serum was at 1: 100,1: 500 two dilution factor, Hep-2 nucleus dyeing fluorescence intensity all obviously reduces, and prompting OBF-1 defective has appreciable impact to MRL-lpr lupus mice serum antinuclear antibody level.

3.3OBF-1 disappearance significantly reduces the quantity of autoantibody secretory cell in the MRL-lpr mice body

Antibody secreting cell is essential to the generation of immunoglobulin and autoantibody, and whether the inventor further influences the generation of antibody secreting cell with ELISPOT research MRL-lpr mice OBF-1 defective.The result is shown in Fig. 7 A and Fig. 7 B, and OBF-1 wild type MRL-lpr mouse spleen can produce a lot of antibody secreting cells.Number that it should be noted that antibody secreting cell in the MRL-lpr mouse spleen of OBF-1 defective significantly reduces, and these mices only observe speckle seldom.And the inventor has also detected the number of antibody secreting cell in the bone marrow, and is consistent with the result of spleen, and the antibody secreting cell in the OBF-1 defective MRL-lpr mouse bone marrow cells also reduces significantly, shown in Fig. 7 C.Thereby these results show that OBF-1 is essential to the generation of MRL-lpr mouse antibodies secretory cell.

3.4OBF-1 the mRNA level of the MRL-lpr mice plasma cell specific gene of defective does not reduce

Plasma cell specific gene Blimp-1, Xbp-1 is verified with IRF-4 to be relevant with the generation of antibody secreting cell.For whether the disappearance of measuring OBF-1 influences these expression of gene, the inventor has measured the level of the mRNA of these genes in OBF-1 disappearance MRL-lpr mice and the wild MRL-lpr mouse spleen of the OBF-1 B cell.Found that, the slight reduction of MRL-lpr mice OBF-1 disappearance IRF-4mRNA level, XBP-1 expresses and is not affected.What is interesting is, repeatedly independently finding that the mRNA level of Blimp-1 increases in the OBF-1 defective MRL-lpr mouse B cell in the test.In addition, with OBF-1 wild type MRL-lpr mice ratio, the germinal center of OBF-1 defective MRL-lpr mice forms relevant transcription inhibitor, the expression of Bcl-6 higher level, this with the OBF-1 deficient mice can not to form germinal center consistent.This results suggest, OBF-1 can reduce the expression of Bcl-6 in the forming process of germinal center.The inventor has also measured the expression of J chain, and it is relevant with dimer IgA covalency with pentamer IgM, and the mRNA level of the MRL-lpr mice J chain of OBF-1 defective significantly reduces, shown in Fig. 8 A.For transcribing of clear and definite whether J chain relies on OBF-1, the inventor detects the expression of J chain in the isolating spleen B cell of OBF-1 deficient mice.The mRNA level of OBF-1 wild-type mice and OBF-1 deficient mice J chain is not observed significant difference, sees Fig. 8 B.Therefore prompting, OBF-1 defective MRL-lpr mice J chain to transcribe inhibition relevant with the interaction of lpr and OBF-1.

3.5OBF-1 defective does not influence the B cell development of MRL-lpr mouse spleen

3.5.1OBF-1 defective does not influence MRL-lpr mouse spleen B cell development maturation

With OBF-1 ^{+ /+}, OBF-1 ^-/-, OBF-1 ^{+ /+}Fas ^-/-, OBF-1 ^-/-Fas ^-/-Mice (6 every group, down with) spleen single cell suspension pair dyes with anti-CD19, anti-IgM and anti-CD19, anti-IgD antibody respectively, the distinctive result of flow cytometry as shown in Figure 9, with OBF-1 ^{+ /+}The mice ratio, OBF-1 ^-/-CD19 in the mouse spleen ⁺IgM ⁺Cell obviously reduces, CD19 ⁺IgD ⁺Cell also obviously reduces, and this group cell is from CD19 ⁺IgM ⁺Cell development is sophisticated.Therefore prompting, OBF-1 plays an important role to the tour B cell that bone marrow enters spleen.

Compare the MRL-lpr mouse spleen immature B cells (CD19 of OBF-1 homozygote defective with OBF-1 wild type MRL-lpr mice ⁺IgM ⁺) and mature B cell (CD19 ⁺IgD ⁺) quantity is respectively 22,24, and OBF-1 ^{+ /+}Be respectively 24,26 in the MRL-lpr mice, cell quantity does not reduce; Therefore, MRL-lpr mice OBF-1 defective does not influence the transition period B cell of bone marrow to the spleen migration, does not influence B cell development maturation in the spleen yet.

3.5.2OBF-1 defective does not influence MRL-lpr mouse bone marrow cells B cells whose development

Except the OBF-1 sudden change does not influence MRL-lpr mouse spleen B cell development, the inventor has verified that also the OBF-1 sudden change is to the cytocerastic influence of this mouse bone marrow cells B.As seen from Figure 10, with OBF-1 ^{+ /+}The mice ratio, OBF-1 ^-/-CD19 in the mouse bone marrow cells ⁺IgM ⁺Cell slightly reduces, CD19 ⁺IgD ⁺Cell also has minimizing.And CD19 ⁺IgM ^-, CD19 ⁺IgD ^-The cell showed increased, promptly immature B cytosis, OBF-1 disappearance can be blocked the B cell and grown to immature B by pro B lymphocyte, pre B lymphocyte in the prompting bone marrow.

OBF-1 sudden change MRL-lpr mouse bone marrow cells B cell development situation is similar with spleen: compare OBF-1 sudden change MRL-lpr mouse bone marrow cells immature B cells (CD19 with OBF-1 wild type MRL-lpr mice ⁺IgM ⁺) and mature B cell (CD19 ⁺IgD ⁺) quantity is respectively 12,14, but is slight increase, it is generally acknowledged that sophisticated B cell in the bone marrow is the memory cell by a spot of expression high-affinity, flows back to again with circulation, and further is divided into plasma cell.But the inventor still can detect the mature B cell suitable with immature B cells quantity from bone marrow, has the approach of being grown to mature B cell by immature B cells in the possible bone marrow.Prompting OBF-1 defective do not influence yet MRL-lpr mouse bone marrow cells B cell by immaturity to sophisticated transformation.

3.5.3MRL-lpr mice OBF-1 defective CD4 ^-CD8 ^-B220 ⁺CD3 ⁺Cells accumulation significantly reduces

There are some researches show, transcribe co-activation factor OBF-1 and mainly in the B cell, express, especially germinal center's cell; Though external use phorbol ester and ionomycin can instantaneous inducing T cell OBF-1 expression, the OBF-1 defective does not influence the T cells whose development; Fas mutant mice B220 ⁺CD3 ⁺Cells accumulation is distinctive, and this group cell is considered to the thymus source, and the performance specificity is regulated the T cell function.Be unexpectedly, with the wild MRL-lpr mice ratio of OBF-1, the spleen of OBF-1 defective MRL-lpr mice and the B220 of lymph node ⁺CD3 ⁺The quantity of cell reduces significantly, sees Figure 11 A and B.And consistent with former observed result is OBF-1 ^-/-The CD3 of MRL-lpr mice ⁺, CD4 ⁺, CD8 ⁺Cells whose development is not affected.

3.6OBF-1 the nephritis of immune complex deposit mediation does not take place in the MRL-lpr mice of defective

3.6.1OBF-1 the MRL-lpr mouse kidney immune complex deposit of defective disappears

The glomerulonephritis of immune complex mediation is main pathological change in the MRL-lpr mice.The immunofluorescence dyeing of kidney section, as shown in figure 12, OBF-1 wild type MRL-lpr mice glomerule has the deposition of IgG and complement C3; And MRL-lpr mice and OBF-1 that OBF-1 knocks out ^{+ /+}Or OBF-1 ^-/-The kidney that mice is the same is not found significant IgG and C3 deposition.

3.6.2OBF-1 glomerulonephritis does not take place in the MRL-lpr mice of defective

PAS (Periodic acid-Schiff) dyeing (seeing Figure 13) of kidney section shows, with OBF-1 ^{+ /+}And OBF-1 ^-/-The control mice ratio, the obvious enlargement of OBF-1 wild type MRL-lpr mice glomerule, it is big that capsular space becomes, mesentery epithelial proliferation, the formation of crescent.And OBF-1 defective MRL-lpr mice glomerule does not have obvious inflammatory reaction symptom.

3.7OBF-1 disappearance reduces the MRL-lpr mouse death rate

Subsequently, the inventor has observed the survival rate of OBF-1 defective MRL-lpr mice and OBF-1 wild type MRL-lpr mice, and as shown in figure 14, OBF-1 wild type MRL-lpr mice begins death at 4.5 monthly ages, and is consistent with the MRL-lpr mice of the wild type of expecting.OBF-1 wild type MRL-lpr mice death when 7 monthly ages (survival rate 43.75%) of 56.25%.And the MRL-lpr mice of OBF-1 disappearance all can survive to 7 monthly ages (survival rate 100%).Survival rate to two kinds of mouse compares: there is significant difference p＜0.0001.Therefore, the OBF-1 defective can significantly increase the life-span of MRL-lpr mice.

The effect that embodiment 3OBF-1 siRNA produces autoantibody

The design of one .OBF-1 siRNA

The inventor has designed a series of siRNA (siRNA, 21 bases) at the particular order on the OBF-1 gene, sees Table 3, can effectively suppress the siRNA of OBF-1 gene expression in the hope of screening.

Table 3

		Sequence	SEQ ID NO：
				1	Positive-sense strand siRNA	GGAGCCAGUGAAGGAGCUAUU	21
2	Antisense strand siRNA	UAGCUCCUUCACUGGCUCCUU						22
				3	Positive-sense strand siRNA	CAUUAUGUGCUGGCUGGCUUU	23
4	Antisense strand siRNA	AGCCAGCCAGCACAUAAUGUU						24
				5	Positive-sense strand siRNA	UGUCACGCCAAGAAGCACUUU			25
6	Antisense strand siRNA	GUGCUUCUUGGCGUGACAUU						26
				7	Positive-sense strand siRNA	CACGUACGAGCUCAACCACUU			27
8	Antisense strand siRNA	GUGGUUGAGCUCGUACGUGUU	28

The preparation of two .siRNA compositionss and application

1 * 10 ⁶Add 100nM OBF-1 siRNA in the cell of individual secretion autoantibody (as follows).

The effect that three .OBF-1 siRNA produce autoantibody

The inventor is a subjects with the T347 cell strain (available from U.S. Einstein university) of the IgG2a anti-dsDNA antibody of secreting high titre, observes that each siRNA is contrast for the effect that autoantibody produces with the cell that does not give siRNA in the table 3.Found that No. 1 (Figure 15 A and B) and No. 2 siRNA have the autoantibody effect that good reduction T347 cell produces, 3-8 number siRNA is not ideal enough for the effect that reduces autoantibody.

The method of embodiment 4 screenings minimizing material of antibody secreting cell

In this example, material standed for is each siRNA shown in the table 3.

Test group: the T347 cell strain that adds material standed for and expression OBF-1.

Matched group: the T347 cell strain that does not add material standed for and expression OBF-1.

May further comprise the steps:

In the test group, in the T347 cell culture of expressing OBF-1, add each siRNA shown in the table 3 respectively, hatch appropriate time after, detect the expression of OBF-1.

The expression of OBF-1 in the expression of OBF-1 in the aforementioned test group and the matched group is compared, if the expression of the OBF-1 in the test group significantly is lower than matched group (＜70%) statistically, just show that this material standed for is to reduce antibody secreted potential material.

The result shows, No. 1 and No. 2 siRNA have the expression effect of good reduction OBF-1, thereby can be used as the material that reduces antibody secreting cell.

Discuss

1. animal model

So far, produced multiple systems lupus erythematosus mouse model.Wherein the most frequently used has three kinds: NZB/NZWF1, MRL-lpr and BXSB.NZB/NZW F1 is produced with the male Mus copulation of relative normal N ZW by the female Mus of the NZB of lupus background, is the most classical SLE mouse model, typical lupoid acne phenotype takes place: serum anti-DNA antibody, lupus nephritis, hemolytic anemia.It is heavier than male that the female sexually transmitted disease (STD) of this mice is decreased degree, and the morbidity advance ratio is male fast, and this and human SLE are quite similar.But this mouse invasion time is later, just begins to take place lupus nephritis when 9 monthly ages.In addition, female NZB/NZW F1 mice is infertile.BXSB mouse also is the SLE mouse model of using always.The male morbidity of this mice is higher than female far away, points out its morbidity and Y chromosome interlocking.This sends out in the women just opposite well with human SLE.So above-mentioned two kinds of mouse models are not the most suitable.

The animal model that the present invention sets up is based on another kind of spontaneous SLE mouse model MRL-lpr commonly used and sets up.This mice is because Fas gene the 2nd includes reverse transcription early transposon (the earlyretroviral transposon that 4.7kb is inserted in the subarea, Etn), make mRNA aberrant splicing, mRNA transcribe ahead of time and stop, cause saltant Fas mRNA and protein level only to be 1/10 of control mice.This sudden change is the genotypic foundation of inventor's identification of M RL-lpr mice Fas.The proteic rapid minimizing of Fas cause T in the MRL-lpr mice body, bone-marrow-derived lymphocyte can not take place activation-inducing cell death (activation-induced cell death, AICD).T, B cell are because can not apoptosis and bulk deposition is the major reason that the lupus phenotype takes place the MRL-lpr mice.The characteristics of this mouse model are that onset is fast, can fall ill about 8 weeks, and course of disease progress is rapid, female 17 weeks of average life, male 22 weeks of average life.Use the MRL-lpr mice and can observe and analyze the lupus phenotype quickly.

The inventor is when setting up the MRL-lpr mouse model of OBF-1 defective, with the OBF-1 of F2 in generation ^-/-Fas ^-/-Mice and MRL-lpr parental generation mice are backcrossed 6-8 for the back OBF-1 that produces ^{+ /+}Fas ^-/-, OBF-1 ^-/-Fas ^-/-Two kinds of mouse genotypes are used for experiment.The OBF-1 that the inventor produces for the back with the 6-8 that backcrosses ^{+ /+}Fas ^-/-Mouse genotypes, rather than MRL-lpr parental generation mice (genotype also is OBF-1 ^{+ /+}Fas ^-/-) as experiment contrast, consider that exactly the former has incorporated other background except that the OBF-1 sudden change in the OBF-1 mice.

2.OBF-1 the MRL-lpr lupus mice autoantibody secretory cell of defective research

Find and identify that can to suppress or eliminate the key gene that autoantibody produces extremely important for the Therapeutic Method of understanding autoimmune mechanism and exploration autoimmune disease.

Among the present invention, the inventor has confirmed that OBF-1 is important to the development of multiple pathogenic autoantibody in spontaneous lupus model MRL-lpr mice.In the MRL-lpr mice, the OBF-1 disappearance is eliminated all production of antibodies at nuclear antigen fully, comprises lupus specificity anti-double-chain DNA and anti-sm antibody.Carry out the MRL-lpr mice serum that ELISA detects the OBF-1 disappearance the inventor, the OD value is similar to negative control, does not observe the generation of color.On the contrary, produce the autoantibody of high titre in the MRL-lpr mice of OBF-1 wild type.And the inventor's result shows the MRL-lpr mice, and the OBF-1 disappearance can be prevented hypergammaglobulinemia, the generation of glomerulonephritis and reduction Infant Mortality.Therefore, this research is consistent with the former inventor's work, and hint OBF-1 is an important function of gene to the generation of autoantibody, shows that OBF-1 can be used as the valuable target spot of medicine of research therapy system systemic autoimmune diseases.

Subsequently, the inventor has studied the mechanism of the MRL-lpr mice autoantibody generation elimination of OBF-1 disappearance.The inventor discovered in the past that OBF-1 disappearance blocking-up pre B lymphocyte changed to immature B cells, caused in the bone marrow of Aiolo knock-out mice, and the quantity of immaturity and mature B cell reduces significantly.Therefore, the inventor proposes autoreactivity B cell in the immature B cells stage, stops or disappearance.In the MRL-lpr mouse bone marrow cells, the OBF-1 disappearance can not weaken the differentiation of immaturity and mature B cell.And immaturity in the spleen and mature B cell do not reduce yet.The IgG secretory cell is important to the generation of pathologic autoantibody and hypergammaglobulinemia in the MRL-lpr mice, and the inventor is by the effect of enzyme linked immunological spot test research OBF-1 to the generation of IgG secretory cell in vivo.Interesting thing has lacked OBF-1, and the IgG secretory cell reduces significantly in the spleen of MRL-lpr mice.And the quantity of IgG secretory cell also is significant minimizing in the bone marrow.Therefore, these discoveries provide direct evidence, and promptly the generation of OBF-1 antagonist or autoantibody secretory cell is essential in vivo.The elimination mechanism that has shown autoantibody, the prevention hypergammaglobulinemia.

In the inventor's system, the differentiation of antibody secreting cell seems and the specific gene Blimp-1 of plasma cell, and XBP-1 and IRF-4 do not have tangible dependency, though IRF-4 expresses reduction is arranged slightly.In the antibody cell differentiation procedure, Blimp-1 thinks that OBF-1 is dependent before expressing.With the wild MRL-lpr mice ratio of OBF-1, not only the level of OBF-1 defective MRL-lpr mice Blimp-1mRNA does not descend also slightly rising.This dissimilar results suggest, in different systems, Blimp-1 is to the demand difference of OBF-1.People such as William find that id reaction B cell (RF B cell) can breed and experience somatic hypermutation, in AM14 MRL-lpr mouse spleen T cellular regions red pulp edge, the autoantibody that has proposed these mices reacts the zone that may occur in outside the germinal center.

Therefore, MRL-lpr mice OBF-1 to germinal center outside autoreactivity B cells whose development may also need.Fas mutant mice (MRL-lpr, B6-lpr and Fas knock-out mice) and autoimmune lymphopoiesis syndrome are with unusual double negative t cells (CD4 ^-CD8 ^-B220 ⁺CD3 ⁺Gathering cell) is feature.Though the function of these cells is still largely unknown, they are considered to the T cell source, play regulating action in immunoreation.What is interesting is that the OBF-1 disappearance significantly reduces B220 in the MRL-lpr mice ⁺CD3 ⁺Gathering of cell.This effect is not the cytocerastic result of T who weakens because in the MRL-lpr of OBF-1 defective mice CD3 ⁺, CD4 ⁺And CD8 ⁺Cell quantity does not reduce.Though potential mechanism does not understand that still the inventor's result shows that this special cells group's growth needs OBF-1 that signal is provided.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Inst. of Life Science, CAS

＜120〉method and composition of treatment autoimmune disease

<130>073583

<160>28

<170>PatentIn version 3.3

<210>1

<211>17

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>1

gctccctgac cattgac 17

<210>2

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>2

tcctgtccca tccccctgta a 21

<210>3

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

ggcttagaca acaaagcgtg tgtcc 25

<210>4

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

gcgtgcaatc catcttgttc aatgg 25

<210>5

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

ctccagactc tcttgcttta c 21

<210>6

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

gacaagagat tagcctccag g 21

<210>7

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>7

ctccagactc tcttgcttta c 21

<210>8

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>8

gacaccagtt atgaaggaag g 21

<210>9

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>9

cattcctgtc cccaacgcat caactg 26

<210>10

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>10

ggtgcccaag caccaaagtc atagc 25

<210>11

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>11

gctggagcag caagtggtgg atttgg 26

<210>12

<211>26

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>12

ggcttccagc ttggctgatg aggtcc 26

<210>13

<211>32

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>13

cagcaccttc ctcttctctg atgaggagct cc 32

<210>14

<211>30

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>14

ctggcggaga gccagaggcc tgaaggatgc 30

<210>15

<211>23

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>15

gtcttcactg gggagtccta gcc 23

<210>16

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>16

gggtgcaaat ggagagcctc taagg 25

<210>17

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>17

gaagccccaa agccctcagt cgttg 25

<210>18

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>18

ggggcatgta attaaacctt gtgtg 25

<210>19

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>19

tgttaccaac tgggacgaca 20

<210>20

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>20

tctcagctgt ggtggtgaag 20

<210>21

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>21

ggagccagug aaggagcuau u 21

<210>22

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>22

uagcuccuuc acuggcuccu u 21

<210>23

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>23

cauuaugugc uggcuggcuu u 21

<210>24

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>24

agccagccag cacauaaugu u 21

<210>25

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>25

ugucacgcca agaagcacuu u 21

<210>26

<211>20

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>26

gugcuucuug gcgugacauu 20

<210>27

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>27

cacguacgag cucaaccacu u 21

<210>28

<211>21

<212>RNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉siRNA

<400>28

gugguugagc ucguacgugu u 21

Claims (10)

1. a B cell-specific is transcribed the purposes of co-activation factor OBF-1 gene or proteic antagonist, it is characterized in that, is used to prepare the material that reduces the autoantibody secretory cell.

2. purposes as claimed in claim 1 is characterized in that, described antagonist is selected from: the B cell-specific is transcribed co-activation factor OBF-1 gene or proteic part, antibody, siRNA or antisense nucleotide.

3. purposes as claimed in claim 2 is characterized in that, described siRNA is selected from:

SiRNA with sequence shown in the SEQ ID NO:21; Or

SiRNA with sequence shown in the SEQ ID NO:22.

4. purposes as claimed in claim 1 is characterized in that, the material of described minimizing autoantibody secretory cell also is used to prepare the preparation of prevention or treatment autoimmune disease.

5. purposes as claimed in claim 4 is characterized in that, described autoimmune disease comprises: systemic lupus erythematosus (sle), autoimmune hemolytic anemia, rheumatoid arthritis.

6. a B cell-specific is transcribed co-activation factor OBF-1 gene or proteic purposes, it is characterized in that, is used to prepare the material that reduces the autoantibody secretory cell.

7. a B cell-specific is transcribed co-activation factor OBF-1 gene or proteic purposes, it is characterized in that, is used to screen the material that reduces the autoantibody secretory cell.

8. method of screening the material that reduces the autoantibody secretory cell is characterized in that described method comprises step:

(a) candidate substances and expression B cell-specific are transcribed the proteic cells contacting of co-activation factor OBF-1; With

(b) detect candidate substances to the proteic influence of OBF-1;

Wherein, if described candidate substances can reduce the proteic expression of OBF-1 or suppress the proteic activity of OBF-1, show that then this candidate substances is to reduce the material of autoantibody secretory cell.

9. one kind prepares the method that the B cell-specific is transcribed the MRL-lpr mice of co-activation factor OBF-1 disappearance, it is characterized in that described method comprises:

(1) MRL-lpr lupus mice and OBF-1 disappearance mice are hybridized, produce the first filial generation mice;

(2) with first filial generation mice pairing hybridization, produce the second filial mice; With

(3) identify second filial mice genotype, pick out the MRL-lpr mice of OBF-1 disappearance.

10. the method for the excessive generation relevant disease of prevention or treatment autoantibody secretory cell, it is characterized in that described method comprises: the B cell-specific that gives experimenter's effective dose is transcribed co-activation factor OBF-1 gene or proteic antagonist.

Images