CN101016543A - In vitro methods of producing and identifying immunoglobulin molecules in eukaryotic cells - Google Patents

Abstract

The present invention relates to efficient methods for expressing immunoglobulin molecules in eukaryotic cells. The invention further relates to methods for preparing libraries of immunoglobulin heavy and light chains for expression in eukaryotic cells, in particular by trimolecular recombination. The invention also provides methods of selecting and screening antigen-specific immunoglobulin molecules and antigen-specific fragments thereof. The present invention also provides kits for preparing, screening and selecting antigen-specific immunoglobulin molecules. Finally, the invention provides immunoglobulin molecules and antigen-specific fragments thereof prepared by the methods provided herein.

Description

Method for screening polynucleotides encoding antigen-specific immunoglobulin molecules or antigen-specific fragments thereof

This application is a divisional application of an invention patent application with a filing date of November 14, 2001, an application number of 01820904.1, and an invention title of "Method for Screening Encoding Antigen-Specific Immunoglobulin Molecules or Antigen-Specific Fragments".

Background of the invention

field of invention

The present invention relates to a method for efficiently expressing immunoglobulin molecules in eukaryotic cells, a method for producing immunoglobulin heavy chain and light chain libraries for expression in eukaryotic cells, and methods for isolating immunoglobulins that bind to specific antigens methods, and immunoglobulins produced by one of these methods.

related technology

Immunoglobulin preparation

Antibodies with specific specificities are being used in an increasing number of different medical applications.

Specific antibodies against self-antigens are especially valuable for therapeutic and diagnostic purposes in vivo. A number of rodent monoclonal antibodies have been isolated using hybridoma technology and used in vivo for therapeutic and diagnostic applications in humans. For example, one early application of these mouse monoclonal antibodies was as a targeting agent to kill or image tumors (F.H. Deland and D.M. Goldenberg 1982 in "Radionuclide Imaging," D.E. Kuhl, eds., pp. 289-297, Pergamon, Paris; R. Levy and R.A. Miller ANN. Rev. Med. 1983, 34:107-116). However, using such antibodies in vivo can cause problems. Exogenous immunoglobulins can elicit antiimmunoglobulin responses that interfere with therapy (R.A. Miller et al., 1983 Blood62:988-995) or cause allergy or immune complex hypersensitivity (B. Ratner, 1943, Allergy, Anaphylaxis and Immunotherapy, Williams and Wilkins, Baltimore). Accordingly, development of antibodies that are not themselves immunogenic in the host is particularly important for such applications, eg, development of antibodies against human antigens that are not themselves immunogenic in humans.

Isolating antibody fragments specific for self-antigens is a difficult task. Animals often do not develop antibodies against self-antigens, a phenomenon known as tolerance. In general, immunization with self-antigens does not result in the production of circulating antibodies. It is therefore difficult to develop antibodies against self-antigens.

Previously, three strategies have been used to generate immunoglobulin molecules that specifically recognize self-antigens. In one approach, rodent antibody sequences are converted to human antibody sequences by grafting specialized complementarity determining regions (CDRs) comprising the antigen-binding site of a selected rodent monoclonal antibody into the framework regions of the human antibody ( Winter et al, British Patent No.GB21886 38B (1987); Reichmann L. et al, Nature (London) 332:323-327 (1988); Foote J. and Winter G; J.Mol.Biol.224:487-499 ( 1992)). In this method, which has been named antibody humanization, the three CDR loops of each heavy and light chain of a rodent immunoglobulin are grafted into homologous positions in the four framework regions of the corresponding human immunoglobulin chain . Because some framework residues also contribute to antibody avidity, often the structure must be further modified by additional framework substitutions in order to enhance avidity. This can be a laborious and expensive process.

Recently, transgenic mice expressing human immunoglobulin sequences were generated (Mendez M.J. et al., Nat. Genet. 15:146-156 (1997)). This strategy has the potential to speed up the selection of human antibodies, but it suffers from the same limitation as antibody humanization approaches, namely that antibodies are selected from pre-existing repertoires in mice that are encoded by the mouse rather than human genome formed by proteins. This may affect the epitope specificity of antibodies chosen against a particular antigen. For example, immunization of mice with human proteins for which homologues exist in mice may result in the production of antibodies primarily specific for those epitopes that are different in humans and mice. And these may not be the best target epitopes.

An alternative method not subject to the same limitations is to screen recombinant human antibody fragments displayed on phage (Vaughan T.J., Nat. Biotechnol. 14:309-314 (1996); Barbas C.F., III, Nat.Med. 1:837-839 (1995); Kay B.K. et al., "Phage Display of Peptides and Proteins", Academic press (1996)). In phage display, functional immunoglobulin domains are displayed on the surface of phage particles that carry the polynucleotide sequences encoding them. In typical phage display methods, immunoglobulin fragments, such as Fab, Fv or disulfide bond-stabilized Fv immunoglobulin domains, are displayed as fusion proteins, ie, fused to phage surface proteins. Examples of phage display methods that can be used to prepare antibodies include Brinkman U. et al. (1995) (J. Immunol. Methods 182: 41-50; ); Ames, R. S. et al. (1995) (J. Immunol. Methods 184: 177-186) Kettleborough, C.A. etc. (1994) (Eur.J.Immunol.24:952-958); Persic, L. etc. (1997) (Gene187:9-18); Burton, D.R. etc. (1994) (Advances in Immunology57:191 -280)；PCT/GB91/01134；WO95/15982；WO95/20401；以及美国专利5698426，5223409，5403484，5580717，5427908，5750753，5821047，5571698，5427908，5516637，5780225，5658727和5733743(这些文献均is incorporated by reference in its entirety).

Since phage display usually results only in the expression of antigen-binding fragments of immunoglobulin molecules, following phage selection, the immunoglobulin coding region must be isolated from the phage and recloned for the production of whole antibodies (including human antibodies) or any other Antigen-binding fragments of interest and expressed in any host of interest (animal cells, insect cells, plant cells, yeast, bacteria). For example, techniques for the recombinant production of Fab, Fab' and F(ab') _fragments may also be applied using methods known in the art, such as those disclosed in: WO92/22324; Mullinax RL et al. (BioTechniques 12 (6): 864-869 (1992); and Sawai, H. et al. AJRI 34: 26-34 (1995); and Better, M. et al., Science 240: 1041-1043 (1988)) are disclosed (these documents are in full text cited by reference).

Immunoglobulin libraries constructed in phage can be derived from natural antibody-producing cells or specifically immunized individuals, and can theoretically include new and different combinations of human immunoglobulin heavy and light chains. Although this strategy is not limited by the intrinsic antibody repertoire, it requires that the complementarity-determining regions (CDRs) of the expressed immunoglobulin fragments be synthesized and folded correctly in bacteria. However, many antigen-binding domains are difficult to assemble correctly in bacterial cells when they exist as fusion proteins. In addition, the protein does not undergo normal eukaryotic post-translational modifications. Thus, this approach imposes a different means of selection on the antibody specificities that can be obtained.

Therefore, there is a need for a method or method that can identify immunoglobulin molecules and antigen-specific fragments thereof from unbiased immunoglobulin repertoires that can be synthesized in eukaryotic cells, properly glycosylated and assemble correctly.

Eukaryotic expression library. A fundamental tool in the field of molecular biology is the conversion of poly(A) ⁺ mRNA into double-stranded (ds) cDNA, which can then be inserted into cloning vectors and expressed in suitable host cells. One approach commonly used in many cDNA cloning strategies involves the construction of a cDNA library, which is a pool of cDNA clones derived from poly(A) ⁺ mRNA from cells of the organism of interest. For example, to isolate cDNAs expressing immunoglobulin genes, cDNA libraries can be prepared from pre-B cells, B cells, or plasma cells. Methods for constructing cDNA libraries in different expression vectors, including filamentous phage, bacteriophage lambda, cosmid and plasmid vectors, are known. Some common methods are described in, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, ^2nd Edition, Cold Spring Harbor Laboratory, publisher, Cold Spring Harbor, NY (1990).

A number of different methods for isolating target genes from cDNA libraries have been used with varying degrees of success. These methods include, for example, the use of nucleic acid hybridization probes, which are labeled nucleic acid fragments having a sequence complementary to the DNA sequence of the target gene. When this method is applied to cDNA clones in transformed bacterial hosts, those colonies or plaques that hybridize strongly to the probe are likely to contain the target DNA sequence. However, the hybridization method neither requires nor detects whether a particular cDNA clone is expressed. Alternatively, screening methods rely on expression in a bacterial host, for example colonies or plaques can be screened by immunoassays that detect their binding to antibodies directed against the protein of interest. However, assays to measure expression in bacterial cells are often hampered because the protein may not be expressed efficiently in the bacterial host, may be expressed in the wrong conformation, or it may not be processed as well as in eukaryotic systems and/or transport. Many of these above-mentioned problems have been encountered in attempts to produce immunoglobulin molecules in bacterial hosts.

Thus, the use of mammalian expression libraries to isolate cDNA encoding immunoglobulin molecules has several advantages over bacterial libraries. For example, immunoglobulin molecules and their subunits expressed in eukaryotic hosts should be functional and subject to normal post-translational modifications. Normally, proteins transported to the cell surface through the intracellular membrane system should undergo a complete transport process. Furthermore, the use of eukaryotic systems makes it possible to isolate polynucleotides based on functional expression of eukaryotic RNA or protein. For example, immunoglobulin molecules can be isolated according to their specificity for particular antigens.

Except for some lymphokine cDNAs (Wong, G.G., et al., Science 228:810-815 (1985) isolated recently by expression in COS cells; Lee, F. et al., Proc.Natl.Acad.Sci.USA83: 2061-2065 (1986); Yokota, T., et al., Proc. Only a few cDNAs were isolated from the expression library. There are two main reasons for this: first, the existing technology for constructing a large plasmid library is difficult to master, and the size of the library is difficult to approach the size that can be achieved by phage cloning technology (Huynh, T. et al., DNA Cloning, Vol I, A Practical Approach, Glover, D.M. (ed.), IRL Press, Oxford (1985), pp49-78). Second, existing vectors are poorly suited for high-level expression, with one exception (Wong, G.G., et al., Science 228:810-815 (1985)). Thus, expression in mammalian hosts has most commonly been performed previously as a means of confirming the identity of proteins encoded by genes isolated by conventional cloning methods.

Pox virus vector. Poxvirus vectors are widely used as expression vehicles for protein and antigen expression in eukaryotic cells. The ease of cloning and propagating vaccinia in various host cells has led to the widespread use of poxvirus vectors for expressing foreign proteins and as vaccine delivery vehicles (Moss, B., Science 252: 1662-7 (1991)).

Large DNA viruses are particularly useful expression vectors in the study of cellular processes because they are capable of expressing many different proteins in their native form in a variety of cell lines. Furthermore, gene products expressed in recombinant poxviruses were shown to be efficiently processed and presented with MHC class I to activate cytotoxic T cells. The gene of interest is usually cloned in a plasmid under the control of a promoter flanked by sequences homologous to non-essential regions of the virus, and this cassette is then introduced into the genome by homologous recombination. A complete set of vectors for expression, selection and detection has been designed to realize various cloning and expression strategies. However, homologous recombination is not an effective means of producing recombinant viruses when complex libraries need to be generated or when the inserted DNA is large. An alternative strategy for constructing recombinant genomes has been applied to poxviruses (Merchlinsky et al., 1992, Virology 190: 522-526; Pfleiderer et al., 1995, J. General Virology 76: 2957-2962; Scheiflinger et al., 1992, Proc. Natl. Acad.Sci.USA 89:9977-9981), herpes virus (Rixon et al., 1990, J.General Virology 71:2931-2939) and baculovirus (Ernst et al., 1994, Nucleic Acids Research 22:2855-2856) genome, the strategy relies on the direct ligation of viral DNA "arms" to an insert and subsequent rescue of infectious virus.

Poxviruses are versatile vectors in eukaryotic cell research because they are easy to construct and engineered to express high levels of foreign proteins. The broad host range of the virus allows for reliable protein expression in many cell types. Directed cloning strategies have been devised to expand the utility of poxvirus chimeras, in which they are constructed by directly ligating DNA fragments into vaccinia "arms" in vitro and transfecting this DNA mixture into cells infected with a helper virus Recombinant genomes (Merchlinsky et al., 1992, Virology 190:522-526; Scheiflinger et al., 1992, Proc. Natl. Acad. Sci. USA 89:9977-9981). This method has been used for high-level expression of foreign proteins (Pfleiderer et al., 1995, J.General Virology 76:2957-2962), and can efficiently clone fragments up to 26kb (Merchlinsky et al., 1992, Virology 190:522-526 ).

Naked vaccinia virus DNA is not infectious because such a virus cannot use the cellular transcription machinery and instead relies on its own proteins to synthesize viral RNA. Previously, temperature-sensitive conditions lethal (Merchlinsky et al., 1992, Virology 190:522-526) or non-homologous fowlpox viruses (Scheiflinger et al., 1992, Proc.Natl.Acad.Sci.USA 89:9977-9981) were Used as a helper virus for packaging. The ideal helper virus efficiently assists in the production of infectious virus from the input DNA, but does not replicate in the host cell or recombine with the vaccinia virus DNA product. For these reasons, fowl pox virus is a very useful helper virus. It can enter mammalian cells and provide the proteins required for replication of input vaccinia virus DNA. However, it does not recombine with vaccinia virus DNA and does not produce infectious fowlpox virus in mammalian cells. Therefore, it can be used at a higher multiplicity of infection (MOI).

Typically, foreign protein-coding sequences are introduced into the poxvirus genome by homologous recombination with infectious virus. In this conventional method, previously isolated foreign DNA is cloned into a transfer plasmid behind the vaccinia promoter and flanked by sequences homologous to regions of the poxvirus that are not essential for viral replication. The transfer vector is introduced into poxvirus-infected cells so that the transfer plasmid and the poxvirus genome recombine in vivo by homologous recombination. The result of homologous recombination is the transfer of foreign DNA into the viral genome.

Although conventional homologous recombination can be used to express isolated foreign DNA in poxviruses, this method does not facilitate library construction because the vast majority of recovered viruses do not acquire foreign DNA inserts. With conventional homologous recombination, recombination efficiencies are on the order of 0.1% or less. Therefore, the use of poxviral vectors is limited to the subcloning of previously isolated DNA molecules for protein expression and vaccine development.

Alternative methods utilizing directly linked vectors have been established to efficiently construct chimeric genomes in situations where homologous recombination is not amenable (Merchlinsky et al., 1992, Virology 190:522-526; Scheiflinger et al., 1992, Proc. Natl. Acad. Sci. USA. 89:9977-9981). In such a protocol, DNA from the genome is digested, ligated with the insert in vitro, and transfected into cells infected with a helper virus (Merchlinsky et al., 1992, Virology 190:522-526; Scheiflinger et al., 1992, Proc. . Natl. Acad. Sci. USA. 89:9977-9981). In one approach, the genome is digested at a single NotI site, and DNA inserts containing elements for selection or detection of chimeric genomes are ligated into genome arms (Scheiflinger et al., 1992, Proc. Natl. Acad. Sci. USA .89:9977-9981). Insertion of foreign DNA into the vaccinia virus genome using this direct ligation method has been described (Pfleiderer et al., 1995, J. General Virology 76:2957-2962).

Alternatively, the vaccinia WR genome was modified to generate vNotI/tk by removing the NotI site in the HindIII F fragment and reintroducing a NotI site proximal to the thymidine kinase gene, thus inserting a The sequence will disrupt the thymidine kinase gene, allowing drug selection to isolate chimeric genomes (Merchlinsky et al., 1992, Virology 190:522-526).

Direct ligation to the vector vNotI/tk allows efficient cloning and propagation of previously isolated DNA inserts of at least 26 kb in length (Merchlinsky et al., 1992, Virology 190:522-526). Although the large DNA fragment was efficiently cloned into the genome, the protein encoded by the DNA insert was expressed only at low levels comparable to the thymidine kinase gene, an early gene in vaccinia virus that is relatively weakly expressed . Furthermore, the DNA would insert into the NotI site in both orientations and thus might not be expressed at all. In addition, although the recombination efficiency using direct ligation is higher than that observed in conventional homologous recombination, the resulting titers are still relatively low.

Therefore, poxvirus vectors have not previously been used to identify unknown genes of interest from complex clonal populations because there are no efficient, high-titer cloning methods for poxviruses. Recently, however, the present inventors established a method for preparing recombinant poxviruses using trimolecular recombination. See WO 00/028016 (Zauderer), published May 18, 2000, which is hereby incorporated by reference in its entirety.

Trimolecular recombination is a new, efficient and high-titer method for preparing recombinant poxviruses. Using the trimolecular recombination approach in vaccinia virus, the inventors have achieved recombination efficiencies of at least 90%, two orders of magnitude higher than titers obtained by direct ligation. According to the trimolecular recombination method, the poxvirus genome is cleaved to generate two non-homologous segments or "arms". A transfer vector is prepared carrying the heterologous insert DNA flanked by regions of homology to the two poxvirus arms. Delivery of the arms and transfer vector to the recipient host cell allows the three DNA molecules to recombine in vivo. The result of recombination is the generation of a single molecule of the poxvirus genome comprising the two poxvirus arms and the insert DNA.

Summary of the invention

According to one aspect of the present invention, there is provided a method for identifying polynucleotides encoding antigen-specific immunoglobulin molecules or antigen-specific fragments thereof from a library of polynucleotides expressed in eukaryotic cells.

Also provided is a method of identifying a polynucleotide encoding an immunoglobulin molecule or fragment thereof having altered effector function.

Also provided is a method for constructing a polynucleotide library encoding immunoglobulin subunit polypeptides in eukaryotic cells using viral vectors, wherein the library is constructed by a three-molecule recombination method.

Further provided is a method of identifying a host cell expressing an antigen-specific immunoglobulin molecule or antigen-specific fragment thereof on its surface by detection of antigen-induced cell death, antigen-induced signaling, or antigen-specific binding for selection and/or screening.

Also provided is a method for screening soluble immunoglobulin molecules or antigen-specific fragments thereof expressed by eukaryotic host cells expressing polynucleotide libraries encoding soluble secreted immunoglobulin molecules by antigen binding or By detecting the antigenic or organism specific function of said immunoglobulin molecule.

Brief description of the drawings

Figure 1: Selection of specific human antibodies by antigen-induced apoptosis.

Figure 2A: Preparation of host cells that directly or indirectly undergo cell death in response to antigenic crosslinking of surface immunoglobulins.

Figure 2B: Demonstration of modified CH33 host cells engineered to undergo CTL-induced lysis or cell death upon antigen cross-linking of surface immunoglobulins.

Figure 3: Construction of pVHE.

Figure 4: Construction of pVKE and pVLE.

Figure 5: Selection of specific human antibodies by antigen-dependent attachment.

Figure 6: Schematic representation of the tripartite recombination method.

Figure 7: Nucleotide sequences of the p7.5/tk and pEL/tk promoters. This figure shows the nucleotide sequence of the promoter and the beginning of the thymidine kinase gene (SEQ ID NO: 140 for V7.5/tk; SEQ ID NO: 142 for VEL/tk ), and the corresponding amino acid sequences including the initiation codon and part of the open reading frame, here named as SEQ ID NO: 141 and SEQ ID NO: 143.

Figure 8: Construction of pVHEs.

Figure 9: Attenuation of poxvirus-mediated cytopathic effects.

Figure 10: Construction of scFv expression vector.

Figure 11: Construction of pVHE-X-G1.

Figure 12A: A modification of the nucleotide sequence of the p7.5/tk vaccinia transfer plasmid (SEQ ID NO: 1). A new vector p7.5/ATGO/tk (SEQ ID NO: 2) derived from the p7.5/tk vaccinia transfer plasmid as described in the text.

Figure 12B: New vector p7.5/ATG1/tk (SEQ ID NO: 3) derived from the p7.5/tk vaccinia transfer plasmid as described in the text.

Figure 12C: New vector p7.5/ATG2/tk (SEQ ID NO: 4) derived from the p7.5/tk vaccinia transfer plasmid as described in the text.

Figure 12D: New vector p7.5/ATG3/tk (SEQ ID NO: 5) derived from the p7.5/tk vaccinia transfer plasmid as described in the text.

Figure 13: Construction of IgM-Fas fusion products.

Figure 14: Expression of Igα and Igβ in transfected COS7 and HeLaS3 cell lines. Total RNA isolated from (A) COS7-Igαβ-1, (B) COS7-Igαβ-2, (C) HeLaS3-Igαβ-1, (D) EBV-transformed human B cells in the presence or absence of reverse transcriptase The case was reverse transcribed into cDNA, followed by PCR amplification with the igα5'/igα3' and igβ5'/igβ3' primer sets. PCR products were then analyzed on a 0.8% agarose gel. It should be noted that human B cells display alternative splicing patterns for both Igα and Igβ. See, eg, Hashimoto, S. et al., Mol. Immunol. 32:651 (1995).

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

The present invention broadly relates to methods of identifying and/or producing functional, antigen-specific immunoglobulin molecules or antigen-specific fragments thereof (ie, antigen-binding fragments) in eukaryotic systems. Furthermore, the present invention relates to a method for identifying polynucleotides encoding antigen-specific immunoglobulin molecules or fragments thereof from a complex expression library of polynucleotides encoding these immunoglobulin molecules or fragments thereof, wherein said library is in Constructed and expressed in eukaryotic host cells. Additional embodiments include isolated antigen-specific immunoglobulin molecules or antigen-specific fragments thereof prepared by any of the methods described above, as well as kits that enable the preparation of such isolated immunoglobulins.

A particularly preferred aspect of the invention is the use of poxvirus vectors constructed by trimolecular recombination to construct complex immunoglobulin libraries in eukaryotic host cells. The ability to construct complex cDNA libraries in poxvirus-based vectors, and to select and/or screen specific recombinants for antigen-induced cell death, antigen-induced signaling, or antigen-specific binding, may serve as a valuable tool in eukaryotic cells. Basis for the identification of immunoglobulins, especially human immunoglobulins, which have many well-defined specificities. It overcomes bias in selection of antibody repertoires in rodents, or limitations of synthesis and assembly in phage or bacteria.

It should be mentioned that the term "a" or "an" means "one or more"; for example, "an immunoglobulin molecule" is understood to mean one or more immunoglobulin molecules. Accordingly, the terms "a", "one or more" and "at least one" are used interchangeably herein.

The terms "eukaryote" or "eukaryotic organism" are meant to encompass all organisms in the kingdoms of animals, plants and protists, including protozoa, fungi, yeast, green algae, unicellular plants, multicellular Plants and all animals, including vertebrates and invertebrates. The term excludes bacteria and viruses. "Eukaryotic cell" is meant to include a single "eukaryotic cell" as well as a plurality of "eukaryotic cells" and encompasses cells from eukaryotic organisms.

The term "vertebrate" is meant to cover a single "vertebrate" as well as a plurality of "vertebrates", including mammals and birds, as well as fish, reptiles and amphibians.

The term "mammal" is meant to encompass a single "mammal" as well as a plurality of "mammals", including but not limited to humans; primates such as apes, monkeys, orangutans and chimpanzees; canidae such as dogs and wolves; felines such as cats , lions and tigers; equines such as horses, donkeys and zebras; food animals such as cattle, pigs and sheep; ungulates such as deer and giraffes; rodents such as mice, rats, hamsters and guinea pigs; and bears. Preferably, said mammal is a human.

The terms "tissue culture" or "cell culture" or "culture" refer to the in vitro maintenance or growth of plant or animal tissue or cells under conditions that preserve cellular structure, cellular function, further differentiation, or all three. "Primary tissue cells" are those cells taken directly from a tissue, ie, a homogeneous population of cells that performs the same function in an organism. Treatment of such tissue cells with the proteolytic enzyme trypsin dissociates them into individual primary tissue cells that grow or maintain cellularity when seeded on culture plates. Cell cultures derived from the proliferation of primary cells in tissue culture are referred to as "secondary cell cultures". Most secondary cells divide a limited number of times and then die. But a small number of secondary cells can pass this "dangerous period," after which they can proliferate indefinitely to form continuing "cell lines." The liquid culture medium in which cells are cultured is referred to herein as "culture medium" or "culture medium". The medium into which molecules of interest, such as immunoglobulin molecules, are secreted during cell culture is referred to herein as "conditioned medium".

The term "polynucleotide" refers to any one or more nucleic acid segments, or nucleic acid molecules, such as DNA or RNA segments, present in a nucleic acid or construct. A "polynucleotide encoding an immunoglobulin subunit polypeptide" refers to a polynucleotide comprising the coding region for the polypeptide. In addition, polynucleotides may encode regulatory elements, such as promoters or transcription terminators, or may encode specific elements of a polypeptide or protein, such as secretion signal peptides or functional domains.

As used herein, the term "identification" refers to a method by which a molecule of interest, such as a polynucleotide encoding an immunoglobulin molecule having a desired specificity or function, can be distinguished from a population or library of such molecules come out. Identification methods include "selection" and "screening". As used herein, "selection" methods are those that allow the isolation of a molecule of interest directly from a library. For example, in one selection method described herein, host cells containing the polynucleotide of interest are released from the matrix by a single hydrolysis, while cells containing other polynucleotides in the library remain attached, thereby directly separating them. As used herein, "screening" methods are those in which a pool containing the molecule of interest is subjected to an assay that detects the molecule of interest. The one pool in which the molecule was detected is then subjected to similar analysis into progressively smaller pools until a pool highly enriched in the molecule of interest is obtained. For example, in one screening method described herein, a pool of host cells comprising a library of polynucleotides encoding immunoglobulin molecules is assayed for antigen binding by expressing a reporter molecule.

Immunoglobulin. As used herein, an "immunoglobulin molecule" is defined as a complete bimolecular immunoglobulin, ie generally comprising four "subunit polypeptides", ie two identical heavy chains and two identical light chains. In some cases, eg, immunoglobulin molecules derived from camelid species or engineered on the basis of camelid immunoglobulins, complete immunoglobulin molecules may consist of heavy chains only, with no light chains. See, eg, Hamers-Casterman et al., Nature 363:446-448 (1993). Thus "immunoglobulin subunit polypeptide" refers to either a single heavy chain polypeptide or a single light chain polypeptide. Immunoglobulin molecules may also be referred to as "antibodies," and the terms are used interchangeably herein. "Isolated immunoglobulin" refers to one immunoglobulin molecule, or two or more immunoglobulin molecules, which are substantially separated from their surroundings of proteins and other substances and which are capable of binding a specific antigen.

The heavy chain, which determines the "class" of the immunoglobulin molecule, is the larger of the two subunit polypeptides and contains variable and constant regions. "Heavy chain" refers to the secreted full-length heavy chain form, ie, the form released from the cell, or the membrane-bound heavy chain form, ie, comprising a transmembrane domain and an intracellular domain. The transmembrane and intracellular domains may be naturally occurring domains associated with a heavy chain, i.e. domains found in memory B cells, or it may be heterologous transmembrane and intracellular domains, e.g. from different species The immunoglobulins can be derived from heterologous polypeptides, that is, non-immunoglobulin polypeptides. It will be apparent that certain aspects of the invention are preferably practiced using cell membrane-associated immunoglobulin molecules, while other aspects are preferably practiced using secreted immunoglobulin molecules (ie, those lacking transmembrane and intracellular domains). Immunoglobulin "classes" refer to the large group of immunoglobulins that perform different functions in the host. For example, human immunoglobulins can be divided into five classes, namely IgG (containing gamma heavy chains), IgM (containing μ heavy chains), IgA (containing alpha heavy chains), IgE (containing ε heavy chains) and IgD (containing delta heavy chains). ). Certain classes of immunoglobulins are further divided into "subclasses." For example, in humans there are four different IgG subclasses, IgG1, IgG2, IgG3, and IgG4, which include γ-1, γ-2, γ-3, and γ-4 heavy chains, respectively, and two different IgA subclasses. class, ie, IgA-1 and IgA-2, which include the alpha-1 and alpha-2 heavy chains, respectively. It should be mentioned that the class and subclass designations of immunoglobulins vary between animal species and that certain animal species may include additional classes of immunoglobulins. Birds, for example, also produce IgY contained in egg yolks.

"Light chain" refers to the smaller immunoglobulin subunit joined to the amino-terminal region of a heavy chain. Like heavy chains, light chains include variable and constant regions. There are two different light chains, kappa and lambda, and a pair of such light chains can combine with any pair of heavy chains to form an immunoglobulin molecule.

Immunoglobulin subunit polypeptides each include constant and variable regions. In most species, the variable region of the heavy chain, or _VH domain, and the variable region of the light chain, or _VL domain, combine to form "complementarity determining regions" or CDRs, which are specific antigen-recognizing domains in immunoglobulin molecules. part of the epitope. In camelid species, however, the heavy chain variable region, termed _VHH , constitutes the entire CDR. The main differences between camelid _VHH variable domains and variable domains ( _VH ) from conventional antibodies include (a) the light chain contact surface of _VH has more hydrophobic amino acids than the corresponding region in _VHH , (b) The CDR3 of _VHH is longer, and (c) there is often a disulfide bond between CDR1 and CDR3 in _VHH . Each complete immunoglobulin molecule contains two identical CDRs. During the differentiation of antibody-producing cells in animals, a series of rearrangements of germline DNA segments lead to the formation of a gene encoding a specific variable region, which can produce a large variable region associated with the heavy and light chain constant regions pool. Additional changes in the variable regions of the heavy and light chains can be achieved by somatic mutation in differentiated cells. The structure and in vivo formation of immunoglobulin molecules are well known to those of ordinary skill in the art of immunology. A concise review of the generation of immunoglobulin diversity can be found, for example, in Harlow and Lane, Antibodies, A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1988) (hereinafter "Harlow"); and Roitt et al., Immunology Gower Medical Publishing, Ltd., London (1985) (hereinafter referred to as "Roitt"). Harlow and Roitt are hereby incorporated by reference in their entirety.

Immunoglobulins additionally have a number of effector functions mediated by binding to effector molecules. For example, binding of the C1 component of complement to immunoglobulins activates the complement system. Activation of complement is important for opsonization and lysis of cellular pathogens. Activation of complement can also stimulate inflammatory responses and may also be involved in autoimmune hypersensitivity. In addition, through the Fc region, the Fc receptor site on the antibody Fc region binds to the Fc receptor (FcR) on the cell, thereby allowing the immunoglobulin to bind to the cell. There are a number of Fc receptors specific for different classes of antibodies, including, but not limited to, IgG (gamma receptors), IgE (η receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibodies to Fc receptors on the cell surface triggers a number of important and distinct biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, and lysis of antibody-coated target cells by killer cells (termed antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transport and regulation of immunoglobulin production.

The immunoglobulins of the invention may be from any animal source, including birds, fish and mammals. Preferably, the antibody is of human, mouse, dog, cat, rabbit, goat, guinea pig, camel, llama, horse or chicken origin. In a preferred aspect of the invention, immunoglobulins that specifically interact with "self" antigens are identified, eg human immunoglobulins that specifically bind human antigens.

As used herein, an "antigen-specific fragment" of an immunoglobulin molecule is any fragment or variant of an immunoglobulin molecule that retains the ability to bind antigen. Antigen-specific fragments include, but are not limited to, Fab, Fab' and F(ab') ₂ , Fd, single chain Fvs (scFvs), single chain immunoglobulins (e.g., heavy chain or portion thereof fused to light chain or portion thereof), together), disulfide-linked Fvs (sdFvs), diabodies, triabodies, tetrabodies, scFvs minibodies, Fab minibodies and Dimeric scFvs and any other fragments comprising _VL and _VH domains in a conformation capable of forming specific CDRs. Antigen-specific fragments may also contain _VHH domains derived from camel id antibodies. Wherein the _VHH can be engineered to include CDRs from other species, eg from human antibodies. Alternatively, the human heavy chain _VH segment can be engineered to resemble the single chain camelid CDRs, a process known as "camelization". See, eg, Davies J. and Riechmann, L., FEBS Letters 339:285-290 (1994) and Riechmann, L. and Muyldermans, S., J. Immunol. Meth. 231:25-38 (1999), both Articles are hereby incorporated by reference in their entirety.

Antigen-specific immunoglobulin fragments (including single-chain immunoglobulins), which may contain variable regions only or in combination with whole or part of: heavy chain constant domains or parts thereof, e.g. CH1, CH2 on heavy chains, CH3, a transmembrane and/or cytoplasmic domain; and a light chain constant region, such as a CK or Cλ domain, or a portion on a light chain. Also included in the invention are variable regions and any combination of CH1, CH2, CH3, _CK , _Cλ , transmembrane and cytoplasmic domains.

It is well known in the art that Fv includes VH domain and VL domain, Fab includes VH and L chains connected to CH1, and Fab minibody includes fusion of CH3 domain and Fab, etc.

It is well known in the art that scFvs comprise a VH linked to a VL by a peptide linker typically 15-20 residues in length, diabodies comprise scFvs with a peptide linker of approximately 5 residues in length, triabodies ) contains scFv without a peptide linker, tetrabodies contain scFv with a 1-residue long peptide linker, scFv minibodies contain scFv fused to a CH3 domain, and dimeric scFv contain scFv utilizing Two scFv fusions in tandem with another peptide linker (reviewed in Chames and Baty, FEMS Microbiol. Letts. 189:1-8 (2000)). Preferably, said antigen-specific immunoglobulin fragment comprises two antigen-binding domains, _VH and _VL . Other immunoglobulin fragments are known in the art and are disclosed in references such as those described herein.

In certain embodiments, the invention relates to methods of identifying (i.e., selecting or screening) polynucleotides that individually or collectively encode antigen-specific immunoglobulin molecules, antigen-specific fragments thereof, or have specific antigen-specific Immunoglobulin molecules or fragments of related function. In a related embodiment, the invention relates to isolated immunoglobulin molecules encoded by polynucleotides identified by these methods.

Preferred methods involve a two-step screening and/or selection process. In a first step, by introducing a library of polynucleotides encoding a first immunoglobulin subunit into a population of eukaryotic host cells, and expressing said subunit together with one or more second immunoglobulin subunits, thereby A polynucleotide encoding a first immunoglobulin subunit (i.e., heavy chain or light chain) is identified from the library, where the second immunoglobulin subunit is different from the first immunoglobulin subunit, i.e. if the first Where the immunoglobulin subunit is a heavy chain polypeptide, the second immunoglobulin subunit is a light chain polypeptide.

Once one or more polynucleotides encoding one or more first immunoglobulin subunits have been isolated from the library in the first step, the second immunoglobulin subunit is identified in a second step. transferring and expressing the isolated polynucleotide encoding the isolated first immunoglobulin subunit into a host cell in which a library of polynucleotides encoding the second immunoglobulin subunit is expressed such that the identification of A polynucleotide encoding a second immunoglobulin subunit that, when bound to the first immunoglobulin subunit identified in the first step, forms a specific antigen-recognizing and/or Functional immunoglobulin molecules or fragments thereof that perform specific functions.

When the immunoglobulin fragment consists of only one polypeptide (i.e. a single-chain fragment or a fragment comprising a _VHH domain), and thus is encoded by a polynucleotide, the preferred method involves a one-step screening and/or selection process . identifying polynucleotides encoding single-stranded fragments from the library by introducing the library into host cells, such as eukaryotic cells, and recovering from these host cells polynucleotides encoding immunoglobulin fragments in the library, Wherein said single chain fragment comprises a heavy chain variable region and a light chain variable region, or comprises a _VHH region.

In certain embodiments, specific immunoglobulin molecules are identified by contacting host cells expressing immunoglobulin molecules on their surface with the antigen, which allows selection and/or screening of the antigen in a number of different ways as described below Combined cells. In other embodiments, the desired soluble secreted immunoglobulin molecule can be identified by assaying the conditioned media pool for a desired functional characteristic of the immunoglobulin molecule (eg, virus neutralization).

In the case of an immunoglobulin molecule bound to the surface of a host cell, the first step comprises introducing into the a host cell population capable of expressing said immunoglobulin molecule; introducing into the same host cell a second polynucleotide library encoding a second immunoglobulin subunit polypeptide population operably linked to a transcriptional regulatory region; expressing immunoglobulin molecules or antigen-specific fragments thereof on the surface of said host cells; contacting the host cells with the antigen, and recovering polynucleotides from the first library from those host cells that bind the antigen.

In the case of complete secretion of the immunoglobulin molecule into the cell culture medium, the first step involves introducing into the A host cell population capable of expressing said immunoglobulin molecule; introducing into the same host cell a second polynucleotide library encoding a second immunoglobulin subunit polypeptide population and operably linked to a transcriptional regulatory region; Immunoglobulin molecules, or antigen-specific fragments thereof, are secreted and secreted into cell culture media; samples of conditioned media are assayed for desired antigen-associated antibody function; and samples grown in conditions under which the desired function is observed The polynucleotides from the first library are recovered within the host cells in culture.

As used herein, a "library" is a representative species of polynucleotides, i.e. a population of polynucleotides that are related, for example, from the same animal species, tissue type, organ or cell type, wherein said library collectively comprises the given at least two different species within a given polynucleotide genus. Preferably the polynucleotide library comprises at least ¹⁰ , 100, 10 ³ , 10 ⁴ , 10 5 , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ different species within a given polynucleotide genus. More specifically, the libraries of the invention encode a plurality of certain immunoglobulin subunit polypeptides, either heavy chain subunit polypeptides or light chain subunit polypeptides. As used herein, a "library" of the present invention comprises polynucleotides that share a common attribute, that is, polynucleotides encoding immunoglobulin subunit polypeptides of a particular type and class. For example, the library may encode human mu, gamma-1, gamma-2, gamma-3, gamma-4, alpha-1, alpha-2, epsilon or delta heavy chains, or human kappa or lambda light chains. Although the members of any one library of the invention encode the same heavy or light chain constant region, the library as a whole comprises at least 2, preferably at least 10, 100, 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ Or ¹⁰⁹ different variable domains, ie multiple variable domains related to a common constant domain.

In other embodiments, the library encodes a plurality of immunoglobulin single chain fragments comprising variable regions, such as light chain variable regions or heavy chain variable regions, preferably both light chain variable regions and heavy chains variable region. Optionally, such libraries comprise polynucleotides encoding a certain type and class of immunoglobulin subunit polypeptides or domains thereof.

One aspect of the invention encompasses methods of making a library of polynucleotides encoding immunoglobulin subunits. Furthermore, the present invention encompasses libraries of immunoglobulin subunits constructed in eukaryotic expression vectors according to the methods described herein. Preferably such libraries are prepared in eukaryotic viral vectors, more preferably poxviral vectors. Such methods and libraries are described herein.

"Recipient cell" or "host cell" or "cell" refers to a cell or population of cells into which a polynucleotide library of the present invention has been introduced. The host cells of the invention are preferably eukaryotic cells or cell lines, preferably plant, animal, vertebrate, mammalian, rodent, mouse, primate or human cells or cell lines. "Host cell population" refers to a group of cultured cells into which the "library" of the present invention can be introduced and expressed. Any host cell that supports expression of a given library constructed in a given vector is included. Suitable and preferred host cells are disclosed herein. Furthermore, specific host cells are disclosed herein which are preferably used with specific vectors or specific selection and/or screening protocols. While it is preferred that the population of host cells is a monoculture, ie, each cell in the population is of the same cell type, mixed cultures of cells are also contemplated. The host cells of the present invention may be attached, ie, host cells grown on a solid substrate, or the host cells may be grown in suspension. Host cells can be cells derived from primary tumors, cells derived from metastases, primary cells, cells that have lost contact inhibition, transformed primary cells, immortalized primary cells, cells that may have undergone apoptosis, and Cell lines derived from these cells.

As mentioned above, a preferred method of identifying immunoglobulin molecules involves introducing a first library of polynucleotides into a population of host cells, and introducing a second library of polynucleotides into the same population of host cells. The first and second libraries are complementary, i.e. if the first library encodes immunoglobulin heavy chains, the second library encodes immunoglobulin light chains so that immunoglobulin molecules or their Antigen-specific fragments. Also as mentioned above, another method of identifying immunoglobulins or immunoglobulin fragments involves introducing a single library of polynucleotides encoding single-stranded fragments into a population of host cells. Thus descriptions of libraries of polynucleotides, the composition of the polynucleotides in the library, and the polypeptides encoded by these polynucleotides encompass the polynucleotides comprising the first library and the polynucleotides comprising the second library, as well as the polypeptides encoded by them. peptide. These libraries can be constructed in any suitable vector, and both libraries can, but need not, be constructed in the same vector. Suitable and preferred vectors for the first and second libraries are disclosed below.

The polynucleotides contained in the library of the present invention encode immunoglobulin subunit polypeptides by being "operably linked to" a transcriptional regulatory region. One or more nucleic acid molecules in a given polynucleotide are "operably linked" when they are in a functional relationship. Such a relationship may exist between the coding region of the polypeptide and the regulatory sequences linked in such a way that when an appropriate molecule (eg, a transcriptional activator protein, polymerase, etc.) binds to the regulatory sequence, the coding region will be expressed. A "transcriptional regulatory region" includes, but is not limited to, a promoter, enhancer, operator, and transcriptional termination signal, and which is present with a polynucleotide to direct its transcription. For example, a promoter is operably linked to a nucleic acid molecule encoding an immunoglobulin subunit polypeptide if the promoter affects the transcription of the nucleic acid molecule. Generally, "operably linked" means that DNA sequences in a polynucleotide are contiguous or closely linked together. However, certain transcriptional regulatory regions, such as enhancers, are not necessarily contiguous.

"Regulatory sequences" or "regulatory regions" refer to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. Regulatory sequences suitable for use in prokaryotes include, for example, a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals and enhancers.

Various transcriptional regulatory regions are known to those skilled in the art. Preferred transcriptional regulatory regions include those capable of functioning in vertebrate cells, such as, but not limited to, those derived from poxviruses, adenoviruses, herpesviruses, e.g. Contain A), simian virus 40 (preferably early promoter), retroviruses (such as Rous sarcoma virus) and picornaviruses (especially the internal ribosome entry site or IRES, enhancer region, also referred to herein as CITE sequence) promoter and enhancer sequences. Other preferred transcriptional regulatory regions include those derived from mammalian genes, such as actin, heat shock protein, and bovine growth hormone, and other sequences that control gene expression in eukaryotic cells. Additional suitable transcriptional regulatory regions include tissue-specific promoters and enhancers, as well as inducible promoters (eg, promoters inducible by tetracycline, and temperature-sensitive promoters). Particularly preferred are promoters capable of functioning in the cytoplasm of poxvirus-infected cells, as discussed in detail below.

In certain preferred embodiments, each "immunoglobulin subunit polypeptide" (ie, "first immunoglobulin subunit polypeptide" or "second immunoglobulin subunit polypeptide") comprises (i) a heavy chain constant region (membrane-bound or fully secreted form of the heavy chain constant region) and the first immunoglobulin constant region of the light chain constant region, (ii) an immunoglobulin variable region corresponding to the first constant region, i.e. if said If the immunoglobulin constant region is a heavy chain constant region, then preferably the immunoglobulin variable region comprises a _VH region, and if the immunoglobulin constant region is a light chain variable region, preferably the immunoglobulin constant region comprises a _VL region, and (iii) a signal peptide capable of directing transport of an immunoglobulin subunit polypeptide across the membrane of the endoplasmic reticulum and the plasma membrane of a host cell, wherein the immunoglobulin subunit polypeptide is a membrane-bound or fully secreted heavy chain, or is linked to The light chain of the heavy chain. Thus, either a surface immunoglobulin molecule or a fully secreted immunoglobulin molecule can be formed by the mutual association of two identical heavy chains and two identical light chains.

In certain preferred embodiments regarding immunoglobulin fragments, the single chain fragment comprises an immunoglobulin variable region selected from a heavy chain variable region and a light chain variable region, preferably comprising both variable regions. If the immunoglobulin fragments include both heavy and light chain variable regions, they may be joined directly (ie, they have no peptide or other kind of linker), or linked by other means. If they are otherwise linked, as described below, they may be linked directly, or via disulfide bonds formed during expression, or via a peptide linker. Accordingly, the CDRs are formed by the association of the heavy and light chain variable regions.

The heavy and light chain variable regions of one single chain fragment can be associated with each other, or the heavy chain variable region of one single chain fragment can be associated with the light chain variable region of another single chain fragment and vice versa , depending on the type of connector. In one embodiment, said single chain fragment may further comprise a constant region selected from the group consisting of a heavy chain constant region or domain thereof and a light chain constant region or domain thereof. Two single-chain fragments can be associated with each other through their constant regions.

As mentioned above, in certain embodiments, the polynucleotide encoding the light chain variable region and the heavy chain variable region of the single chain fragment also encodes a linker. The single chain fragment may comprise a single polypeptide having a _VH -linker- _VL or _VL -linker- _VH sequence. In some embodiments, the linker is selected such that the heavy and light chains of the single chain fragments are brought together in the proper conformational orientation. See, eg, Huston, JS et al., Methods in Enzym. 203:46-121 (1991). Thus in these embodiments, the linker should be able to span the 3.5 nm distance between its fusion point with the variable region without distorting the native Fv conformation. In these embodiments, the amino acid residues comprising the linker are capable of spanning this distance and should be 5 amino acids or longer. Single-chain fragments with a 5-amino acid linker can exist as monomers, but mainly as dimers. Preferably, the linker is at least about 10 or at least 15 residues long. In other embodiments, the length of the linker is chosen to promote the formation of scFv tetramers (tetramers), which are 1 amino acid long. In some embodiments, the variable regions are directly linked (ie, the single-chain fragments do not contain peptide linkers) so as to facilitate the formation of scFv trimers (trimers). These changes are well known in the art (see, eg, Chames and Baty, FEMS Microbiol. Letts. 189:1-8 (2000)). The linker should not be so long as to cause steric interference with the binding site. Thus, preferably linkers are about 25 residues in length or less.

The amino acids of the peptide linker are preferably selected such that the linker is hydrophilic so that it will not be buried in the antibody. The linker (Gly-Gly-Gly-Gly-Ser) ₃ (SEQ ID NO: 6) is a widely used preferred linker for many antibodies because it provides sufficient flexibility. Other linkers include Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly GlySer (SEQ ID NO: 7), Glu Gly Lys Ser Ser Gly Ser Gly Ser GluSer Lys Ser Thr (SEQ ID NO: 8), Glu Gly Lys Ser Ser Gly SerGly Ser Glu Ser Lys Ser Thr Gln (SEQ ID NO: 9), Glu Gly LysSer Ser Gly Ser Gly Ser Glu Ser Lys Val Asp (SEQ ID NO: 10), Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly LysGly (SEQ ID NO: 11), Lys Glu Ser Gly Ser Val Ser Ser Glu GlnLeu Ala Gln Phe Arg Ser Leu Asp (SEQ ID NO: 12), and Glu SerGly Ser Val Ser Ser Glu Glu Leu Ala Phe Arg Ser Leu Asp (SEQ ID NO: 13). Alternatively, the linker such as (Gly-Gly-Gly-Gly-Ser) 3 (SEQ ID NO: 6) is mutagenized, or the amino acids in the linker are randomized, and the band is screened or selected using a phage display vector or the method of the present invention. Of the antibodies with different linkers that have the highest avidity or have the greatest impact on the phenotype, of course any sequence can be used. Examples of shorter linkers include fragments of the above linkers, and examples of long linkers include combinations of the above linkers, combinations of fragments of the above linkers, and combinations of the above linkers and linker fragments.

Also preferred are those immunoglobulin subunit polypeptides that are variants or fragments of the immunoglobulin subunit polypeptides described above. Any variant or fragment that produces an antigen-binding fragment of an immunoglobulin molecule is contemplated. Such variants may become attached to the host cell surface, for example, by association with a native transmembrane domain, receptor-ligand interaction, or fusion with a heterologous transmembrane domain, or may be secreted into the cell culture medium. Examples of antigen-binding fragments of immunoglobulin molecules are described herein.

In those embodiments wherein the immunoglobulin subunit polypeptide comprises a heavy chain polypeptide, any immunoglobulin heavy chain from any animal species is contemplated. Suitable and preferred immunoglobulin heavy chains are described herein. The immunoglobulin heavy chains include heavy chains from vertebrates such as birds (especially chickens), fish and mammals, with mammalian immunoglobulin heavy chains being preferred. Examples of heavy immunoglobulin chains include human, mouse, dog, cat, horse, goat, rat, sheep, bovine, pig, guinea pig, camel, llama and hamster immunoglobulin heavy chains. Among these, human immunoglobulin heavy chains are especially preferred. Also contemplated are hybrid immunoglobulin heavy chains comprising heavy chain portions from one or more species, such as mouse/human hybrid immunoglobulin heavy chains, or "camelized" human immunoglobulins heavy chain. For human immunoglobulin heavy chains, it is preferred that the immunoglobulin heavy chains of the present invention are selected from the group consisting of mu heavy chains (i.e. heavy chains of IgM immunoglobulins), gamma-1 heavy chains (i.e. IgG1 immunoglobulins) protein heavy chain), γ-2 heavy chain (i.e. IgG2 immunoglobulin heavy chain), γ-3 heavy chain (i.e. IgG3 immunoglobulin heavy chain), γ-4 heavy chain (i.e. IgG4 immunoglobulin heavy chain), α-1 heavy chain (that is, the heavy chain of IgA1 immunoglobulin), α-2 heavy chain (that is, the heavy chain of IgA2 immunoglobulin), ε heavy chain (that is, the heavy chain of IgE immunoglobulin), and the delta heavy chain (ie, the heavy chain of an IgD immunoglobulin). In certain embodiments, preferred immunoglobulin heavy chains include human mu, gamma-1, gamma-2, gamma-3, gamma-4, alpha-1, alpha-2, epsilon and delta heavy chains in membrane bound form. chain. Particularly preferred is the human mu heavy chain in membrane bound form.

Membrane-bound forms of immunoglobulins are usually anchored to the cell surface by a transmembrane domain, the transmembrane region of which constitutes part of the heavy chain polypeptide through alternative transcriptional termination and splicing of the heavy chain messenger RNA. See eg pages 9 and 10 of Roitt. "Transmembrane domain," "transmembrane region," or related terms interchangeably, refers to the portion of a heavy chain polypeptide that is anchored to the cell membrane. Typical transmembrane domains contain hydrophobic amino acids, which are discussed in more detail below. "Intracellular domain", "cytoplasmic domain" or interchangeably related terms refer to those parts of a polypeptide that are intracellular, as distinct from those parts that are either anchored to the cell membrane or exposed on the cell surface. The membrane-bound form of an immunoglobulin heavy chain polypeptide usually comprises a very short cytoplasmic domain of approximately three amino acids. The membrane-bound forms of immunoglobulin heavy chain polypeptides of the invention preferably comprise the transmembrane and intracellular domains normally associated with such immunoglobulin heavy chains, for example the transmembrane and domains associated with mu and delta heavy chains in pre-B cells. The intracellular domain, or the transmembrane and intracellular domain associated with any immunoglobulin heavy chain in B memory cells. However, it is also contemplated that heterologous transmembrane and intracellular domains are associated with a given immunoglobulin heavy chain polypeptide, eg the transmembrane and intracellular domains of a mu heavy chain may be associated with the extracellular portion of a gamma heavy chain. Alternatively, transmembrane and/or cytoplasmic domains of entirely heterologous polypeptides, such as those of major histocompatibility molecules, cell surface receptors, viral surface proteins, chimeric domains or synthetic domain.

In those embodiments wherein the immunoglobulin subunit polypeptide comprises a light chain polypeptide, any immunoglobulin light chain from any animal species is contemplated. Suitable and preferred immunoglobulin light chains are described herein. Said immunoglobulin light chains include light chains from vertebrates such as birds (especially chickens), fish and mammals, with mammalian immunoglobulin light chains being preferred. Examples of immunoglobulin light chains include human, mouse, dog, cat, horse, goat, rat, sheep, bovine, porcine, guinea pig and hamster immunoglobulin light chains. Among these, human immunoglobulin light chains are especially preferred. Also contemplated are hybrid immunoglobulin light chains comprising portions of light chains from one or more species, such as mouse/human hybrid immunoglobulin light chains. Preferred immunoglobulin light chains include human kappa and lambda light chains. Any pair of light chains can join the same pair of heavy chains to form an immunoglobulin molecule, which has a characteristic _H2L2 structure, which is _well known to those of ordinary skill in the art.

According to a preferred aspect of the present invention, each member of the polynucleotide library described herein (eg, the first polynucleotide library or the second polynucleotide library) comprises (a) encoding an immunoglobulin common to all members of the library A first nucleic acid molecule for a protein constant region, and (b) a second nucleic acid molecule encoding an immunoglobulin variable region, wherein the second nucleic acid molecule is upstream and in-frame with the first nucleic acid molecule. Accordingly, the immunoglobulin subunit polypeptides encoded by each member of the polynucleotide library of the invention (i.e., the immunoglobulin light or heavy chain encoded by such polynucleotides) preferably comprise Associated immunoglobulin constant regions.

The constant region of the light chain encoded by the "first nucleic acid molecule" comprises about half of the subunit polypeptide and is located at the C-terminus, ie in the second half of the light chain polypeptide. The light chain constant region, referred to herein as the _CL constant region, or more specifically the _CK constant region or _Cλ constant region, comprises approximately 110 amino acids held in a "loop" by interchain disulfide bonds.

The constant region of the heavy chain encoded by the "first nucleic acid molecule" comprises three quarters or more of the subunit polypeptide and is located at the C-terminus, that is, in the second half of the heavy chain polypeptide. The heavy chain constant region, referred to herein as the _CH constant region, comprises 3 or 4 peptide loops or "domains" of approximately 110 amino acids, each closed by an interchain disulfide bond. More specifically, the heavy chain constant region of a human immunoglobulin includes a Cμ constant region, a Cδ constant region, a Cγ constant region, a Cα constant region and a Cε constant region. Cγ, Cα, and Cδ heavy chains each contain 3 constant region domains, commonly referred to as _CH1 , _CH2 , and _CH3 , while Cμ and Cε heavy chains contain 4 constant region domains, commonly referred to as _CH 1, _CH2 , _CH3 and _CH4 . Nucleic acid molecules encoding human immunoglobulin constant regions can be easily obtained from cDNA libraries obtained from, for example, human B cells or their precursors, by methods such as PCR, which are well known to those skilled in the art, the following examples There are also public.

The immunoglobulin subunit polypeptides of the invention each contain an immunoglobulin variable region encoded by a "second nucleic acid molecule". Within the polynucleotide library, each polynucleotide comprises the same constant region, but the library contains a plurality, i.e. at least 2, preferably at least 10, 100, 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ different variable regions. As is well known to those of ordinary skill in the art, light chain variable regions are encoded by rearranged nucleic acid molecules, each comprising a light chain _VL region (specifically a _Vκ region or a _Vλ region) and a light chain J region (Specifically, the _Jκ region or the _Jλ region). Similarly, heavy chain variable regions are also encoded by rearranged nucleic acid molecules, each comprising a heavy chain _VH , D, and J region. These rearrangements occur at the DNA level as cells differentiate. Nucleic acid molecules encoding the variable regions of the heavy and light chains can be obtained, eg, by PCR, from mature B cells and plasma cells that are eventually differentiated to express antibodies specific for a particular epitope. Furthermore, if antibodies directed against a particular antigen are desired, the variable regions can be isolated from mature B cells and plasma cells of animals that have been immunized with that antigen, thereby producing expanded levels of antibody variable regions capable of interacting with that antigen. Alternatively, if a more diverse library is desired, variable regions can be isolated from precursor cells, such as pre-B cells and immature B cells, in which immunoglobulin gene rearrangements have occurred but not yet exposed Give self or non-self antigens. For example, variable regions can be isolated by PCR from normal human bone marrow obtained from multiple donors. Alternatively, the variable regions may be synthetic, eg, prepared in the laboratory by generating synthetic oligonucleotides, or derived from in vitro manipulation of germline DNA, resulting in rearrangement of the immunoglobulin genes.

In addition to the first and second nucleic acid molecules encoding immunoglobulin constant and variable regions, respectively, each member of the polynucleotide library of the invention further comprises a third nucleic acid molecule encoding a signal peptide as described above, the third nucleic acid molecule directly upstream and in reading frame of the second nucleic acid molecule encoding the variable region.

"Signal peptide" refers to, for example, a polypeptide sequence capable of directing the translocation of nascent immunoglobulin polypeptide subunits to the surface of a host cell. A signal peptide may also be referred to in the art as a "signal sequence", "leader sequence", "secretion signal peptide" or "secretion signal sequence". Signal peptides are usually expressed as part of an intact or "immature" polypeptide and are generally located at the N-terminus. The common structure of signal peptides from different proteins is often described as a positively charged n-region, followed by a hydrophobic h-region and a neutral but polar c-region. In many cases, once the protein has reached its final destination, the amino acids comprising the signal peptide are cleaved to produce a "mature" form of the polypeptide. Cleavage is catalyzed by enzymes called signal peptidases. The (-3, -1) rule states that for cleavage to proceed correctly, the residues at positions -3 and -1 (relative to the cleavage site) must be small and neutral. See, eg, McGeoch, Virus Res. 3:271-286 (1985) and von Heinje, Nucleic Acids Res. 14:4683-4690 (1986).

All cells, including the host cells of the invention, possess a constitutive secretory pathway by which proteins to be exported, including secreted immunoglobulin subunit polypeptides, are secreted from the cell. These proteins pass through the ER-Golgi processing pathway, where they may be modified. If no other signal is detected on the protein, it is directed to the cell surface to be secreted. Alternatively, the immunoglobulin subunit polypeptides may ultimately be expressed as integral membrane components on the surface of the host cell. Membrane-bound forms of immunoglobulin subunit polypeptides initially follow the same pathway as the secreted form, passing through the lumen of the ER, but they remain in the ER membrane due to the presence of termination translocation signals or "transmembrane domains". The transmembrane domain is a hydrophobic stretch of approximately 20 amino acid residues that adopts an alpha-helical conformation as it spans the membrane. Membrane-embedded proteins are anchored in the phospholipid bilayer of the plasma membrane. For secreted proteins, the N-terminal region of transmembrane proteins has a signal peptide that crosses the membrane and is cleaved upon exiting the lumen of the ER. The transmembrane form of an immunoglobulin heavy chain polypeptide uses the same signal peptide as the secreted form.

The signal peptide of the present invention may be a natural immunoglobulin signal peptide, that is, encoded by a part of the sequence of the natural heavy chain or light chain transcript; A functional derivative of the ability to secrete. Alternatively, a heterologous signal peptide or a functional derivative thereof may be used. For example, the native signal peptide of an immunoglobulin subunit polypeptide can be replaced with the signal peptide of human tissue plasminogen activator or mouse β-glucuronidase.

Signal sequences, transmembrane domains, and cytoplasmic domains are known for many classes of membrane-bound proteins. These sequences can be used accordingly, i.e. either said sequences from a particular protein are used in pairs (e.g. signal sequence and transmembrane domain, or signal sequence and cytoplasmic domain, or transmembrane domain and cytoplasmic domain ), or all three together, or with each component from a different protein, or these sequences can be synthetic, derived entirely from the artificial delivery domain consensus sequence as mentioned above.

Particularly preferred signal sequences and transmembrane domains include, but are not limited to, those derived from CD8, ICAM-2, IL-8R, CD4 and LFA-1. Additional useful sequences include those derived from 1) Type I integral membrane proteins, such as the IL-2 receptor beta chain (residues 1-26 are signal sequence, 241-265 are transmembrane residues; see Hatakeyama et al., Science244: 551 (1989) and von Heijne et al., Eur.J.Biochem.174: 671 (1988) and insulin receptor beta chain (residues 1-27 are signal sequences, 957-959 are transmembrane regions, 960-1382 is the cytoplasmic domain; see Hatakeyama et al., supra, and Ebina et al., Cell40:747 (1985))); 2) Type II membrane-intrinsic proteins, such as neutral endopeptidases (residues 29-51 are transmembrane regions, 2-28 is the cytoplasmic domain; see Malfroy et al., Biochem.Biophys.Res.Commun.144:59 (1987)); 3) Type III proteins, such as human cytochrome P450 NF25 (Hatakeyama et al., supra); and 4 ) type IV proteins, such as human P-glycoprotein (Hakeyama et al., supra). In this case CD8 and ICAM-2 are especially preferred. Signal sequences such as CD8 and ICAM-2 are located at the very 5' end of the transcript. In the case of CD8, the signal sequence consists of amino acids 1-32 (Nakauchi et al., PNAS USA 82:5126 (1985)), and in the case of ICAM-2, the signal sequence consists of amino acids 1-21 (Staunton et al., Nature (London ) 339:61 (1989)). These transmembrane domains consist of amino acids 145-195 in CD8 (Nakauchi, supra) and amino acids 224-256 in ICAM-2 (Staunton, supra).

Alternatively, the membrane anchor domain includes a GPI anchor, which forms a covalent bond between the molecule and the lipid bilayer via a glycosylphosphatidylinositol bond, as in DAF (see Homans et al., Nature 333(6170): 269 -72 (1988), and Moran et al., J. Biol. Chem. 266:1250 (1991)). To achieve this, the GPI sequence from Thy-1 can be placed 3' to the immunoglobulin or immunoglobulin fragment instead of the transmembrane sequence.

Similarly, myristylation sequences can serve as membrane anchoring domains. Myristylation of c-src is known to enable its recruitment to the plasma membrane. This is a simple and effective method of membrane localization provided that the first 14 amino acid residues of the protein are fully responsible for this function (see Cross et al., Mol. Cell. Biol. 4(9) 1834 (1984); Spencer et al., Science262 : 1019-1024 (1993)). This motif has been shown to be effective for reporter gene localization and can be used to anchor the zeta chain of a TCR. This motif is placed 5' to the immunoglobulin or immunoglobulin fragment to localize the construct to the plasma membrane. Other modifications such as hexadecanoylation can be used to anchor the construct in the plasma membrane; for example, the hexadecanoylation sequence of the G protein-coupled receptor kinase GRK6 sequence (Stoffel et al., J. Biol. Chem. 269:27791 (1994)); hexadecanoylation sequence of rhodopsin (Barnstable et al., J. Mol. Neurosci. 5(3):207 (1994)); and p21H-rasl protein (Capon et al., Nature 302; 33(1983)).

In addition to first and second nucleic acid molecules encoding immunoglobulin constant and variable regions, respectively, each member of the polynucleotide library of the invention as described above may additionally comprise other nucleic acid molecules encoding heterologous polypeptides. These additional polynucleotides may be in addition to or in place of the third nucleic acid molecule encoding the signal peptide. Such additional nucleic acid molecules encoding heterologous polypeptides may be located upstream or downstream of nucleic acid molecules encoding variable chain regions or heavy chain regions.

The heterologous polypeptide encoded by the additional nucleic acid molecule can be a rescue sequence. The so-called rescue sequence is a sequence that can be used to purify or isolate immunoglobulins or their fragments or polynucleotides encoding them. Thus, for example, peptide rescue sequences include purification sequences, such as 6-His tags for Ni affinity columns, and epitope tags for detection, immunoprecipitation or FACS (fluorescence activated cell sorting). Suitable epitope tags include myc (for use with a commercially available 9E10 antibody), the BSP biotinylated target sequence of the bacterial enzyme BirA, flu tags, LacZ and GST. The additional nucleic acid molecule may also encode a peptide linker.

In a preferred embodiment, heterologous polypeptides are used in combination. Thus, for example, any number of combinations of signal, rescue and stabilization sequences may be used, with or without linker sequences. One can place various fusion polynucleotides encoding heterologous polypeptides 5' and 3' to polynucleotides encoding the immunoglobulin or fragment thereof. Those skilled in the art will understand that these sequence components can be used in many combinations and variations.

The polynucleotides contained in the first and second libraries are introduced into a suitable host cell. Suitable host cells are characterized by the ability to express immunoglobulin molecules attached to their surfaces. The polynucleotide can be introduced into host cells by methods well known to those skilled in the art. Suitable and preferred methods of introduction are disclosed herein.

It is easily understood that the introduction method differs depending on the nature of the vector used for constructing the polynucleotide library. For example, lipofection (such as with anionic liposomes (see, e.g., Felgner et al., 1987 Proc. Natl. Acad Sci. USA 84:7413), or cationic liposomes (see, e.g., Brigham, K.L. et al., Am. J Med Sci.298 (4): 278-2821 (1989); U.S. Patent 4897355 (Eppstein et al.)), electroporation, calcium phosphate precipitation (generally refer to Sambrook et al., Molecular Cloning: ALaboratory Manual, second edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989), protoplast fusion, spheroplast fusion, or the introduction of DNA plasmid vectors by the DEAE-glucan method (Sussman et al., Cell. Biol. 4:1641-1643 (1984)) Host cells. The above documents are incorporated herein by reference in their entirety.

When the method of choice is lipofection, the nucleic acid can be complexed with cationic liposomes such as DOTMA: DOPE, DOTMA, DOPE, DC-cholesterol, DOTAP, Transfectam(R) (Promega) , Tfx(R) (Promega), LipoTAXI ^(TM) (Stratagene), PerFect Lipid ^(TM) (Invitrogen), SuperFect ^(TM) (Qiagen). When the nucleic acid is transfected by anionic liposomes, the anionic liposomes can encapsulate the nucleic acid. Preferably, the DNA is introduced by liposome-mediated transfection using the manufacturer's protocol (eg for Lipofectamine; Life Technologies Incorporated).

Where the plasmid is a viral vector, introduction into the host cell is most conveniently performed by routine infection. However, in many cases, viral nucleic acid can be introduced into cells by any of the methods described above, because viral nucleic acid is "infectious", that is, after viral nucleic acid is introduced into cells, it is sufficient to make cells active without other conditions progeny virus particles. It should be mentioned, however, that certain viral nucleic acids, such as poxvirus nucleic acids, are not infectious and must therefore be introduced with additional components provided, for example by viral particles that encapsulate the viral nucleic acid, by virions that have been engineered to produce the desired cells with viral elements, or via a helper virus.

The first and second polynucleotide libraries can be introduced into the host cell in any order or simultaneously. For example, if both the first and second polynucleotide libraries are constructed in viral vectors, either infectious or inactivated, the vectors can be introduced as a mixture by simultaneous infection, or by serial infection. If one library is constructed in a viral vector and the other in a plasmid vector, it is most convenient to introduce one library and then the other.

Following introduction of the first and second polynucleotide libraries into host cells, immunoglobulin molecules or antigen-specific fragments thereof are expressed on the membrane surface of the host cells or secreted into the cell culture medium. "To express" refers to the transcription and translation of the immunoglobulin subunit polypeptide by the vector introduced into the host cell, preferably allowing the host cell to transport the fully assembled immunoglobulin molecule or its antigen-specific fragment to the membrane surface or in cell culture medium. In general, expressing requires culturing the host cell into which the polynucleotide has been introduced under suitable conditions for expression to occur. These conditions and the time required for expression vary depending on the host cell and vector chosen and are well known to those skilled in the art.

In certain embodiments, those host cells that express immunoglobulin molecules on their surface and secrete soluble immunoglobulin molecules into the cell culture medium are contacted with the antigen. As used herein, an "antigen" is any molecule capable of specifically binding to an antibody, immunoglobulin molecule, or antigen-specific fragment thereof. "Specific binding" refers to the binding of the antigen to the CDRs of the antibody. The portion of an antigen that specifically interacts with a CDR is an "epitope", or "antigenic determinant". An antigen may contain one epitope, but generally, an antigen contains at least two epitopes, and may include any number of epitopes depending on the size, conformation, and type of antigen.

Antigens are usually peptides or polypeptides, but can be any molecule or compound. For example, organic compounds such as dinitrophenol or DNP, nucleic acids, carbohydrates or any mixture of these compounds, with or without peptides or polypeptides, may be suitable antigens. The smallest peptide or polypeptide epitope is considered to be about 4 or 5 amino acids. Preferably the peptide or polypeptide epitope comprises at least 7, more preferably at least 9, most preferably between about 15 and 30 amino acids. Because CDRs can recognize antigenic peptides or polypeptides of tertiary structure, the amino acids that make up the epitope need not be contiguous, and in some cases, not even on the same peptide chain. In the present invention, the peptide or polypeptide antigen preferably contains at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 15, at least 20, at least 25 , most preferably a sequence of about 15 to 30 amino acids. Preferably the peptide or polypeptide containing or consisting of an epitope is at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 , or 100 amino acid residues. The antigen can be in any form, and can also be free, such as dissolved in a solution, or attached to any matrix. Suitable and preferred substrates are disclosed herein. In certain embodiments, as described in detail below, the antigen may be part of a presenting cell that expresses the antigen.

It will be appreciated that immunoglobulin molecules specific for any antigen may be prepared according to the methods of the invention. Preferred antigens are "self" antigens, ie antigens derived from the same species as the immunoglobulin molecule produced. As an example, it may be desirable to raise human antibodies against human tumor antigens including, but not limited to, CEA antigen, GM2 antigen, Tn antigen, sTn antigen, Thompson-Friedenreich antigen (TF), Globo H antigen, Le(y ) antigen, MUC1 antigen, MUC2 antigen, MUC3 antigen, MUC4, MUC5AC antigen, MUC5B antigen, MUC7 antigen, carcinoembryonic antigen, human chorionic gonadotropin beta chain (hCGβ) antigen, HER2/neu antigen, PSMA antigen, EGFRvIII Antigen, KSA antigen, PSA antigen, PSCA antigen, GP100 antigen, MAGE1 antigen, MAGE2 antigen, TRP1 antigen, TRP2 antigen, and tyrosinase antigen. Other "self" antigens of interest include, but are not limited to, cytokines, receptors, ligands, glycoproteins, and hormones.

The invention also includes the preparation of antibodies directed against antigens on the infectious agent. Examples of such antigens include, but are not limited to bacterial antigens, viral antigens, parasite antigens and fungal antigens. Examples of viral antigens include, but are not limited to, adenovirus antigens, alphavirus antigens, calicivirus antigens such as calicivirus capsid antigens, coronavirus antigens, canine distemper virus antigens, Ebola virus antigens, enterovirus antigens, Flavivirus antigens, hepatitis virus (A-E) antigens such as hepatitis B core or surface antigens, herpes virus antigens such as herpes simplex virus or varicella zoster virus glycoprotein antigens, immunodeficiency virus antigens such as human immunodeficiency virus envelope or protease Antigens, infectious peritonitis virus antigens, influenza virus antigens such as influenza A hemagglutinin or neuraminidase antigens, leukemia virus antigens, Marburg virus antigens, oncogenic virus antigens, orthomyxovirus antigens, papillomavirus antigens, para Influenza virus antigens such as hemagglutinin/neuraminidase antigens, paramyxovirus antigens, parvovirus antigens, pestivirus antigens, picornavirus antigens such as poliovirus capsid antigens, rabies virus antigens such as rabies virus saccharides Protein G antigen, reovirus antigen, retrovirus antigen, rotavirus antigen, and other oncogenic or cancer-associated viral antigens.

Examples of bacterial antigens include, but are not limited to, Actinomycetes antigens, Bacillus antigens, Bacteroides antigens, Bordetella antigens, Bartonella antigens, Borrelia antigens such as B. bergdorferi OspA antigens, Brucella Genus antigens, Campylobacter antigens, Capnocytobacter antigens, Chlamydia antigens, Clostridium antigens, Corynebacterium antigens, Coxella antigens, Dermatophilus antigens, Enterococcus antigens, Erie Histella antigens, Escherichia antigens, Francella antigens, Fusobacterium antigens, Hemobartonella antigens, Haemophilus antigens, e.g. Haemophilus influenzae type b outer membrane protein antigens , Helicobacter antigen, Klebsiella antigen, L-form bacterial antigen, Leptospira antigen, Listeria antigen, Mycobacterium antigen, Mycoplasma antigen, Neisseria Antigen, Neorickettsia antigen, Nocardia antigen, Pasteurella antigen, Peptococcus antigen, Peptostreptococcus antigen, Pneumococcus antigen, Proteus antigen, Pseudomonas Bacteria antigens, Rickettsia antigens, Rocali marella antigens, Salmonella antigens, Shigella antigens, Staphylococcus antigens, Streptococcus antigens, e.g. Streptococcus pyogenes M protein antigen , Treponema antigens, and Yersinia antigens, such as Yersinia pestis F1 and V antigens.

Examples of fungal antigens include, but are not limited to Absidia antigens, Acremonium antigens, Alternaria antigens, Aspergillus antigens, Rana antigens, Bipolaris antigens, Budomyces antigens, Candida Saccharomyces antigen, Coccidioides antigen, Otomycetes antigen, Cryptococcus antigen, Curvularia antigen, Epidermophyton antigen, Exophyllium antigen, Geotrichum antigen, Histoplasma Genus antigen, Mycobacterium madura antigen, Phialomyces antigen, Microsporum antigen, Moniliella antigen, Mortierella antigen, Mucor antigen, Paecilomyces antigen, Penicillium antigen, Phialemonium antigen , Phialadium Antigen, Prototheca Antigen, Pseudallescheria Antigen, Pseudomicrodochium Antigen, Pythium Antigen, Rhinosporum Antigen, Rhizopus Antigen, Scolecobasidium Antigen, Sporothrix Antigen, Puccinia Antigen, Trichophyton Antigen, Silk Saccharomyces antigen, and Xylohypha antigen.

Examples of protozoan parasite antigens include, but are not limited to, Babesia antigens, Cycloidia antigens, Besnoitia antigens, Cryptosporidium antigens, Eimeri antigensa Antigens, Encephalitozoon Antigens, Encephalitozoon Antigens, Endomoebae Antigens, Giardia Antigens, Hammondia Antigens, Hepatozoon Antigens, Isosporidia Antigens, Leishmania Antigens, Microspores Microsporidia antigen, Neospora antigen, Microspora antigen, Pentatrichomonas antigen, Plasmodium antigen, such as P.falciparum circumsporozoite (PfCSP), sporozoite surface protein 2 (PfSSP2), liver state ( liver state) antigen 1 carboxy terminus (PfLSA-1 c-term), and exporter 1 (PfExp-1) antigen, Pneumocystis antigen, Sarcocystis antigen, Schistosoma antigen , Theileria antigen, Toxoplasma antigen, and Trypanosoma antigen.

Examples of helminth parasite antigens include, but are not limited to, Acanthocheilonema antigens, Aelurostrongylus antigens, Ancylostoma antigens, Angiostrongylus antigens, Ascaris antigens, Brugia antigens, Bunostomum Antigen, Capillary Nematode Antigen, Chabertia Antigen, Cooperia Antigen, Crenosoma Antigen, Dictyocaulus Antigen, Dictyocaulus Antigen, Dioctophyme Antigen, Dipetalonema Antigen, Diphyllobothrium Antigen, Diplydium Antigen, Dirofilaria Antigen, Dracunculus Antigen, Diphyllobothrium Antigen, Filaroides Antigen, Haemonchus Antigen, Lagochilascaris Antigen, Loa Antigen, Mansonian Antigen, Muellerius Antigen, Nanophyetus Antigen , Nematode antigen, Nematodirus antigen, Nodularia antigen, Onchocercia antigen, Opisthorchis antigen, Ostertagia antigen, Parafilaria ) antigens, Paragonis antigens, Paraascaris antigens, Paleoptera antigens, Prostrongylus antigens, Setaria antigens, Spirocerca antigens, Spirometra antigens , Stephanofilaria antigen, Strongyloides antigen, Strongyloides antigen, Sucking nematodes (Thelazia) antigen, Toxascaris (Toxascaris) antigen, Toxoplasma antigen, Trichostrongylus antigen, Trichostrongylus antigen, whip Nematode antigens, Ancylostoma antigens, and Wucera antigens.

In those selection and screening protocols in which immunoglobulin molecules are expressed on the surface of host cells, the host cells of the invention are contacted with an antigen by a method that allows specific recognition of the immunoglobulin molecule expressed on the surface of the host cell. The antigens of the CDRs bind to the CDRs, thereby distinguishing host cells that specifically bind the antigen from those that do not. Any method that brings host cells expressing antigen-specific antibodies into contact with the antigen is included in the invention, for example, if the host cells are in suspension and the antigen is attached to a solid substrate, cells that specifically bind to the antigen will be captured onto a solid substrate so that those cells that do not bind the antigen can be washed away and the bound cells can subsequently be recovered. Alternatively, host cells can be recovered from the cell supernatant if they are attached to a solid substrate through specific binding of the antigen, resulting in the cells being released from the substrate (eg, by cell death). A preferred method of contacting the host cells of the invention with the antigen is disclosed, in particular using a library constructed in a vaccinia vector by trimolecular recombination.

In a preferred screening method for the detection of antigen-specific immunoglobulin molecules expressed on the surface of host cells, the host cells of the invention are incubated with a selection antigen, wherein said antigen is directly labeled with fluorescein-5 - Isothiocyanate (FITC), or indirectly labeled with biotin, followed by detection with FITC-labeled streptavidin. Other fluorescent probes familiar to those skilled in the art may be used. During the incubation, the labeled selection antigen binds to the antigen-specific immunoglobulin molecules. Cells expressing antibody receptors for specific fluorescently-labeled antigens can be selected by fluorescence-activated cell sorting, thereby distinguishing host cells that specifically bind to the antigen from those that do not. With the emergence of a cell sorter capable of sorting more than 1× ¹⁰⁸ cells within 1 hour, a large number of cells infected with a recombinant vaccinia library of immunoglobulin genes can be screened to select the cells that express Cell subpopulations of specific antibody receptors.

After harvesting the host cells that specifically bind the antigen, the polynucleotides of the first library are recovered from these host cells. "Recovery" means roughly separating desired components from undesired components. For example, host cells bound to an antigen are "recovered" upon detachment of the host cells from the solid substrate from which polynucleotides of the first library are "recovered" by crude separation from other cellular components. It should be mentioned that the term "recovery" does not imply any type of purification or separation to remove viruses and other components. Recovery of polynucleotides can be performed by any conventional method known to those of ordinary skill in the art. In a preferred aspect, the polynucleotides are recovered by harvesting infectious viral particles, eg, vaccinia virus vector particles in which the first library is constructed, contained within host cells bound to the antigen.

In screening protocols in which certain immunoglobulin molecules are secreted entirely from the surface of host cells, the cell culture medium in which the pool of host cells is grown, the "conditioned medium", can be "contacted" with the antigen in such a way , this method enables the binding of an antigen that specifically recognizes the CDRs of an immunoglobulin molecule to the CDRs, and enables the detection of antigen-antibody interactions. Such methods include, but are not limited to, immunoblotting, ELISA assays, RIA assays, RAST assays, and immunofluorescence assays. Alternatively, the conditioned medium is subjected to functional assays for specific antibodies. Examples of such assays include, but are not limited to, virus neutralization assays (for antibodies against specific viruses), bacterial opsonization/phagocytosis assays (for antibodies against specific bacteria), antibody-dependent cellular cytotoxicity (ADCC) assays assays, assays to detect inhibition or promotion of certain cellular functions, methods to detect IgE-mediated histamine release from mast cells, hemagglutination assays, and hemagglutination inhibition assays. These assays are capable of detecting antigen-specific antibodies with desired functional characteristics.

After identification of conditioned media containing immunoglobulin molecules that specifically bind antigen or possess desired functional characteristics, further screening steps are performed until host cells producing the immunoglobulin molecules of interest are recovered, and then extracted from these host cells The polynucleotides of the first library are recovered.

Those of ordinary skill in the art will readily understand that identifying polynucleotides encoding immunoglobulin subunit polypeptides may require two or more rounds of the above-mentioned selection, and two or more rounds of the above-mentioned screening must be performed. One round of selection will not necessarily isolate a pure polynucleotide encoding the desired first immunoglobulin subunit polypeptide; the resulting mixture after the first round of selection may be enriched in the desired polynucleotide but also contaminated with impurity inserts . The screening methods described herein identify pools containing active host cells and/or immunoglobulin molecules, but these pools also contain inactive species. Therefore, the active pool was further subdivided for additional rounds of screening. Therefore, the identification of a polynucleotide encoding a first immunoglobulin subunit polypeptide which, when associated with a second immunoglobulin subunit polypeptide, is capable of forming a target immunoglobulin molecule or an antigen-specific fragment thereof may require several rounds of selection and/or Either screening or, more advantageously, increases the proportion of cells containing the desired polynucleotide. Accordingly, this embodiment further requires that the polynucleotides recovered in the first round are introduced into a second population of cells and subjected to a second round of selection.

Thus, the first selection step as described above may or must be repeated 1 or more times in order to enrich for polynucleotides encoding immunoglobulin subunit polypeptides of interest. To repeat the first step of this embodiment, the polynucleotide or polynucleotide pool recovered as described above is introduced into a population of host cells capable of expressing immunoglobulin molecules encoded by the polynucleotides in the library. These host cells may be of the same type as used in the first round of selection, or different, provided they express the immunoglobulin molecule. The second polynucleotide library is also introduced into these host cells, so that the immunoglobulin molecules or antigen-specific fragments thereof are expressed on the cell membrane surface of the host cells or in the cell culture medium. Similarly, contacting the cells or conditioned medium with the antigen, or testing the medium in a functional assay, again from those cells expressing an immunoglobulin molecule that specifically binds to the antigen and/or has the desired functional properties or The host cell intensively recovers the polynucleotides of the first library. These steps may be repeated one or more times to enrich the first library for polynucleotides encoding immunoglobulin subunit polypeptides that specifically bind an antigen and/or possess desired functional properties A portion of an immunoglobulin molecule, or an antigen-specific fragment thereof.

After appropriate enrichment of polynucleotides of interest from the first library as described above, the recovered polynucleotides are "isolated", i.e. they are substantially removed from their natural environment and are largely separated from the library. Polynucleotides that do not encode antigen-specific immunoglobulin subunit polypeptides are isolated. For example, a cloned polynucleotide contained in a vector is considered isolated for the purposes of the present invention. It will be appreciated that two or more different immunoglobulin subunit polypeptides that specifically bind the same antigen can be recovered by the methods described herein. Accordingly, a mixture of polynucleotides encoding polypeptides that bind to the same antigen is also considered "isolated". Other examples of isolated polynucleotides include those (partially or substantially) purified DNA molecules maintained in heterologous host cells or in solution. For the purposes of the present invention, however, polynucleotides contained in clones that are members of a pooled library and that are not associated with, for example, an antigen-specific immunoglobulin subunit polypeptide, are not "isolated" for the purposes of the invention. Other clones in the library were isolated. For example, a polynucleotide contained in a viral vector is "isolated" after it has been recovered and subjected to plaque purification, and a polynucleotide contained in a plasmid vector is "isolated" after it has been amplified from a single bacterial colony.

Knowing that an antigen may contain two or more epitopes, any one epitope may bind several different immunoglobulin molecules, so it is expected that several suitable polynucleotides may be recovered from the first step of this embodiment , for example 2, 3, 4, 5, 10, 100 or more polynucleotides each encoding an immunoglobulin subunit polypeptide in association with the polynucleotides of the second library When the encoded appropriate immunoglobulin subunit polypeptide binds, it can form an immunoglobulin molecule or an antigen-specific fragment thereof that specifically binds to an antigen of interest. It is contemplated that each distinct polynucleotide recovered from the first library can be isolated individually. However, these polynucleotides may be isolated as a group of polynucleotides encoding polypeptides having the same antigen specificity, and these polynucleotides may be "isolated" together. Such mixtures of polynucleotides, whether isolated individually or co-isolated, can be as explained below, alone or with 2, 3, 4, 5, 10, 100 or more polynucleotides The acid pool is introduced into the host cell together in the second step.

Once one or more suitable polynucleotides have been isolated from the first library, in a second step of this embodiment, one or more polynucleotides encoding immunoglobulin subunit polypeptides similar to those isolated from the first library are identified. The immunoglobulin subunit polypeptides encoded by the polynucleotides of a library are capable of associating to form immunoglobulin molecules or antigen-specific fragments thereof that specifically bind an antigen of interest or possess desired functional properties.

Accordingly, the second step comprises introducing a second polynucleotide library encoding a second immunoglobulin subunit polypeptide into a population of host cells capable of expressing immunoglobulin molecules, introducing into the same population of host cells at least one From the polynucleotides of the first library, immunoglobulin molecules or antigen-specific fragments thereof are expressed on the surface of said host cells, or completely secreted into the cell culture medium, and these host cells or the conditioned medium grown by the host cells are combined with The specific antigen of interest is contacted, or the conditioned medium is subjected to a functional assay, and the polynucleotides of the second library are recovered from those host cells that bind the antigen of interest or grown in a medium that exhibits the desired activity. The second step is therefore very similar to the first step, except that the second immunoglobulin subunit polypeptides encoded by the polynucleotides of the second library are associated in the host cell with those polynucleotides isolated from the first library. As mentioned above, a single cloned polynucleotide isolated from the first library can be used, or a pool of several polynucleotides isolated from the first library can be introduced simultaneously. As in the first step described above, one or more rounds of enrichment, i.e., selection or screening of a progressively smaller pool, are performed so that the second library is enriched for polynucleotides encoding second immunoglobulin subunit polypeptides , the second immunoglobulin subunit polypeptide is a part of an immunoglobulin molecule capable of specifically binding an antigen of interest or exhibiting desired functional properties. Also as in the first step, one or more desired polynucleotides are isolated from the second library. If pools of isolated polynucleotides were used in earlier rounds of enrichment in the second step, it is preferable to use smaller pools of polynucleotides isolated from the first library, or more preferably, pools of polynucleotides isolated from the second library, in subsequent enrichment steps. A library of single cloned polynucleotides. For any single polynucleotide isolated from the first library and used in the selection process for polynucleotides in the second library, it is possible to isolate several (i.e., 2, 3, 4, 5, 10, 100 or more polynucleotides) from the second library. a plurality of) polynucleotides encoding a second immunoglobulin subunit polypeptide capable of associating with a first immunoglobulin subunit polypeptide encoded by a polynucleotide isolated from the first library Immunoglobulin molecules, or antigen-binding fragments thereof, are formed that specifically bind the antigen of interest or exhibit desired functional properties.

The selection/screening method for libraries encoding single-stranded fragments requires only one library instead of the first and second libraries, and only 1 selection/screening step. Similar to either of the two steps for immunoglobulins, it may also be advantageous to perform two or more rounds of enrichment in this one-step selection/screening method.

carrier. When constructing an antibody library in eukaryotic cells, any conventional vector capable of expression in eukaryotic cells can be used. For example, libraries can be constructed in viral, plasmid, phage, or phagemid vectors, so long as the particular vector chosen contains transcriptional and translational regulatory regions capable of functioning in eukaryotic cells. However, it is preferred to construct antibody repertoires as described above in eukaryotic viral vectors.

Eukaryotic viral vectors can be of any type, such as animal viral vectors or plant viral vectors. The native genome of a viral vector can be positive-, negative-, or double-stranded RNA, or DNA, and the native genome can be circular or linear. For animal viral vectors, include those that infect invertebrates (such as insects, protozoans or helminth parasites) or vertebrates (such as mammals, birds, fish, reptiles and amphibians). The choice of viral vector is limited only by the maximum insert size and protein expression level. Suitable viral vectors are those that infect yeast and other fungal cells, insect cells, protozoan cells, plant cells, avian cells, fish cells, reptile cells, amphibian cells or mammalian cells, particularly preferably mammalian viral vectors . Any conventional viral vector can be used in the present invention, including but not limited to poxvirus vectors (such as vaccinia virus), herpesvirus vectors (such as herpes simplex virus), adenovirus vectors, baculovirus vectors, retrovirus vectors, microRNA Viral vectors (eg poliovirus), alphavirus vectors (eg Sindbis virus) and enteroviruses (eg mengovirus). DNA viral vectors are preferred, such as poxviruses, herpesviruses, baculoviruses and adenoviruses. As described in detail below, poxviruses, especially orthopoxviruses, especially vaccinia viruses are particularly preferred. In a preferred embodiment, a host cell capable of producing infectious viral particles of any selected viral vector is used. Many conventional viral vectors, such as vaccinia virus, have a very broad host range and therefore can use many different host cells.

As mentioned above, the first and second libraries of the invention can be constructed in the same or different vectors. However, in a preferred embodiment, the first and second libraries are prepared such that the polynucleotides of the first library and the second library are conveniently recovered, e.g., the polynucleotides of the first library are conveniently combined with The polynucleotides of the second library are separated and the polynucleotides of the second library are conveniently recovered from the polynucleotides of the first library in a second step. For example, in the first step, if the first library is constructed in a viral vector and the second library is constructed in a plasmid vector, the polynucleotides of the first library can be easily recovered in the form of infectious virus particles, while the remaining Polynucleotides and cell debris of the second library. Similarly, in the second step, if the second library is constructed in a viral vector, and the polynucleotides of the first library isolated in the first step are introduced into a plasmid vector, the polynucleotides containing the second library polynucleotides can be easily recovered. Acidic infectious virus particles.

When the second polynucleotide library or polynucleotides isolated from the first library are introduced into the host cell in a plasmid vector, it is preferred that the immunoglobulin subunit polypeptide encoded by the polynucleotide contained in the plasmid vector is operable The transcriptional regulatory regions driven by proteins encoded by viral vectors containing additional libraries were linked in a convenient manner. For example, if the first library is constructed in a poxvirus vector and the second library is constructed in a plasmid vector, preferably a polynucleotide encoding a second immunoglobulin subunit polypeptide constructed in the plasmid library is operably linked to a A transcriptional regulatory region functioning in the cytoplasm of infected cells, preferably a promoter. Similarly, in the second step, if it is desired to insert polynucleotides isolated from the first library into a plasmid vector to construct the second library in a poxvirus vector, the polynucleotides isolated from the first library and inserted into the plasmid are preferred The acid is operably linked to a transcriptional regulatory region, preferably a promoter, capable of functioning in the cytoplasm of poxvirus-infected cells. Suitable and preferred examples of such transcriptional regulatory regions are disclosed herein. In this way, the polynucleotides of the second library are expressed only in those cells which are also infected with the poxvirus.

However, it would be desirable if the first and second libraries, and those polynucleotides isolated from the first library, could be maintained in one viral vector without having to maintain one or both libraries in two different vector systems. It is very convenient. Therefore, in the present invention, the first or second library sample maintained in the viral vector can be inactivated, so that the viral vector infects the cell, the genome of the viral vector is transcribed, but the vector does not replicate, that is, when the viral vector is introduced In cells, gene products carried by the viral genome, such as immunoglobulin subunit polypeptides, are expressed, but infectious virus particles are not produced.

In a preferred aspect, the constructs are made in eukaryotic cells by treating a sample of the library constructed in the viral vector with 4'-aminomethyl-trimethasalen (psoralen) and then exposing the viral vector to ultraviolet (UV) light. The first or second library within the viral vector is inactivated. Psoralen and UV inactivation of viruses are well known to those of ordinary skill in the art. See, eg, Tsung, K. et al., J. Virol. 70:165-171 (1996), which is incorporated by reference in its entirety.

Psoralen treatment generally involves incubating a cell-free sample of the viral vector with psoralen at a concentration of about 0.1 μg/ml to about 20 μg/ml, preferably at a concentration of about 1 μg/ml to about 17.5 μg/ml. μg/ml, about 2.5 μg/ml to about 15 μg/ml, about 5 μg/ml to about 12.5 μg/ml, about 7.5 μg/ml to about 12.5 μg/ml, or about 9 μg/ml to about 11 μg/ml. Thus, the concentration of psoralen may be approximately 0.1 μg/ml, 0.5 μg/ml, 1 μg/ml, 2 μg/ml, 3 μg/ml, 4 μg/ml, 5 μg/ml, 6 μg/ml, 7 μg/ml, 8 μg /ml, 9μg/ml, 10μg/ml, 11μg/ml, 12μg/ml, 13μg/ml, 14μg/ml, 15μg/ml, 16μg/ml, 17μg/ml, 18μg/ml, 19μg/ml, or 20μg/ml ml. Preferably, the concentration of psoralen is about 10 μg/ml. As used here, the term "approximately" takes into account time, chemical concentration, temperature, pH and other factors usually in a laboratory or factory which are difficult to be exact and may be within a certain amount depending on the type of measurement and the equipment used for the measurement Variety.

Usually the incubation with psoralen is carried out for a period of time prior to UV irradiation. The time period is preferably from about 1 minute to about 20 minutes before UV irradiation. Preferably, the time period varies from about 2 minutes to about 19 minutes, from about 3 minutes to about 18 minutes, from about 4 minutes to about 17 minutes, from about 5 minutes to about 16 minutes, from about 6 minutes to about 15 minutes , from about 7 minutes to about 14 minutes, from about 8 minutes to about 13 minutes, or from about 9 minutes to about 12 minutes. Thus, the incubation time can be about 1 minute, about 2 minutes, about 3 minutes, about 4 minutes, about 5 minutes, about 6 minutes, about 7 minutes, about 8 minutes, about 9 minutes, about 10 minutes, about 11 minutes , about 12 minutes, about 13 minutes, about 14 minutes, about 15 minutes, about 16 minutes, about 17 minutes, about 18 minutes, about 19 minutes, or about 20 minutes. More preferably, a 10 minute incubation is performed prior to UV irradiation.

The psoralen-treated virus was then exposed to UV light. The UV may be of any wavelength, but long wave UV light is preferred, eg around 365nm. Exposure to UV is performed for a time range of about 0.1 minutes to about 20 minutes. Preferably, the time range is about 0.2 to about 19 minutes, about 0.3 to about 18 minutes, about 0.4 to about 17 minutes, about 0.5 to about 16 minutes, about 0.6 to about 15 minutes, about 0.7 to about 14 minutes, about 0.8 to about 13 minutes, about 0.9 to about 12 minutes, about 1 to about 11 minutes, about 2 to about 10 minutes, about 2.5 to about 9 minutes, about 3 to about 8 minutes, about 4 to about 7 minutes, or about 4.5 to About 6 minutes. Thus, the incubation time can be about 0.1, about 0.5, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20 minutes. More preferably, the viral vector is exposed to UV light for about 5 minutes.

The ability to assemble and express immunoglobulin molecules or antigen-specific fragments thereof from two polynucleotide libraries encoding immunoglobulin subunit polypeptides in eukaryotic cells is a significant improvement over the production of single-chain antibodies in bacterial systems Because the two-step selection process can be used as the basis for selecting immunoglobulin molecules or antigen-specific fragments with various specificities.

The following examples provide examples of specific embodiments which further illustrate but do not limit the present embodiments. As previously described in detail, selection for particular immunoglobulin subunit polypeptides, eg, immunoglobulin heavy and light chains, is accomplished in two stages. First, a diverse heavy chain library from immunoglobulin-producing cells from a natural or immunized donor is constructed in a eukaryotic viral vector (such as a poxvirus vector); a similarly diverse library of immunoglobulin light chains is constructed in a plasmid vector , where the expression of the recombinant gene is regulated by a viral promoter, or constructed in a eukaryotic viral vector that has been inactivated by eg psoralen and UV treatment. Host cells expressing immunoglobulin molecules or antigen-specific fragments thereof are infected with viral vectors encoding the heavy chain library at a multiplicity of infection of approximately 1 (MOI=1). "Multiplicity of infection" refers to the average number of virus particles that can infect each host cell. For example, if an infection with an MOI of 1 is desired, ie each cell is infected by an average of 1 virus particle, the number of infectious virus particles used for infection is adjusted to equal the number of cells to be infected.

According to this strategy, host cells are transfected with a library of light chain plasmids, or an inactivated light chain virus The library infects host cells. Under such conditions, a single host cell can express multiple immunoglobulin molecules or fragments thereof, and different light chains and the same heavy chain in each host cell form _a characteristic _H2L2 structure.

Those of ordinary skill in the art will appreciate that it is difficult to control the number of plasmids taken up by cells because successful transfection depends on inducing competence in cells, which is not uniform and may result in uptake of varying amounts of DNA. Thus, in those embodiments where careful control of the number of polynucleotides of the second library introduced per infected host cell is desired, the use of inactivated viral vectors is preferred because the multiplicity of infection of the virus is then more easily controlled.

The expression of multiple light chains in a single host cell, combined with a heavy chain, has the effect of reducing the affinity ("avidity") of specific antigen immunoglobulins, but for the selection of higher affinity ("affinity") binding sites It's beneficial. As used herein, the term "avidity" refers to a measure of the strength with which a single epitope binds to a CDR of an immunoglobulin molecule. See eg Harlow pp. 27-28. As used herein, the term "affinity" refers to the overall stability of the complex formed by the immunoglobulin group and the antigen, that is, the functional binding strength of the immunoglobulin mixture to the antigen. See eg Harlow pp. 29-34. "Affinity" relates to the affinity of individual immunoglobulin molecules in a population for a particular epitope, and also to the potency of the immunoglobulin and that antigen. For example, the interaction between a bivalent monoclonal antibody and an antigen with a highly repetitive epitope structure (such as a polymer) has high affinity. Those of ordinary skill in the art will appreciate that if a host cell expresses immunoglobulin molecules on its surface, each containing a particular heavy chain, but different immunoglobulin molecules on the surface contain different light chains, then the host cell is sensitive to a given The "affinity" of the antigen will decrease. However, the possibility of recovering a population of immunoglobulin molecules that are related in that they contain a common heavy chain but, by association with different light chains, are able to bind specific antigens with a range of affinities reaction. Accordingly, by adjusting the number of different light chains or fragments thereof that are capable of associating with a certain number of heavy chains or fragments thereof in a given host cell, the present invention provides a method for selecting and enriching for various avidity levels. A method for immunoglobulin molecules or antigen-specific fragments thereof.

When utilizing this strategy in the first step of the method for selecting immunoglobulin molecules or antigen-specific fragments thereof as described above, it is preferred to construct the first library in eukaryotic viral vectors at an MOI of about 1 to 10 (preferably about Infecting host cells with the first library of 1), introducing the second library under conditions that allow uptake of up to 20 polynucleotides of the second library per infected host cell. For example, if the second library is constructed in an inactivated viral vector, host cells are infected with the second library at an MOI of about 1 to 20, although depending on the viral vector used and the properties of the immunoglobulin molecule of interest, a higher or higher MOI may be required. MOI below this range. If the second library is constructed in a plasmid vector, the transfection conditions are adjusted so that 0 to 20 plasmids enter each host cell. A higher or lower affinity response to the selection antigen is controlled by increasing or decreasing the average number of polynucleotides of the second library allowed into each infected cell.

More preferably, when the first library is constructed in a viral vector, with an MOI of about 1-9, about 1-8, about 1-7, about 1-6, about 1-5, about 1-4, or about 1- The first library of 2 infects the host cell. In other words, the host cell is infected with the first library at an MOI of about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2 or about 1. Most preferably, host cells are infected with the first library at an MOI of about 1.

When the second library is constructed in a plasmid vector, it is preferred to allow up to about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2 or about 1 second library multicore Under the condition of nucleotides, the plasmid vector is introduced into the host cell. Most preferably, when the second library is constructed in a plasmid vector, the plasmid vector is introduced into the host cell under conditions that permit the uptake of up to about 10 polynucleotides of the second library per infected host cell.

Similarly, when the second library is constructed in an inactivated viral vector, it is more preferably at an MOI of about 1-19, about 2-18, about 3-17, about 4-16, about 5-15, about 6-14 , about 7-13, about 8-12 or about 9-11 introducing the second library into the host cell. In other words, the host cell is treated at an MOI of about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 12, about 11, about 10, about 9, about 8, about 7 , about 6, about 5, about 4, about 3, about 2, or about 1 infection of the second library. In a most preferred aspect, the host cell is infected with the second library at an MOI of about 10. Those of ordinary skill in the art will appreciate that the titer and "MOI" of inactivated virus cannot be measured directly, but can be inferred from the titer of the starting stock of infectious virus (which is then inactivated).

In a most preferred aspect of the present invention, the first library is constructed in a viral vector, the second library is constructed in an inactivated viral vector, and the host cell is infected with the first library with an MOI of about 1, and the second library with an MOI of about 10. The second library infects the host cells.

In the present invention, preferred viral vectors are derived from poxviruses, such as vaccinia virus. If the first library encoding the first immunoglobulin subunit polypeptides is constructed in a poxvirus vector, the expression of the second immunoglobulin subunit polypeptides encoded by the second library constructed in a plasmid vector or an inactivated virus vector is regulated by poxvirus. Controlled by a viral promoter, the second immunoglobulin subunit polypeptide is expressed at high levels in the cytoplasm of poxvirus-infected cells without nuclear integration.

In the second step of selecting immunoglobulins as described above, the second library is preferably constructed in an infectious eukaryotic vector and host cells are infected with the second library at an MOI of about 1 to 10. More preferably, when the second library is constructed in a viral vector, an MOI of about 1-9, about 1-8, about 1-7, about 1-6, about 1-5, about 1-4 or about 1-2 The second library infects the host cell. In other words, the host cell is infected with the second library at an MOI of about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2 or about 1. Most preferably, host cells are infected with the second library at an MOI of about 1.

In the second step of selecting immunoglobulins, polynucleotides from the first library have been isolated. In certain embodiments, individual first library polynucleotides, ie, clones, are introduced into the host cell used to isolate the second library polynucleotides. In this case, the polynucleotides isolated from the first library are introduced into the host cells under conditions that permit at least about 1 polynucleotide per host cell. But because all polynucleotides introduced from the first library are identical, ie, copies of the cloned polynucleotide, the number of polynucleotides introduced into any given host cell is of little importance. For example, if the cloned polynucleotide isolated from the first library is contained in an inactivated viral vector, the vector will be introduced at an MOI of about 1, although MOIs greater than 1 are also feasible. Similarly, if cloned polynucleotides isolated from the first library are introduced into plasmid vectors, the number of plasmids introduced into any given host cell is not critical, but rather the transfection conditions should be adjusted to ensure that each host cell introduces At least 1 polynucleotide. Either embodiment may be employed if, for example, several different polynucleotides are isolated from the first library. In this embodiment, a pool of two or more different polynucleotides isolated from a first library may advantageously be introduced into a host cell infected with a second library of polynucleotides. In this case, if the polynucleotides isolated from the first library are comprised in an inactivated viral vector, preferably the MOI of the inactivated viral particles is greater than about 1, such as about 2, about 3, about 4, about 5 or higher; Or if the polynucleotides isolated from the first library are contained in a plasmid vector, conditions that allow entry of at least about 2, 3, 4, 5 or more polynucleotides per cell are preferred.

Pox virus vector. As mentioned above, the preferred viral vectors for use in the present invention are poxvirus vectors. "Poxviruses" include all members of the family Poxviridae, including the subfamilies Chordopoxviridae (vertebrate poxviruses) and Entomopoxviridae (insectpoxviruses). See, eg, B. Moss (Virology, 2d Edition, B.N. Fields, D.M. Knipe et al., Eds., Raven Press, 2080 (1990)). Chordopoxviruses include the following genera, among others: orthopoxviruses (e.g. vaccinia virus, smallpox virus, raccoonpox virus); fowlpoxviruses (e.g. fowlpoxviruses); goatpoxviruses (e.g. viruses (eg, Shope fibroma and myxoma); and swine pox viruses (eg, porcine pox virus). Entomopoxviruses comprise three genera: A, B and C. In the present invention, orthopoxviruses are preferred. Vaccinia virus, the prototype orthopoxvirus, has been established and well characterized as a vector for expressing heterologous proteins. In the present invention, vaccinia virus vectors are preferred, especially those that have been established for trimolecular recombination. However, other orthopoxviruses, especially raccoonpoxviruses, have also been developed as vectors with better properties for certain applications.

Poxviruses are characterized by their large size and complexity and contain similarly large and complex genomes. It is worth mentioning that poxvirus replication takes place entirely in the cytoplasm of the host cell. The central part of the poxvirus genome is similar, while the ends are more variable. Thus, the central portion of the poxvirus genome is thought to carry genes responsible for important functions common to all poxviruses, such as replication. In contrast, the terminal portion of the poxvirus genome appears to be responsible for features such as pathogenicity and host range that vary among poxviruses and are more likely not required for virus replication in tissue culture. Therefore, it is speculated that if the poxvirus genome is to be modified by rearrangement or removal of DNA fragments or the introduction of foreign DNA fragments, those parts of the natural DNA that are usually located at the distal end are rearranged, removed, or interrupted by the introduced foreign DNA. Some are preferably in more distal regions, as they are not expected to be essential for viral replication and production of infectious virions in tissue culture.

The native vaccinia virus genome is a cross-linked double-stranded linear DNA molecule of approximately 186,000 base pairs, characterized by terminal inverted repeats. The vaccinia virus genome has been fully sequenced, but the function of most gene products is unknown. Goebel, S.J. et al., Virology 179:247-266, 517-563 (1990); Johnson, G.P. et al., Virology 196:381-401. A large number of non-essential regions were identified in the vaccinia virus genome. See, eg, Perkus, M.E. et al., Virology 152:285-97 (1986); and Kotwal, G.J. and Moss B., Virology 167:524-37.

In those embodiments where a poxvirus vector, particularly a vaccinia virus vector, is used to express an immunoglobulin subunit polypeptide, any suitable poxvirus vector may be used. The library of immunoglobulin subunit polypeptides is preferably carried in regions of the vector that are not essential for the growth and replication of the vector, so that infectious virus can be produced. Although many non-essential regions of the vaccinia virus genome have been characterized, the site most commonly used for insertion of foreign genes is the thymidine kinase site located in the HindIIIJ segment of the genome. In certain preferred vaccinia vectors, the tk site has been engineered to contain 1 or 2 unique restriction enzyme sites, allowing the convenient use of trimolecular recombination for library preparation. See supra and Zauderer, PCT Publication No. WO 00/028016.

A library of polynucleotides encoding immunoglobulin subunit polypeptides is inserted into a poxvirus vector, particularly a vaccinia virus vector, operably linked to a transcriptional regulatory region capable of functioning in the cytoplasm of a poxvirus-infected cell. Together.

The poxvirus transcriptional regulatory region contains a promoter and a transcriptional termination signal. Gene expression in poxviruses is temporally regulated, and the promoters of early, mid, and late genes have different structures. Certain poxvirus genes are expressed constitutively, and the promoters of these "early-late" genes have a heterozygous configuration. A synthetic early-late promoter was also established. See Hammond J.M. et al., J. Virol. Methods 66:135-8 (1997); Chakrabarti S. et al., Biotechniques 23:1094-7 (1997). In the present invention, any poxvirus promoter may be used, but depending on the chosen host cell and/or selection regime, early, late or constitutive promoters may be preferred. In general, it is preferred to use a constitutive promoter.

Examples of early promoters include 7.5kD promoter (also a late promoter), DNA pol promoter, tk promoter, RNA pol promoter, 19-kD promoter, 22-kD promoter, 42-kD promoter, 37-kD promoter, 87-kD promoter, H3' promoter, H6 promoter, D1 promoter, D4 promoter, D5 promoter, D9 promoter, D12 promoter, I3 promoter, M1 promoter and N2 Promoter. See Moss, B. "Poxviruses and their Replication" (Virology, 2d Edition, Eds. B.N. Fields, D.M. Knipe et al., Raven Press, p. 2088 (1990)). Early genes transcribed in vaccinia virus and other poxviruses recognize the transcription termination signal TTTTTNT, where N can be any nucleotide. Transcription typically terminates approximately 50 bp upstream of this signal. Therefore, if heterologous genes are to be expressed from poxvirus early promoters, care must be taken that this signal is not present in the coding regions of these genes. See, eg, Earl, P.L. et al., J. Virol. 64:2448-51 (1990).

Examples of late promoters include 7.5kD promoter, MIL promoter, 37-kD promoter, 11-kD promoter, 11L promoter, 12L promoter, 13L promoter, 15L promoter, 17L promoter, 28-kD promoter Promoter, H1L promoter, H3L promoter, H5L promoter, H6L promoter, H8L promoter, D11L promoter, D12L promoter, D13L promoter, A1L promoter, A2L promoter, A3L promoter and P4b promoter . See Moss, B. "Poxviruses and their replication" (Virology, 2d Edition, edited by B.N. Fields, D.M. Knipe et al., Raven Press, p. 2090 (1990)). Late promoters apparently do not recognize transcription termination signals that early promoters do.

Preferred constitutive promoters for use in the present invention include the synthetic early-late promoter described by Hammond and Chakrabarti, the MH-5 early-late promoter, and the 7.5kD or "p7.5" promoter. Examples utilizing these promoters are disclosed herein.

As will be discussed in detail below, certain selection and screening methods based on host cell death require that the mechanism leading to cell death occurs prior to any cytopathic effect (CPE) caused by viral infection. The kinetics of CPE initiation in virus-infected cells depend on the virus used, the multiplicity of infection, and the type of host cell. For example, in many tissue cultures infected with vaccinia virus at an MOI of approximately 1, CPE is not apparent until well beyond 48 to 72 hours post-infection. This allows a period of 2 to 3 days for high-level expression of immunoglobulin molecules independent of carrier-induced CPE, as well as antigen-based selection. However, this time period may not be sufficient for some selection methods, especially when higher MOIs are used, and moreover, the time before CPE onset may be shorter in the cell line of interest. Therefore, there is a need for viral vectors, especially poxvirus vectors (such as vaccinia virus vectors), that have attenuated cytopathic effects so that, if desired, the time period for selection can be extended.

For example, some attenuation is achieved by genetic mutation. They can be completely deficient mutants, ie need a helper virus to produce infectious virions, or they can be conditional mutants, such as temperature-sensitive mutants. Conditional mutants are especially preferred because when expression of host genes is desired, virus-infected host cells can be maintained in a non-permissive environment, such as a non-permissive temperature, and then switched to a permissive environment, such as a permissive temperature, to allow the production of virus particles. Alternatively, fully infectious viruses can be "attenuated" with chemical inhibitors that reversibly block viral replication at specific times in the infection cycle. Such chemical inhibitors include, but are not limited to, hydroxyurea and 5-fluorodeoxyuridine. When expression of host genes is desired, virus-infected host cells are maintained in chemical inhibitors, which are then removed to allow production of virus particles.

A large number of attenuated poxviruses, particularly vaccinia viruses, have been established. For example, modified vaccinia Ankara (MVA) is a highly attenuated vaccinia virus derived from 570 passages in primary chicken embryonic fibroblasts (Mayr, A. et al., Infection 3: 6-14 (1975)) . The recovered virus was missing nearly 15% of wild-type vaccinia DNA, which greatly affected the host range of the virus. MVA cannot replicate or replicates very inefficiently in most mammalian cell lines. A unique property of the host range restriction effect is that the block in non-permissive cells occurs at a later stage of the replication cycle. The expression of viral late gene is basically not damaged, but virion morphogenesis is interrupted (Suter, G. and Moss, B.Proc Natl Acad Sci USA89:10847-51 (1992); Carroll, M.W. and Moss, B. . Virology 238:198-211 (1997)). High levels of viral protein synthesis even in non-permissive host cells make MVA a particularly safe and efficient expression vector. However, because MVA cannot complete the infection cycle in most mammalian cells, in order to recover infectious virus for multiple selection cycles, it is necessary to compensate for the deficiency of MVA by its infecting or superinfecting helper virus, which itself is defective , which can then be separated from infectious MVA recombinants by differential expansion at low MOI in permissive host cells of MVA.

Poxvirus infection has a significant inhibitory effect on the protein and RNA synthesis of host cells. These effects on host gene expression may in some cases interfere with the selection of specific poxvirus recombinants that have specific physiological effects on the host cell. Vaccinia virus strains defective in certain key early genes showed greatly reduced inhibition of host cell protein synthesis. Attenuated poxviruses lacking certain key early genes have also been described. See, eg, US Patents 5,766,882 and 5,770,212 to Falkner et al. Examples of critical early genes that can be defective include, but are not limited to, the vaccinia virus 17L, F18R, D13L, D6R, A8L, J1R, E7L, F11L, E4L, I1L, J3R, J4R, H7R and A6R genes. A preferred key early gene for defect processing is the D4R gene encoding uracil DNA glycosylase. A vaccinia virus defective in a particular key gene readily propagates in a compensating cell line that provides the key gene product.

As used herein, the term "compensation" refers to restoration of lost function in trans by another source, such as host cells, transgenic animals or helper viruses. The loss of said function is caused by the loss of the gene product responsible for this function by the defective virus. Thus, defective poxviruses are inactive forms of the parental poxviruses that can become viable in the presence of compensation. The host cell, transgenic animal or helper virus contains the sequence encoding the missing gene product, or "compensation element". The compensatory element should be expressible, stably integrated into the host cell, transgenic animal or helper virus, and preferably have no or only minimal risk of recombination with the genome of the defective poxvirus.

Viruses produced in compensated cell lines are capable of infecting non-compensated cells and express high levels of early gene products. However, in the absence of this key gene product, host shutdown, DNA replication, packaging and production of infectious virus particles do not occur.

In particularly preferred embodiments described herein, the gene product of interest expressed by the complex library constructed in vaccinia virus is selected for by coupling the induced expression of the compensatory element with the expression of the gene product of interest. Because the compensatory elements are expressed only in those host cells that express the desired gene product, only these host cells produce infectious virus that can be readily recovered.

The preferred embodiments relating to vaccinia virus can be modified to use any poxvirus vector in ways apparent to those of ordinary skill in the art. In the direct selection method, vectors other than poxvirus or vaccinia virus can be used.

Trimolecular recombination method. Traditionally, no one has used poxvirus vectors such as vaccinia virus to identify previously unknown genes of interest from complex libraries because there are no efficient, high-titer library construction and screening methods for vaccinia. Conventional methods for heterologous protein expression in vaccinia virus include homologous recombination in vivo and direct ligation in vitro. Using homologous recombination, recombinant virus yields are on the order of 0.1% or less. Although higher yields of recombinant virus were obtained using the direct ligation method, lower titers were obtained. Therefore, the use of vaccinia vectors is limited to the cloning of previously isolated DNA for protein expression and vaccine development.

Trimolecular recombination, as disclosed in PCT publication WO 00/028016 (Zauderer), is a new efficient, high titer production method for cloning in vaccinia virus. Using the three-molecule recombination method, the inventors achieved at least 90% recombinant virus yield, and the titer was at least 2 orders of magnitude higher than that obtained by the direct connection method.

Therefore, in a preferred embodiment, a polynucleotide library capable of expressing immunoglobulin subunit polypeptides is constructed in a poxvirus, preferably a vaccinia virus vector, by tripartite recombination.

"Trimolecular recombination" or "trimolecular recombination method" refers to a method that allows three The DNA molecules are recombined in vivo, thereby preparing a viral genome, preferably a poxvirus genome, more preferably a vaccinia virus genome, comprising heterologously inserted DNA. The result of recombination is a viable viral genome molecule comprising the two genome segments and the inserted DNA. Therefore, the trimolecular recombination method applied to the present invention comprises: (a) cleaving an isolated viral genome, preferably a DNA viral genome, more preferably a linear DNA viral genome, more preferably a poxvirus or vaccinia virus genome, thereby producing a first viral fragment and A second viral segment, wherein the first viral segment has no homology to the second viral segment; (b) providing a population of transfer plasmids comprising polypeptides encoding immunoglobulin subunits (e.g., immunoglobulin light chain, immunoglobulin light chain, immunoglobulin protein heavy chains or their antigen-specific fragments) operably linked to a transcriptional regulatory region flanked by a 5' flanking region and a 3' flanking region, wherein the 5' flanking region Homologous to the first viral segment described in (a), the 3' flanking region is homologous to the second viral segment described in (a); and the transfer plasmid is capable of homologous to the first and second viral segments Recombination to form a live viral genome; (c) the transfer plasmid described in (b) and the first and second viral fragments described in (a), the transfer plasmid and viral fragments can carry out homologous recombination in vivo ( That is, trimolecular recombination) is introduced into the host cell under the conditions to produce a modified live viral genome containing a polynucleotide encoding an immunoglobulin subunit polypeptide; and (d) recovering the modified viral genome produced by this technique . Preferably, the recovered modified viral genome is packaged in infectious viral particles.

"Recombination efficiency" or "yield of recombinant virus" refers to the ratio of recombinant virus to the total amount of virus produced during the preparation of the virus library of the present invention. As shown in Example 5, this efficiency can be calculated by dividing the titer of the recombinant virus by the titer of the total virus and multiplying by 100%. For example, titers are determined by detecting plaques of provirus stocks on suitable cells with selection (eg, recombinant virus) and without selection (eg, recombinant virus plus wild-type virus). Methods of selection, especially if the heterologous polynucleotide is inserted within the viral thymidine kinase (tk) site, are well known in the art and include the use of bromodeoxyuridine (BDUR) due to disruption of the tk gene. ) or other nucleotide analogues. Examples of selection methods are described in the text.

"Efficient recombination" means a recombination efficiency of at least 1%, more preferably a recombination efficiency of at least about 2%, 2.5%, 3%, 3.5%, 4%, 5%, 10%, 20%, 30%, 40%, 50% %, 60%, 70%, 75%, 80%, 85%, 90%, 95% or 99%.

Many selection systems can be used, including but not limited to thymidine kinases such as herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl.Acad.Sci.USA48:2026) and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell22:817) genes, these genes can be used in tk- ^{, hgprt-} , aprt ^- cells, respectively. Likewise, the following genes can be selected on the basis of antimetabolite resistance: dhfr conferring resistance to methotrexate (Wigler et al., 1980, Proc. Natl. Acad. Sci. USA 77:3567; O'Hare et al., 1981, Proc.Natl.Acad.Sci.USA78:1527); gpt conferring resistance to mycophenolic acid (Mulligan & Berg, 1981, 1981, Proc.Natl.Acad.Sci.USA78:2072); conferring resistance to aminoglycosides neo (Colberre-Garapin et al., 1981, J. Mol. Biol. 150: 1); and hygro (Santerre et al., 1984, Gene 30: 147) conferring resistance to hygromycin.

In summary, the first and second viral segments or "arms" of the viral genome, as described above, preferably contain all of the genes necessary for viral replication and production of infectious viral particles. Examples of suitable arms and methods of producing them using vaccinia virus vectors are disclosed herein. Guidance on regions essential for vaccinia replication can be found in US Patent 5,770,212 to Falkner et al.

However, naked poxvirus genomic DNA, such as the vaccinia virus genome, cannot produce infectious progeny in the absence of virally encoded proteins/functions associated with incoming virions. Desired virally encoded functions include RNA polymerase, which recognizes transfected vaccinia DNA as a template, initiates transcription, and ultimately replicates the transfected DNA. See US Patent 5,445,953 to Dorner et al.

Thus, in order to utilize a poxvirus, such as vaccinia virus, to produce infectious progeny virus by trimolecular recombination, the recipient cell preferably contains packaging functionality. This packaging function can be provided by a helper virus, ie, a virus which, together with the transfected naked genomic DNA, can provide the appropriate proteins and factors necessary for the replication and assembly of progeny viruses.

The helper virus may be a closely related virus, such as a poxvirus belonging to the same subfamily as vaccinia, and may be from the same or a different genus. In this case, it is beneficial to select a helper virus that provides an RNA polymerase capable of recognizing the transfected DNA as a template, initiating transcription and ultimately replication of the transfected DNA. If a closely related virus is used as a helper virus, it may be beneficial to attenuate it so as to impair the formation of infectious virus. For example, temperature-sensitive helper viruses can be used at non-permissive temperatures. Preferably, a heterologous helper virus is used. Examples of this include, but are not limited to, avipox, such as fowlpox, or amputum virus (mousepox) virus. Fowlpox viruses are particularly preferred because they provide essential helper functions but do not replicate or produce infectious virions in mammalian cells (Scheiflinger et al., Proc. Natl. Acad. Sci. USA 89:9977-9981 (1992) ). The use of heterologous viruses reduces the recombination between the helper virus genome and the infected genome, which can occur when homologous sequences of very similar viruses are present within a cell. See Fenner & Comben, Virology 5:530 (1958); Fenner, Virology 8:499 (1959).

Alternatively, the necessary helper functions of the recipient cells can be provided by genetic elements rather than helper viruses. For example, host cells can be transformed to produce helper functions constitutively, or transiently transfected with plasmids expressing helper functions, infected with retroviruses expressing helper functions, or by any other suitable helper virus expressing the desired function. expression vector provided. See US Patent 5,445,953 to Corner et al.

According to the trimolecular recombination method, the first and second viral genome segments cannot be joined or recombined with each other, ie they do not contain compatible overhangs or regions of homology, or, overhangs have been treated with dephosphorylases. In a preferred embodiment, the viral genome comprises a first recognition site for a first restriction endonuclease and a second recognition site for a second restriction endonuclease, said first and second viral fragments being obtained by using a suitable The generation of viral "arms" is generated by restriction enzyme digestion of the viral genome, and the first and second viral fragments are isolated by conventional methods. Ideally, the first and second restriction enzyme recognition sites are unique within the viral genome, or, alternatively, cleavage with both restriction enzymes generates viral "arms" that contain genes for all critical functions , that is, the physical arrangement of the first and second recognition sites in the viral genome to extend the region between the first and second viral segments is not essential for the infectivity of the virus.

In a preferred embodiment of the use of vaccinia vectors in the trimolecular recombination method, vaccinia vectors containing a viral genome with two unique restriction sites in the tk gene are used. In some preferred vaccinia virus genomes, the first restriction enzyme is NotI whose recognition site is GCGGCCGC in the tk gene, and the second restriction enzyme is ApaI whose recognition site is GGGCCC in the tk gene. More preferred are vaccinia vectors comprising the v7.5/tk viral genome or the vEL/tk viral genome.

According to this embodiment, a transfer plasmid having flanking regions capable of homologous recombination with the region of the vaccinia virus genome containing the thymidine kinase gene is used. A segment of the vaccinia virus genome that contains the HindIII-J segment containing the tk gene is conveniently used.

When the viral vector is a poxvirus, preferably the inserted polynucleotide is operably linked to a poxvirus expression control sequence, more preferably a strong constitutive poxvirus promoter, such as p7.5 or a synthetic early/late promoter .

Accordingly, the transfer plasmids of the invention comprise polynucleotides encoding immunoglobulin subunit polypeptides (e.g., heavy chains and immunoglobulin light chains, or antigen-specific fragments of heavy or light chains) operably linked to Poxvirus p7.5 promoter, or synthetic early/late promoter.

A preferred transfer plasmid of the present invention is pVHE, which contains a polynucleotide encoding an immunoglobulin heavy chain polypeptide operably linked to the poxvirus p7.5 promoter, which comprises the sequence:

GGCCAAAAATTGAAAAACTAGATCTATTTATTGCACGCGGCCGCAAACCATGGGATGGAGCTG

TATCATCCCTCTTCTTGGTAGCAACAGCTACAGCCCGCATATGGTCCACCGTCTCCTCAGGGAG

TGCATCCGCCCCAACCCTTTTTCCCCCTCGTCTCCTGTGAGAATTCCCGTCGGATACGAGCAG

CGTGGCCGTTGGCTGCCTCGCACAGGACTTCCTTCCCGACTCCATCACTTTCTCCTGGAAATA

CAAGAACAACTCTGACATCAGCAGCACCCGGGGCTTCCCATCAGTCCTGAGAGGGGGCAAGTA

CGCAGCCACCTCACAGGTGCTGCTGCCTTCCAAGGACGTCATGCAGGGCACAGACGAACACGT

GGTGTGCAAAGTCCAGCACCCCAACGGCAACAAAGAAAAGAACGTGCCTCTTCCAGTGATTGC

TGAGCTGCCTCCCAAAGTGAGCGTCTTCGTCCCACCCCCGCGACGGCTTCTTCGGCAACCCCCG

CAGCAAGTCCAAGCTCATCTGCCAGGCCACGGGTTTCAGTCCCCGGCAGATTCAGGTGTCCTG

GCTGCGCGAGGGGAAGCAGGTGGGGTCTGGCGTCACCACGGACCAGGTGCAGGCTGAGGCCAA

AGAGTCTGGGCCCACGACCTACAAGGTGACTAGCACACTGACCATCAAAGAGAGCGACTGGCT

CAGCCAGAGCATGTTCACCTGCCGCGTGGATCACAGGGGCCTGACCTTCCAGCAGAATGCGTC

CTCCATGTGTGTCCCCGATCAAGACACAGCCATCCGGGTCTTCGCCATCCCCCCATCCTTTGC

CAGCATCTTCCTCACCAAGTCCACAAGTTGACCTGCCTGGTCACAGACCTGACCACCTATGA

CAGCGTGACCATCTCCTGGACCCGCCAGAATGGCGAAGCTGTGAAAACCCACACCAACATCTC

CGAGAGCCACCCCAATGCCACTTTCAGCGCCGTGGGTGAGGCCAGCATCTGCGAGGATGACTG

GAATTCCGGGGAGAGGTTCACGTGCACCGTGACCCACACAGACCTGCCCTCGCCACTGAAGCA

GACCATCTCCCGGCCCAAGGGGGTGGCCCTGCACAGGCCCGATGTCTACTTGCTGCCACCAGC

CCGGGAGCAGCTGAACCTGCGGGAGTCGGCCACCATCACGTGCCTGGTGACGGGCTTCTCTCC

CGCGGACGTCTTCGTGCAGTGGATGCAGAGGGGGCAGCCCTTGTCCCCGGAGAAGTATGTGAC

CAGCGCCCCAATGCCTGAGCCCCAGGCCCCAGGCCGGTACTTCGCCCACAGCATCCTGACCGT

GTCCGAAGAGGAATGGAACACGGGGGAGACCTACACCTGCGTGGTGGCCCATGAGGCCCTGCC

CAACAGGGTCACTGAGAGGACCGTGGACAAGTCCACCGAGGGGGAGGTGAGCGCCGACGAGGA

GGGCTTTGAGAACCTGTGGGCCACCGCCTCCACCTTCATCGTCCTTCTTCCTCCTGAGCCTCTT

CTACAGTACCACCGTCACCTTGTTCAAGGTGAAATGAGTCGAC

Named as SEQ ID NO: 14 in the text. The heavy chain variable region amplified by PCR can be inserted in frame into BssHII (nucleotides 96-100 of SEQ ID NO: 15) and BstEII (nucleotides of SEQ ID NO: 16) shown in bold in the sequence Acid 106-112) single enzyme cleavage site.

In addition, pVHE may be used in embodiments where, as described above, it is desirable to transfer polynucleotides isolated from a first library into plasmid vectors for subsequent selection of polynucleotides from a second library.

Another preferred transfer plasmid of the present invention is pVKE, which comprises a polynucleotide encoding an immunoglobulin kappa light chain polypeptide operably linked to the poxvirus p7.5 promoter, which contains the sequence:

GGCCAAAAATTGAAAAACTAGATCTATTTATTGCACGCGGCCGCCCATGGGATGGAGCTGTAT

CATCCTCTTCTTGGTAGCAACAGCTACAGGCGTGCACTTGACTCGAGATCAAACGAACTGTGG

CTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTG

TTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGGTGGATAACG

CCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACA

GCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAAACACAAAGTCTACGCCTGCG

AAGTCACCCCATCAGGGCCTGAGCTCGCCCGTCACAAAAGAGCTTCAACAGGGGAGAGTGTTAGG

TCGAC

Named as SEQ ID NO: 17 in the paper. The PCR-amplified kappa light chain variable region can be inserted in-frame into ApaLI (nucleotides 95-100 of SEQ ID NO: 18) and XhoI (nucleotides 95-100 of SEQ ID NO: 19) shown in bold in the sequence. Nucleotide 105-110) single enzyme cleavage site.

In addition, pVKE may be used in embodiments where polynucleotides of the second library are required to be present in the plasmid vector during selection of polynucleotides of the first library as described above.

Another preferred transfer plasmid of the present invention is pVLE, which comprises a polynucleotide encoding an immunoglobulin lambda light chain polypeptide operably linked to the poxvirus p7.5 promoter, which contains the sequence:

GGCCAAAAATTGAAAAACTAGATCTATTTATTGCACGCGGCCGCCCATGGGATGGAGCTGTAT

CATCCTCTTCTTGGTAGCAACAGCTACAGGCGTGCACTTGACTCGAGAAGCTTACCGTCCTAC

GAACTGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAA

CTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAAGG

TGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACA

GCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCT

ACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAG

AGTGTTAGGTCGAC

Named as SEQ ID NO: 20 in the paper. The PCR-amplified lambda light chain variable region can be inserted in-frame into the ApaLI (nucleotides 95-100 of SEQ ID NO: 21) and HindIII (nucleotides 95-100 of SEQ ID NO: 22) shown in bold in the sequence. Nucleotide 111-116) single enzyme cutting site.

In addition, pVlE may be used in embodiments that require polynucleotides of the second library to be present in the plasmid vector during selection of polynucleotides of the first library as described above.

"Insert DNA"refers to one or more heterologous DNA segments to be expressed in a recombinant viral vector. According to the present invention, "insert DNA" is a polynucleotide encoding an immunoglobulin subunit polypeptide. The DNA segment can be natural, non-natural, synthetic or a combination thereof. Methods for preparing the inserted DNA of the invention are disclosed herein.

"Transfer plasmid" refers to a plasmid vector containing an insert DNA located between the 5'flanking region and the 3'flanking region as described above. The 5' flanking region has homology to the first viral segment and the 3' flanking region has homology to the second viral segment. Preferably, the transfer plasmid contains a suitable promoter, such as a strong constitutive vaccinia promoter upstream of the inserted DNA when the viral vector is a poxvirus. The term "vector" refers to a polynucleotide construct containing a heterologous polynucleotide segment, which is capable of transferring said polynucleotide segment to a suitable host cell. Preferably, the polynucleotide contained in the vector is operably linked to suitable regulatory sequences that cause expression of the polynucleotide in a suitable host. Such regulatory sequences include a promoter to effect transcription, an optional operator sequence to regulate transcription, a sequence encoding the appropriate ribosomal binding site for the mRNA, and sequences to regulate termination of transcription and translation. As used in the present invention, a vector can be a plasmid, phage particle, virus, messenger RNA, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Typical plasmid expression vectors for expression in mammalian cell culture are, for example, based on pRK5 (EP307247), pSV16B (WO91/08291) and pVL1392 (Pharmingen).

However, "transfer plasmid" as used herein is not limited to a specific plasmid or vector. Any circular or linear or other suitable form of DNA segment can be used as a vector for transferring the DNA insert together with the first and second viral "arms" into the host cell in the trimolecular recombination method. Other suitable vectors include bacteriophage lambda, mRNA, DNA fragments, etc. described herein or known in the art. A multi-plasmid may be a "primary library" of lambda phage such as described herein.

Improvements in Trimolecular Recombination. Trimolecular recombination can be used to construct a cDNA library with a titer on the order of 10 ⁷ pfu in vaccinia virus. Several factors limit the diversity of such cDNA libraries or other libraries. They include: the size of primary cDNA libraries or other libraries, such as polynucleotide libraries encoding immunoglobulin subunit polypeptides, in plasmid vectors that can be constructed, and purification of large quantities (hundreds of micrograms) of viral "arms" (preferably vaccinia virus " arm” or other poxvirus “arm”). Improved trimolecular recombination to allow vaccinia or other viral DNA to be combined with primary cDNA libraries or other libraries such as polynucleotides encoding immunoglobulin subunit polypeptides constructed in lambda phage or DNA derived from it or phagemids Recombination, or the ability to make individual viral DNA arms in vivo following infection with modified viral vectors, can greatly increase the quality and titer of eukaryotic viral cDNA or other libraries constructed using this method.

Transfer of cDNA inserts from the lambda phage library to vaccinia virus. Lambda phage vectors have several advantages over plasmid vectors for the construction of cDNA libraries or other libraries such as polynucleotides encoding immunoglobulin subunit polypeptides. Plasmid cDNA (or other DNA insert) libraries or linear DNA libraries can be introduced into bacterial cells by chemical/heat shock transformation or electroporation. Bacterial cells are preferably transformed with relatively small plasmids, resulting in the possible loss of longer cDNAs or other inserts in the library, such as polynucleotides encoding immunoglobulin subunit polypeptides. In addition, transformation is a relatively inefficient process for introducing foreign DNA or other DNA into cells. In order to construct cDNA libraries or other libraries (such as polynucleotides encoding immunoglobulin subunit polypeptides), it is necessary to use expensive commercially available competent bacteria. In contrast, phage lambda vectors tolerate cDNA inserts of 12 kb or longer without any size bias. The λ vector can be packaged into virions in vitro by using highly efficient commercially available packaging extracts, and then the recombinant λ genome can be introduced into bacterial cells by infection. This process produces primary libraries with higher titers and better reflections of larger cDNAs or other inserts of DNA (such as polynucleotides encoding immunoglobulin subunit polypeptides) than are typically obtained in plasmid libraries.

In order to be able to transfer a cDNA insert or other DNA insert from a lambda vector, such as a polynucleotide encoding an immunoglobulin subunit polypeptide, into a eukaryotic vector such as vaccinia virus, the lambda vector must be modified such that It contains vaccinia virus DNA sequences so as to be capable of homologous recombination with vaccinia virus DNA. The examples below use vaccinia homologous sequences, but other viruses can be similarly used. For example, the vaccinia HindIII J segment (containing the vaccinia tk gene) (3 kb of vaccinia DNA sequence) contained in the plasmid p7.5/ATGO/tk (described below in Example 5) can be cut with HindIII and SnaBI and subcloned into The HindIII/SnaBI sites in pT7Blue3 (Novagen Cat. No. 70025-3) form pT7B3.Vtk. The vaccinia tk gene can be excised from this vector with SacI and SnaBI and inserted into the SacI/SmaI site in LambdaZap Express (Stratagene), resulting in Lambda.Vtk. The Lambda.Vtk vector contains NotI, BamHI, SmaI and SalI single restriction sites, which can be used to insert cDNA downstream of the vaccinia 7.5k promoter. A cDNA library can be constructed in Lambda.Vtk by methods known in the art.

DNA from a cDNA library or other library constructed in Lambda.Vtk or any similar phage (such as a polynucleotide encoding an immunoglobulin subunit polypeptide) can be used to prepare cDNA or other inserted DNA recombinant vaccinia viruses that Includes cDNA inserts or other inserts with flanking vaccinia DNA sequences designed to facilitate homologous recombination. Methods for excising plasmids from the lambda genome by co-infection with helper phage (ExAssist phage, Stratagene Cat. No. 211203) are well known in the art. Large-scale cleavage from lambda-based libraries produces equivalent cDNA or other libraries in plasmid vectors. Plasmids excised from eg the Lambda.Vtk cDNA library contain the vaccinia tk sequence flanked by a cDNA insert or other insert DNA such as a polynucleotide encoding an immunoglobulin subunit polypeptide. This plasmid DNA can then be used to construct vaccinia recombinants by trimolecular recombination. Another embodiment of this method is to purify lambda DNA directly from the original Lambda.Vtk library and transfect the recombinant viral (lambda) DNA or fragments thereof together with two large vaccinia DNA fragments for trimolecular recombination .

The vaccinia arm is produced in vivo. Purification and transfection of vaccinia DNA or other viral DNA "arms" is a limiting factor in the construction of polynucleotide libraries by trimolecular recombination. Modifications to this method to allow in vivo generation of viral arms, particularly vaccinia arms, allow for more efficient library construction in eukaryotic viruses.

The host cell can be modified to express a restriction enzyme that recognizes a unique site introduced into the viral vector genome. For example, when vaccinia virus infects these host cells, the restriction enzymes will digest vaccinia DNA, producing "arms" that can only be repaired (ie, rejoined) by trimolecular recombination. Examples of restriction enzymes include bacterial enzymes NotI and ApaI, yeast endonuclease VDE (R. Hirata, Y. Ohsumi, A. Nakano, H. Kawasaki, K. Suzuki, Y. Anraku. 1990 J. Biological Chemistry 265: 6726-6733), Chlamydomonas eugametos endonuclease I-CeuI and other endonucleases known in the art. For example, a vaccinia strain containing NotI and ApaI single restriction sites in its tk gene has been constructed, and a vaccinia strain containing VDE and/or I-CeuI single restriction sites in the tk gene can be easily constructed by methods known in the art. virus strain.

Constitutively expressed restriction enzymes are lethal to cells because the enzymes fragment chromosomal DNA. To avoid this difficult problem, in one embodiment the host cell is modified to express the restriction enzyme gene under the control of an inducible promoter.

A preferred inducible expression method utilizes the Tet-On Gene Expression System (Clontech). In this system, expression of the gene encoding the endonuclease is silenced in the absence of an inducer (tetracycline). This allows the isolation of stable transfected cell lines that can be induced to express toxic genes (ie, endonucleases) (Gossen, M. et al., Science 268: 1766-1769 (1995)). The expression of the endonuclease can be induced by adding the tetracycline derivative doxycycline. In a preferred embodiment, BSC1 host cells are stably transfected with a Tet-On vector regulating NotI gene expression. Induce a confluent monolayer with doxycycline, then infect v7.5/tk (there is a NotI single enzyme cutting site in the tk gene), and use cDNA or insert DNA recombinant transfer plasmid or transfer DNA or lambda phage or phage plasmid DNA for transfection. Host cell-encoded Not I endonuclease digests exposed vaccinia DNA, such as the NotI single restriction site in the tk gene or other sequences, resulting in two large vaccinia DNA fragments that are only compatible with the transfer plasmid or phage Trimolecular recombination of DNA is required to form full-length viral DNA. Digestion of host cell chromosomal DNA with NotI is not expected to prevent the production of modified infectious virus because host cell propagation is not required for virus replication and virion assembly.

In another embodiment of using this method to make a viral arm (such as a vaccinia arm) in vivo, a modified vaccinia strain is constructed that contains a unique endonuclease site in the tk gene or other non-essential gene and is expressed in the vaccinia Another non-essential site in the genome contains a heterologous polynucleotide encoding an endonuclease under the control of the T7 phage promoter. Infection of cells expressing T7 RNA polymerase will result in the expression of the endonuclease and subsequent digestion of vaccinia DNA by this enzyme. In a preferred embodiment, its expression is activated by T7 by insertion in the HindIIIC or F region (Coupar, E.H.B. et al., Gene 68: 1-10 (1988); Flexner, C. et al., Nature 330: 259-262 (1987)). The vaccinia v7.5/tk strain was modified to form v7.5/tk/T7NotI by subregulating the cassette containing the cDNA encoding NotI. Cell lines were stably transfected with cDNA encoding T7 RNA polymerase under the control of a mammalian promoter (O. Elroy-Stein, B. Moss. 1990 Proc. Natl. Acad. Sci. USA 87:6743-6747). Infection of this packaging cell line with v7.5/tk/T7NotI results in T7 RNA polymerase-dependent expression of NotI and subsequent digestion of vaccinia DNA into arms. Digested vaccinia DNA arms can only be reconstituted and packaged into infectious full-length viral DNA following trimolecular recombination with transfer plasmid or phage DNA. In yet another embodiment of the method, T7 RNA polymerase can be provided by co-infecting T7 RNA polymerase recombinant helper virus, such as fowl pox virus (P.Britton, P.Green, S.Kottier, K.L.Mawditt, Z. . Penzes, D. Cavanagh, M.A. Skinner. 1996 J. General Virology 77:963-967).

A feature of trimolecular recombination using these different strategies to generate large viral DNA fragments in vivo (preferably vaccinia DNA fragments) is that digestion of vaccinia DNA can be performed prior to recombination, but does not have to be. It ensures that only the recombinant virus escapes the damage caused by digestion. This is in contrast to trimolecular recombination using transfection in vitro digested vaccinia DNA, where fragments of vaccinia DNA must be prepared prior to recombination. It is possible that bimolecular recombination prior to digestion yields recombinants more frequently than trimolecular recombination after digestion.

Selection and screening strategies for the isolation of recombinant immunoglobulin molecules using viral vectors, especially poxviruses. In certain embodiments of the invention, trimolecular recombination methods are utilized to generate polynucleotide libraries expressing immunoglobulin subunit polypeptides. In this embodiment, a library comprising full-length immunoglobulin subunit polypeptides or fragments thereof is obtained by first inserting the immunoglobulin constant region and signal Peptide cassettes are prepared. Rearranged immunoglobulin variable regions are isolated by PCR from pre-B cells from unimmunized animals or from B cells or plasma cells from immunized animals. These PCR fragments were cloned between and in-frame with the immunoglobulin signal peptide and constant region, thereby generating the coding region for the immunoglobulin subunit polypeptide. These transfer plasmids are introduced into host cells with poxvirus "arms" and libraries are generated using a tripartite recombination approach.

The present invention provides various methods of identifying (ie, selecting or screening) immunoglobulin molecules having a desired specificity, wherein said immunoglobulin molecules are produced in vitro in eukaryotic cells. These methods include selection for host cell effects such as antigen-induced cell death and antigen-induced signaling; screening of host cell populations for antigen-specific binding and screening of host cell populations in growth media for the presence of desired Soluble immunoglobulin molecule for antigen-specific or functional characteristics.

As described in detail herein, the present invention provides for the identification of immunoglobulin molecules expressed in eukaryotic cells or their antigen specificity based on antigen-induced cell death, antigen-induced signaling, antigen-specific binding or other antigen-specific functions. Fragment method. The selection and screening techniques of the present invention eliminate the biases associated with antibody selection in rodents or the limitations of synthesis and assembly in bacteria.

Many of the identification methods described herein rely on the expression of host cell genes or host cell transcriptional regulatory regions that are induced, directly or indirectly, in response to antigen binding to immunoglobulin molecules or antigen-specific fragments thereof expressed on the surface of host cells. Cells die or produce a detectable signal. It should be mentioned that the most preferred embodiments of the present invention require infection of host cells with eukaryotic viral vectors, preferably poxviral vectors, more preferably vaccinia viral vectors. Those of ordinary skill in the art will readily appreciate that in certain cell lines, upon infection with a poxvirus, some protein synthesis in the host cell is rapidly shut down even in the absence of viral gene expression. This poses a problem if upregulation of host cell genes or host cell transcriptional regulatory regions is required in order to induce antigen-induced cell death or cell signaling. But the problem is not unsolvable, since in some cell lines the inhibition of host protein synthesis is incomplete prior to viral DNA replication. See Moss, B. "Poxviridae and Its Replication" (Virology, ^2nd Edition, Eds. BNFields, DMKnipe et al., Raven Press, p. 2096 (1990)). But this requires rapid screening of large numbers of host cells for expression of genes that are up-regulated upon cross-linking with surface-expressed immunoglobulin molecules upon infection with eukaryotic vectors, preferably poxvirus vectors, more preferably vaccinia virus vectors The ability of the product; the target host cells should also be screened to see if they can differentially express cellular genes when they are infected with various mutants and attenuated viruses.

Correspondingly, the present invention provides a method of utilizing the expression profiles of specific host cells on ordered cDNA library microarrays to screen a large number of host cells to see their host cell gene expression and/or host cell Manipulation of transcriptional regulatory regions that affect antigen-induced cell death or cell signaling. Expression profiles in microarrays are described by Duggan, D. J. et al. (Nature Genet. 21(1 Suppl): 10-14 (1999)), which is incorporated by reference in its entirety.

According to this method, expression profiling is used to compare the gene expression patterns of uninfected host cells and host cells infected with a eukaryotic expression vector, preferably a poxvirus vector, more preferably a vaccinia virus vector, wherein the particular eukaryotic virus vector is used for Vectors for construction of the first and second polynucleotide libraries of the invention. In this way, suitable host cells can be identified that express immunoglobulin molecules or antigen-specific fragments thereof on their surface, and further express the desired inducible protein upon infection with a given virus.

Expression profiling can also be used to compare host cell gene expression patterns in a given host cell, for example, comparing the expression pattern of a host cell infected with a fully infectious viral vector to a host cell infected with its corresponding attenuated viral vector. Expression profiling in microarrays enables large-scale screening of host cells infected with a variety of attenuated viruses achieved by various means. For example, some attenuation is achieved by genetic mutation. Many vaccinia virus mutants have been studied. These may be completely deficient mutants, ie a helper virus is required for the production of infectious virions, or they may be conditional mutants, such as temperature-sensitive mutants. Conditional mutants are especially preferred because when expression of host genes is desired, virus-infected host cells can be maintained in a non-permissive environment (eg, at a non-permissive temperature) and then switched to a permissive environment (eg, at a permissive temperature) in order to produce virus particles. Alternatively, fully infectious viruses can be "attenuated" with chemical inhibitors that reversibly block viral replication at defined points in the infection cycle. Such chemical inhibitors include, but are not limited to, hydroxyurea and 5-fluorodeoxyuridine. When expression of host genes is desired, virus-infected host cells are maintained in chemical inhibitors, which are then removed to allow production of virus particles.

Using this approach, expression profiles in microarrays can be used to identify suitable host cells, suitable transcriptional regulatory regions, and/or suitable attenuated viruses in any of the selection methods described herein.

In one embodiment, a method of selecting molecules encoding immunoglobulins or antigen-specific fragments thereof based on direct antigen-induced apoptosis is provided. According to this method, the host cell selected for infection and/or transfection is an early stage B-cell lymphoma. Suitable early B-cell lymphoma cell lines include, but are not limited to, CH33 cells, CH31 cells (Pennell, C.A. et al., Proc. Natl. Acad. Sci. USA82: 3799-3803 (1985)), or WEHI-231 cells (Boyd , A.W. and Schrader, J.W.J. Immunol. 126:2466-2469 (1981)). Early B-cell lymphoma cell lines respond to cross-linking of antigen-specific immunoglobulins by inducing spontaneous growth arrest and programmed cell death (Pennell, C.A. and Scott, D.W. Eur. J. Immunol. 16:1577-1581 (1986); Tisch, R. et al., Proc. Natl. Acad. Sci. USA85:69114-6918 (1988); Ales-Martinez, J.E. et al., Proc. ; Warner, G.L. and Scott, D.W. Cell. Immunol. 115:195-203 (1988)). After infecting and/or transfecting the first and second polynucleotide libraries as described above, allowing the synthesis and assembly of the antibody molecules to proceed for about 5 to 48 hours, preferably about 6 hours, about 10 hours, about 12 hours, About 16 to 20 hours, about 24 to 30 hours, about 36 hours, about 40 hours, or about 48 hours, more preferably about 12 hours or about 24 hours; binds to any specific immunoglobulin receptor (i.e., a membrane-bound immunoglobulin molecule, or an antigen-specific fragment thereof), and induces apoptosis in those host cells expressing the immunoglobulin by inducing Growth inhibition and programmed cell death respond directly to cross-linking of antigen-specific immunoglobulins. recovering apoptotic host cells, or their contents, including polynucleotides encoding immunoglobulin subunit polypeptides contained therein, thereby enriching the first library for polynucleotides encoding first immunoglobulin subunit polypeptides , the first immunoglobulin subunit polypeptide, as part of an immunoglobulin molecule or an antigen-specific fragment thereof, can specifically bind a target antigen.

After further selection and enrichment of the polynucleotides of the first library, and isolation of these polynucleotides, a similar process is performed to recover the polynucleotides of the second library as immunoglobulin molecules, or antigen-specific fragments thereof. Part of it is capable of binding to a specific antigen of interest.

Figure 1 shows an example of this approach. A "first library" is constructed in a poxvirus vector, preferably a vaccinia virus vector, of polynucleotides encoding various heavy chains from antibody-producing cells of naive or immunized donors; in a plasmid vector encoding an immunoglobulin A similarly diverse "second library" of light chain polynucleotides, wherein the expression of the polynucleotides is regulated by a vaccinia promoter, preferably a synthetic early/late promoter, such as the p11 promoter, or the p7.5 promoter. For this embodiment, the immunoglobulin heavy chain constant region encoded by the poxvirus construct is preferably designed to retain the transmembrane region so that the immunoglobulin receptor is expressed on the surface membrane. Eukaryotic cells, preferably early stage B-cell lymphoma cells, are infected with a poxvirus heavy chain library at a multiplicity of infection of approximately 1 (MOI=1). Two hours later, the infected cells are transfected with the light chain plasmid library under conditions that allow the uptake and expression of an average of 10 or more individual light chain recombinant plasmids per cell. Because the expression of the recombinant gene in the plasmid is regulated by the vaccinia virus promoter, the recombinant gene product can be expressed at a high level in the cytoplasm of cells infected with the vaccinia virus without nuclear integration. Furthermore, a mechanism for sequence-independent amplification of circular DNA in the cytoplasm of vaccinia virus-infected cells would result in higher concentrations of transfected light chain recombinant plasmids (Merchlinsky, M. and Moss, B. Cancer Cell 6 : 87-93 (1988)). These two factors lead to high-level expression, resulting in excess light chain synthesis.

Another preferred embodiment utilizes the T7 bacteriophage promoter active in cells expressing T7 RNA polymerase to regulate the expression of polynucleotides encoding the " First library "of polynucleotides encoding various heavy chains from antibody-producing cells of naive or immunized donors; and construction of a similar diversification of polynucleotides encoding immunoglobulin light chains in plasmid vectors" Two libraries" (Eckert D. and Merchlinsky M.J Gen Virol.80 (Pt6): 1463-9 (1999); Elroy-Stein O., Fuerst T.R. and MossB. Proc. Natl. Acad. Sci. USA86 (16): 6126 -30(1989); Fuerst T.R., Earl P.L. and Moss B. Mol Cell Biol. 7(7):2538-44(1987); Elroy-Stein O. and Moss B.Proc.Natl.Acad.Sci. USA 87(17):6743-7 (1990); Cottet S. and Corthesy B. Eur J Biochem 246(1):23-31).

Those of ordinary skill in the art will readily appreciate that kinetic considerations were important in the design of this experiment, since expression vectors derived from poxviruses are themselves cytopathic for a period of approximately 1 to 10 days, and this The time period is more usually on the order of 2 to 8 days, 2 to 6 days, or 2 to 4 days, depending on the viral vector used, the particular host cell and the multiplicity of infection. In a preferred embodiment, B-cell lymphomas are selected in which the apoptotic response to surface immunoglobulin cross-linking is more rapid than the natural cytopathic effect of poxvirus infection in the cells. Therefore, it is preferred that apoptosis of immunoglobulin molecules on the surface of host cells due to antigen-induced cross-linking occurs about 1 hour to 4 days after contacting the host cells with the antigen so as to occur prior to induction of CPE. More preferably, apoptosis occurs about 1 hour, 2 hours, about 3 hours, 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours after contacting the host cell with the antigen, About 10 hours, about 11 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 22 hours, about 24 hours, about 28 hours, about 32 hours, about 36 hours, about 40 hours hours, about 44 hours, about 48 hours. More preferably, apoptosis is induced within about 12 hours of contacting the host cells with the antigen. Alternatively, attenuated poxviruses with slower induction kinetics of cytopathic effects may be used. Attenuated poxvirus vectors are disclosed herein.

According to this method, when apoptosis occurs, host cells are selected that express antigen-specific immunoglobulins on their surface. For example, if host cells are attached to a solid substrate, those cells undergoing apoptosis are released from the substrate and recovered by harvesting the liquid medium in which the host cells were grown. Alternatively, host cells are attached to a solid substrate, and those undergoing apoptosis undergo hydrolysis, releasing their cytoplasmic contents into the liquid medium in which the host cells are grown. Viral particles released from these cells can then be harvested from the liquid culture medium.

Host cells containing polynucleotides encoding immunoglobulin subunit polypeptides may become "non-attached" or "non-viable" by mechanisms such as hydrolysis, non-attachment, loss of viability, loss of membrane Integrity, loss of structural stability, destruction of cytoskeleton components, failure to maintain membrane potential, cell cycle arrest, failure to generate energy, etc. Therefore, the host cells containing the polynucleotide of interest can be recovered, ie separated from the rest of the cells, by any physical means, such as aspiration, washing, filtration, centrifugation, cell sorting, fluorescence activated cell sorting (FACS) and the like.

For example, host cells containing polynucleotides encoding immunoglobulin subunit polypeptides may undergo lysis, thereby releasing recombinant virus particles (preferably poxvirus particles, more preferably vaccinia virus particles) into the culture medium, or become inattentive. wall, thus detaching from the solid support. Therefore, in a preferred embodiment, released recombinant virus and/or non-adherent cells are separated from adherent cells by aspiration or washing.

Where the host cells are early stage B cell lymphoma cell lines, these cells can be allowed to attach to the solid substrate through interaction with B cell specific antibodies bound to the substrate. Suitable B cell-specific antibodies include, but are not limited to, anti-CD19 antibodies and anti-CD20 antibodies.

In other preferred embodiments, antigen-induced cell death is caused directly or indirectly by host cells transfected with a construct in which the foreign polynucleotide whose expression indirectly causes cell death can be manipulated The transcriptional regulatory region, which is induced upon cross-linking of surface immunoglobulin molecules, is linked.

A "transcriptional regulatory region induced upon cross-linking of a surface immunoglobulin molecule" refers to a region, such as a host cell promoter, that normally regulates genes that are upregulated upon cross-linking of a surface-expressed immunoglobulin molecule. A preferred example of such a transcriptional regulatory region is the BAX promoter, which is upregulated upon crosslinking of surface immunoglobulin molecules in early stage B cell lymphoma cells.

In one embodiment (as shown in Figures 2A and 2B), there is provided a method of inducing cell death when a foreign polynucleotide encoding a cytotoxic T cell (CTL) epitope is expressed. The foreign polynucleotides encoding CTL epitopes are placed operably linked to transcriptional regulatory regions that are induced upon crosslinking of surface immunoglobulin molecules. Upon antigen-induced cross-linking of immunoglobulin molecules on the surface of the host cell, CTL epitopes are expressed on the surface of the host cell within the range of defined MHC molecules that are also expressed on the surface of the host cell. Cells are contacted with epitope-specific CTLs that recognize CTL epitopes within a defined range of MHC molecules, and cells expressing CTL epitopes are rapidly lysed. Methods for selecting and recovering host cells expressing specific CTL epitopes are further disclosed in PCT Publication WO 00/028016 by Zauderer.

Selection of host cells is accomplished by recovering cells or their contents that have undergone cell death and/or lysis. For example, if host cells grown attached to a solid support are selected, those host cells that undergo cell death and/or lysis are released from the support and recovered in the cell supernatant. Alternatively, virus particles released by host cells that have undergone cell death and/or lysis can be recovered from the cell supernatant.

According to this embodiment, the MHC molecule expressed on the surface of the host cell may be a class I MHC molecule or a class II MHC molecule. In a particularly preferred embodiment, the MHC molecule expressed on the host cell is a H-2K ^d molecule and the CTL epitope expressed upon antigen-induced cross-linking is the peptide GYKAGMIHI, designated herein as SEQ ID NO:23.

When utilizing this method, any host cell capable of expressing an immunoglobulin molecule or antigen-specific fragment thereof on its surface can be used. Suitable host cells include immunoglobulin negative plasmacytoma cell lines. Examples of such cell lines include, but are not limited to, NS1 cell lines, Sp2/0 cell lines and P3 cell lines. Other suitable cell lines will be apparent to those of ordinary skill in the art.

In another preferred embodiment (as shown in Figures 2A and 2B) there is provided a method wherein cell death is indirectly induced using a host cell transfected with a construct comprising a "suicide" gene The heterologous polynucleotide is operably linked to a transcriptional regulatory region that is induced upon crosslinking of surface immunoglobulin molecules. "Suicide gene" refers to a nucleic acid molecule that, when expressed, causes cell death. Polynucleotides that may act as suicide genes include many cell death inducing sequences known in the art. Preferred suicide genes are those encoding toxins such as Pseudomonas exotoxin A chain, diphtheria toxin A chain, ricin A chain, abrin A chain, modeccin A chain and alpha-sarcin those genes. A preferred suicide gene encodes the diphtheria toxin A subunit. Once antigen-induced cross-linking of immunoglobulin molecules on the surface of host cells occurs, the promoters of apoptosis-inducing genes are induced, thereby expressing suicide genes and promoting cell death.

In this approach, any host cell capable of expressing an immunoglobulin molecule or antigen-specific fragment thereof on its surface and capable of identifying transcriptional regulatory regions by expression profiling where the transcriptional regulatory regions occur in the presence of surface immunoglobulin Induced when molecules cross-link. Suitable host cells include early B-cell lymphoma cell lines and immunoglobulin-negative plasmacytoma cell lines. Examples of such cell lines include, but are not limited to, CH33 cell line, CH31 cell line, WEHI-231 cell line, NS1 cell line, Sp2/0 cell line and P3 cell line. Other suitable cell lines will be apparent to those of ordinary skill in the art.

Where the host cells are Ig-negative plasmacytoma cell lines, these cells can be allowed to attach to a solid substrate through interaction with a plasmacytoma-specific antibody bound to the substrate. Suitable plasmacytoma-specific antibodies include, but are not limited to, anti-CD38 antibodies (Yi, Q. et al., Blood90:1960-1967 (1997)), anti-CD31 antibodies (Medina, F. et al., Cytometry39:231-234 (2000) )), anti-CD20 antibody (Haghighi, B. et al., Am. J. Hematol. 59:302-308 (1998)) and anti-CD10 antibody (Dunphy, C.H., Acta. Cytol. 40: 358-362 (1996)) .

Combinations of the direct and indirect antigen-induced cell death methods described herein can be used. For example, in those embodiments where the host cell is an early B-cell lymphoma, and antigen cross-linking directly induces apoptosis, antigen-induced cell apoptosis can be accelerated by transfecting the early-stage B-cell lymphoma host cell with such a construct. death, a polynucleotide encoding a foreign cytotoxic T cell epitope in the construct is operably linked to a transcriptional regulatory region that is induced upon crosslinking of surface immunoglobulin molecules. Cell death is accelerated when antigen-crosslinked cells come into contact with specific cytotoxic T cells. Similarly, in those embodiments where the host cell is an early stage B cell lymphoma, and cross-linking of the antigen directly affects apoptosis, antigen-induced apoptosis can be accelerated by transfecting the early stage B cell lymphoma host cell with such a construct. Cell death, the construct in which a suicide gene is operably linked to a transcriptional regulatory region that is induced upon cross-linking of surface immunoglobulin molecules.

Immunoglobulin heavy chains can be modified such that a specific antigen induces a readily detectable signal in cells in which receptors are cross-linked by the specific antigen. A preferred embodiment utilizes an apoptosis-inducing system to select for cell killing resulting from the expression of antigen-specific receptors. An example of an apoptosis-inducing system includes the human FAS (CD95, APO-1) receptor, a member of the tumor necrosis-nerve growth factor receptor superfamily that recruits and assembles the death-inducing signaling complex ( This complex activates a series of proteolytic caspases) to play a role in regulating apoptosis. Several reports describe FAS-based inducible cell death systems in which apoptosis can be induced by chimeric proteins containing the cytoplasmic "death domain" of FAS coupled to different receptors in Together, apoptosis can be induced by a variety of cellular regulators. Ishiwatari-Hayasaka et al successfully used the extracellular domain of mouse CD44 and human FAS to induce apoptosis when cross-linked with multivalent anti-CD44 antibody (Ishiwatari-Hayasaka H. et al., J Immunol 163:1258-64 (1999 )). In addition, Takahashi et al. demonstrated that chimeric human G-CSFR/FAS (extracellular/cytoplasmic) protein can induce apoptosis when cross-linked with anti-G-CSFR antibody (Takahashi T et al., J BiolChem 271: 17555-60 (1996 )). These authors have demonstrated that chimeric protein dimers do not induce apoptosis. The complex must be at least in trimer form.

In a preferred embodiment, a chimeric gene was constructed in which the transmembrane and cytoplasmic death domains of FAS were fused to the carboxy-terminus of the CH1 domain of the human IgM heavy chain (CH1-Fas, Figure 13( a)). A library of VH-CH1-Fas recombinant vaccinia viruses was generated by inserting various VH genes into this construct as described. In host cells infected with the VH-CH1-Fas construct and transfected with recombinant vaccinia viruses encoding different immunoglobulin light chains or infected with psoralen-treated recombinant vaccinia viruses encoding different immunoglobulin light chains, Assembly of membrane receptors with VH-CH1-Fas. Those cells expressing a heavy and light chain variable region gene combination with the desired specificity will have certain membrane receptors cross-linked in the presence of immobilized antigen of the desired specificity. Formation of a functional complex of VHCH1/FAS oligomers induces apoptosis. Trimers can be formed by cross-linking with multivalent antigens or by immobilizing more than one antigen on tissue culture plates or beads.

In a flexible embodiment, the VH library is expressed in a fusion protein in which a polypeptide comprising the transmembrane domain and the cytoplasmic death domain of FAS is fused to the carboxy-terminus of the CH4 domain of the IgM heavy chain ( Figure 13(b)). In another embodiment, the cytoplasmic death domain of FAS is fused to the carboxy-terminus of the transmembrane domain following the IgM heavy chain CH4 domain (Figure 13(c)).

The latter two embodiments (Figure 13(b) and (c)) result in the synthesis of a dimeric Fas death domain that promotes the formation of the trimeric complexes required for the induction of apoptotic signaling, thereby increasing the antigenicity of choice. Number of specific receptors. But with monomeric constructs (Fig. 13(a)), fewer but higher avidity antigen receptors can be selected for while reducing the background of non-antigen-specific cell death. The two receptors with dimeric Fas domains differ in whether the transmembrane region encoded in the fusion protein is Fas or IgM derived. Transmembrane regions derived from IgM may be more effective for membrane receptors expressed in cells of the B lymphocyte lineage. An advantage of this embodiment is that it is not limited to B cells. Specifically, monomeric Fas constructs can be synthesized and expressed as membrane receptors in a wide range of cell types that produce high titers of vaccinia virus, including epidermal cell lines, HeLa cells, and BSC-1 cells.

In another embodiment, an antigen-induced cell signaling-based screening method for recovering polynucleotides encoding immunoglobulin molecules or antigen-specific fragments thereof is provided. According to this approach, host cells are transfected with a readily detectable reporter construct (such as luciferase) operably linked to a transcriptional regulatory region that responds to surface immunoglobulin crosslinking. is upregulated. By contacting a pool of host cells expressing immunoglobulins or fragments thereof on their surface with the antigen, a signal can be detected centrally when cross-linking occurs. Referring to the first step of the immunoglobulin identification method described above, the signaling method can be carried out as follows. Dividing the first library of polynucleotides encoding immunoglobulin subunit polypeptides into a plurality of pools, for example about 2, 5, 10, 25, 15, 75, 100 or more pools, each pool containing about 10, 100 , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ or 10 ⁹ different polynucleotides encoding immunoglobulin subunit polypeptides with different variable regions. Preferably each pool initially contains about ¹⁰³ polynucleotides. Each pool was expanded, saving a duplicate sample for subsequent recovery. In the case of polynucleotide populations constructed on viral vectors (preferably poxviruses, more preferably vaccinia viruses), tissue can be infected with fractions thereof at a low MOI (eg MOI < 0.1) by, for example, diluting a stock solution of a high-titer viral library Microcultures of cells were grown to prepare the pools. Usually after 48 hours of infection, the virus titer is amplified more than 1000 times. Amplifying virus titers in multiple separate pools reduces the risk of loss of recombinant subpopulations due to relatively rapid growth of more competitive subpopulations.

The virus pool is then used to infect a pool of host cells equal to the amount of the prepared virus pool. These host cells have been engineered to express reporter molecules upon surface immunoglobulin cross-linking. The number of host cells infected per pool depends on the number of polynucleotides contained in the pool and the desired MOI. The second library of polynucleotides is also introduced into the pool of host cells and allows expression of immunoglobulin molecules or fragments thereof on the surface of the host cells.

The pool of host cells is then contacted with the antigen of interest under conditions under which the host cells expressing antigen-specific immunoglobulin molecules on their surface express a detectable reporter molecule when said immunoglobulin molecules are cross-linked , and then screen each host cell pool for reporter expression. The pool of host cells for which expression of the reporter molecule can be detected is harvested, and the polynucleotides of the first library are recovered from the sample left over from the initial amplification of the pool of polynucleotides.

In order to further enrich the polynucleotides encoding antigen-specific immunoglobulin subunit polypeptides in the first library, the polynucleotides recovered above were divided into multiple subpools. Create subpools to have fewer distinct members than the pool used above. For example, if each first pool contains ¹⁰³ different polynucleotides, the subpools created should each contain on average about 10 or 100 different polynucleotides. Introduction of the subpool and the second library into the host cell allows expression of the immunoglobulin molecule or fragment thereof on the membrane surface of the host cell. The host cells are then contacted with the antigen as above, those subpools of host cells in which expression of the reporter is detected are identified, and the polynucleotides of the first library are recovered as described above from the replicate pool left behind. Those of ordinary skill in the art will appreciate that this process may be repeated one or more times in order to sufficiently enrich for polynucleotides encoding antigen-specific immunoglobulin subunit polypeptides.

Once the further steps of selecting and enriching the polynucleotides of the first library are completed and these polynucleotides are isolated, a similar process is performed to recover the polynucleotides of the second library as immunoglobulin molecules or their antigen specificity. A part of the fragment can bind the specific antigen of interest.

Any suitable reporter molecule can be used in this method, the choice of which depends on the host cell used, the detection equipment available and the ease of detection. Suitable reporters include, but are not limited to, luciferase, green fluorescent protein, and beta-galactosidase.

Any host cell capable of expressing an immunoglobulin molecule on its surface can be used in this method. Preferred host cells include immunoglobulin-negative plasmacytoma cells, such as NS1 cells, Sp2/0 cells or P3 cells, and early stage B-cell lymphoma cells.

Similar to the cell death approach described above, kinetic considerations require that expression of the reporter construct occurs prior to induction of CPE. Nevertheless, it is preferred that expression of the detectable reporter due to antigen-induced cross-linking of immunoglobulin molecules on the surface of the host cell occurs from about 1 hour to 4 days after contacting the host cell with the antigen, so as to precede the expression of the CPE. induced to occur. More preferably, expression of the reporter occurs at about 1 hour, 2 hours, about 3 hours, 4 hours, about 5 hours, about 6 hours, about 7 hours, about 8 hours, about 9 hours after contacting the host cell with the antigen , about 10 hours, about 11 hours, about 12 hours, about 14 hours, about 16 hours, about 18 hours, about 20 hours, about 22 hours, about 24 hours, about 28 hours, about 32 hours, about 36 hours, about 40 hours, about 44 hours, about 48 hours. More preferably expression of the reporter occurs within about 12 hours of contacting the host cell with the antigen.

A "transcriptional regulatory region induced upon cross-linking of a surface immunoglobulin molecule" refers to a region, such as a host cell promoter, that normally regulates genes that are upregulated upon cross-linking of a surface-expressed immunoglobulin molecule. A preferred example of such a transcriptional regulatory region is the BAX promoter, which is upregulated upon crosslinking of surface immunoglobulin molecules in early stage B cell lymphoma cells.

In another embodiment, there is provided a selection or screening method for selecting molecules encoding immunoglobulins or antigen-specific fragments thereof based on antigen-specific binding. Figure 5 shows this embodiment. According to this method, host cells expressing antigen-specific immunoglobulin molecules or fragments thereof on their surface are recovered solely by detecting antigen binding. Antigen binding can be used as a selection method to directly select host cells expressing antigen-specific immunoglobulin molecules by using the characteristic of binding antigen through a method similar to the cell death-based method described above. For example, if the antigen is bound to a solid substrate, antigen-binding host cells in suspension can be recovered by binding the antigen to the solid substrate. Alternatively, antigen binding can be used as a screening process, ie, the pool of host cells is screened for detectable antigen binding by methods similar to those described above for antigen-induced cell signaling. For example, a pool of host cells expressing immunoglobulins or fragments thereof on their surface is contacted with the antigen, and antigen binding of a given pool is detected by immunoassay, eg, by detection of an enzyme-antibody conjugate bound to the antigen.

Referring to the first step of the immunoglobulin identification method described above, selection via an antigen-specific binding method can be performed as follows. Host cells are selected for infection and/or transfection that express high levels of immunoglobulin molecules on their surface. Preferably, the host cells are grown in suspension. Following infection with the first and second polynucleotide libraries as described above, synthesis and assembly of antibody molecules is permitted. The host cells are then transferred to wells of a microtiter plate with the antigen bound to the surface. Host cells capable of binding the antigen thereby attach to the surface of the well, and unbound cells are removed by gentle washing. Alternatively, host cells that bind the antigen can be recovered, eg, by fluorescence activated cell sorting (FACS). FACS, also known as flow cytometry, can be used to select individual cells based on optical properties including fluorescence. It would be useful to be able to screen large populations of cells in a relatively short period of time. Finally, those host cells that bind the antigen are recovered, thereby enriching the first library for polynucleotides encoding first immunoglobulin subunit polypeptides that are specific for immunoglobulin molecules or their antigens. A part of the sex fragment, which can specifically bind the target antigen.

After further selection and enrichment of polynucleotides from the first library, and isolation of these polynucleotides, a similar process is performed to recover polynucleotides from the second library as part of immunoglobulin molecules or antigen-specific fragments thereof , capable of binding to a specific antigen of interest.

Any host cell capable of expressing an immunoglobulin molecule on its surface can be used in this selection method. Preferred host cells include immunoglobulin-negative plasmacytoma cells, such as NS1 cells, Sp2/0 cells or P3 cells, and early stage B-cell lymphoma cells. Preferably these cells are capable of growing in suspension.

Referring to the first step of the immunoglobulin identification method described above, screening can be performed by an antigen-specific binding method as follows. The first polynucleotide library encoding immunoglobulin subunit polypeptides constructed in viral vectors is divided into multiple pools by the method described above. The virus pool is then used to infect a pool of host cells equal to the amount of the prepared virus pool. In such screening methods, it is preferred that the host cells are adhered to a solid substrate. The second library of polynucleotides is likewise introduced into the pool of host cells, allowing expression of immunoglobulin molecules or fragments thereof on the surface of the host.

The pool of host cells is then contacted with the antigen of interest. After incubation with antigen, excess unbound antigen is washed away. Finally, the cell pool was screened for antigen binding. Antigen binding can be detected by a variety of methods. For example, the antigen can be conjugated to an enzyme. After removal of unbound antigen, substrate is added and the product of the enzymatic reaction is detected. The method can be enhanced using a secondary antibody conjugate or a streptavidin/biotin system. Such screening methods are well known to those of ordinary skill in the art, and can be obtained in the form of kits from regular merchants. Likewise, antigen binding to host cells can be detected microscopically if the antigen is bound to microscopic particles such as gold beads. As with the cell signaling method described above, those pools of host cells in which antigen binding is detected are harvested and the polynucleotides of the first library contained therein are recovered. Alternatively, a pool of host cells in which antigen binding is detectable is identified, and the first library polynucleotides contained therein are recovered from replicate samples of the pool of polynucleotides remaining from initial amplification of the pool of polynucleotides.

In order to further enrich the polynucleotides of the first library encoding antigen-specific immunoglobulin subunit polypeptides, the polynucleotides recovered above were divided into multiple subpools. Create subpools to have fewer distinct members than the pool used above. For example, if each first pool contains ¹⁰³ different polynucleotides, the subpools created should each contain on average about 10 or 100 different polynucleotides. The subpool is introduced into host cells together with the above-mentioned second library, so that immunoglobulin molecules or fragments thereof are expressed on the membrane surface of the host cells. The host cells are then contacted with the antigen as above, and those sub-pools of host cells in which antigen binding is detectable are harvested or simply identified, and the polynucleotides of the first library contained therein, or contained in a replicate sample, are recovered. Those of ordinary skill in the art will appreciate that this process may be repeated one or more times in order to sufficiently enrich for polynucleotides encoding antigen-specific immunoglobulin subunit polypeptides.

After further selection and enrichment of polynucleotides of the first library and isolation of these polynucleotides, a similar process is carried out to recover polynucleotides of the second library as part of immunoglobulin molecules or antigen-specific fragments thereof, capable of binding to a specific antigen of interest.

Any host cell capable of expressing an immunoglobulin molecule on its surface can be used in this method. Preferred host cells include immunoglobulin-negative plasmacytoma cells, such as NS1 cells, Sp2/0 cells or P3 cells, and early stage B-cell lymphoma cells.

In practicing the direct and indirect antigen-induced cell death methods described herein, the antigen of interest can be contacted with the host cells by any convenient method. For example, in certain embodiments, antigens (eg, peptides or polypeptides) are attached to a solid substrate. As used herein, a "solid support" or "solid matrix" is any form of support known in the art that is capable of binding cells or antigens. Well-known supports include plastics for tissue culture, glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnets mine. The nature of the carrier can be either soluble or insoluble to some extent for the purposes of the invention. The support material can have virtually any possible structural configuration as long as the conjugated molecule is capable of binding to the cells. Thus, the support configuration may be spherical, such as a bead, or cylindrical, such as on the inner surface of a test tube, or the outer surface of a rod. Alternatively, the surface can be flat such as a sheet, test strip, etc. Preferred supports include polystyrene beads. Such support configurations include test tubes, beads, microbeads, wells, plates, tissue culture plates, plates, microplates, microtiter plates, bottles, rods, strips, vials, stirrers, and the like. Solid supports can be magnetic or non-magnetic. Those skilled in the art know of many other suitable carriers for binding cells or antigens, or can readily ascertain such substances.

Alternatively, the antigen may be expressed on the surface of a presenting cell that expresses the antigen. As used herein, an "antigen-presenting cell expressing an antigen" refers to a cell that expresses an antigen of interest on its surface in such a manner that the antigen can interact with immunoglobulin molecules attached to the surface of the host cell. Preferred antigen-expressing presenting cells are engineered to express the antigen of interest as a recombinant protein, but the antigen may also be native to the cell. The antigen-expressing recombinant presenting cells can be constructed by any suitable method using molecular biology and protein expression techniques well known to those skilled in the art. Appropriate cells are usually transfected with a plasmid vector encoding the desired antigen, and cells expressing the desired polypeptide antigen are screened. Preferably, the recombinant presenting cells expressing the antigen can stably express the antigen of interest. Cells of the same type as the antigen-expressing presenting cells, but which have not been engineered to express the antigen of interest are referred to herein as "non-antigen-presenting cells". Any suitable cell line can be used to generate antigen-expressing cells. Examples of such cell lines include, but are not limited to, the monkey kidney CVI line transformed with SV40 (COS-7, ATCC CRL1651); the human embryonic kidney line (293, Graham et al., J. Gen Virol. 36:59 (1977)) ; baby hamster kidney cells (BHK, ATCC CCL10); Chinese hamster ovary cells DHFR (CHO, Urlaub and Chasin, Proc.Natl.Acad.Sci.USA77: 4216 (1980)); mouse podocytes (TM3, Mather, Biol .Reprod.23:243-251(1980)); monkey kidney cells (CVIATCC CCL70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); human neck carcinoma cells (HELA, ATCC CCL2); canine kidney cells (MDCK, ATCC CCL34); buffalor rat hepatocytes (BRL 3A, ATCC CRL1442); human lung cells (W138, ATCC CCL75); human hepatocytes (hep G2, HB8065); mouse breast cancer (MMT060562, ATCC CCL51) TRI cells (Mather et al., Annals N.Y. Acad. Sci 383:44-68 (1982)); NIH/3T3 cells (ATCC CRL-1658) and mouse L cells (ATCC CCL-1). Other cell lines will be apparent to those of ordinary skill in the art. Various cell lines are available from the American Type Culture Collection (10801 University Boulevard, Manassas, VA 20110-2209).

Those of ordinary skill in the art understand that antigen-expressing cells contain many natural antigenic determinants on their surface in addition to the antigen of interest. Those host cells of the present invention that express a broad range of different immunoglobulin molecules or antigen-specific fragments thereof on their surface are expected to bind these additional antigenic determinants. Therefore, when using antigen-expressing presenting cells with the antigen of interest to contact the host cells of the present invention, it is necessary to first remove those host cell populations expressing immunoglobulins active against said other antigenic determinants. . The present invention provides methods for removing from a population of host cells host cells expressing immunoglobulin molecules specific for native surface antigens of non-antigen presenting cells. Figure 5 shows this approach. In general, these methods involve contacting the host cell population with non-antigen presenting cells prior to contacting the host cell population with antigen-expressing presenting cells.

In one embodiment, the method comprises adsorbing the population of host cells to non-antigen presenting cells bound to a solid substrate. The non-binding cells and/or polynucleotides contained therein are recovered and the recovered host cells or new host cells into which the recovered polynucleotides have been introduced are then contacted with the antigen expression presenting cells. In those selection methods in which the pool of host cells is contacted with the antigen, the pool of host cells is adsorbed to non-antigen presenting cells bound to a solid substrate. The non-binding cells and/or polynucleotides contained therein are recovered during harvest, and the recovered host cells or host cells into which the recovered polynucleotides have been introduced are brought into contact with antigen expression presenting cells.

In another embodiment, the method comprises contacting the host cell population with non-antigen presenting cells under conditions wherein surface immunoglobulins are expressed reactive with surface antigens of antigenic determinants on the non-antigen presenting cells. Those host cells of protein molecules, when the immunoglobulin molecules on the surface of the host cells are cross-linked, the previously described programmed cell death (such as apoptosis), direct or indirect cell death or cell signaling (ie expression of reporter). Those host cells that have not undergone cell death or expressed the reporter, or more specifically, the polynucleotides from the first or second library from those host cells, are then recovered. For example, if a population of host cells expressing immunoglobulin molecules remains attached to a solid substrate, and those cells that undergo cell death are released from the substrate, the contents of the culture medium are aspirated and discarded, and the cells that remain attached and their contents are recovered. Contains polynucleotides.

Those of ordinary skill in the art appreciate that multiple rounds of elimination may be required to remove from a population of host cells those host cells expressing immunoglobulins reactive with antigenic determinants carried by non-antigen presenting cells. We further envisage that rounds of depletion could be replaced by rounds of enrichment for host cells expressing immunoglobulin molecules that specifically bind an antigen of interest expressed on antigen-expressing presenting cells.

In another embodiment, a screening method based on antigen-specific functions of immunoglobulin molecules is provided to recover polynucleotides encoding immunoglobulin molecules or antigen-specific functional fragments thereof. According to this method, a pool of host cells expressing fully soluble immunoglobulin molecules is prepared. Expression is allowed and the resulting cell culture medium is tested by different functional assays requiring specificity for a particular antigen. According to this method, the "function" being tested can be a conventional effector function performed by the immunoglobulin molecule, such as virus neutralization, opsonization, ADCC, antagonist/agonist activity, histamine release, hemagglutination or hemagglutination inhibition . Alternatively, the "function" refers only to binding the antigen.

In a related embodiment, a screening method for selecting immunoglobulin molecules with known antigen specificity but altered effector function is provided. According to these embodiments, libraries of immunoglobulin subunit polypeptides with known antigen specificities but with alterations in constant domains known to be involved in a given effector function are constructed. According to this method, a pool of host cells expressing fully soluble immunoglobulin molecules is prepared. Expression is allowed, and the resulting increased or inhibited activity in the cell culture medium is detected by different functional assays. According to this method, the "function" being tested can be a conventional effector function performed by an immunoglobulin molecule, such as virus neutralization, opsonization, complement fixation, ADCC, antagonist/agonist activity, histamine release, hemagglutination or inhibition of hemagglutination.

Referring to the first step of the immunoglobulin identification method described above, the screening for effector function can be performed as follows. As described above, the first library of polynucleotides encoding fully secreted immunoglobulin subunit polypeptides is divided into pools, each pool containing approximately 10, 100, 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , ¹⁰⁸ or ¹⁰⁹ different polynucleotides encoding fully secreted immunoglobulin subunit polypeptides with different variable regions. Preferably each pool initially contains about ¹⁰³ polynucleotides. Each pool was amplified and a duplicate was saved for subsequent recovery. In the case of polynucleotide pools constructed on viral vectors (preferably poxviruses, more preferably vaccinia viruses), tissue can be infected at a low MOI (e.g. MOI < 0.1) with a portion thereof, for example by diluting a high titer viral library stock solution Microcultures of cells were grown to prepare the pools. Usually after 48 hours of infection, the virus titer is amplified more than 1000 times. Amplifying virus titers in multiple separate pools reduces the risk of loss of recombinant subpopulations due to relatively rapid growth of competing subpopulations.

The virus pool is then used to infect a pool of host cells equal to the amount of the prepared virus pool. The number of host cells infected per pool depends on the number of polynucleotides contained in the pool and the desired MOI. Essentially, any host cell capable of being infected by the viral vector employed and capable of expressing fully secreted immunoglobulin molecules can be used in this method. Preferred host cells include immunoglobulin-negative plasmacytoma cells, such as NS1 cells, Sp2/0 cells, or P3 cells, and early stage B-cell lymphoma cells. These cells can be cultured in suspension or attached to solid surfaces. A second library of polynucleotides is also introduced into the pool of host cells and allows expression of fully secreted immunoglobulin molecules or fragments thereof.

The conditioned medium in which the pool of host cells is cultured is then recovered and tested for effector function in response to a specific antigen of interest by standardized functional assays.

Any suitable functional test can be used for this method. For example, immunoglobulin molecules capable of neutralizing a target virus (eg, HIV) can be detected in harvested cell supernatants in a virus neutralization assay. Alternatively, the harvested cell supernatant can be tested for its ability to block or promote (ie, act as an antagonist or agonist) a target cell function (eg, apoptosis). Exemplary suitable functional tests are described in the Examples below. As used herein, "functional testing" also includes simple detection of antigen binding, eg, using conventional ELISA assays well known to those of ordinary skill in the art.

When the conditioned medium growing a given pool of host cells has the desired function, recovering the polynucleotides of the first library contained in the host cells of the pool from the sample left over when the pool of polynucleotides was initially expanded .

In order to further enrich the polynucleotides encoding antigen-specific immunoglobulin subunit polypeptides in the first library, the polynucleotides recovered above were divided into multiple subpools. Create subpools to have fewer distinct members than the pool used above. For example, if each first pool contains ¹⁰³ different polynucleotides, the subpools created should each contain on average about 10 or 100 different polynucleotides. Introduction of the subpool and the second library into host cells as described above allows expression of fully secreted immunoglobulin molecules or fragments thereof. Conditioned media in which the pool of host cells were cultured was recovered as described above, and conditioned media samples with desired functional properties were identified by standardized functional assays to detect effector functions in response to specific antigens of interest, from previously left replicate pools. The polynucleotides of the first library contained in the subpool of host cells are recovered. Those of ordinary skill in the art will appreciate that this process may be repeated one or more times in order to sufficiently enrich for polynucleotides encoding antigen-specific immunoglobulin subunit polypeptides.

Once the further steps of selecting and enriching the polynucleotides of the first library are completed and these polynucleotides are isolated, a similar process is performed to recover the polynucleotides of the second library as part of immunoglobulin molecules or fragments thereof , showing the desired antigen-specific function.

Reagent test kit. The present invention further provides a kit for selecting antigen-specific recombinant immunoglobulins expressed in eukaryotic host cells. The kit comprises one or more containers containing one or more components necessary to perform the methods described herein. In one embodiment, the kit comprises: (a) a first polynucleotide library encoding a plurality of first immunoglobulin subunit polypeptides operably linked to a transcriptional regulatory region, wherein each first immunoglobulin subunit polypeptide The protein subunit polypeptide comprises: (i) a first immunoglobulin constant region selected from a heavy chain constant region and a light chain constant region, (ii) an immunoglobulin variable region corresponding to said first constant region, and (iii) ) a signal peptide capable of directing the expression or secretion of the first immunoglobulin subunit polypeptide on the cell surface, wherein the first library is constructed in a eukaryotic virus vector; (b) by operably linking the transcriptional regulatory region, A second polynucleotide library encoding a plurality of second immunoglobulin subunit polypeptides, wherein each second immunoglobulin subunit polypeptide comprises: (i) a second immunoglobulin subunit selected from a heavy chain constant region and a light chain constant region a globulin constant region, wherein the second immunoglobulin constant region is different from the first immunoglobulin constant region, (ii) an immunoglobulin variable region corresponding to said second constant region, and (iii) capable of directing the A signal peptide expressed or secreted by the second immunoglobulin subunit polypeptide on the cell surface, wherein the second immunoglobulin subunit polypeptide is capable of combining with the first immunoglobulin subunit polypeptide to form a surface immunoglobulin The molecule, or an antigen-specific fragment thereof, is attached to a host cell membrane, and the second library is constructed in a eukaryotic viral vector; and (c) a population of host cells capable of expressing said immunoglobulin molecule. In this kit, both the first and second libraries are provided in the form of infectious viral particles and inactivated viral particles, wherein the inactivated viral particles are capable of infecting a host cell to express the Contains polypeptides, but does not carry out viral replication. In addition, the host cells provided in the kit are capable of expressing antigen-specific immunoglobulin molecules that can be selected by interaction with the antigen. The use of the kit is consistent with the method described in the text. In certain embodiments, kits include control antigens and reagents to standardize the selection of a particular antigen of interest.

Isolated immunoglobulins. The invention further provides an isolated antigen-specific immunoglobulin or fragment thereof prepared by any of the methods described herein. These isolated immunoglobulins can be used as diagnostic or therapeutic reagents. In addition, the present invention provides a composition comprising the isolated immunoglobulin of the present invention and a pharmaceutically acceptable carrier.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA and immunology, which are within the ordinary skill of the art. Such techniques are explained fully in the literature. See, e.g., Molecular Cloning A Laboratory Manual, ^2nd Ed., Sambrook et al., Cold Spring Harbor Laboratory Press (1989); Molecular Cloning: A Laboratory Manual, Sambrook et al., Cold Spring Harbor Laboratory, New York (1992), DNA Cloning, Vol. I and II (DNGlover ed., 1985); Oligonucleotide Synthesis (MJGait ed.1984); Mullis et al., U.S. Patent 4,683,195; Nucleic Acid Hybridization (BDHames&S.J.Higgins ed.1984); Transcription and Translation (BDHames&S.J.Higginsed. 1984); Culture of Animal Cells (RI Freshney, Alan R. Liss, Inc. 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., NY); Gene Transfer Vectors For Mammalian Cells (JH Miller and MP Calos eds. 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vol. 154 and 155 (Wu et al. eds), Immunochemical Methods In Cell And Molecular Biology (Edited by Mayer and Walker, Academic Press, London, 1987); Handbook of Experimental Immunology, Vol I-IV (edited by DM Weir and CC Blackwell, 1986); Manipulating the Mouse Embryo (Coid Spring Harbor Laboratory Press, Coid Spring Harbor, NY 1986); and Ausubel et al. , Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989).

Antibody Engineering, ^2nd edition, CA K Borrebaeck, ed., Oxford Univ. Press (1995) describes the general principles of antibody engineering. The general principles of protein engineering are presented in Protein Engineering, A Practical Approach, Richwood, D. et al., Eds., IRL Press at Oxford Univ. Press, Oxford, Eng. (1995). Antibodies were proposed in Nisonoff, A., Molecular Immunology, 2 ^nd ed, Sinauer Associates, Sunderland, MA (1984); and Steward, MW, Antibodies, Their Structure and Function, Chapman and Hall, New York, NY (1984). Fundamentals of binding to half-antibodies. In addition, routine methods of immunology known in the art that are not specifically described are generally referred to in Current Protocols in Immunology, John Wiley & Sons, New York; Stites et al. (eds.), Basic and Clinical-Immunology (8 ^th ed), Appleton & Lange, Norwalk, CT ( 1994) and Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, WH Freeman and Co., New York (1980).

Standard references presenting fundamental principles of immunology include Current Protocols in Immunology, John Wiley & Sons, New York; Klein, J., Immunology: The Science of Self-Nonself Discrimination, John Wiley & Sons, New York (1982); Kennett, R. et al., Monoclonal Antibodies, Hybridoma: A New Dimension in Biological Analyzes, Plenum Press, New York (1980); Campbell, A., "Monoclonal Antibody Technology" in Burden, R. et al., Laboratory Techniques in Biochemistry and Molecular Biology, Vol13, Eldsevere ( 1984).

Example

Example 1 Constructing a Specific Diversified Human Immunoglobulin Library

Libraries of polynucleotides encoding various immunoglobulin subunit polypeptides are generated as follows. Genes encoding VH (variable heavy region), VK (variable light chain) and VL (variable light chain) were amplified by PCR. For each of the three variable region gene families, recombinant plasmid libraries and vaccinia virus libraries were constructed. The variable region genes are inserted into p7.5/tk-based transfer/expression plasmids, between the immunoglobulin leader and constant region sequences of the corresponding heavy or light chain. The plasmid is used to generate the corresponding vaccinia virus heavy assembly through three-molecule recombination, and the plasmid can also be directly used to express high-level immunoglobulin chains after being transfected into cells infected with vaccinia virus. Lymphoma cells were first infected with the vaccinia heavy chain library and then transiently transfected with the plasmid light chain library. Co-expression of IgM with light chains will result in assembly and surface expression of the antibody molecule.

1.1 Press pVHE. An expression vector containing the constant region of the human mu membrane immunoglobulin, designated herein as PVHE, was constructed as follows. The strategy is shown in Figure 3. cDNA encoding the membrane-bound human IgM heavy chain was isolated from bone marrow RNA using the SMART ^(TM) RACE cDNA Amplification Kit available from Clontech, Palo Alto, CA. PCR was performed using the following references: 5' primer (huCμ5B)/5'-ATTAGGATCCGGTCACCGTCTCCTCAGGG-3' (SEQ ID NO: 24) and 3' primer (huCμ3S) 5'-ATTAGTCGACTCATTTCACCTTGAACAAGGTGAC-3' (SEQ ID NO: 25). The PCR product was then inserted into pBluescript II/KS at the BamHI and SalI sites for site-directed mutagenesis to eliminate the two BstEII sites located between the CH2 and CH4 domains. Nucleotide substitutions were chosen that did not alter the amino acids encoded at these positions.

Plasmid p7.5/tk, generated as described in Zauderer, PCT Publication No. WO 00/028016 and in Example 5 below, was transformed into pVHE by the method described below. The multiple cloning site (MCS) in P7.5/tk was replaced with a cassette containing the following restriction sites: NotI-NcoI-BssHII-BstEII-SalI, generating p7.5/tk2. The cassette having the sequence 5'-GCGGCCGCAAACCATGGAAAGCGCGCATATGGTCACCAAAAGTCGAC-3' is referred to herein as SEQ ID NO:26. A cassette encoding the signal peptide sequence corresponding to amino acids -19--3 of the IgM heavy chain was cloned into p7.5/tk2 between the NcoI and BssHII sites to generate p7.5/tk2L. The BstEII-mutated IgM heavy chain generated as described above was then cloned between the SalI and BstEII sites in p7.51tk ₂ L to generate pVHE. Next, a heavy chain variable region (VH) cassette comprising nucleotides encoding amino acids -4 to 110, generated by PCR as described below, was cloned into pVHE between the BssHII and BstEII sites to generate polynucleotide library. Due to the overlap between the μ heavy chain sequence and the selected restriction enzyme sites, this will result in the expression of the adjacent membrane-bound heavy chain immunoglobulin subunit polypeptides in the correct translation reading frame.

1.2 pVHE. An expression vector containing the constant region of human μ-secreted immunoglobulin, called pVHE herein, was constructed as follows. Figure 8 shows the strategy. The cDNA encoding the secreted human IgM heavy chain was isolated from bone marrow RNA using the SMART RACE cDNA Amplification Kit. The upstream primer huCμ5B contained an added BamHI site and a BstEII site at the 5' end, followed by amino acids 111-113 of VH and the first amino acid of CμH1. The downstream primer shuCμ3S contains the last 6 amino acids of secreted Cμ, followed by a stop codon and SalI site. These primers have the following sequences:

huCμ5B: 5'-ATTAGGATCCGGTCACCGTCTCCTCAGGG-3' (SEQ ID NO: 27); and

shuCμ3S: 5'-ATTAGTCGACTCAGTAGCAGGTGCCAGCTGT-3' (SEQ ID NO: 28).

Then the PCR product was inserted into the BamHI and SalI sites of pBluescriptII/KS for site-directed mutagenesis in order to remove the two BstEII sites located in the CH2 and CH4 domains. Nucleotide substitutions with no change in the amino acid encoded by these positions were selected.

The plasmid p7.5/tk2L prepared in Section 1.1 was transformed into pVHEs by the following method. The BstEII mutated secreted IgM heavy chain prepared as described above was then cloned into the BstEII and SalI sites in p7.5/tk2L, thereby generating pVHEs. A heavy chain variable region (VH) cassette comprising nucleotides encoding amino acids -4 to 110, prepared by PCR as described below, was then cloned into pVHEs between the BssHII and BstEII sites to generate a secreted heavy chain encoding polynucleotide library. Due to the overlap between the μ heavy chain sequence and the selected restriction enzyme sites, the adjacent secreted heavy chain immunoglobulin subunit polypeptides are expressed in the correct translation reading frame.

1.3 pVKE and pVLE. The expression vectors named pVKE and pVLE containing the constant regions of human κ and λ immunoglobulin light chains were constructed as follows. Figure 4 shows this strategy.

(a) Plasmid p7.5/tk was transformed into pVKE by the following method. Remove the two XhoI and two HindIII sites of p7.5/tk by filling in the connection, remove the 3 ApaLI sites (one in the main chain, one in ColEl ori, and the other in Amp) by standard methods, and use A cassette containing the following restriction sites replaced the multiple cloning site (MCS) of p7.5/tk: NotI-NcoI-ApaLI-XhoI-HindIII-SalI, resulting in p7.5/tk3. This cassette is referred to in the text as SEQ ID NO: 29, and its sequence is 5'-GCGGCCGCCC ATGGATACGTGCACTTGACTCGAGAAGCTT AGTAGTCGAC-3'.

A cassette encoding the signal peptide sequence corresponding to amino acids -19 to -2 in the kappa light chain was cloned into p7.5/tk3 between the NcoI and ApaLI sites, resulting in p7.5/tk3L. cDNA encoding the CK region was isolated from bone marrow RNA using the SMART ^™ RACE cDNA Amplification Kit as described above, using primers containing an XhoI site at the 5' end of the region encoding amino acids 104-107+Ck, a stop codon and a 3' end SalI. These primers had the following sequences: huCk5: 5'-CAGGACTCGA GATCAAACGA ACTGTGGCTG-3' (SEQ ID NO: 30); huCk3: 5' AATATGTCGA CCTAACACTCTCCCCTGTTG AAGCTCTTT-3' (SEQ ID NO: 31); and huCk3: 5'-AATATGTCGA CCTAACACTC TCCCCTGTTG AAGCTCTT-3' (SEQ ID NO: 32). The CK cassette was then cloned into p7.5/tk3L between the XhoI and SalI sites, generating pVKE. A kappa light chain variable region cassette (VK) containing nucleotides encoding amino acids -3 to 105, prepared by PCR as described below, was then cloned into pVKE between the ApaLI and XhoI sites. Due to the overlap in the kappa light chain sequence and selected restriction enzyme sites, the contiguous kappa light chain immunoglobulin subunit polypeptides are expressed in the correct translation reading frame.

(b) The plasmid p7.5/tk3L was transformed into pVLE by the following method. cDNA encoding the CK region was isolated from bone marrow RNA using the SMART ^™ RACE cDNA Amplification Kit as described above, using primers with a HindHIII site at the 5' end and a region encoding amino acids 105 to 107 of Vλ, and a stop codon at the 3' end and SalI sites. These primers had the following sequences: huCλ5: 5'-ATTTAAGCTT ACCGTCCTACGAACTGTGGC TGCACCATCT-3' (SEQ ID NO: 33); and huCλ3 (SEQ ID NO: 31). The Cκ cassette was then inserted into the HindIII and SalI sites in p7.5/tk3L , resulting in pVLE. A lambda light chain variable region cassette (VL) containing nucleotides encoding amino acids -3 to 140, prepared by PCR as described below, was then cloned into pVLE between the ApaLI and HindIII sites. Due to the overlap of the lambda light chain sequence and selected restriction enzyme sites, the adjacent lambda light chain immunoglobulin subunit polypeptides are expressed in the correct translation reading frame.

1.4 Variable regions. Heavy chain, kappa light chain and lambda light chain variable regions were isolated by PCR for cloning into expression vectors prepared as described above by the following method. Normal human bone marrow RNA (available from Clontech) isolated from multiple donors was used for cDNA synthesis. An aliquot of the cDNA preparation was used for PCR amplification with primer pairs selected from the following primer sets: VH/JH, VK/JK or VL/JL. Tables 1 and 2 list the primers used to amplify the variable regions.

(a) Heavy chain variable region. Due to the way plasmid expression vectors are designed, the VH primer (i.e., the forward primer in the primer pair used to amplify the V region of the heavy chain) has the following general configuration, where the BssHII restriction site is underlined:

VH Primer: Beginning of GCGCGC ACTCC-VH FR1 primer.

Primers were designed to include codons encoding the last 4 amino acids of the leader sequence, where the BssHII site encodes amino acids -4 to -3, followed by the VH family-specific FR1 sequence. Tables 1 and 2 list the sequences of the different family-specific VH primers. Because the last 5 amino acids of the heavy chain variable region (i.e., amino acids 109-113, which are identical in the six human heavy chain J regions) are contained in the plasmid pVHE, the JH primer (i.e., the reverse primer) had the following configuration to include the BstEII site encoding amino acids 109 to 110 (underlined):

JH Primer: - the coding nucleotide sequence of amino acid 103-108 of VH (ending with G) - GTCACC

Using these primers, the VH PCR product begins with codons encoding amino acids -4 to 110, where BssHII is amino acids -4 and -3, and ends with a BstEII site at codons located at amino acids 109 and 110. After digestion with appropriate restriction enzymes, these PCR products were cloned into pVHE digested with BssHII and BstEII.

To amplify the most likely rearranged heavy chain variable regions, the VH and JH primer families shown in Tables 1 and 2 were used. The VH1, 3, and 4 families account for 44 of the 51 V regions present in the human genome. The inclusion of codons encoding amino acids 109-113 in the expression vector precludes the use of a single universal JH primer. However, the five JH primers shown in Tables 1 and 2 can be combined for each VH primer to reduce the number of PCR reactions required.

(b) Kappa light chain variable region. The VK primer, the forward primer used to amplify the variable region of the kappa light chain, has the following general configuration, where the ApaLI restriction site is underlined:

VK Primer: Start of GTGCAC TCC-VκFR1 Primer

The VK primer contained codons encoding the last 3 amino acids of the kappa light chain leader sequence, with an ApaLI site encoding amino acids -3 and -2, followed by a VK family-specific FR1 sequence. Because the codons encoding the last 4 amino acids (amino acids 104-107) of the kappa light chain variable region are included in the expression vector pVKE, the JK primer, the reverse primer used to amplify the kappa light chain variable region, exhibits the following structure:

JK primers:

- Nucleotide sequence encoding amino acids 98-103 of VK - CTCGAG

The XhoI site (shown underlined) contains the codons encoding amino acids 104-105 of the kappa light chain variable region. The PCR product encoding the kappa light chain variable region begins with a codon for amino acid-3 and ends with a codon for amino acid 105, has an ApaLI site containing codons for amino acids-3 and -2, and contains codons for amino acids 104 and 105 XhoI site for the codon. The VK1/4 and VK3/6 primers each have two degenerate nucleotide positions. Using these JK primers (see Tables 1 and 2), JK1, 3 and 4 will have a Val to Leu mutation at amino acid 104, and JK3 will have an Asp to Glu mutation at amino acid 105.

(c) Lambda light chain variable region. The VL primer, the forward primer in the pair of primers used to amplify the variable region of the lambda light chain, has the following general configuration, where the ApaLI restriction site is underlined:

VL Primer: Start of GTGCAC TCC-VL

The ApaLI site contains codons encoding amino acids -3 and -2, followed by the VL family-specific FR1 sequence. Because the codons encoding the last 5 amino acids of VL (amino acids 103-107) are included in the expression vector pVLE, the JL primers show the following configuration, thereby including the HindIII site (underlined) containing the codons encoding amino acids 103-104 show):

JL Primer: - Nucleotide sequence of amino acids 97-102 in VL - AAGCTT

The PCR product encoding the variable region of the lambda light chain begins with a codon for amino acid-3 and ends with a codon for amino acid 104, wherein the ApaLI site contains codons for amino acids-3 and -2, and the HindIII site contains codons for amino acids 103 and 104 codons.

Table 1. Oligonucleotide primers used for PCR amplification of variable regions of human immunoglobulins. Recognition sites of restriction enzymes used for cloning are shown in bold. Primer sequences are from 5' to 3'.

VH1 (SEQ ID NO: 34) TTT TGC GCG CAC TCC CAG GTG CAGCTG GTG CAG TCT GG VH2 (SEQ ID NO: 144) AATA TGC GCG CAC TCC CAG GTC ACCTTG AAG GAGTCT GG VH3 (SEQ ID NO: 35) TTT TGC GCG CAC TCC GAG GTG CAGCTG GTG GAG TCT GG VH4 (SEQ ID NO: 36) TTT TGC GCG CAC TCC CAG GTG CAGCTG CAG GAG TCG GG VH5 (SEQ ID NO: 145) AATA TGC GCG CAC TCC GAG GTG CAGCTG GTG CAG TCT G

JH1 (SEQ ID NO: 37) GAC GGT GAC CAG GGT GCC CTG GCCCCA JH2 (SEQ ID NO: 38) GAC GGT GAC CAG GGT GCC ACG GCCCCA JH3 (SEQ ID NO: 39) GAC GGT GAC CAT TGT CCC TTG GCCCCA JH4/5 (SEQ ID NO: 40) GAC GGT GAC CAG GGT TCC CTG GCCCCA JH6 (SEQ ID NO: 41) GAC GGT GAC CGT GGT CCC TTG GCCCCA VK1 (SEQ ID NO: 42) TTT GTG CAC TCC GAC ATC CAG ATGACC CAG TCT CC VK2 (SEQ ID NO: 43) TTT GTG CAC TCC GAT GTT GTG ATGACT CAG TCT CC VK3 (SEQ ID NO: 44) TTT GTG CAC TCC GAA ATT GTG TTGACG CAG TCT CC VK4 (SEQ ID NO: 45) TTT GTG CAC TCC GAC ATC GTG ATGACC CAG TCT CC VK5 (SEQ ID NO: 46) TTT GTG CAC TCC GAA ACG ACA CTCACG CAG TCT CC VK6 (SEQ ID NO: 47) TTT GTG CAC TCC GAA ATT GTG CTGACT CAG TCT CC JK1 (SEQ ID NO: 48) GAT CTC GAG CTT GGT CCC TTG GCCGAA JK2 (SEQ ID NO: 49) GAT CTC GAG CTT GGT CCC CTG GCCAAA JK3 (SEQ ID NO: 50) GAT CTC GAG TTT GGT CCC AGG GCCGAA

JK4 (SEQ ID NO: 51) GAT CTC GAG CTT GGT CCC TCC GCCGAA JK5 (SEQ ID NO: 52) AAT CTC GAG TCG TGT CCC TTG GCCGAA VL1 (SEQ ID NO: 53) TTT GTG CAC TCC CAG TCT GTG TTGACG CAG CCG CC VL2 (SEQ ID NO: 54) TTT GTG CAC TCC CAG TCT GCC CTGACT CAG CCT GC VL3A (SEQ ID NO: 55) TTT GTG CAC TCC TCC TAT GTG CTGACT CAG CCA CC VL3B (SEQ ID NO: 56) TTT GTG CAC TCC TCT TCT GAG CTGACT CAG GAC CC VLA (SEQ ID NO: 57) TTT GTG CAC TCC CAC GTT ATA CTGACT CAA CCG CC VL5 (SEQ ID NO: 58) TTT GTG CAC TCC CAG GCT GTG CTCACT CAG CCG TC VL6 (SEQ ID NO: 59) TTT GTG CAC TCC AAT TTT ATG CTGACT CAG CCC CA VL7 (SEQ ID NO: 60) TTT GTG CAC TCC CAG GCT GTG GTGACT CAG GAG CC JL1 (SEQ ID NO: 61) GGT AAG CTT GGT CCC AGT TCC GAAGAC JL2/3 (SEQ ID NO: 62) GGT AAG CTT GGT CCC TCC GCC GAA T

Table 2. Oligonucleotide primers used for PCR amplification of variable regions of human immunoglobulins. Recognition sites of restriction enzymes used for cloning are shown in bold. Primer sequences are indicated in the direction from 5' to 3'.

VH1a (SEQ ID NO: 63) AATA TGC GCG CAC TCC CAG GTG CAGCTG GTG CAG TCT GG VH2a (SEQ ID NO: 64) AATA TGC GCG CAC TCC CAG GTC ACCTTG AAG GAG TCT GG VH3a (SEQ ID NO: 65) AATA TGC GCG CAC TCC GAG GTGCAG CTG GTG GAG TCT GG VH4a (SEQ ID NO: 66) AATA TGC GCG CAC TCC CAG GTG CAGCTG CAG GAG TCG GG VH5a (SEQ ID NO: 67) AATA TGC GCG CAC TCC GAG GTGCAG CTG GTG CAG TCT G JH1a (SEQ ID NO: 68) GA GAC GGT GAC CAG GGT GCC CTGGCC CCA JH2a (SEQ ID NO: 69) GA GAC GGT GAC CAG GGT GCC ACGGCC CCA JH3a (SEQ ID NO: 70) GA GAC GGT GAC CAT TGT CCC TTGGCC CCA JH4/5a (SEQ ID NO: 71) GA GAC GGT GAC CAG GGT TCC CTGGCC CCA JH6a (SEQ ID NO: 72) GA GAC GGT GAC CGT GGT CCC TTGGCC CCA VK1a (SEQ ID NO: 73) CAGGA GTG CAC TCC GAC ATC CAGATG ACC CAG TCT CC VK2a (SEQ ID NO: 74) CAGGA GTG CAC TCC GAT GTT GTGATG ACT CAG TCT CC

VK3a (SEQ ID NO: 75) CAGGA GTG CAC TCC GAA ATT GTGTTG ACG CAG TCT CC VK4a (SEQ ID NO: 76) CAGGA GTG CAC TCC GAC ATC GTGATG ACC CAG TCT CC VK5a (SEQ ID NO: 77) CAGGA GTG CAC TCC GAA ACG ACACTC ACG CAG TCT CC VK6a (SEQ ID NO: 78) CAGGA GTG CAC TCC GAA ATT GTGCTG ACT CAG TCT CC JK1a (SEQ ID NO: 79) TT GAT CTC GAG CTT GGT CCC TTGGCC GAA JK2a (SEQ ID NO: 80) TT GAT CTC GAG CTT GGT CCC CTGGCC AAA JK3a (SEQ ID NO: 81) TT GAT CTC GAG TTT GGT CCC AGGGCC GAA JK4a (SEQ ID NO: 82) TT GAT CTC GAG CTT GGT CCC TCCGCC GAA JK5a (SEQ ID NO: 83) TT AAT CTC GAG TCG TGT CCC TTGGCC GAA VL1a (SEQ ID NO: 84) CAGAT GTG CAC TCC CAG TCT GTGTTG ACG CAG CCG CC VL2a (SEQ ID NO: 85) CAGAT GTG CAC TCC CAG TCT GCCCTG ACT CAG CCT GC VL3Aa (SEQ ID NO: 86) CAGAT GTG CAC TCC TCC TAT GTGCTG ACT CAG CCA CC VL3Ba (SEQ ID NO: 87) CAGAT GTG CAC TCC TCT TCT GAGCTG ACT CAG GAC CC VL4a (SEQ ID NO: 88) CAGAT GTG CAC TCC CAC GTT ATACTG ACT CAA CCG CC

VL5a (SEQ ID NO: 89) CAGAT GTG CAC TCC CAG GCT GTGCTC ACT CAG CCG TC VL6a (SEQ ID NO: 90) CAGAT GTG CAC TCC AAT TTT ATGCTG ACT CAG CCC CA VL7a (SEQ ID NO: 91) CAGAT GTG CAC TCC CAG GCT GTGGTG ACT CAG GAG CC JL1a (SEQ ID NO: 92) AC GGT AAG CTT GGT CCC AGT TCCGAA GAC JL2/3a (SEQ ID NO: 93) AC GGT AAG CTT GGT CCC TCC GCCGAA TAC

Example 2

Selection Strategies for Human Immunoglobulins Binding Specific Antigens

A vaccinia virus expression vector comprising a polynucleotide encoding a recombinant heavy chain immunoglobulin subunit polypeptide that confers specificity for a particular antigen when combined with certain unidentified light chains is selected as follows, e.g. Figure 1 shows. Selection of specific immunoglobulin heavy and light chains is done in two stages. First, using the pVHE constructed as described in Example 1 as a transfer plasmid, multiple recombinants from antibody-producing cells from unimmunized or immunized donors were constructed in poxvirus-based vectors by tripartite recombination (see Example 5). Chain libraries; similar libraries of immunoglobulin light chains were constructed in plasmid vectors such as pVKE and pVLE constructed as described in Example 1, where the expression of the recombinant gene was regulated by the p7.5 vaccinia promoter. The immunoglobulin heavy chain constant region in the poxvirus construct is designed to retain the transmembrane domain, resulting in expression of the immunoglobulin receptor on the surface membrane. Host cells, such as early stage B-cell lymphoma cells, are infected with a library of poxvirus heavy chains at a multiplicity of infection of 1 (MOI=1). Two hours later, the infected cells were transfected with the light chain plasmid library under conditions allowing the uptake and expression of an average of 10 or more individual light chain plasmids per cell. Because the expression of the recombinant gene in the plasmid is regulated by the vaccinia virus promoter, the recombinant gene product is expressed at a high level in the cytoplasm of cells infected with vaccinia virus without nuclear integration. Under these conditions, a single cell can express multiple antibodies in which different light chains combine with the same heavy chain to form the characteristic H2L2 structure in each infected cell.

2.1 Direct antigen-induced apoptosis. Early stage B-cell lymphoma host cells are infected with recombinant vaccinia virus encoding recombinant heavy chain immunoglobulin subunit polypeptide, and transfected with the plasmid encoding recombinant light chain immunoglobulin subunit polypeptide. Host cells respond to cross-linking of antigen-specific immunoglobulin receptors by inducing spontaneous growth arrest and programmed cell death. As outlined in Figure 1, the synthesis and assembly of antibody molecules is allowed to proceed for 12 hours or longer, during which specific antigens are presented on synthetic particles or polymers, or on the surface of antigen-expressing cells, in order to interact with any specific immunoglobulin Protein receptors cross-link and induce apoptosis in cells indicating expression of the selected antigen. Recombinant vaccinia virus genomes extracted from cells induced to undergo apoptosis are enriched for polynucleotides encoding immunoglobulin heavy chain genes conferring the desired specificity.

2.2 Indirect antigen-induced cell death. Early B-cell lymphoma host cells were transfected with a construct in which the promoter of an apoptosis-inducing gene (BAX promoter) drives exogenous cytotoxicity as shown in Figure 2A (lower panel) and 2B (upper panel) Expression of T cell epitopes. Host cells express CTL epitopes in response to cross-linking of antigen-specific immunoglobulin receptors, and these cross-linked cells undergo hydrolysis upon addition of specific CTLs. These stably transfected host cells are then infected with a recombinant vaccinia virus encoding a recombinant heavy chain immunoglobulin subunit polypeptide and transfected with a plasmid encoding a recombinant light chain immunoglobulin subunit polypeptide. As outlined in Figure 1, the synthesis and assembly of antibody molecules is allowed to proceed for 12 hours or longer, during which specific antigens are presented on synthetic particles or polymers, or on the surface of antigen-expressing cells, in order to render any specific immune Globulin receptors are cross-linked. When epitope-specific CTLs are added, cells whose surface immunoglobulin molecules are cross-linked undergo hydrolysis, which indirectly induces cell death.

2.3 Direct antigen-induced cell death. Early B-cell lymphoma host cells were transfected with a construct in which the promoter of an apoptosis-inducing gene (BAX promoter) drives diphtheria toxin as shown in Figure 2A (upper panel) and 2B (lower panel) Expression of the cytotoxic A subunit. Host cells express toxin subunits in response to cross-linking of antigen-specific immunoglobulin receptors, and these cross-linked cells undergo cell death. These stably transfected host cells are then infected with a recombinant vaccinia virus encoding a recombinant heavy chain immunoglobulin subunit polypeptide and transfected with a plasmid encoding a recombinant light chain immunoglobulin subunit polypeptide. As outlined in Figure 1, the synthesis and assembly of antibody molecules proceeds for 12 hours or longer, during which specific antigens are presented on synthetic particles or polymers, or on the surface of antigen-expressing cells, so that any specific Immunoglobulin receptors are cross-linked. Those cells whose surface immunoglobulin molecules are cross-linked undergo rapid and immediate cell death.

2.4 Discussion. The reason for the upregulation of the expression of these recombinant genes by cross-linked surface Ig receptors is that the expression of each of the two constructs is regulated by the promoter of a gene whose expression in early B-cell lymphoma cells Is naturally upregulated after Ig cross-linking. This can be illustrated by the BAX promoter. BAX is an example of a proapoptotic gene that is often upregulated in early B-cell lymphoma cells under these conditions. Regulatory regions (promoters) of other genes may perform as well or better. Such genes can be identified, for example, by comparing the gene expression profiles of early stage B cell lymphoma cells before and after crosslinking membrane Ig on a microarray.

Transfection of cells with a construct expressing the diphtheria A chain (dipA) resulted in more rapid apoptosis than through Ig crosslinking alone. More rapid cell death can be induced by the addition of specific cytotoxic T cells to certain target peptides associated with native MHC molecules expressed on the cell, small genes whose expression is regulated by BAX or BAX-like promoters coded. In addition, host cells other than early B-cell lymphoma cells are similarly engineered to express genes that induce, directly or indirectly, cell death upon antigenic cross-linking of surface immunoglobulin molecules, independent of program Cell apoptosis, which occurs in early B-cell lymphoma cell lines upon antigen cross-linking.

In the above selection process, a variety of matrices can be used to present the antigen and cross-link specific membrane immunoglobulin receptors. These include, but are not limited to, magnetic beads, protein-coated tissue culture plates, and cells transfected with a gene encoding an antigen of interest. Examples of cells that can be transfected for high expression of the antigen of interest include, but are not limited to, L cells and NIH 3T3 cells. However, if transfected cells are used to express and present recombinant antigens, it is necessary to first remove any host cells expressing antibodies reactive with the membrane antigens of the untransfected cells from the population of immunoglobulin-expressing host cells. This removal can be achieved by one or more rounds of adsorption to untransfected cells immobilized on a solid substrate. It is then possible to use transfectants expressing the antigen to positively select for cells expressing the specific recombinant antibody. In a preferred embodiment, alternating cycles of negative and positive selection are repeated until the desired enrichment is achieved.

In one embodiment of the positive selection step, antibody-expressing B lymphocytoma cells are adhered to a solid substrate to which B cell-specific anti-CD19 and/or anti-CD20 antibodies have been bound. Adhesive indicator cells are induced to undergo hydrolysis to release their cytoplasmic contents, including all viral immunoglobulin heavy chain recombinants, into the culture medium. Recombinant viruses harvested from cells and cell debris recovered from culture are enriched for those encoding immunoglobulin heavy chains that confer specificity for selected antigens when combined with certain as yet unidentified light chains. chain of recombinant virus. Additional rounds of antigen-driven selection in cells freshly infected with this enriched population of recombinant viruses and subsequently transfected with the same unselected starting plasmid population encoding the various light chains resulted in further enrichment of the recombinant virus of interest. chain. After repeating this selection process several times, a small number of heavy chains were isolated that had the best specificity for a particular antigen when combined with some unidentified light chains.

To select for a light chain that confers the desired specificity when combined with a previously selected heavy chain, host cells are infected by MOI = 1 with a library of light chain recombinants constructed in a vaccinia-based vector, followed by a previously selected Repeat the entire selection process as described above by performing transfection with a plasmid recombinant of one of the heavy chains. The antigen-driven selection process described above was performed for several cycles to isolate the best light chain partner for that heavy chain.

In another preferred embodiment, a similar strategy is performed using the binding properties of cells expressing specific antibodies on the membrane surface. The strategy, illustrated in Figure 5, does not use early stage B-cell lymphomas that respond apoptotically to receptor crosslinking as indicator cells, but rather by conjugation to synthetic particles or polymers conjugated to antigen, or to Host cells expressing the specificity of the immunoglobulin of interest are selected on the surface of transfected cells expressing the specific antigen. In this case, indicator cells were chosen for their ability to express high levels of membrane immunoglobulin receptors rather than for their apoptotic response to membrane immunoglobulin receptor crosslinking. Preferred cell lines include immunoglobulin negative plasmacytoma. Other issues related to the specificity, context and efficiency of the selection process were dealt with as described above.

Example 3

Antibodies with specific specificities are selected from a library of ¹⁰ immunoglobulin heavy and light chain combinations.

The affinity of specific antibodies that can be selected from a library is a function of the size of the library. In general, the greater the number of heavy and light chain combinations represented by the library, the greater the likelihood that high affinity antibodies will exist and be selected. Previous work using phage display suggested that, for many antigens, a library size of ¹⁰⁹ immunoglobulin heavy and light chain combinations was sufficient for the selection of relatively high avidity specific antibodies. Theoretically, it is possible to construct a library of ¹⁰⁹ recombinants, each of which expresses a unique heavy chain and a unique light chain, or has a combination comprising heavy and light chain variable regions Single-stranded constructs at the locus. But the most preferred approach is to generate this number of antibody combinations by constructing two libraries of ¹⁰ heavy and ¹⁰ light immunoglobulin chains that can co-express all ¹⁰ possible combinations . In this example, the pool of heavy chains has greater diversity, as heavy chains are often found to contribute more to specific antigen binding sites than the associated light chains.

3.1 Heavy chain genes. A vaccinia recombinant library with a titer of about 10 ⁶ was constructed from a minimum of 10 ⁵ immunoglobulin heavy chain cDNA transfer plasmid recombinants, wherein the plasmid recombinants were derived from 100 bone marrow cells by the method described above (Example 1). Donor pool for RNA synthesis. This library must be amplified to a titer of at least ¹⁰⁹ heavy chain recombinants as described below. A preferred method for amplifying the library is to infect a microculture of approximately 5 x ¹⁰⁴ BSC1 cells with a single pool of ¹⁰³ vaccinia heavy chain recombinants. Usually after 48 hours of infection, the virus titer can be amplified more than 1000 times. Amplifying viral titers in multiple separate pools can reduce the risk of losing recombinant subpopulations due to relatively rapid growth of competing subpopulations.

3.2 Light chain genes. A vaccinia recombinant library with a titer of about 10 ⁵ was constructed from a minimum of 10 ⁴ immunoglobulin light chain cDNA transfer plasmid recombinants, wherein the plasmid recombinants were synthesized from RNA derived from a bone marrow donor pool as described in Example 1 of. For the multiple rounds of selection of heavy chains described below, this library must be amplified to a titer of ¹⁰¹⁰ to ¹⁰¹¹ light chain recombinants. A preferred method for amplifying the library is to infect 100 microcultures of approximately 5 x ¹⁰⁴ BSC1 cells with a single pool of ¹⁰³ vaccinia light chain recombinants. Viral recombinants recovered from each of these 100 infected cultures were further amplified into individual pools with titers of approximately ¹⁰⁸ to ¹⁰⁹ viral recombinants. For convenience, these pools of light chains are labeled L1 to L100.

3.3 Selection of immunoglobulin heavy chain recombinants. 100 parts of 10 ⁷ cultures of non-producing myeloma cells, preferably Sp2/0, or early B-cell lymphoma, preferably CH33, were infected with live vaccinia heavy chain recombinants at MOI = 1, and simultaneously infected with MOI = 1 to 10 recombinant vaccinia light chains inactivated with psoralen (4'-aminomethyltrimethasalen) (see below). For psoralen inactivation, ¹⁰⁸ to ¹⁰⁹ pfu/ml of cell-free virus was treated with 10 μg/ml of psoralen for 10 minutes at 25°C and then exposed to long-wave UV light (365-nm)2 Minutes (Tsung, K., JHYim, W. Marti, RML Buller, and JANorton. J. Virol. 70:165-171 (1996)). Viruses treated with psoralen were unable to replicate but were able to express early viral genes, including recombinant genes under the control of early but not late viral promoters. Under these conditions, the light chains synthesized by the psoralen-treated recombinants could assemble into immunoglobulin molecules with the single heavy chains expressed in each infected cell.

The choice of MOI = 1 or MOI = 10 for infection with psoralen-inactivated light chain recombinants will affect the relative concentration of a specific H+L chain combination in a positive cell, i.e. high at MOI = 1, high at MOI = 1 It is lower at MOI=10 (due to dilution by multiple light chains). The concentration of specific immunoglobulin on the cell surface is low, and the corresponding density decreases, and antibodies with high affinity for the target ligand will be selected. On the other hand, high concentrations of specific receptors are expected to facilitate immunoglobulin receptor-mediated binding or signaling.

After the first round of antigen-specific selection by binding or signaling as described in Example 2, an enriched population of recombinant virus is recovered from each culture whose titer is likely to be that of the added virus during this primary selection Background levels of 1% to 10%, depending on non-specific binding or spontaneous release of virus. For convenience, the pools of heavy chain recombinants recovered in the first round of selection that obtained psoralen-treated virus from the starting light chain recombinant pools L1 to L100, respectively, were labeled Hla to H100a.

In order to perform the second round of selection under the same conditions as the first round, it is still necessary to amplify the titer of the recovered heavy chain recombinant by 10 to 100 times. For a second round of selection, live viral heavy chain recombinants and psoralen-treated light chain recombinants are then used to infect non-producing myelomas or early B-cell lymphomas, e.g. The same culture of ¹⁰ cells was infected with the heavy chain recombinant and the psoralen-treated light chain recombinant from the starting L37 pool used to select for H37a. For convenience, the heavy chain recombinants recovered from the H37a pool in the second round of selection were labeled as H37b et al.

After the second round of selection, specific viral recombinants may typically be enriched by a factor of 10 or more compared to the starting viral population. In this case, it is not necessary to perform a third round of selection under the same conditions as the first or second round, as specific clones are well represented even at 10-fold lower titers. Therefore for the third round of selection, ¹⁰⁶ non-producing myeloma or early B-cell lymphoma cells were infected with live viral heavy chain recombinants and psoralen-treated light chain recombinants from the same pool. 100 cultures. After the 5th round of selection, the number of infected cells can be reduced by another 10-fold.

3.4 Identification of antigen-specific heavy chain recombinants.

(a) After each round of selection, it can be determined whether the antigen-specific heavy chain in a particular pool (eg H37f) is enriched to 10% or more, which can be detected by picking 10 individual virus pfu from this heavy chain pool compared with the original Antigen specificity when the light chains of the L37 pool are linked. Since the light chain population contained ¹⁰⁴ different cDNAs distributed in 100 individual pools, each pool had an average of approximately ¹⁰² different light chains. Even if the selected heavy chain confers the desired antigenic specificity only when combined with a certain class of light chains from the available set of light chains, 1% of random cells infected with the selected heavy chain recombinant and MOI = 1 The cells of the light chain pool are capable of expressing the desired specificity. This frequency can be increased to an average of 10% if cells are infected with light chain at MOI=10. The preferred method of demonstrating specificity is to infect a CH33 early stage B-cell lymphoma cell line with a pool of immunoglobulin heavy and light chains that has been transfected with an easily detectable reporter construct, e.g. Luciferin driven by the promoter of the CH33 gene activated by membrane receptor crosslinking. If the selected heavy chain confers the desired antigen specificity when associated with any of the 100 or more light chains in the pool, infect with a pool of plaque-purified heavy chain recombinants and associated light chains This transfectant produces an easily detectable signal. Note that this same method can be used to analyze heavy chains, whether they are selected for by specific binding or specific signaling mediated by immunoglobulin receptors of infected cells.

(b) An alternative approach to identifying the most promising antigen-specific heavy chains is to screen for those most representative in the selected population. Inserts can be isolated by PCR amplification using vector-specific primers flanking the insertion site, and these inserts can be sequenced to determine the frequency of the sequence observed. However, in this case, it is still necessary to identify the relevant light chain as described below.

3.5 Selection of immunoglobulin light chain recombinants. Once the antigen-specific heavy chain is isolated, the light chain that confers antigen specificity when bound to the heavy chain can be isolated from the pool used for selection of the heavy chain as described in 3.4(a). Alternatively, another light chain that binds to the same heavy chain with increased affinity can be selected from a larger library. For this purpose, a library of vaccinia recombinants with a titer of approximately 10 ⁶ was constructed from a minimum of 10 ⁵ immunoglobulin light chain cDNA transfer plasmid recombinants synthesized by the method described previously (Example 1) . Reverse the procedure described in 3.3 and now use live viral light chain recombinants at MOI = 1 and selected psoralen-treated single specific heavy chain recombinants to infect non-producing myeloma or early B cell lymphoid tumor. To facilitate selection to higher affinity immunoglobulins, it is preferred to dilute the concentration of each specific H+L chain pair by infection with MOI=10 light chains.

3.6 Selection of immunoglobulin heavy chain recombinants in the presence of a single immunoglobulin light chain. The selection of immunoglobulin heavy chains that contribute to the specificity of a particular antibody can be simplified if a candidate light chain has been identified. This may be the case, for example, when a murine monoclonal antibody was previously selected. Mouse light chain variable regions can be grafted onto human light chain constant regions to optimize pairing with human heavy chains, a process previously termed "directed selection" by other investigators using phage display (Jespers, L.S., A. Roberts, S.M. Mahler, G.Winter, H.R., and Hoogenboom. Bio/Technology 12:899-903, 1994; Figini, M., L. Obici, D. Mezzanzanica, A. Griffiths, M.I. Colnaghi, G. Winters, and S. Canevari. Cancer Res. 58:991-996, 1998). In theory, this molecular matching could be further performed if the human variable region gene framework regions were also grafted onto the murine light chain variable region sequence (Rader, C., D.A. Cheresh, and C.F. Barbas, Proc. Natl. Acad . Sci. USA 95:8910-8915). Any human heavy chain selected to pair with this modified antigen-specific light chain can itself serve as the basis for selecting the best human light chain from a more diverse set as described in 3.5.

Example 4

Selection of specific human antibodies from cDNA libraries constructed in adenoviral, herpesviral or retroviral vectors

4.1 Herpes virus. Methods for generating helper virus-free stocks of recombinant infectious Herpes Simplex Virus Amplicons have been described (T.A. Stavropoulos, C.A. Strathdee. 1998 J. Virology 72:7137-7143). Using this approach, cDNA libraries constructed of human immunoglobulin heavy and/or light chain genes or fragments thereof (including single-stranded fragments) in plasmid amplicon vectors have the potential to be packaged into libraries of infectious amplicon particles . An amplicon library constructed from an immunoglobulin heavy chain gene and another amplicon library constructed from an immunoglobulin light chain gene can be co-infected with non-producing myeloma cell lines. By selecting for binding to an antigen of interest, myeloma cells expressing a combination of immunoglobulin genes with a desired specificity can be enriched for. Herpesvirus amplicons enable stable expression of transgenes in infected cells. Cells selected for binding in the first round will retain their immunoglobulin gene repertoire and stably express antibodies with this specificity. This allows for repeated selection cycles until an immunoglobulin gene with the desired specificity is isolated. Selection strategies that lead to cell death can also be tried. Amplicon vectors recovered from those dead selected cells cannot be used to infect fresh target cells because, in the absence of helper virus, these amplicons are replication-defective and cannot be packaged into an infectious form. The amplicon vector contains a plasmid origin of replication and an antibiotic resistance gene. This allows recovery of selected amplicon vectors by transformation of DNA purified from selected cells into bacteria. Selection with an appropriate antibiotic enables the isolation of bacterial cells that have been transformed with the amplicon vector. If different antibiotic (eg, ampicillin and kanamycin) resistance genes are used for the heavy and light chain amplicon vectors, the heavy and light chain genes can be selected separately from the same selected cell population. Amplicon plasmid DNA can be extracted from bacteria and packaged into infectious virus particles by co-transfecting packaging cells with amplicon DNA and packaging-deficient HSV genomic DNA. The infectious amplicon particle can then be harvested and used to infect a fresh population of target cells for another round of selection.

4.2 Adenovirus. Methods for preparing recombinant adenoviruses have been described (S. Miyake, M. Makimura, Y. Kanegae, S. Harada, Y. Sato, K. Takamori, C. Tokuda, I. Saito. 1996 Proc. Natl. Acad. Sci.USA 93:1320-1324; T.C.He, S.Zhou, L.T.Da Costa, J.Yu, K.W.Kinzler, B.Volgelstein.1998 Proc.Natl.Acad.Sci.USA 95:2509-2514). Using one of these methods, cDNA libraries can be constructed in adenoviral vectors. Insertion of the cDNA into the E3 or E4 region of the adenovirus will result in a replication-competent recombinant virus. This library can be used in similar applications, such as the construction of a vaccinia cDNA library by trimolecular recombination. For example, a heavy chain cDNA library can be inserted into the E3 or E4 region of an adenovirus. This will generate a replicable heavy chain library. The light chain cDNA library can be inserted into the El gene of adenovirus to generate a replication deficient library. The replication-deficient light chain library can be amplified by infecting cells that provide adenovirus E1 in trans, such as 293 cells. These two libraries can be used in a selection strategy similar to that already described using a replicable vaccinia heavy chain library and a psoralen-inactivated vaccinia light chain library.

4.3 Advantages of vaccinia virus. Vaccinia virus has several advantages over herpes virus or adenovirus in constructing cDNA libraries. First, vaccinia virus replicates in the cytoplasm of the host cell, whereas HSV and adenovirus replicate in the nucleus. For vaccinia virus, the frequency of recombination in the cytoplasm of the cDNA recombination transfer plasmid is higher than that of HSV or adenovirus for packaging/recombination in the nucleus. Second, vaccinia virus can replicate plasmids in a sequence-independent manner, whereas adenovirus or herpesvirus cannot (M. Merchlinsky, B. Moss. 1988 Cancer Cells 6:87-93). Replication of cDNA recombinant transfer plasmids in vaccinia may result in higher frequency production of recombinant virus. Although we describe the possibility of constructing cDNA libraries in herpes virus or adenoviral vectors, it should be emphasized that the construction of cDNA libraries in these viral vectors using these methods has not been reported.

4.4 Retroviruses. Construction of cDNA libraries in replication-defective retroviral vectors has been described (T. Kitamura, M. Onishi, S. Kinoshita, A. Shibuya, A. Miyajima, and G.P. Nolan. 1995 PNAS 92:9146-9150; I. Whitehead, H. Kirk, and R. Kay. 1995 Molecular and Cellular Biology 15: 704-710.). Retroviral vectors are integrated after infection of target cells, and retroviral vectors have been widely used because they can efficiently transduce target cells and induce stable transgene expression. A retroviral cDNA library constructed using immunoglobulin heavy chain genes and another retroviral library using immunoglobulin light chain genes can be used to co-infect non-producing myeloma cell lines. By selecting for binding to an antigen of interest, myeloma cells expressing a combination of immunoglobulin genes with the desired specificity can be enriched for. Cells selected by binding in the first round will retain their immunoglobulin gene repertoire and stably express immunoglobulins with that specificity. This allows the selection cycle to be repeated until an immunoglobulin gene with the desired specificity is isolated.

Example 5

Trimolecular recombination

5.1 Preparation of expression library. This example describes a three-molecular recombination method using modified vaccinia vectors and associated transfer plasmids to generate nearly 100% recombinant vaccinia and for the first time to efficiently construct representative DNA in vaccinia library. Figure 6 illustrates the three-molecule recombination method.

5.2 Construction of the vector. The previously described vaccinia transfer plasmid pJ/K (a plasmid derived from pUC13) carries the vaccinia thymidine kinase gene containing an in-frame NotI site (Merchlinsky, M. et al., Virology 190:522-526), which It was further modified to carry a strong vaccinia virus promoter followed by Not I and Apa I restriction sites. Two different vectors, p7.5/tk and pELJtk, included the 7.5K vaccinia promoter or the strong synthetic early/late (E/L) promoter, respectively (Figure 7). The Apa I site is preceded by a strong translation initiation sequence including an ATG codon. This modification was introduced in the vaccinia virus thymidine kinase (tk) gene, flanked by the regulatory and coding sequences of the viral tk gene. Modifications within the tk gene in these two new plasmid vectors were transferred by homologous recombination of the flanking tk sequences into the genome-derived vNotI-vector of the vaccinia WR strain, resulting in new viral vectors v7.5/tk and vEL/tk . Importantly, Not I and Apa I restriction enzyme digestion of these viral vectors isolated two large viral DNA fragments, each containing a separate non-homologous segment of the vaccinia tk gene and together containing All genes required for assembly of infectious virus particles. Example 1 describes additional details regarding the construction and characterization of these vectors, as well as their further use in vaccinia virus for direct ligation of DNA fragments.

5.3 Increase the frequency of vaccinia virus recombinants. A conventional method for producing recombinants in vaccinia virus utilizes homologous recombination between the recombinant vaccinia transfer plasmid and the viral genome. Table 3 shows the results of a model experiment to determine the frequency of homologous recombination following transfection of recombinant transfer plasmids into vaccinia virus-infected cells under standard conditions. To facilitate functional testing, a minigene encoding the immunodominant 257-264 peptide epitope of ovalbumin linked to H-2K ^b was inserted into the NotI site of the tk gene of the transfer plasmid. As a result of homologous recombination, the interrupted tk gene was replaced by the wild-type tk+ gene in all recombinant viruses. This could serve as a marker for recombination, as tk-human 143B cells infected with tk-virus are resistant to BrdU toxicity, unlike cells infected with wild-type tk+ virus. Recombinant virus can be scored by virus pfu on 143B cells grown in the presence of 125 mM BrdU.

The frequency of recombinants obtained in this way was of the order of 0.1% (Table 3).

Table 3: Production of recombinant vaccinia viruses by conventional homologous recombination Virus* dna Titer w/o BrdU Full scale w/BrdU % recombinant** vaccinia --- 4.6×10 ⁷ 3.0×10 ³ 0.006 vaccinia 30ng pE/Lova 3.7×10 ⁷ 3.2×10 ⁴ 0.086 vaccinia 300ng pE/Lova 2.7×10 ⁷ 1.5×10 ⁴ 0.056

*Vaccinia virus strain vNotI

**% recombinant = (titer with BrdU/titer without BrdU) × 100

Such recombination frequencies are too low to efficiently construct cDNA libraries in vaccinia vectors. The following two steps were used to generate higher frequencies of vaccinia virus recombinants.

(1) A limiting factor in the frequency with which viral recombinants can be generated by homologous recombination after transfection of plasmid transfer vectors into vaccinia virus-infected cells is the high efficiency of viral infection and the relative inefficiency of plasmid DNA transfection. As a result, many infected cells did not take up the recombinant plasmid and thus could only produce wild-type virus. To reduce dilution for recombination efficiency, a mixture of naked viral DNA and recombinant plasmid DNA was transfected into mammalian cells infected with fowlpox virus (FPV). As previously described by other researchers (Scheiflinger, F. et al., 1992, Proc. Natl. Acad. Sci. USA 89: 9977-9981), FPV does not replicate in mammalian cells, but can be used for transfection of non-infectious cells. Cells with sexually naked vaccinia DNA provide the accessory functions necessary for the packaging of mature vaccinia virus particles. This modification of the homologous recombination technique alone was able to increase the frequency of viral recombinants approximately 35-fold to 3.5% (Table 4).

Table 4: Production of recombinant vaccinia viruses by modified homologous recombination.

Virus dna Titer w/o BrdU Titer w/BrdU % recombinant PFV none 0 0 0 none Vaccinia WR 0 0 0 PFV Vaccinia WR 8.9×10 ⁶ 2.0×10 ² 0.002 PFV Vaccinia WR+pE/Lova (1:1) 5.3×10 ⁶ 1.2×10 ⁵ 2.264 PFV Vaccinia WR+pE/Lova (1:10) 8.4×10 ⁵ 3.0×10 ⁴ 3.571

*% recombinant = (titer with BrdU/titer without BrdU) × 100

Table 4. Infection of confluent BSC1 cells (5×10 ⁵ cells/well) with fowlpox virus strain HP1 at MOI=1.0. Two hours later, the supernatant was aspirated, the cells were washed twice with Opti-MemI medium, and 600ng of vaccinia strain WR genomic DNA was used alone or with plasmid pE at a molar ratio of 1:1 or 1:10 (vaccinia:plasmid) through lipofectamine. /Lova transfection. This plasmid contains a fragment of ovalbumin cDNA encoding the SIINFEKL epitope, which is known to bind with high affinity to the mouse MHC class I molecule ^Kb . Expression of this minigene is regulated by a strong synthetic early/late vaccinia promoter. The insert is flanked by vaccinia tk DNA. Cells were harvested three days later and virus was extracted by three cycles of freeze/thaw in a dry ice isoamyl alcohol/37°C water bath. Titers of crude virus stocks were determined by plaque assay on human TK-143B cells with and without BrdU.

(2) Another significant increase in the frequency of viral recombinants was achieved by transfecting FPV-infected cells with a mixture of recombinant plasmids and two large approximately 80 kb and 100 kb vaccinia v7.5/tk DNA fragments , wherein the two fragments were digested with Not I and Apa I restriction endonucleases. Because the Not I and Apa I sites had been introduced into the tk gene, each of these large vaccinia DNA arms included a segment of the tk gene. Since there is no homology between the two tk gene segments, the only way the two vaccinia arms could be joined was by bridging by homologous tk sequences flanking the insert in the recombinant transfer plasmid. The results in Table 5 show that more than 99% of the infectious vaccinia viruses produced in the triple transfected cells recombined the DNA insert as determined by the BrdU resistance of the infected tk-cells.

Table 5: Production of 100% recombinant vaccinia virus using trimolecular recombination.

Virus DNA Titer w/oBrdU Full scale w/BrdU % recombinant* PFV v7.5/tk without cutting 2.5×10 ⁶ 6.0×10 ³ 0.24 PFV NotI/Apal v7.5/tk arm 2.0×10 ² 0 0 PFV NotI/Apal v7.5/tk arm+pE/Lova (1:1) 6.8×10 ⁴ 7.4×10 ⁴ 100

*% recombinant = (titer with BrdU/titer without BrdU) × 100

Table 5. Digestion of genomic DNA (1.2 μg) of vaccinia strain V7.5/tk with ApaI and NotI restriction enzymes. Divide the digested DNA in two. One part was mixed with pE/Lova at a 1:1 (vaccinia:plasmid) molar ratio. This plasmid contains a fragment of ovalbumin cDNA encoding the SIINFEKL epitope, which is known to bind with high affinity to the mouse MHC class I molecule ^Kb . Expression of this minigene is regulated by a strong synthetic early/late vaccinia promoter. The insert is flanked by vaccinia tk DNA. DNA was transfected with lipofectamine into a confluent monolayer of BSC1 cells (5×10 ⁵ cells/well) that had been previously infected with FPV at MOI=1.0 for two hours. One sample was transfected with 600 ng of untreated genomic V7.5/tk DNA. Cells were harvested three days later and virus was extracted by three cycles of freeze/thaw in a dry ice isoamyl alcohol/37°C water bath. Titers of crude virus stocks were determined by plaque assay on TK-143B cells with and without BrdU selection.

5.4 Construction of a representative cDNA library in vaccinia virus. A cDNA library was constructed in vaccinia vectors to show that known cellular mRNA sequences were representatively expressed. Additional modifications were introduced in the p7.5/tk transfer plasmid and v7.5/tk viral vector in order to increase the efficiency of recombinant expression in infected cells. The modifications included the introduction of translation initiation sites in three different reading frames, translation and transcription termination signals, and other restriction sites for DNA insertion.

First, the HindIII J fragment of p7.5/tk (vaccinia tk gene) was subcloned from this plasmid into the HindIII site of pBS phagemid (Stratagene) to generate pBS.Vtk.

Secondly, pBS.Vtk was digested with SmaI and PstI, a part of the original multiple cloning site of the plasmid was removed, treated with mung bean nuclease, and re-ligated to generate pBS.Vtk.MCS-. This treatment removes the SmaI, BamHI, SalI and PstI single restriction sites in pBS.Vtk.

Again, the aim here was to introduce a new multiple cloning site downstream of the 7.5k promoter in pBS.Vtk.MCS-. This new multiple cloning site was generated by PCR using 4 different upstream primers and a common downstream primer. These 4 PCR products will either lack the ATG start codon or contain the ATG start codon in each of the three possible reading frames. In addition, each PCR product contains translation stop codons for three reading frames at the 3' end, as well as a dual vaccinia transcriptional stop signal. These 4 PCR products were respectively connected to the NotI/ApaI site of pBS.Vtk.MCS-, resulting in 4 vectors, p7.5/ATGO/tk, p7.5/ATG1/tk, p7.5/ATG2/tk , and p7.5/ATG3/tk, Figure 12 shows their sequence modifications relative to p7.5/tk. Each vector includes BamHI, SmaI, PstI and SalI single restriction sites for cloning DNA inserts, either using their own endogenous translation initiation site (in p7.5/ATGO/tk vectors), or A vector translation initiation site in one of three possible reading frames (p7.5/ATG1/tk, p7.5/ATG3/tk and p7.5/ATG4/tk) was utilized.

In a model experiment, cDNA was synthesized from poly-A+ mRNA from a murine tumor cell line (BCA39) and ligated into each of four modified p7.5/tk transfer plasmids. Transfer plasmids are amplified by passaging in prokaryotic host cells such as E. coli as described herein or by other methods known in the art. Twenty micrograms of Not I and Apa I digested v/tk vaccinia virus DNA arms and an equimolar mixture of the four recombinant plasmid cDNA libraries were transfected into BSC-1 cells infected with FPV helper virus for trimolecular recombination. The total titer of the harvested virus was 6×10 ⁶ pfu, more than 90% of which were BrdU-resistant.

To determine the size distribution of cDNA inserts in recombinant vaccinia libraries, single isolated plaques were picked with sterile Pasteur pipettes and transferred to 1.5 ml tubes containing 100 ul of phosphate buffered saline (PBS). Viruses were released from cells by three cycles of freeze/thaw at 37°C in dry ice/isoamyl alcohol. Approximately one-third of each viral plaque was used to infect one well of a 12-well plate containing tk-human 143B cells in a final volume of 250ul. At the end of the two hour infection period, each well was covered with 1 ml of DEME containing 2.5% fetal bovine serum (DEME-2.5) and BudR, an amount of Brd11 sufficient to achieve a final concentration of 125 ug/ml. Cells were incubated for 3 days at 37°C in a CO ₂ incubator. The cells were harvested on day 3, pelleted by centrifugation, and resuspended in 500 μl PBS. Virus was released from cells by three freeze/thaw cycles as described above. Confluent monolayers of BSC-1 cells in 50 mm tissue culture dishes were infected with 20% of each virus stock in a final volume of 3 ml DEME-2.5. At the end of the 2 hour infection period, cells were overlaid with 3 ml DMEM-2.5. Cells were incubated at 37C in a _CO2 incubator for 3 days. On day 3, cells were harvested, pelleted by centrifugation, and resuspended in 300 μl PBS. Virus in cells was released by three freeze/thaw cycles as described above. Transfer 100 μl of crude virus stock solution to a 1.5ml test tube, add an equal volume of melted 2% low-melting point agarose, and transfer the virus/agarose mixture to the pulse-field gel sample well. After the agar had solidified they were removed from the sample wells and cut into three equal portions. All triplicates were transferred to the same 1.5ml tube and 250[mu]l 0.5M EDTA, 1% Sarkosyl and 0.5mg/ml proteinase K were added. The strips were incubated in the solution at 37°C for 24 hours. After washing several times in 500 μl of 0.5X TBE buffer, transfer a portion of each gel piece to one well of a 1% low melting point agarose gel. After adding the strips, the wells were sealed by adding additional melted 1% low melting point agarose. The gel was then electrophoresed in 0.5X TBE for 16 hours at 200 volts, 8 second pulse time, in a Bio-Rad pulsed field gel electrophoresis apparatus. The gel was stained in EB, and the agarose portion containing the vaccinia genomic DNA was excised from the gel and transferred to a 1.5 ml tube. Vaccinia DNA was purified from agarose using β-agarase (Gibco) following the manufacturer's recommendations. Resuspend the purified vaccinia DNA in 50ul ddH ₂ O. 1 μl of each DNA stock solution was used as a template for polymerase chain reaction (PCR) using vaccinia TK-specific primers MM428 and MM430 (on the side of the insertion site) and Klentaq polymerase (Clontech) in 20 μl according to the manufacturer’s recommendation in the final volume. Reaction conditions included an initial denaturation step at 95°C for 5 min, followed by 30 cycles of 94°C for 30 s, 55°C for 30 s, and 68°C for 3 min. 2.5 μl of each PCR reaction system was separated on 1% agarose gel and stained with EB. Amplified fragments of different sizes were observed. Corrected for flanking vector sequences amplified in PCR, the size of the insert ranged from 300 to 2500 bp.

Representative expression of gene products in this library was established by showing that the frequency of specific cDNA recombinants in the vaccinia library was indistinguishable from that of the same cDNA recombinants in the standard plasmid library. This is illustrated in Table 6 for IAP sequences previously shown to be upregulated in murine tumors. Twenty individual pools from the vaccinia library, each averaging 800 or 200 virus pfu, were amplified by infecting microcultures of 143Btk-cells in the presence of BDUR. After 3 days, DNA was extracted from each infected culture, and sequence-specific primers were used to detect the presence of previously identified endogenous retrovirus (IAP, intracisternal A particle) sequences by PCR. Poisson analysis of the positive pool frequencies indicated a frequency of approximately one IAP recombinant per 500 pfu of virus (Table 6). Similarly, 20 individual pools from the plasmid library with an average of 1400 or 275 bacterial cfu were amplified by transformation of DH5α bacteria. Plasmid DNA from each pool was tested for the presence of identical IAP sequences. Poisson analysis of the positive pool showed a frequency of 1 IAP recombinant per 450 plasmids (Table 6).

Limiting dilution analysis of the IAP sequence in the table 6 recombinant vaccinia library and conventional plasmid cDNA library PCR# positive well F ₀ mu frequency #PFU/well vaccinia library 800 18/20 0.05 2.3 1/350 200 6/20 0.7 0.36 1/560 #PFU/well Plasmid library 1400 20/20 0 - - 275 9/20 0.55 0.6 1/450

F ₀ = proportion of negative wells; μ = DNA precursor/well = -lnF ₀

A similar analysis of alpha-tubulin sequence display in vaccinia libraries yielded similar results. The frequencies of randomly selected sequences were comparable in the two libraries constructed from the same tumor cDNA, suggesting that although construction of vaccinia libraries is more complex and certainly less routine than construction of plasmid libraries, tumor cDNA sequences can equally be represented.

discuss

The tripartite recombination strategy described above can generate nearly 100% viral recombinants. This is a significant improvement over the current method of preparing viral recombinants by transfecting cells infected with vaccinia virus with a plasmid transfer vector. The latter method produces viral recombinants at a frequency of only on the order of 0.1%. The high yield of viral recombinants in tripartite recombination allowed for the first time efficient construction of genomic or cDNA libraries in vaccinia virus-derived vectors. In the first experiments, recombinant virus titers of 6 x ¹⁰⁶ were obtained after transfection with 20 μg of a mixture of NotI and ApaI digested vaccinia vector arms together with equimolar concentrations of tumor cell cDNA. This technological advancement has created new and efficient screening and selection strategies for isolating specific genomic and cDNA clones.

The trimolecular recombination method described here can be used with other viruses, such as mammalian viruses, including vaccinia and herpes viruses. Typically two viral arms with no homology are produced. The only way the two viral arms can be joined is by bridging by homologous sequences flanking the insert in a transfer vector such as a plasmid. When both viral arms and transfer vector are present in the same cell, the only infectious virus produced is a recombinant of the DNA insert in the transfer vector.

Libraries constructed in vaccinia and other mammalian viruses by the trimolecular recombination method of the present invention have similar advantages to those described herein for vaccinia virus and its use in the CTL screening system of the present invention for identifying target antigens. DNA libraries constructed from vaccinia or other mammalian viruses are expected to have similar advantages for more complex analysis in eukaryotic cells. Such assays include, but are not limited to, screening for DNA encoding eukaryotic cell receptors and ligands.

Example 6

Preparation of transfer plasmid

Transfer vectors for cloning can be prepared by known methods. A preferred method involves cleavage of 1-5 micrograms of the vector with a suitable restriction enzyme (eg SmaI, SalI or BamHI and SalI) in a suitable buffer at a suitable temperature for at least 2 hours. The linearly digested vector was separated by electrophoresis of the digested vector on a 0.8% agarose gel. The linearized plasmid was excised from the gel and purified from agarose using known methods.

connect. The cDNA and the digested transfer vector are ligated together by known methods. In a preferred method, T4 DNA ligase is used to ligate 50-100ng of the transfer vector with different concentrations of cDNA, using a suitable buffer at 14°C for 18 to 24 hours.

transform. The sample solution of the ligation reaction is transformed into Escherichia coli such as DH10B or DH5α by electroporation using a known method. The transformation reaction was plated on LB agar plates containing a selection antibiotic (ampicillin) and grown at 37°C for 14-18 hours. All transformed bacteria are pooled together, and plasmid DNA is isolated by known methods.

The preparation of the buffers mentioned above in accordance with the description of the preferred methods of the invention will be obvious to the person skilled in the art.

Example 7

Introducing vaccinia virus DNA fragments and transfer plasmids into tissue culture cells for trimolecular recombination

cDNA or other libraries were constructed in the 4 transfer plasmids as described in Example 5 or by other techniques known in the art. The cDNA library was introduced into vaccinia virus by trimolecular recombination. Confluent BSC1 monolayer cells were infected with fowl pox virus HP1 at MOI = 1-1.5. Infections were performed in serum-free medium supplemented with 0.1% bovine serum albumin. BSC1 cells can be plated in 12- or 6-well plates, 60mm or 100mm tissue culture plates, or in 25cm ² , 75cm ² , or 150cm ² bottles. Purified DNA from v7.5/tk or vEL/tk was digested with restriction enzymes ApaI and NotI. After the digestion was complete, the enzyme was heat-inactivated and the digested vaccinia arm was purified on a centricon 100 column. A transfection complex is then formed between the digested vaccinia DNA and the transferred plasmid cDNA library. Lipofectamine or Lipofectamine Plus (Life Technologies, Inc.) is preferably used to form these transfection complexes. Transfections in 12-well plates typically require 0.5 µg of digested vaccinia DNA and 10 ng to 200 ng of plasmid DNA from the library. Transfections performed in larger culture tubes require proportionally increased amounts of vaccinia DNA and transfer plasmid. After infection at 37°C for 2 hours, fowlpox virus was removed, vaccinia DNA was added, and plasmid transfection complexes were transferred. Cells were incubated with the transfection complex for 3 to 5 hours, after which time the transfection complex was removed and replaced with 1 ml of DMEM supplemented with 2.5% fetal bovine serum. Cells were cultured at 37 °C for 3 days in a CO _incubator . Cells were harvested after 3 days and virus was released by three cycles of freeze/thaw in dry ice/isoamyl alcohol/37°C water bath.

Example 8

Infect mammalian cells

This example describes other methods of transfecting cells with vaccinia DNA and transfer plasmids. Trimolecular recombination can be performed by transfecting digested vaccinia DNA and transfer plasmids into host cells using, for example, the calcium phosphate precipitation method (F.L. Graham, A.J. Vander Eb (1973) Virology 52:456-467, C .Chen, H.Okayama (1987) Mol.Cell.Biol.7:2745-2752), DEAE-Dextran (D.J.Sussman, G.Milman (1984) Mol.Cell.Biol.4:1641-1643), or electro Perforation (T.K. Wong, E. Neumann (1982) Biochem. Biophys. Res. Commun. 107: 584-587, E. Neumann, M. Schafer Ridder, Y. Wang, P. H. Hofschneider (1982) EMBO J. 1: 841-845 ).

Example 9

Construction of MVA Trimolecular Recombinant Vector

In order to construct a modified vaccinia Ankara (MVA) vector suitable for trimolecular recombination, two single-cut restriction endonuclease sites must be inserted in the MVA tk gene. The complete MVA genome sequence is known (GenBank U94848). A search of the sequence revealed that the restriction enzymes AscI, RsrII, SfiI, and XmaI do not cleave the MVA genome. We chose restriction endonucleases AscI and XmaI because these two enzymes are readily available, and the recognition sequence sizes of AscI and XmaI are 8bp and 6bp, respectively. To introduce these sites into the MVA tk gene, a construct was prepared containing a reporter gene (E. coli gusA) flanked by XmaI and AscI sites. The Gus gene can be obtained from pCRII.Gus (M. Merchlinsky, D. Eckert, E. Smith, M. Zauderer. 1997 Virology 238:444-451). This reporter gene construct was cloned into a transfer plasmid containing the vaccinia tk DNA flanking sequence and the early/late 7.5k promoter controlling expression of the reporter gene. The Gus gene was PCR amplified from this construct using Gus specific primers. Gus sense strand 5'

ATGTTACGTCCTGTAGAAACC 3' (SEQ ID NO:94), and Gus antisense strand 5'TCATTGTTTGCCTCCCTGCTG 3' (SEQ ID NO:95). The Gus PCR product was then amplified by PCR using Gus-specific primers, wherein the primers had been modified so that the sense primer contained NotI and XmaI sites, and the antisense primer contained AscI and ApaI sites. The sequences of these primers are:

NX-Gus sense 5'AAAGCGGCCGCCCCGGGATGTTACGTCC3' (SEQ ID NO: 96); and

AA-Gus antisense 5'AAAGGGCCCGGCGCGCCTCATTGTTTGCC3' (SEQ ID NO: 97).

This PCR product was digested with NotI and ApaI and cloned into the NotI and ApaI sites of p7.5/tk (M. Merchlinsky, D. Eckert, E. Smith, M. Zauderer. 1997 Virology 238:444-451). The 7.5k-XmaI-gusA-AscI construct was introduced into MVA by conventional homologous recombination in permissive QT35 or BHK cells. Selection of recombinant phages by staining with the Gus substrate X-Glu (5-bromo-3 indole-ss-D-glucuronic acid; Clontech) (M.W. Carroll, B. Moss. 1995 Biotechniques 19:352-355) spot. The MVA-Gus clone (which also contains XmaI and AscI single restriction sites) was plaque purified to homogeneity. Large-scale cultures of MVA-Gus were expanded on BHK cells and naked DNA was isolated from purified virus. After digestion with XmaI and AscI, MVA-Gus DNA was used for trimolecular recombination to construct a cDNA expression library in MVA.

MVA cannot complete its life cycle in most mammalian cells. This attenuation will result in longer periods of high-level expression of recombinant cDNAs, but no recovery of viable MVA from infected cells. Failure to recover viable MVA from selected cells will prevent the repeated selection cycles necessary to isolate functional cDNA recombinants of interest. One solution to this problem is to infect cells already infected with MVA with a helper virus that compensates for the host-range deficiency of MVA. The helper virus provides the gene products that MVA lacks and are necessary to complete its life cycle. It is unlikely that another helper virus with restricted host range (such as fowlpox virus) could also compensate for the MVA deficiency, since these viruses are also restricted in mammalian cells. Wild-type strains of vaccinia virus should be able to compensate for MVA. In this case, however, the generation of replication-competent vaccinia viruses would complicate the cycle of selection and isolation of recombinant MVA clones. A conditionally deficient vaccinia virus that provides the helper functions required to recover viable MVA from mammalian cells under non-permissive conditions, but does not produce replication-competent virus, can be used. The vaccinia D4R open reading frame (orf) encodes uracil DNA glycosylase. This enzyme is required for vaccinia virus replication, is expressed early after infection (before DNA replication), and disruption of this gene is lethal to vaccinia. Stably transfected mammalian cell lines expressing the vaccinia D4R gene have been shown to be able to compensate for D4R-deficient vaccinia viruses (G.W. Holzer, F.G. Falkner. 1997 J. Virology 71:4997-5002). D4R-deficient vaccinia virus is an excellent candidate helper virus capable of compensating MVA in mammalian cells.

In order to construct a D4R compensating cell line, using primers D4R sense strand 5'AAAGGATCCATAATGAATTC AGTGACTGTA TCACACG 3' (SEQ ID NO: 98) and D4R antisense strand 5' CTTGCGGCCG CTTAATAAATAAACCCTTGA GCCC 3' (SEQ ID NO: 99), from the vaccinia strain D4R orf was cloned by PCR amplification in v7.5/tk. The sense primer has been modified to include a BamHI site, and the antisense primer has been modified to include a NotI site. After PCR amplification and digestion with BamHI and NotI, D4R orf was cloned into the BamHI and NotI sites of pIRESHyg (Clontech). This mammalian expression vector contains a strong CMV immediate early promoter/enhancer and an ECMV internal ribosome entry site (IRES). The D4RIRESHyg construct was transfected into BSC1 cells and transfected clones were selected with hygromycin. IRES enables efficient translation of polycistronic mRNAs containing the D4R orf at the 5' end and the hygromycin phosphotransferase gene at the 3' end. This will allow a high frequency of hygromycin resistant clones with the desired function (these clones express D4R). BSC1 cells expressing D4R (BSC1.D4R) are able to compensate for D4R-deficient vaccinia, allowing the production and propagation of the deficient strain.

To construct D4R-deficient vaccinia, the D4R orf (100732 to 101388 positions of the vaccinia genome) and flanking sequences of 983 bp (5' end) and 610 bp (3' end) were amplified from the vaccinia genome by PCR. Primer D4R flanked by sense 5'ATTGAGCTCTTAATACTTTT GTCGGGTAAC AGAG 3' (SEQ ID NO: 100), and D4R flanked by antisense 5'TTACTCGAGA GTGTCGCAAT TTGGATTTT 3' (SEQ ID NO: 101) contained SacI (sense strand) and XhoI (antisense) sites, which amplify positions 99749 to 101998 of the vaccinia genome. This PCR product was cloned into the SacI and XhoI sites of pBluescript II KS (Stratagene), generating pBS.D4R.Flank. The D4R gene contains an EcoRI single restriction site starting at nucleotide 3 of the 657bp orf, and a PstI single restriction site starting at the nucleotide 433 of the orf. Insertion of the Gus expression cassette at the EcoRI and PstI sites of D4R will remove most of the D4R coding sequence. A 7.5k promoter-Gus expression vector has been constructed (M.Merchlinsky, D.Eckert, E.Smith, M.Zauderer.1997 Virology 238:444-451). The 7.5-Gus expression cassette was isolated from this vector by PCR using primers 7.5 Gus sense 5'AAAGAATTCC TTTATTGTCATCGGCCAAA 3' (SEQ ID NO: 102) and 7.5 Gus antisense 5'AATCTGCAGTCATTGTTTGC CTCCCTGCTG 3' (SEQ ID NO: 103). The 7.5Gus sense primer contains an EcoRI site, and the 7.5Gus antisense primer contains a PstI site. After PCR amplification, the 7.5Gus molecule was digested with EcoRI and PstI and inserted into the EcoRI and PstI sites of pBS.D4R.Flank to generate pBS.D4R-/7.5Gus+. D4R-/Gus+ vaccinia can be produced by conventional homologous recombination by transfecting the pBS.D4R-/7.5Gus+ construct into BSC1.D4R cells infected with v7.5/tk. D4R-/Gus+ virus was isolated by plaque purification on BSC1.D4R cells and staining with X-Glu. This D4R-virus can be used to complement and rescue the MVA genome in mammalian cells.

In a related embodiment, the MVA genome can be rescued in mammalian cells with other defective poxviruses, as well as psoralen/UV inactivated wild-type poxviruses. Psoralen/UV inactivation is discussed in the text.

Example 10

Construction and use of D4R trimolecular recombinant vector

Poxvirus infection has a significant inhibitory effect on host cell protein and RNA synthesis. These effects on host gene expression can in some cases interfere with the selection of specific poxvirus recombinants that have specific physiological effects on the host cell. Certain strains of vaccinia virus deficient in key early genes showed greatly reduced inhibition of host cell protein synthesis. Therefore, the construction of a recombinant cDNA library in a poxvirus vector with early gene function defects is beneficial to the selection of certain recombinants that rely on the continuous active expression of certain host genes to achieve their physiological effects. Disrupting key viral genes prevented the mutant strains from multiplying. However, replication-deficient vaccinia strains can be rescued by trans-complementation of host cells or by a helper virus that can be induced to express the gene to provide the lost function.

Infection of cell populations with poxvirus libraries constructed in replication-deficient strains greatly attenuates the effects of infection on host cell signaling mechanisms, differentiation pathways, and transcriptional regulation. Another important benefit of this strategy is that the expression of key genes under the control of the target transcriptional regulatory region is itself a means of selecting recombinant viruses that directly or indirectly lead to the activation of the transcriptional regulatory region. Examples of this include promoters of genes activated by crosslinking of surface immunoglobulin receptors on early B cell precursors; or promoters of genes encoding markers induced after stem cell differentiation. If such a promoter drives the expression of key viral genes, only those viral recombinants that directly or indirectly activate the expression of this transcriptional regulator will replicate and be packaged into infectious particles. This approach has the potential to generate much lower background than selection methods based on the expression of dipA or CTL target epitopes, since uninduced cells do not contain replicating vaccinia virus, which may pass through nonspecific side effects. let go. Selected recombinants can be further expanded in compensating cell lines or in the presence of compensating helper viruses or transfection plasmids.

Many key early vaccinia genes have been described. A vaccinia strain deficient in the D4R gene is preferably used. The vaccinia D4R open reading frame (orf) encodes uracil DNA glycosylase. This enzyme is required for viral DNA replication and disruption of this gene is lethal to vaccinia (A.K. Millns, M.S. Carpenter, and A.M. Delange. 1994 Virology 198:504-513). It has been demonstrated that stably transfected mammalian cell lines expressing the vaccinia D4R gene are able to compensate for D4R-deficient vaccinia viruses (G.W. Holzer, F.G. Falkner. 1997 J. Virology 71:4997-5002). In the absence of D4R compensation, infection with D4R-deficient vaccinia resulted in greatly reduced inhibition of host cell protein synthesis (Holzer and Falkner). It has also been shown that foreign genes inserted into the tk gene of D4R-deficient vaccinia continue to be expressed at high levels even in the absence of D4R compensation (M. Himly, M. Pfleiderer, G. Holzer, U. Fischer, E. Hannak, F.G. Falkner, and F. Dorner. 1998 Protein Expression and Purification 14: 317-326). Therefore, the replication-deficient D4R strain is very suitable for selection of viral recombinants that rely on the continuous active expression of certain host genes for their physiological effects.

To use this strategy to select specific recombinants from a representative cDNA library constructed in a D4R-deficient vaccinia strain, the following cell lines and vectors are required:

1. Compensation cell lines expressing D4R are required to expand D4R-deficient virus stocks.

2. The D4R gene of the virus strain suitable for trimolecular recombination must be deleted or inactivated.

3. Plasmid or viral constructs must be prepared that express D4R under the control of different inducible promoters, including, for example, those that regulate BAX or that are induced after cross-linking of the membrane immunoglobulin receptor on CH33 B lymphoma cells Promoters for expression of other genes; or promoters for expression of type X collagen after induction of C3H10T1/2 progenitor cells to differentiate into chondrocytes. Stable transfectants of these constructs in relevant cell lines are required to rescue specific recombinants. Alternatively, expression can be induced in cell lines or primary cultures using a helper virus expressing the relevant construct.

10.1 Construction of D4R-compensated cell lines. D4R compensated cell lines were constructed as follows. First, D4R orf (position 100732 to 101388 of the vaccinia genome) was cloned from vaccinia strain v7.5/tk by PCR amplification using the following primers.

D4R-sense, 5'AAAGAATTCA TAATGAATTC AGTGACTGTA TCACACG3', referred to herein as SEQ ID NO: 104;

and D4R-antisense, 5' CTTGGATCCT TAATAAATAA ACCCTTGAGC CC 3', referred to herein as SEQ ID NO: 105.

The sense primer was modified to contain an EcoRI site and the antisense primer was modified to contain a BamHI site (both underlined). After standard PCR amplification and digestion with EcoRI and BamHI, the resulting D4R orf was cloned into the EcoRI and BamHI sites in pIRESneo (purchased from Clontech, Palo Alto, CA). This mammalian expression vector contains a strong CMV immediate early promoter/enhancer and an ECMV internal ribosome entry site (IRES). The D4R/IRESneo construct was transfected into BSC1 cells and transfected clones were selected with G418. IRES enables efficient translation of polycistronic mRNAs containing D4R orf at the 5' end and neomycin phosphotransferase at the 3' end. This results in a high frequency of G418 resistant clones that are functional (these clones express D4R). Transfected clones were detected by Northern blot using the D4R gene as a probe to identify clones expressing high levels of D4R mRNA. BSC1 cells expressing D4R (BSC1.D4R) are able to compensate for D4R-deficient vaccinia, allowing the production and propagation of D4R-deficient virus.

10.2. Construction of D4R-deficient vaccinia vectors. A D4R-deficient vaccinia virus suitable for trimolecular recombination as previously described in Example 5 was constructed as follows: the E. coli GusA expression cassette was inserted into a 300 bp deletion to interrupt the D4R orf (positions 100732 to 101388 of the vaccinia genome).

To insert the GusA gene, the region flanking the insertion site was amplified from vaccinia virus as follows. The flanking region on the left was amplified with the following primers:

D4R left sense: 5'AATAAGCTTT ACTCCAGATA ATATGGA 3'; referred to as SEQ ID NO: 106 in the text;

D4R left antisense: 5'AATCTGCAGC CCAGTTCCAT TTT 3', referred to as SEQ ID NO: 107 in the text.

These primers amplified a region extending from position 100167 to position 100960 of the vaccinia genome, which had been modified to include HindIII (sense) and PstI (antisense) sites (both underlined) for cloning. The resulting PCR product was digested with HindIII and PstI and cloned into the HindIII and PstI sites of pBS (purchased from Stratagene) to generate pBS.D4R.LF. The flanking region on the right was amplified with the following primers: D4R right sense: 5 'AATGGATCCT CATCCAGCGG CTA 3', referred to as SEQ ID NO: 108 in the text; D4R right antisense: 5'AATGAGCTCT AGTACCTACA ACCCGAA 3', referred to as SEQ ID NO: 109 in the text.

These primers amplified to a region extending from positions 101271 to 101975 of the vaccinia genome, which had been modified to include BamHI (sense) and SacI (antisense) sites (both underlined) for cloning. The resulting PCR product was digested with BamHI and SacI, and cloned into the BamHI and SacI sites of pBS.D4R.LF to obtain pBS.D4R.LF/RF.

An expression cassette comprising the GusA coding region operably linked to a poxvirus synthesis early/late (E/L) promoter was inserted into pBS.D4R.LF/RF by the following method. The E/L promoter-Gus cassette is derived from the pEL/tk-Gus construct described in Merchlinsky, M. et al., Virology 238:444-451 (1997). pEL/tk-Gus was digested with NotI, then filled in with the KlenoW fragment to remove the NotI site immediately upstream of the Gus ATG start codon, and re-self-ligated to generate pEL/tk Gus(NotI-). The E/L-Gus expression cassette was isolated by standard PCR from pEL/tk-Gus(NotI-) using the following primers:

EL-Gus sense: 5'AAAGTCGACG GCCAAAAATT GAAATTTT 3', referred to in the text as SEQ ID NO: 110, and

EL-Gus antisense: 5'AATGGATCCT CATTGTTTGC CTCCC 3', referred to as SEQ ID NO: 111 in the text.

The EL-Gus sense primer contains a SalI site and the EL-Gus antisense primer contains a BamHI site (both underlined). After PCR amplification, the EL-Gus cassette was digested with SalI and BamHI and inserted into the SalI and BamHI sites of pBS.D4R.LF/RF to generate pBS.D4R-/ELGus. This transfer plasmid contains the EL-Gus expression cassette flanked by D4R sequences. A 300bp deletion was also generated in the D4R orf.

After the pBS.D4R-/EL Gus construct was transfected into v7.5/tk-infected BSC1.D4R cells, the D4R-/Gus+ vaccinia virus suitable for trimolecular recombination was prepared by conventional homologous recombination. D4R-/Gus+ viruses were isolated by plaque purification on BSCl.D4R cells and staining with X-Glu (M.W. Carroll, B. Moss. 1995. Biotechniques 19:352-355). This new strain was named v7.5/tk/Gus/D4R.

A representative vaccinia cDNA library was constructed by trimolecular recombination using DNA purified from v7.5/tk/Gus/D4R as described in Example 5, but the reaction was performed in the BSC1.D4R complemented cell line.

10.3. Preparation of host cells expressing D4R regulated by an inducible promoter. A host cell expressing the D4R gene when the inducible promoter is induced is prepared as follows. A plasmid construct capable of expressing the vaccinia D4R gene under the control of an inducible promoter was prepared. Examples of inducible promoters include, but are not limited to, promoters that are upregulated upon cross-linking of membrane immunoglobulins on CH33 cells (for antibody selection), such as the BAX promoter described in Examples 2 and 3. Vaccinia D4Rorf was amplified by PCR using the primers D4R sense and D4R antisense described in Section 10.1 above. These PCR primers were modified as necessary so that they contained the desired restriction enzyme sites. The D4R orf is then cloned into a suitable eukaryotic expression vector (enabling selection of stably transformed cells) operably linked to any desired promoter using methods known to those of ordinary skill in the art.

This construct is then transfected into a suitable host cell, such as those described in Examples 2 and 3 for antibody selection. The D4R gene operably linked to the BAX promoter is stably transfected into a suitable cell line, such as CH33 cell line, CH31 cell line or WEHI-231 cell line. The resulting host cells were used for antibody production essentially as described in Example 3 using the library constructed in v7.5/tk/Gus/D4R. Antigen-induced cross-linking of membrane-expressed immunoglobulin molecules on the surface of host cells results in induction of expression of the D4R gene product in the cross-linked cells. Expression of D4R compensates for the defect in the v7.5/tk/Gus/D4R genome (in which the library was made) resulting in the production of infectious virus particles.

Example 11

Attenuation of poxvirus-mediated host suppression by a reversible inhibitor of DNA synthesis

As discussed previously, attenuated or defective viruses are sometimes required to reduce cytopathic effects. Cytopathic effects during viral infection may interfere with selection and identification of immunoglobulin molecules utilizing host cell death (eg, crosslink-induced apoptosis). Such effects can be attenuated by reversible inhibitors of DNA synthesis such as hydroxyurea (HU) (Pogo, B.G. and S. Dales Virology, 1971. 43(1):144-51). HU inhibits the DNA synthesis of cells and viruses by seizing the deoxynucleotide precursors in the replication complex (Hendricks, S.P. and C.K. Mathews J Biol Chem, 1998.273(45): 29519-23). Inhibition of viral DNA replication will block late viral RNA transcription but allow transcription and translation under the control of the early vaccinia promoter (Nagaya, A., B.G. Pogo, and S. Dales Virology, 1970. 40(4):1039-51). Treatment with a reversible inhibitor of DNA synthesis (such as HU) can therefore detect the effect of cross-linking. After appropriate incubation, HU inhibition can be released by washing the host cells, allowing the viral replication cycle to continue and infectious recombinants to be recovered (Pogo, B.G. and S. Dales Virology, 1971. 43(1): 144-51).

The results in Figure 9 show that the induction of type X collagen synthesis, which is a marker of chondrocyte differentiation, in C3H10T 1/2 progenitor cells treated with BMP-2 (bone morphogenetic protein-2) was blocked by vaccinia infection However, HU-mediated inhibition of viral DNA synthesis rescued the protein synthesis. When cultures were washed with fresh medium to remove HU, viral DNA synthesis and assembly of infectious particles proceeded very rapidly, and infectious virions were isolated 2 hours after washing.

C3H10T 1/2 cells were infected with WR vaccinia virus at MOI = 1, and after 1 h, medium or 400 ng/ml BMP-2 was added with or without 2 mM HU. After an additional 21 hours of incubation at 37°C, HU was removed by washing with fresh medium. The infection cycle was allowed to continue for 2 hours to initiate viral DNA replication and assembly of infectious particles. At 24 hours, RNA was extracted from cells maintained in 4 different culture conditions. Northern analysis was performed with a type X collagen-specific probe. Uninduced C3H10T1/2 cells have a mesenchymal progenitor phenotype and do not express type X collagen (first column from left). Adding BMP-2 to normal uninfected C3H10T 1/2 cells can induce them to differentiate into mature chondrocytes and express type X collagen (compare the first and second columns from the left), while C3H10T cells infected with vaccinia Adding BMP-2 to 1/2 cells could not induce the synthesis of type X collagen (third column from the left). In the presence of 2 mM HU, BMP-2 induced the synthesis of type X collagen even in vaccinia virus-infected C3H10T 1/2 cells (fourth column from the left).

This strategy of attenuating the cytopathic effects of viruses can be used for other viruses, other cell types and can be used to select eg immunoglobulin molecules that induce apoptosis when cross-linked.

Example 12

Construction of Human Fab Fragment Library with Multiple Specificities

A library of polynucleotides encoding fully human diverse immunoglobulin Fab fragments was prepared as follows. These Fab fragments comprise a heavy chain variable region joined together with a first constant region domain (VH-CH1), paired with an immunoglobulin light chain. Human VH (heavy chain variable region), VK (kappa light chain variable region) and VL (lambda light chain variable region) genes were amplified by PCR. For each of these three variable region gene families, both recombinant plasmid libraries and vaccinia virus libraries were constructed. The variable region genes were inserted into the p7.5/tk-based transfer/expression plasmid immediately upstream of the constant region sequence corresponding to the CH1 domain of the heavy chain or the CK constant region of the kappa light chain. These plasmids are used to generate the corresponding vaccinia virus recombinants by trimolecular recombination, or after transfection of one immunoglobulin chain or fragment thereof into cells infected with a vaccinia virus recombinant of the second immunoglobulin chain or fragment thereof , using these plasmids to directly express high-level Fab fragments. These two chains are synthesized and assembled to form Fab fragments. These Fab fragments may be membrane-bound or secreted by splicing coding sequences for signal sequences, transmembrane domains and/or intracellular domains, as will be appreciated by those of ordinary skill in the art.

12.1 pVHEc. An expression vector encoding a human heavy chain fragment comprising the VH and CH1 domains of Cμ, called pVHEc, was constructed as follows. Plasmid p7.5/tk2 was prepared as previously described in Example 1.1. A DNA construct encoding amino acids 109-113 of VH and a CH1 domain (i.e. amino acids 109-223B of Cμ) was amplified from the IgM heavy chain gene isolated as described in Example 1, and modified by PCR to encode amino acids 109-223B. The region of the 113+ CμCH1 domain contains a BstEII site at the 5' end and a stop codon and a SalI site at the 3' end. This DNA was inserted between BstEII and SalI in p7.5/tk2 to generate pVHEc. The heavy chain variable region (VH) PCR product (amino acids (-4) to (110)) prepared as described in Example 1.4(a) was cloned into the BssHII and BstEII sites using the primers listed in Tables 1 and 2 . Because of the overlap in the CH1 domain sequence and the selected restriction enzyme sites, this would result in the construction of a contiguous heavy chain fragment that lacks a functional signal peptide but is in the correct translation reading frame.

12.2 pVKEc and pVLEc. Expression vectors encoding the constant regions of human kappa and lambda immunoglobulin light chains, named pVKEc and pVLEc, were constructed as follows. Plasmid p7.5/tk3.1 was prepared as previously described in Example 1.3.

(a) Plasmid p7.5/tk3.1 was transformed into pVKEc by the following method. The cDNA encoding the CK region was isolated with primers as described in Example 1 so that the 5' end of the region encoding amino acid 104-107+CK contained an XhoI site, and the 3' end contained a stop codon and a SalI site , and then cloned into the XhoI and SalI sites of p7.5/tk3.1 to generate pVKEc. The κ light chain variable region (VK) PCR product (amino acids (-3) to (105)) prepared as described in Example 1.4(b) was then cloned into ApaLI of pVKEc using the primers listed in Tables 1 and 2. and XhoI sites. Due to the overlap between the kappa light chain sequence and the selected restriction enzyme sites, this resulted in the construction of a continuous kappa light chain lacking a functional signal peptide, but in the correct translation reading frame.

(b) The plasmid p7.5/tk3.1 was transformed into pVLEc by the following method. The cDNA encoding the CK region was isolated with primers as described in Example 1 so that it contained a HindIII site at the 5' end of the amino acid 105-107 region encoding Vλ, a stop codon and a SalI site at the 3' end , and then cloned into the HindIII and SalI sites of p7.5/tk3 to generate pVLEc. The lambda light chain variable region (VL) PCR product (amino acids (-3) to (104)) prepared as described in Example 1.4(c) was then cloned into ApaLI of pVLEc using the primers listed in Tables 1 and 2. and HindIII sites. Due to the overlap between the lambda light chain sequence and the selected restriction enzyme sites, this resulted in the construction of a continuous lambda light chain lacking a functional signal peptide but in the correct translation reading frame.

12.3 Fab in secreted or membrane-bound form. Expression vectors (pVHEc, pVKEc and pVLEc) can be used as prototypic vectors in which the secretion signal, transmembrane domain, cytoplasmic domain or their combination can be cloned to localize the Fab to the cell surface or extracellular space. These signals and domains (examples of which are listed in Table 7) can be inserted at the N-terminal of the Fab between NcoI and BssHE of pVHEc (or between NcoI and ApaLI of pVKEc and pVLEc) and/or at the C-terminal SalI site . To target the Fab for secretion into the extracellular compartment, a signal peptide was inserted at the N-terminus of one or both of the Fab chain, VH-CH1 or light chain. To anchor the Fab to the plasma membrane for extracellular presentation, a transmembrane domain is added to the carboxy-terminus of the VH-CH1 chain and/or light chain. A cytoplasmic domain can also be added.

Table 7. Positioning signals signal sequence end Location protein MGWSC IILFLVATATGAHS (SEQ ID NO: 146) N ES IgG1 NLWTTASTFIVLFLLSLFYSTTVTLF (SEQ ID NO: 147) C/N PM IgM

Abbreviations for items under position: ES, extracellular periplasm; PM, plasma membrane.

Example 13

Construction of Human Single Chain-Fv (ScFv) Antibody Library

13.1 As shown in Figure 10, construct human scFv expression vectors p7.5/tk3.2 and p7.5/tk3.3 by the following method. Plasmid p7.5/tk3 was prepared as previously described in Example 1.3. Plasmid p7.5/tk3 was transformed into p7.5/tk3.1 by exchanging the 4 nucleotides ATAC between NcoI and ApaLI for ATAGC, such that the start codon ATG in NcoI was in the absence of the inserted signal peptide It was in the same reading frame as ApaLI. It can be convenient by replacing the NotI-to-SaII cassette (SEQ ID NO: 29) described in Example 1.3 with a cassette having the sequence 5'-GCGGCCGCCC ATGGATAGCG TGCACTTGAC TCGAGAAGCT TAGTAGTCGAC-3' (referred to herein as SEQ ID NO: 112) realize the transformation.

By using the following sequence cassette: XhoI-(nucleotides encoding amino acids 106-107 of Vκ)-(nucleotides encoding a 10 amino acid linker)-G-BssHII-ATGC-BstEII-(nucleotides encoding amino acids 111-113 of VH Nucleotide)-stop codon-SalI to replace the region between XhoI and SalI (i.e. nucleotides 30 to 51 of SEQ ID NO: 12, referred to as SEQ ID NO: 113 in the text), the plasmid p7.5/ tk3.1 was converted to p7.5/tk3.2. This was achieved by digesting p7.5/tk3.1 with XhoI and SalI and inserting a cassette with the sequence 5' CTCGAGAT CAAAGAGGGT AAATCTTCCG GATCTGGTTC CGAAGGCGCGCATGCGGTCA CCGTCTCCTC ATGAGTCGAC 3' (referred to as SEQ ID NO: 114 in the text). The final size of the linker between Vκ and VH is 14 amino acids, of which the last 4 amino acids are from the inserted VH PCR product as follows. The sequence of the linker is 5'GAGGGT AAA TCT TCC GGA TCT GGT TCC GAA GGC GCG CAC TCC 3' (SEQ ID NO: 115), which encodes the amino acid EGKSSGSGSEGAHS (SEQ ID NO: 116).

By using the following cassette: HindIII-(nucleotides encoding amino acids 105-107 of Vλ)-(nucleotides encoding a 10 amino acid linker)-G-BssHII-ATGC-BstEII-(nucleotides encoding amino acids 111-113 of VH nucleotides)-stop codon-SalI to replace the region between HindIII and SalI (i.e. nucleotides 36 to 51 of SEQ ID NO: 112) (referred to as SEQ ID NO: 117 in the text), and the plasmid p7.5 /tk3.1 is converted to p7.5/tk3.3. This was achieved by digesting p7.5/tk3.1 with HindIII and SalI and inserting a cassette with the sequence 5' AAGCTTACCG TCCTAGAGGG TAAATCCTCC GGATCTGGTTCCGAAGGCGCG CATGCGGTCA CCGTCTCCTC ATGAGTCGAC 3' (referred to as SEQ ID NO: 118 in the text). The final size of the linker between Vλ and VH is 14 amino acids, where the last 4 amino acids are from the VH PCR product inserted below. The sequence of the linker is 5'GAG GGT AAA TCT TCC GGA TCT GGT TCC GAA GGC GCGCAC TCC 3' (SEQ ID NO: 119), which encodes the amino acid EGKSSGSGSEGAHS (SEQ ID NO: 120).

13.2 Cytoplasmic form of scFv. Expression vectors encoding scFv polypeptides comprising human kappa or lambda immunoglobulin light chain variable regions fused to human heavy chain variable regions were constructed as follows.

(a) The cytoplasmic VκVH scFv expression product was constructed as follows. Using the primers listed in Tables 1 and 2, the κ light chain variable region (Vκ) PCR product (amino acids (-3) to (105)) prepared as described in Example 1.4(b) was cloned into p7.5/ Between the ApaLI and XhoI sites in tk3.2. Because of the overlap in the kappa light chain sequence and the selected restriction enzyme sites, this resulted in the construction of a continuous kappa light chain in the same translational reading frame as the downstream linker. The heavy chain variable region (VH) PCR product (amino acids (-4) to (110)) prepared as described in Example 1.4(a) was cloned into p7.5/tk3 using the primers listed in Tables 1 and 2 .2 Between the BssHII and BstEII sites, a complete scFv open reading frame is formed. The resulting product is a cytoplasmic form of the VK-VH fusion protein linked by a 14 amino acid linker. The ScFv is preceded by 6 additional amino acids and part of the Vκ signal peptide encoded by a restriction site at the amino terminus.

(b) The cytoplasmic VλVH scFv expression product was constructed as follows. Using the primers listed in Tables 1 and 2, the lambda light chain variable region (VL) PCR product (amino acids (-3) to (104)) prepared as described in Example 1.4(c) was cloned into p7.5/ Between the ApaLI and HindIII sites in tk3.3. Because of the overlap in the lambda light chain sequence and the selected restriction enzyme sites, this resulted in the construction of a continuous lambda light chain in the same translation reading frame as the downstream linker. The heavy chain variable region (VH) PCR product (amino acids (-4) to (110)) prepared as described in Example 1.4(a) was cloned into p7.5/tk3 using the primers listed in Tables 1 and 2 .3 Between the BssHII and BstEII sites, a complete scFv open reading frame is formed. The resulting product is a cytoplasmic form of Vλ-VH fusion protein linked by a 14 amino acid linker. The ScFv is preceded by 6 additional amino acids encoded by a restriction site at the amino terminus and part of the Vλ signal peptide.

13.3 Secreted or membrane-bound scFvs. The cytoplasmic scFv expression vector described in Section 13.2 can be used as a prototype vector in which the scFv can be localized to the cell surface or extracellular space after cloning into the secretion signal, transmembrane domain, cytoplasmic domain or a combination thereof. Table 7 lists examples of signal peptides and membrane anchor domains. To secrete the scFv polypeptide into the extracellular space, a cassette encoding an in-frame secretion signal peptide is inserted between the NcoI and ApaLI sites of p7.5/tk3.2 or p7.5/tk3.3 to allow its expression at the N-terminus of the scFv polypeptide. To generate a membrane-bound scFv for selection based on Ig-crosslinking or Ig-binding, in addition to the signal peptide, a cassette encoding the membrane-bound form of Cμ was cloned between the C-terminal BstEII and SalI sites of the scFv, at The nucleotides encoding VH amino acids 111-113 are downstream and in the same reading frame. A cytoplasmic domain can also be added.

Example 14

Construction of a camelized human single-chain antibody library

Camelid species use only heavy chains to form antibodies known as heavy chain antibodies. Poxvirus expression systems can be used to generate secreted or membrane-bound human single domain libraries in which the human _VH domains have been "camelized", i.e. altered to be identical to the _VHH domains of camelid antibodies, and then Selection can be based on functional assays or Ig-crosslinking/conjugation. The human V _H gene can be camelized by conventional mutation methods, making it closer to the camelid V _H H gene. For example, the human _VH3 gene prepared as described in Example 1.4 using an appropriate primer pair selected from Tables 1 and 2 can be camelized by substituting E for G44, R for L45, and G or I for W47. See, eg, Riechmann, L., and Muyldermans, SJ Immunol. Meth. 231:25-38. To generate secreted single domain antibody libraries, cassettes encoding camelized human _VH genes were cloned into the BssHII and BstEII sites of the pVHEs prepared in Example 1.2 and expressed in-frame. To generate a membrane-bound single domain antibody library, the cassette encoding the camelized human _VH gene was cloned into the BssHII and BstEIl sites of pVHE prepared as described in Example 1.1 and expressed in-frame. Vector pVHE and pVHEs already have a signal peptide cloned between the NcoI and BssHII sites. Amino acid residues in the three CDR regions of the camelized human _VH gene were extensively randomized, and the resulting library was selected in poxviruses as described herein.

Example 15

Selection of Fc-modified antibodies with enhanced immune effector function

Human monoclonal antibodies are being used in medical applications to treat an increasing number of human diseases. Human antibodies may induce or block signaling through specific cellular receptors. In certain applications, human antibodies may activate many helper effector cells through the interaction between the Fc portion of the antibody molecule and matching Fc receptors (FcRs) on these effector cells. It is therefore interesting to identify modifications of the immunoglobulin heavy chain constant region sequences that enhance or inhibit FcR-mediated binding and signaling or the binding and activation of other mediators of immune effector functions, such as components of the complement system. See, eg, US Patent 5,624,821; Xu, D. et al., Cell Immunol 200:16-26 (2000); and US Patent 6,194,551, which are incorporated herein by reference in their entirety.

One such specific effector function is antibody-dependent cellular cytotoxicity (ADCC), a process in which antibody-coated target cells are destroyed by NK cells or other monocytes. ADCC is mediated by antibody molecules that have variable regions encoding specificity for target cell surface molecules and constant regions encoding specificity for FcyRIII on NK cells. Through crystal structure analysis and site-directed mutagenesis, it has been determined that the FcγRIII binding site on human IgG1 is mainly located on the lower hinge, that is, about amino acids 247-252 of IgG1, and the adjacent CH2 region. See, eg, Sarmay G. et al., Mol Immunol 29:633-639 (1992); and Michaelsen, T.E. et al., Mol Immunol 29:319-26 (1992). By constructing gene libraries encoding antibody molecules with randomly mutated lower hinge regions in selectable mammalian expression vectors, it is possible to select for specific constant region variants with enhanced ADCC function. To simplify the implementation of this strategy, a library is constructed with defined immunoglobulin variable region sequences conferring specificity of interest.

15.1. Construction of pVHE-X and pVKE-X or pVLE-X. Plasmid pVHE-X (human VH expression vector with defined variable regions, referred to as X herein) was constructed as follows. Figure 11 illustrates the build process. Antibodies with a particular specificity X are isolated by conventional methods, or produced and selected in eukaryotic cells using poxvirus vectors by methods described herein. If necessary, the VH gene of the antibody was subcloned into pVHE prepared as described in Example 1.1 between the BssHa/BstEII sites to generate plasmid pVHE-X. Similarly, if necessary, the VK or VL gene of the antibody can be subcloned into the ApaLI/XhoI site of pVKE prepared as described in Example 1.3 to generate pVKE-X, or subcloned into pVLE prepared as described in Example 1.3 The ApaLI/HindIII site, resulting in pVLE-X.

15.2 Isolation of the human Cγ1 cassette. cDNA encoding human Cγ1 heavy chain was isolated from bone marrow RNA using the SMART ^™ RACE cDNA Amplification Kit using the following primers:

huCγ1-5B: 5'ATTAGGATCC GGTCACCGTC TCCTCAGCC3' (SEQ ID NO: 121)

huCγ1-3S: 5'ATTAGTCGACTCATTTACCCCGGAGACAGGGAGAG3' (SEQ ID NO: 122).

The PCR product contained the following elements: BamHI-BstEII-(nucleotides encoding amino acids 111-113 of VH)-(nucleotides encoding amino acids 114-478 of Cγ1)-TGA-SalI. This product was subcloned into the BamHI and SalI sites of pBluescriptII/KS, and the second BstEII site corresponding to amino acids 191 and 192 in the CH1 domain of Cγ1 was removed by site-directed mutagenesis without changing the amino acid sequence.

15.3 Construction of Fcγ1 library. Cγ1 variants were prepared by overlap PCR by the following method. Using the BstEII-mutated Cγ1 cassette prepared as described in section 15.2 as a template for the first round of PCR, amplify with Cγ1-sense/Cγ1-internal-R and Cγ1-internal-S/Cγ1-reverse primer sets in two performed in a separate reaction.

Cγ1-sense: 5'AATATGGTCACCGTCTCCTCAGCC3' (SEQ ID NO: 123)

Cγ1-internal-R: 5'(MNN) _{6TTCAGGTGCTGGGCACGG3} ' (SEQ ID NO: 124)

Cγ1-internal-S: 5'(NNK) ₆ GTCTTCCTCTTCCCCCCA3' (SEQ ID NO: 125)

Cγ1-reverse: 5'AATATGTCGACTCATTTACCCGG3' (SEQ ID NO: 126)

(M=A+C, K=G+T, N=A+T+G+C)

The Cy1-internal-R and Cy1-internal-S primers had degenerate sequence tails encoding variants of 6 amino acids comprising residues 247-252 of the lower hinge. In the second round of PCR, the purified products from the first round were fused together by overlapping PCR with Cγ1 sense and Cγ1 reverse primers.

The volume of the obtained product is about 1000bp, and all 20 kinds of amino acids are randomly encoded at each position of amino acid 247-252. The PCR product was digested with BstEII and SalI and cloned into BstEII/SaII digested pVHE-X (prepared as described in Section 15.1) to generate a pVHE-X-γ1 variant library. These variants were then introduced into vaccinia virus using trimolecular recombination as described in Example 5. Combined with recombinant vaccinia viruses carrying light chains, this Fcγ1 library will be useful for selection of those Fc variants that confer enhanced ADCC activity to VHE-X-γ1 expressing antibodies.

15.4 Other Applications. In addition to generating variants of amino acids 247-252, other residues such as amino acids 278-282 and amino acids 346-351 of IgG1 are also involved in binding to FcγRIII. Following the identification of Fcγ1 variants at amino acids 247-252 that showed enhanced ADCC activity, the same strategy could be used to identify other mutations in the other two regions that showed synergistic enhancement of ADCC function.

The same principles/techniques can be used to identify variants that confer enhanced effector function to other immunoglobulin heavy chain constant region isotypes that bind different Fc receptors. In preferred embodiments, target receptors include FcyRI (CD64), FcyRII-A (CD32), FcyRII-B1, FcyRII-B2, FcyRIII (CD16), and FcεRI. In other preferred embodiments, variants may be selected that enhance binding of complement components to the Fc region or Fc-mediated binding to placental membranes for transplacental transport.

Example 16

Construction of heavy chain fusion proteins to aid in the selection of cells infected with recombinant vaccinia virus with specific immunoglobulin genes

16.1 Construction of CHl-Fas. An expression vector encoding a fusion protein comprising the human heavy chain CH1 domain of Cμ and the transmembrane and death domains of Fas fused thereto was constructed by the following method, named CH1-Fas in the paper. Figure 13(a) schematically illustrates the fusion protein.

Plasmid pVHE prepared as described in Example 1.1 was digested with BstEII and SalI, and a small DNA fragment of about 1.4 kb was gel purified. Then this small fragment is used as the template of PCR reaction, and used primer is forward primer CH1 (F)-5'ACACGGTCAC CGTCTCCTCAGGGAGTGC 3' (SEQ ID NO: 127) and reverse primer CH1 (R) 5' AGTTAGATCTGGATCCTGGA AGAGGCACGT T 3' (SEQ ID NO: 128). The resulting PCR product of approximately 320 bp was gel purified.

Forward primer FAS(F) 5'AACGTGCCTCTTCCAGGATC CAGATCTAAC 3' (SEQ ID NO: 129) and reverse primer FAS(R) 5'ACGCGTCGAC CTAGACCAAGCTTTGGATTT CAT 3' (SEQ ID NO: 130) were used from plasmid pBS-AP014. 2 Amplification of a DNA fragment containing the transmembrane and death domains of Fas. The resulting PCR product of approximately 504 base pairs was gel purified.

The resulting 320 and 504 bp fragments were then combined in one PCR reaction using forward primer CH1 (F) and reverse primer FAS (R) to generate a fusion fragment of approximately 824 bp. This fragment was digested with BstEII and SalI, and the resulting 810 bp fragment was gel purified. Plasmid pVHE was also digested with BstEII and SalI, and the resulting large fragment of about 5.7 kb was gel purified. These two BstEII/SalI fragments were then ligated to generate CH1-Fas.

16.2 Construction of CH4-Fas. An expression vector encoding a fusion protein comprising the human heavy chain CH1-CH4 domains of Cμ and the transmembrane and death domains of Fas fused thereto was constructed by the following method, named CH4-Fas in the paper. Figure 13(b) schematically illustrates the fusion protein.

Plasmid pVHE prepared as described in Example 1.1 was digested with BstEII and SalI, and a small DNA fragment of about 1.4 kb was gel purified. Then this small fragment is used as the template of the PCR reaction, and the primers used are forward primer CH4 (F) 5' CTCTCCCGCG GACGTCTTCG T 3' (SEQ ID NO: 131) and reverse primer CH4 (R) 5' AGTTAGATCT GGATCCCTCAAAAGCCCTCCT C 3' (SEQ ID NO: 132). The resulting PCR product of approximately 268 bp was gel purified.

Transmembrane and death cells containing Fas were amplified from plasmid pBS-AP014.2 using the forward primer FAS(F2) 5'GAGGAGGGCT TTGAGGGATC CAGATCTAAC3' (SEQ ID NO: 133) and the reverse primer FAS(R) in section 16.1. Domain DNA fragment. The resulting PCR product of approximately 504 base pairs was gel purified.

The resulting 268 and 504 bp fragments were then combined in one PCR reaction using forward primer CH4 (F) and reverse primer FAS (R) to generate a fusion fragment of approximately 765 bp. This fragment was digested with SacII and SalI, and the resulting 750 base pair fragment was gel purified. Plasmid pVHE was also digested with SacII and SalI, and the resulting large fragment of about 6.8 kb was gel purified. These two SacII/SalI fragments are then ligated to generate CH4-Fas.

16.3 Construction of CH4(TM)-Fas. The following method is used to construct the expression vector encoding the fusion protein, which comprises the human heavy chain CH1-CH4 domain and transmembrane domain of Cμ, and the death domain of Fas fused therewith, which is named as CH4(TM)- Fas. Figure 13(c) schematically illustrates the fusion protein.

Plasmid pVHE prepared as described in Example 1.1 was digested with BstEII and SalI, and a small DNA fragment of about 1.4 kb was gel purified. Then this small fragment is used as the template of PCR reaction, and used primer is forward primer CH4 (F) and reverse primer CH4 (R2) 5' AATAGTGGTG ATATATTTCA CCTTGAACAA 3' (SEQ ID NO: 134) of 16.2 parts. The resulting PCR product of approximately 356 bp was gel purified.

DNA containing the death domain of Fas was amplified from plasmid pBS-AP014.2 with forward primer FAS(F3) 5'TTGTTCAAGG TGAAAGTGAA GAGAAAGGAA3' (SEQ ID NO: 135) and reverse primer FAS(R) in section 16.1 fragment. The resulting PCR product of approximately 440 base pairs was gel purified.

The resulting 356 and 440 bp fragments were then combined in one PCR reaction using forward primer CH4 (F) and reverse primer FAS (R) to generate a fusion fragment of approximately 795 bp. This fragment was digested with SacII and SalI and the resulting 780 base pair fragment was gel purified. Plasmid pVHE was also digested with SacII and SalI, and the resulting large fragment of about 6.8 kb was gel purified. These two SacII/SalI fragments are then ligated to generate CH4(TM)-Fas.

16.4 Cloning and insertion of various VH genes into Ig-Fas fusion protein. Using the primers listed in Tables 1 and 2, the heavy chain variable region (VH) PCR product (amino acids (-4) to (110)) prepared as described in Example 1.4(a) was cloned into CH1-Fas, CH4 - BssHII and BstEII sites of Fas and CH4(TM)-Fas. Because of the overlap in the CH1 domain sequence and selected restriction enzyme sites, this will create a contiguous heavy chain fragment that lacks a functional signal peptide but is in the correct translation reading frame.

Example 17

Preparation of HeLaS3 and COS7 cell lines expressing Igα and Igβ

In order to express specific human monoclonal antibodies on the cell surface, the heavy and light chain immunoglobulins must be physically linked to other proteins of the B cell receptor complex. Therefore, in order for host cells to express human antibody libraries, they must be able to express the molecules and structures required for the efficient synthesis and assembly of antibodies into membrane-bound receptors. Mouse lymphoma cells express the molecules and structures required to express specific human antibodies on the cell surface. However, one disadvantage of using lymphoma cells for expression of human antibody libraries is that endogenously expressed immunoglobulin heavy and/or light chains can co-assemble with transgenic immunoglobulin chains, resulting in the formation of nonspecific heterologous molecules, which Antigen-specific receptors will be diluted. Another disadvantage of using mouse lymphoma cells to express human antibody libraries is that vaccinia virus replicates poorly in lymphoid cell lines. Thus, preferred cell types for expressing specific human antibodies are those that allow the production of high titers of vaccinia virus and those that are not derived from a B cell line. Preferred cell types include HeLa cells, COS7 cells and BSC-1 cells.

The immunoglobulin heavy and light chains of the B cell receptor are physically linked together with heterodimers of Igα and Igβ transmembrane proteins (Reth, M. 1992. Annu. Rev. Immunol. 10:97). This physical linkage is required for efficient transport of membrane-bound immunoglobulins to the cell surface and signaling through B cell receptors (Venkitaraman, A.R et al., 1991. Nature 352:777). However, it is unclear whether Igα/Igβ heterodimers are necessary or sufficient for the expression of membrane-bound immunoglobulins in heterologous cell lines. Therefore, after transfection of HeLaS3 and COS7 cells with human Igα and Igβ cDNA, the expression of human antibodies on the surface of these cells was evaluated.

17.1 Cloning of human Igα and Igβ cDNA by PCR. Human Igα and Igβ cDNAs were amplified using cDNA prepared from EBV-transformed human B cells as templates for PCR reactions. Human Igα cDNA was amplified with the following primers:

igα5'-5'ATTAGAATTCATGCCTGGGGGTCCAGGA3' (SEQ ID NO: 136); and

igα3'-5'ATTAGGATCCTCACGGCTTCTCCAGCTG3' (SEQ ID NO: 137).

Human Igβ cDNA was amplified with the following primers:

igβ5'-5'ATTAGGATCCATGGCCAGGCTGGCGTTG3' (SEQ ID NO: 138);

igβ3'-5'ATTACCAGCACACTGGTCACTCCTGGCCTGGGTG3' (SEQ ID NO: 139).

The Igα PCR product was cloned into the EcoRI and BamHI sites of the pIRESneo expression vector (Clontech), while the product from the Igβ PCR reaction was cloned into the BamHI and BstXI sites of the pIREShyg vector (Clontech). The cloned Igα and Igβ were confirmed by DNA sequencing.

17.2 Establish stable transfectants of HeLaS3 and COS7 expressing Igα and Igβ. HeLaS3 and COS7 cells were transfected with 0.5 to 1 μg of purified pIRESneo-Igα and pIREShygIgβ plasmid DNA using LIPOFECTAMINE PLUS Reagent (Life technologies) (1×10 ⁶ /well in a 6-well plate). 2 days after initiation, selection was performed with G418 (at 0.4 mg/ml) and hygromycin B (at 0.2 mg/ml) for approximately 2 weeks. Drug-resistant HeLaS3 colonies were directly isolated, and COS7 transfectants were cloned by limiting dilution. The expression of Igα and Igβ of these clones was then analyzed by RT-PCR, and the results of representative clones are shown in FIG. 14 .

Example 18

Construction of diverse libraries of high-affinity human antibodies

The present invention is the only method currently available for constructing a diverse library of immunoglobulin genes in vaccinia or other poxviruses. Vaccinia vectors can be designed to express high levels of membrane receptors that allow efficient binding to antigen-coated matrices. Alternatively, recombinant immunoglobulin heavy chains can be engineered to induce apoptosis when the receptor is cross-linked by antigen. Because vaccinia virus can be easily and efficiently recovered from even programmed cell death, the unique features of this system allow rapid selection of specific human antibody genes.

Sequential selection of the best immunoglobulin heavy and light chains maximizes diversity by screening all available combinations of heavy and light chains. The sequential screening strategy first selects the best heavy chain from a small library containing 10 ⁵ H chain recombinants in the presence of a small library containing 10 ⁴ different light chains. This optimized H chain was then used to select its best partner from a larger library of ¹⁰⁶ to ¹⁰⁷ recombinant L chains. Once the best L chain is selected, a better H chain can be selected from a larger library of 10 ⁶ to 10 ⁷ recombinant H chains. This iteration is a shoelace strategy that enables selection of specific high-affinity antibodies from _as many as ¹⁰¹⁴ _H2L2 combinations. In contrast, selection of a single-chain Fv in a phage library or of a Fab consisting of separate VH-CH1 and VL-CL genes encoded on a single plasmid is a one-step process limited by the actual size of a single phage library (perhaps ¹⁰¹¹ phage Particles) limit.

Since it is not feasible to screen ¹⁰¹⁴ combinations of ¹⁰⁷ H chains and ¹⁰⁷ L chains, to select the best H chain, initially in the presence of ¹⁰⁴ L chains in a non-infectious vector , to select from a library of 10 ⁵ H chain vaccinia recombinants. These combinations are likely to generate low affinity antibodies to many epitopes, resulting in the selection of eg 1 to 100 different H chains. If 100 H chains are selected for a basic antibody, they can then be used for a second round of selection in a larger library of ¹⁰⁶ or ¹⁰⁷ vaccinia recombinant L chains to pick the 100 best L chain partners. The original H chains are then set aside and these 100 L chains are used to select new higher affinity H chains from a larger library of ¹⁰⁶ or ¹⁰⁷ H chains. This strategy resembles an in vitro affinity augmentation. As in normal immune responses, low-affinity antibodies are first selected and then used as the basis for selection of higher-affinity progeny in repeated immunization cycles. High-affinity cloning may arise from somatic mutation in vivo, and this in vitro strategy can achieve the same through recombination of immunoglobulin chains. In both cases, the partner of the modified immunoglobulin chain is the same as that of the original low-affinity antibody.

The basis of this strategy is to control the initial selection of low-affinity antibodies. Selection of low-affinity antibodies is critical. The vaccinia-based approach for sequential selection of H and L chains can be appropriately optimized to ensure that the initial low-affinity selection is successful, given the affinity advantage conferred by expressing bivalent antibodies. In addition, the level of antibody expression can be regulated by using different promoters in the vaccinia system. For example, the vaccinia-adapted T7 polymerase system yielded higher levels of expression than the native vaccinia promoter. The initial rounds of selection can be based on the high-level T7 expression system to ensure the selection of low-affinity "basic antibodies", and the subsequent rounds of selection can be based on low-level expression to guide the selection of high-affinity derivatives.

The following is a summary of the method of the present invention for constructing a diverse library of immunoglobulin genes in vaccinia:

1. Construction of an immunoglobulin membrane-associated heavy chain cDNA library from human lymphocytes in a vaccinia virus vector according to the method described herein. Infect specially engineered cells, such as CH33 cells, mouse myeloma cells and human EBV transformed cell lines, or preferably HeLa cells and Other non-lymphoid cells that do not produce competing immunoglobulin chains and that efficiently support vaccinia replication.

2. These same cells were infected with psoralen-inactivated recombinant vaccinia virus of immunoglobulin light chains from the library of immunoglobulin light chains constructed in the same vaccinia virus vector. Alternatively, these cells can be transfected with the immunoglobulin light chain recombinant in a plasmid expression vector. Each heavy chain can be associated with any light chain throughout the population of cells.

3. The cells are cultured for an appropriate time to obtain optimal expression of the fully assembled antibody on the cell surface. When the host cells are not of lymphoid origin, using host cells that have been stably transfected with genes or cDNAs expressing Igα and Igβ proteins, such as Hela or Cos7 cells, can improve the efficiency of membrane antibody expression.

4a. Binding the antigen of interest to inert beads, which are then mixed with the library of antibody-expressing cells. Cells bound to the antigen-coated beads are recovered and the associated immunoglobulin heavy chain recombinant virus is extracted.

4b. Alternatively, directly or indirectly attach a fluorescent label to the antigen of interest. Antibody-expressing cells that bind to the antigen are recovered by fluorescence-activated cell sorting.

4c. Alternatively, those host cells in which cross-linking of the antibody receptor to the antigen will induce cell death may be employed. This may be a natural occurrence in immature cells of the host cell B-cell germline, or a consequence of the introduction of a Fas-encoded death domain at the carboxy-terminus of the immunoglobulin heavy-chain constant region. The lysed cells are separated from the live cells, and the recombinant virus carrying the corresponding immunoglobulin heavy chain is extracted.

5. Repeat the cycle of steps 1-4 above several times, each time to isolate the recombinant virus and further enrich the heavy chain that is conducive to optimal antigen binding.

6. Once specific antibody heavy chains have been selected, the entire process is repeated for the immunoglobulin light chain cDNA library constructed in proprietary vaccinia virus in order to select specific immunoglobulin light chains that favor optimal antigen binding. Maximum diversification can be achieved by sequential selection of heavy and light chains by screening all available combinations of heavy and light chains. The final Mab product was optimized by selecting fully assembled bivalent antibodies rather than single chain Fv or monomeric Fabs.

7. Determine the sequence of the Mab and verify its specific binding by standard experimental techniques.

The final Mab product was optimized by selecting fully assembled bivalent antibodies rather than single chain Fvs. That said, _the selection was based on bivalent ( _H2L2 ) antibodies rather than scFv or Fab fragments. Synthesis and assembly of fully human intact antibodies in mammalian cells allows for normal post-translational modification and assembly of immunoglobulin chains. Synthesis and assembly of intact antibodies can be very inefficient inside bacterial cells and much specificity is lost because many antibodies do not fold properly in the abnormal physiological environment of bacterial cells.

A wide range of antibody epitope specificities can be selected, including selection of specificity based on functional activity. In particular, antibodies can be selected for specific physiological effects on target cells (eg, screening for inhibition of TNF secretion by activated monocytes; induction of apoptosis, etc.). The following is an overview of the methods for screening specific Mabs based on functional assays:

1. Construction of an immunoglobulin heavy chain cDNA library of naive human lymphocytes in a vaccinia virus vector prepared according to the method described herein. Pools of, for example, about 100 to about 1000 recombinant viruses are separately amplified and used to infect producer cells at a dilution such that each cell is infected with an average of one immunoglobulin heavy chain recombinant virus. These cells were also infected with psoralen-inactivated immunoglobulin light chain recombinant vaccinia virus from an immunoglobulin light chain library constructed in the same vaccinia virus vector. Alternatively, infected cells can be transfected with the immunoglobulin light chain recombinant in a plasmid expression vector. Each heavy chain can be associated with any light chain throughout the population of cells.

2. Infected cells are cultured for sufficient time to allow secretion of fully assembled antibodies.

3. Set up assay wells in which the functional indicator cells of interest are incubated in the presence of the secreted antibody sample. Said cells may, for example, comprise activated monocytes secreting TNF[alpha]. A simple TNF[alpha] ELISA assay can then be used to screen the antibody pool for activities that inhibit cytokine secretion.

4. Further analysis of individual members of the selected pools to identify relevant immunoglobulin heavy chains.

5. Once specific antibody heavy chains are selected, the entire process is repeated for the immunoglobulin light chain cDNA library constructed in a proprietary vaccinia virus vector in order to select specific immunoglobulin light chains that favor optimal antigen binding.

6. Identify the Mab sequence and verify its specific binding by standard experimental techniques. Because functional selection does not require prior knowledge of the target membrane receptor, selected Mabs are both potential drugs and discovery tools to identify relevant membrane receptors.

Selection in human cell culture following random association of immunoglobulin heavy and light chains. As mentioned above, this avoids the limitation of the antibody repertoire due to limitations in synthesis in bacteria. It also avoids the limitation of the antibody repertoire caused by tolerance to homologous gene products in mice. Mouse homologues of important human proteins are usually 80% to 85% identical to the human sequence. Thus, it is expected that mouse antibody responses to human proteins will be focused on epitopes that differ between 15% and 20% in humans and mice. The present invention enables the efficient selection of high affinity, fully human antibodies with a wide range of epitope specificities. This technique can be used for a variety of projects and purposes, including the functional selection of antibodies to unidentified membrane receptors of specific physiological significance.

The scope of the invention is not to be limited by the specific embodiments described, which are intended as illustrations of individual aspects of the invention, all functionally equivalent constructs, viruses and enzymes being within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing specification and accompanying drawings. Such changes are within the scope of the appended claims.

All publications and patent applications mentioned in this specification are individually and specifically incorporated by reference in their entirety. US Patent Application 08/935,377, filed September 22, 1997, and US Patent Application 60/192,586, filed March 28, 2000 are incorporated herein by reference.

sequence listing

<110>University of Rochester

<120> Method for screening polynucleotides encoding antigen-specific immunoglobulin molecules or antigen-specific fragments thereof

<130>1821.007PC05

<150>60/271,424

<151>2001-02-27

<150>60/262,067

<151>2001-01-18

<150>60/298,087

<151>2001-06-15

<150>60/249,268

<151>2000-11-17

<160>147

<170>PatentIn version 3.1

<210>1

<211>57

<212> DNA

<213> Artificial sequence

<220>

<223>p7.5/tk promoter

<400>1

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgccatggg cccggcc 57

<210>2

<211>145

<212>DNA

<213> Artificial sequence

<220>

<223>p7.5/ATGO/tk promoter

<400>2

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgccgtgga tcccccgggc 60

tgcaggaatt cgatatcaag cttatcgata ccgtcgacct cgagggggggg cctaactaac 120

taattttgtt tttgtgggcc cggcc 145

<210>3

<211>148

<212>DNA

<213> Artificial sequence

<220>

<223>p7.5/ATG1/tk promoter

<400>3

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgccatggt ggatcccccg 60

ggctgcagga attcgatatc aagcttatcg ataccgtcga cctcgagggg gggcctaact 120

aactaatttt gtttttgtgg gcccggcc 148

<210>4

<211>149

<212>DNA

<213> Artificial sequence

<220>

<223> p7.5/ATG2/tk vector

<400>4

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgccatgag tggatccccc 60

gggctgcagg aattcgatat caagcttatc gataccgtcg acctcgaggg ggggcctaac 120

taactaattt tgtttttgtg ggcccggcc 149

<210>5

<211>150

<212>DNA

<213> Artificial sequence

<220>

<223> p7.5/ATG3/tk vector

<400>5

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgccatgac gtggatcccc 60

cgggctgcag gaattcgata tcaagcttat cgataccgtc gacctcgagg gggggcctaa 120

ctaactaatt ttgtttttgt gggcccggcc 150

<210>6

<211>15

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400> 6

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>7

<211>15

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>7

Glu Ser Gly Arg Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210>8

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>8

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr

1 5 10

<210>9

<211>15

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>9

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Ser Lys Ser Thr Gln

1 5 10 15

<210>10

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>10

Glu Gly Lys Ser Ser Ser Gly Ser Gly Ser Glu Ser Lys Val Asp

1 5 10

<210>11

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>11

Gly Ser Thr Ser Gly Ser Gly Lys Ser Ser Glu Gly Lys Gly

1 5 10

<210>12

<211>18

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>12

Lys Glu Ser Gly Ser Val Ser Ser Ser Glu Gln Leu Ala Gln Phe Arg Ser

1 5 10 15

Leu Asp

<210>13

<211>16

<212>PRT

<213> Artificial sequence

<220>

<223> linker peptide

<400>13

Glu Ser Gly Ser Val Ser Ser Glu Glu Leu Ala phe Arg Ser Leu Asp

1 5 10 15

<210>14

<211>1555

<212>DNA

<213> Artificial sequence

<220>

<223>pVHE transfer plasmid

<400>14

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgcaaacca tgggatggag 60

ctgtatcatc ctcttcttgg tagcaacagc tacaggcgcg catatggtca ccgtctcctc 120

agggagtgca tccgccccaa cccttttccc cctcgtctcc tgtgagaatt ccccgtcgga 180

tacgagcagc gtggccgttg gctgcctcgc acaggacttc cttcccgact ccatcacttt 240

ctcctggaaa tacaagaaca actctgacat cagcagcacc cggggcttcc catcagtcct 300

gagaggggggc aagtacgcag ccacctcaca ggtgctgctg ccttccaagg acgtcatgca 360

gggcacagac gaacacgtgg tgtgcaaagt ccagcacccc aacggcaaca aagaaaagaa 420

cgtgcctctt ccagtgattg ctgagctgcc tcccaaagtg agcgtcttcg tcccaccccg 480

cgacggcttc ttcggcaacc cccgcagcaa gtccaagctc atctgccagg ccacgggttt 540

cagtccccgg cagattcagg tgtcctggct gcgcgagggg aagcaggtgg ggtctggcgt 600

caccacggac caggtgcagg ctgaggccaa agagtctggg cccacgacct acaaggtgac 660

tagcacactg accatcaaag agagcgactg gctcagccag agcatgttca cctgccgcgt 720

ggatcacagg ggcctgacct tccagcagaa tgcgtcctcc atgtgtgtcc ccgatcaaga 780

cacagccatc cgggtcttcg ccatcccccc atcctttgcc agcatcttcc tcaccaagtc 840

caccaagttg acctgcctgg tcacagacct gaccacctat gacagcgtga ccatctcctg 900

gacccgccag aatggcgaag ctgtgaaaac ccaccaac atctccgaga gccaccccaa 960

tgccactttc agcgccgtgg gtgaggccag catctgcgag gatgactgga attccgggga 1020

gaggttcacg tgcaccgtga cccacacaga cctgccctcg ccactgaagc agaccatctc 1080

ccggcccaag ggggtggccc tgcacaggcc cgatgtctac ttgctgccac cagcccggga 1140

gcagctgaac ctgcgggagt cggccaccat cacgtgcctg gtgacgggct tctctcccgc 1200

ggacgtcttc gtgcagtgga tgcagagggg gcagcccttg tccccggaga agtatgtgac 1260

cagcgcccca atgcctgagc cccaggcccc aggccggtac ttcgcccaca gcatcctgac 1320

cgtgtccgaa gaggaatgga acacggggga gacctacacc tgcgtggtgg cccatgaggc 1380

cctgcccaac agggtcactg agaggaccgt ggacaagtcc accgagggggg aggtgagcgc 1440

cgacgaggag ggctttgaga acctgtgggc caccgcctcc accttcatcg tcctcttcct 1500

cctgagcctc ttctacagta ccaccgtcac cttgttcaag gtgaaatgag tcgac 1555

<210>15

<211>6

<212>DNA

<213> Artificial sequence

<220>

<223> Unique BssHII site in pVHE

<400>15

gcgcgc 6

<210>16

<211>7

<212>DNA

<213> Artificial sequence

<220>

<223> Unique BstEII site in pVHE

<400>16

ggtcacc 7

<210>17

<211>446

<212>DNA

<213> Artificial sequence

<220>

<223>pVKE transfer plasmid

<400>17

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgcccatgg gatggagctg 60

tatcatcctc ttcttggtag caacagctac aggcgtgcac ttgactcgag atcaaacgaa 120

ctgtggctgc accatctgtc ttcatcttcc cgccatctga tgagcagttg aaatctggaa 180

ctgcctctgt tgtgtgcctg ctgaataact tctatcccag agaggccaaa gtacagtgga 240

aggtggataa cgccctccaa tcgggtaact cccaggagag tgtcacagag caggacagca 300

aggacagcac ctacagcctc agcagcaccc tgacgctgag caaagcagac tacgagaaac 360

acaaagtcta cgcctgcgaa gtcacccatc agggcctgag ctcgcccgtc acaaagagct 420

tcaacagggg agagtgttag gtcgac 446

<210>18

<211>6

<212>DNA

<213> Artificial sequence

<220>

<223> Unique ApaLI site in pVKE plasmid

<400>18

gtgcac 6

<210>19

<211>6

<212>DNA

<213> Artificial sequence

<220>

<223> Unique XhoI site in pVKE plasmid

<400>19

ctcgag 6

<210>20

<211>455

<212>DNA

<213> Artificial sequence

<220>

<223>pVLE transfer plasmid

<400>20

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgcccatgg gatggagctg 60

tatcatcctc ttcttggtag caacagctac aggcgtgcac ttgactcgag aagcttaccg 120

tcctacgaac tgtggctgca ccatctgtct tcatcttccc gccatctgat gagcagttga 180

aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga gaggccaaag 240

tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt gtcacagagc 300

aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc aaagcagact 360

acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagc tcgcccgtca 420

caaagagctt caacagggga gagtgttagg tcgac 455

<210>21

<211>6

<212>DNA

<213> Artificial sequence

<220>

Unique ApaLI site in the <223> pVLE plasmid

<400>21

gtgcac 6

<210>22

<211>6

<212>DNA

<213> Artificial sequence

<220>

<223> Unique HindIII site in pVLE

<400>22

aagctt 6

<210>23

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223>H-2Kd restricted peptide (restricted peptide)

<400>23

Gly Tyr Lys Ala Gly Met Ile His Ile

1 5

<210>24

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>24

attaggatcc ggtcaccgtc tcctcaggg 29

<210>25

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>25

attagtcgac tcatttcacc ttgaacaagg tgac 34

<210>26

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223> Cassette for making p7.5/tk2

<400>26

gcggccgcaa accatggaaa gcgcgcatat ggtcaccaaa agtcgac 47

<210>27

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>27

attaggatcc ggtcaccgtc tcctcaggg 29

<210>28

<211>31

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>28

attagtcgac tcagtagcag gtgccagctg t 31

<210>29

<211>50

<212>DNA

<213> Artificial sequence

<220>

<223> Cassette for making p7.5/tk3

<400>29

gcggccgccc atggatacgt gcacttgact cgagaagctt agtagtcgac 50

<210>30

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>30

caggactcga gatcaaacga actgtggctg 30

<210>31

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>31

aatatgtcga cctaacactc tcccctgttg aagctcttt 39

<210>32

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>32

aatatgtcga cctaacactc tcccctgttg aagctctt 38

<210>33

<211>40

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>33

atttaagctt accgtcctac gaactgtggc tgcaccatct 40

<210>34

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>34

ttttgcgcgc actcccaggt gcagctggtg cagtctgg 38

<210>35

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>35

ttttgcgcgc actccgaggt gcagctggtg gagtctgg 38

<210>36

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>36

ttttgcgcgc actcccaggt gcagctgcag gagtcggg 38

<210>37

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>37

gacggtgacc agggtgccct ggcccca 27

<210>38

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>38

gacggtgacc agggtgccac ggcccca 27

<210>39

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>39

gacggtgacc attgtccctt ggcccca 27

<210>40

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>40

gacggtgacc agggttccct ggcccca 27

<210>41

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>41

gacggtgacc gtggtccctt ggcccca 27

<210>42

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>42

tttgtgcact ccgacatcca gatgaccccagtctcc 35

<210>43

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>43

tttgtgcact ccgatgttgt gatgactcag tctcc 35

<210>44

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>44

tttgtgcact ccgaaattgt gttgacgcag tctcc 35

<210>45

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>45

tttgtgcact ccgacatcgt gatgacccag tctcc 35

<210>46

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>46

tttgtgcact ccgaaacgac actcacgcag tctcc 35

<210>47

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>47

tttgtgcact ccgaaattgt gctgactcag tctcc 35

<210>48

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>48

gatctcgagcttggtccctt ggccgaa 27

<210>49

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>49

gatctcgagc ttggtcccct ggccaaa 27

<210>50

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>50

gatctcgagt ttggtcccag ggccgaa 27

<210>51

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>51

gatctcgagc ttggtccctc cgccgaa 27

<210>52

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>52

aatctcgagt cgtgtccctt ggccgaa 27

<210>53

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>53

tttgtgcact cccagtctgt gttgacgcag ccgcc 35

<210>54

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>54

tttgtgcact cccagtctgc cctgactcag cctgc 35

<210>55

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>55

tttgtgcact cctcctatgt gctgactcag ccacc 35

<210>56

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>56

tttgtgcact cctcttctga gctgactcag gaccc 35

<210>57

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>57

tttgtgcact cccacgttatactgactcaa ccgcc 35

<210>58

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>58

tttgtgcact cccaggctgt gctcactcag ccgtc 35

<210>59

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>59

tttgtgcact ccaattttat gctgactcag cccca 35

<210>60

<211>35

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>60

tttgtgcact cccaggctgt ggtgactcag gagcc 35

<210>61

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>61

ggtaagcttg gtcccagttc cgaagac 27

<210>62

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>62

ggtaagcttg gtccctccgc cgaat 25

<210>63

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>63

aatatgcgcg cactcccagg tgcagctggt gcagtctgg 39

<210>64

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>64

aatatgcgcg cactcccagg tcaccttgaa ggagtctgg 39

<210>65

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>65

aatatgcgcg cactccgagg tgcagctggt ggagtctgg 39

<210>66

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>66

aatatgcgcg cactcccagg tgcagctgca gagtcggg 39

<210>67

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>67

aatatgcgcg cactccgagg tgcagctggt gcagtctg 38

<210>68

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>68

gagacggtga ccagggtgcc ctggcccca 29

<210>69

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>69

gagacggtga ccagggtgcc acggcccca 29

<210>70

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>70

gagacggtga ccattgtccc ttggcccca 29

<210>71

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>71

gagacggtga ccagggttcc ctggcccca 29

<210>72

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>72

gagacggtga ccgtggtccc ttggcccca 29

<210>73

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>73

caggagtgca ctccgacatc cagatgaccc agtctcc 37

<210>74

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>74

caggagtgca ctccgatgtt gtgatgactc agtctcc 37

<210>75

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>75

caggagtgca ctccgaaatt gtgttgacgc agtctcc 37

<210>76

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>76

caggagtgca ctccgacatc gtgatgaccc agtctcc 37

<210>77

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>77

caggagtgca ctccgaaacg acactcacgc agtctcc 37

<210>78

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>78

caggagtgca ctccgaaatt gtgctgactc agtctcc 37

<210>79

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>79

ttgatctcga gcttggtccc ttggccgaa 29

<210>80

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>80

ttgatctcga gcttggtccc ctggccaaa 29

<210>81

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>81

ttgatctcga gtttggtccc agggccgaa 29

<210>82

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>82

ttgatctcga gcttggtccc tccgccgaa 29

<210>83

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>83

ttaatctcga gtcgtgtccc ttggccgaa 29

<210>84

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>84

cagatgtgca ctcccagtct gtgttgacgc agccgcc 37

<210>85

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>85

cagatgtgca ctcccagtct gccctgactc agcctgc 37

<210>86

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>86

cagatgtgca ctcctcctat gtgctgactc agccacc 37

<210>87

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>87

cagatgtgca ctcctcttct gagctgactc aggaccc 37

<210>88

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>88

cagatgtgca ctcccacgtt atactgactc aaccgcc 37

<210>89

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>89

cagatgtgca ctcccaggct gtgctcactc agccgtc 37

<210>90

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>90

cagatgtgca ctccaatttt atgctgactc agcccca 37

<210>91

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>91

cagatgtgca ctcccaggct gtggtgactc aggagcc 37

<210>92

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>92

acggtaagct tggtcccagt tccgaagac 29

<210>93

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>93

acggtaagct tggtccctcc gccgaatac 29

<210>94

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>94

atgttacgtc ctgtagaaac c 21

<210>95

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>95

tcattgtttg cctccctgct g 21

<210>96

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>96

aaagcggccg ccccgggatg ttacgtcc 28

<210>97

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>97

aaagggcccg gcgcgcctca ttgtttgcc 29

<210>98

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>98

aaaggatcca taatgaattc agtgactgta tcacacg 37

<210>99

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>99

cttgcggccg cttaataaat aaaccccttga gccc 34

<210>100

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>100

attgagct taatactttt gtcgggtaac agag 34

<210>101

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>101

ttactcgaga gtgtcgcaat ttggatttt 29

<210>102

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>102

aaagaattcc tttatgtcatcggccaaa 29

<210>103

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>103

aatctgcagt cattgtttgc ctccctgctg 30

<210>104

<211>37

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>104

aaagaattca taatgaattc agtgactgta tcacacg 37

<210>105

<211>32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400>105

cttggatcct taataaataa acccttgagc cc 32

<210>106

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>106

aataagcttt actccagata atatgga 27

<210>107

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> primer

<400>107

aatctgcagc ccagttccat ttt 23

<210>108

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>108

aatggatcct catccagcgg cra 23

<210>109

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>109

aatgagct agtacctaca acccgaa 27

<210>110

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>110

aaagtcgacg gccaaaaatt gaaatttt 28

<210>111

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>111

aatggatcct cattgtttgc ctccc 25

<210>112

<211>51

<212>DNA

<213> Artificial sequence

<220>

<223> Transformation of plasmid p7.5/tk3 into p7.5/tk3.1 cassette

<400>112

gcggccgccc atggatagcg tgcacttgac tcgagaagct tagtagtcga c 51

<210>113

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223>Region replaced when transforming plasmid p7.5/tk3.1 to p7.5/tk3.2

<400>113

ctcgagaagc ttagtagtcg ac 22

<210>114

<211>78

<212>DNA

<213> Artificial sequence

<220>

<223> Cassette for transformation of plasmid p7.5/tk3.1 into p7.5/tk3.2

<400>114

ctcgagatca aagagggtaa atcttccgga tctggttccg aaggcgcgca tgcggtcacc 60

gtctcctcat gagtcgac 78

<210>115

<211>42

<212>DNA

<213> Artificial sequence

<220>

<223>p7.5/tk3.2 connector

<400>115

gagggtaaat cttccggatc tggttccgaa ggcgcgcact cc 42

<210>116

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223>p7.5/tk3.2 connector

<400>116

Glu Gly Lys Ser Ser Gly Ser Ser Gly Ser Glu Gly Ala His Ser

1 5 10

<210>117

<211>16

<212>DNA

<213> Artificial sequence

<220>

<223>Region replaced when plasmid p7.5/tk3.1 is transformed into p7.5/tk3.3

<400>117

aagcttagta gtcgac 16

<210>118

<211>81

<212>DNA

<213> Artificial sequence

<220>

<223> Cassette for transformation of plasmid p7.5/tk3.1 into p7.5/tk3.3

<400>118

aagcttaccg tcctagaggg taaatcttcc ggatctggtt ccgaaggcgc gcatgcggtc 60

accgtctcct catgagtcga c 81

<210>119

<211>42

<212> DNA

<213> Artificial sequence

<220>

<223>p7.5/tk3.3 connector

<400>119

gagggtaaat cttccggatc tggttccgaa ggcgcgcact cc 42

<210>120

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223>p7.5/tk3.3 connector

<400>120

Glu Gly Lys Ser Ser Gly Ser Gly Ser Glu Gly Ala His Ser

1 5 10

<210>121

<211>29

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>121

attaggatcc ggtcaccgtctcctcagcc 29

<210>122

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>122

attagtcgac tcatttaccc ggagacagggg agag 34

<210>123

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>123

aatatggtca ccgtctcctc agcc 24

<210>124

<211>36

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<220>

<221> Other features

<222>(2)..(3)

<223> can be any nucleotide

<220>

<221> Other features

<222>(5)..(6)

<223> can be any nucleotide

<220>

<221> Other features

<222>(8)..(9)

<223> can be any nucleotide

<220>

<221> Other features

<222>(11)..(12)

<223> can be any nucleotide

<220>

<221> Other features

<222>(14)..(15)

<223> can be any nucleotide

<220>

<221> Other features

<222>(17)..(18)

<223> can be any nucleotide

<400>124

mnnmnnmnnm nnmnnmnntt caggtgctgg gcacgg 36

<210>125

<211>36

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<220>

<221> Other features

<222>(1)..(2)

<223> can be any nucleotide

<220>

<221> Other features

<222>(4)..(5)

<223> can be any nucleotide

<220>

<221> Other features

<222>(7)..(8)

<223> can be any nucleotide

<220>

<221> Other features

<222>(10)..(11)

<223> can be any nucleotide

<220>

<221> Other features

<222>(13)..(14)

<223> can be any nucleotide

<220>

<221> Other features

<222>(16)..(17)

<223> can be any nucleotide

<400>125

nnknnknnkn nknnknnkgt cttcctcttc ccccca 36

<210>126

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>126

aatatgtcga ctcatttacc cgg 23

<210>127

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>127

acacggtcac cgtctcctca gggagtgc 28

<210>128

<211>31

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>128

agttagatct ggatcctgga agaggcacgt t 31

<210>129

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>129

aacgtgcctc ttccaggatc cagatctaac 30

<210>130

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>130

acgcgtcgac ctagaccaag ctttggattt cat 33

<210>131

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>131

ctctcccgcg gacgtcttcg t 21

<210>132

<211>31

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>132

agttagatct ggatccctca aagccctcct c 31

<210>133

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>133

gaggagggct ttgagggatc cagatctaac 30

<210>134

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>134

aatagtggtg atatatttca ccttgaacaa 30

<210>135

<211>30

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>135

ttgttcaagg tgaaagtgaa gagaaaggaa 30

<210>136

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>136

attagaattc atgcctgggg gtccagga 28

<210>137

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>137

attaggatcc tcacggcttc tccagctg 28

<210>138

<211>28

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>138

attaggatcc atggccaggc tggcgttg 28

<210>139

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>139

attaccagca cactggtcac tcctggcctg ggtg 34

<210>140

<211>69

<212>DNA

<213> Artificial sequence

<220>

<223>p7.5/tk promoter

<220>

<221> CDS

<222>(46)..(69)

<223>

<400>140

ggccaaaaat tgaaaaacta gatctattta ttgcacgcgg ccgcc atg ggc ccg gcc 57

Ala

1

gcc aac ggc gga 69

Ala Asn Gly Gly

5

<210>141

<211>8

<212>PRT

<213> Artificial sequence

<220>

<223> tk sequence of p7.5/tk

<400>141

Met Gly Pro Ala Ala Asn Gly Gly

1 5

<210>142

<211>75

<212>DNA

<213> Artificial sequence

<220>

<223>pE/Ltk promoter

<220>

<221> CDS

<222>(52)..(75)

<223>

<400>142

ggccaaaaat tgaaatttta tttttttttt ttggaatata aagcggccgc c atg ggc 57

Met Gly

1

ccg gcc gcc aac ggc gga 75

Pro Ala Ala Asn Gly Gly

5

<210>143

<211>8

<212>PRT

<213> Artificial sequence

<220>

<223> tk sequence of pE/Ltk

<400>143

Met Gly Pro Ala Ala Asn Gly Gly

1 5

<210>144

<211>39

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>144

aatatgcgcg cactcccagg tcaccttgaa ggagtctgg 39

<210>145

<211>38

<212>DNA

<213> Artificial sequence

<220>

<223> Primer

<400>145

aatatgcgcg cactcccgagg tgcagctggt gcagtctg 38

<210>146

<211>19

<212>PRT

<213> Artificial sequence

<220>

<223> signal sequence

<400>146

Met Gly Trp Ser cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly

1 5 10 15

Ala His Ser

<210>147

<211>26

<212>PRT

<213> Artificial sequence

<220>

<223> signal sequence

<400>147

Asn Leu Trp Thr Thr Ala Ser Thr phe Ile Val Leu Phe Leu Leu Ser

1 5 10 15

Leu Phe Tyr Ser Thr Thr Val Thr Leu Phe

20 25

Claims (88)

1. method of selecting coding for antigens specific immunoglobulin molecule or the segmental polynucleotide of its antigen-specific comprises:

(a) will import to the eukaryotic host cell group that can express described immunoglobulin molecules through the first polynucleotide library that has operably connected transcription regulatory region, the multiple first immunoglobulin (Ig) subunit polypeptide of coding; Wherein each first immunoglobulin (Ig) subunit polypeptide comprises:

(i) be selected from first constant region for immunoglobulin of CH and constant region of light chain,

(ii) with the corresponding immune globulin variable region of described first constant region, and

(iii) can instruct the cell surface expression or the excretory signal peptide of the described first immunoglobulin (Ig) subunit polypeptide;

(b) in described host cell, import the second polynucleotide library of the multiple second immunoglobulin (Ig) subunit polypeptide of coding operably connected transcription regulatory region; Wherein each second immunoglobulin (Ig) subunit polypeptide comprises:

(i) be selected from second constant region for immunoglobulin of CH and constant region of light chain, wherein this second constant region for immunoglobulin is different with first constant region for immunoglobulin,

(ii) with the corresponding immune globulin variable region of described second constant region, and

(iii) can instruct the cell surface expression or the excretory signal peptide of the described second immunoglobulin (Ig) subunit polypeptide;

The wherein said second immunoglobulin (Ig) subunit polypeptide can be combined to form immunoglobulin molecules or its antigen-specific fragment with the described first immunoglobulin (Ig) subunit polypeptide;

(c) allow described host cell expression immunoglobulin molecules or its antigen-specific fragment;

(d) described immunoglobulin molecules is contacted with antigen; And

(e) those polynucleotide of the coding first immunoglobulin (Ig) subunit polypeptide in the recovery first polynucleotide library, the described first immunoglobulin (Ig) subunit polypeptide is special as an immunoglobulin molecules or the segmental part of its antigen-specific for described antigen.

2. the method for claim 1 comprises in addition:

(f) the described polynucleotide that are recovered to are imported the host cell group that can express described immunoglobulin molecules;

(g) import the described second polynucleotide library to this host cell;

(h) allow described host cell expression immunoglobulin molecules or its antigen-specific fragment;

(i) described host cell is contacted with antigen; And

(j) those polynucleotide of the coding first immunoglobulin (Ig) subunit polypeptide in the recovery first polynucleotide library, the described first immunoglobulin (Ig) subunit polypeptide is special as an immunoglobulin molecules or the segmental part of its antigen-specific for described antigen.

3. the method for claim 2, comprise in addition step (f)-(j) is repeated one or repeatedly, thereby the polynucleotide of the coding first immunoglobulin (Ig) subunit polypeptide in the described first polynucleotide library of enrichment, wherein this first immunoglobulin (Ig) subunit polypeptide can be specifically in conjunction with described antigen as an immunoglobulin molecules or the segmental part of its antigen-specific.

4. the method for claim 1 comprises those polynucleotide that separation is recovered in addition from the described first polynucleotide library.

5. the method for claim 4 comprises in addition:

(k) the described second polynucleotide library is imported the eukaryotic host cell group that can express described immunoglobulin molecules;

(1) imports those polynucleotide that separate from the first polynucleotide library to this host cell;

(m) allow described host cell expression immunoglobulin molecules or its antigen-specific fragment;

(n) this host cell is contacted with described specific antigen; And

(o) those polynucleotide of the coding second immunoglobulin (Ig) subunit polypeptide in the described second polynucleotide library of recovery, the described second immunoglobulin (Ig) subunit polypeptide is special as an immunoglobulin molecules or the segmental part of its antigen-specific for described antigen.

6. the method for claim 5 comprises in addition:

(p) the described polynucleotide that are recovered to are imported the host cell group that can express described immunoglobulin molecules;

(q) import those polynucleotide that separate from the first polynucleotide library to this host cell;

(r) allow host cell expression immunoglobulin molecules or its antigen-specific fragment;

(s) this host cell is contacted with described antigen, and

(t) those polynucleotide of the coding second immunoglobulin (Ig) subunit polypeptide in the described second polynucleotide library of recovery, the described second immunoglobulin (Ig) subunit polypeptide is special as an immunoglobulin molecules or the segmental part of its antigen-specific for described antigen.

7. the method for claim 6, comprise in addition step (p)-(t) is repeated one or repeatedly, thereby the polynucleotide of the coding second immunoglobulin (Ig) subunit polypeptide in the described second polynucleotide library of enrichment, wherein this second immunoglobulin (Ig) subunit polypeptide can be specifically in conjunction with described antigen as an immunoglobulin molecules or the segmental part of its antigen-specific.

8. the method for claim 7 comprises those polynucleotide that separation is recovered in addition from the described second polynucleotide library.

9. the method for preparing segmental first polynucleotide of coding for antigens specific immunoglobulin molecule or its antigen-specific and second polynucleotide will be comprising will be combined according to the method separated coding first immunoglobulin (Ig) subunit polypeptide of claim 8 or segmental first polynucleotide of its antigen-specific and the coding second immunoglobulin (Ig) subunit polypeptide or segmental second polynucleotide of its antigen-specific.

10. the method for preparing antigen expressed specific immunoglobulin molecule or the segmental host cell of its antigen-specific is comprising will expressing in the eukaryotic host cell of described polynucleotide with coding second immunoglobulin (Ig) subunit polypeptide or segmental second polynucleotide importing of its antigen-specific according to coding first immunoglobulin (Ig) subunit polypeptide or segmental first polynucleotide of its antigen-specific that the method for claim 9 is produced.

11. host cell according to the preparation of the method for claim 10.

12. preparation antigen specific immune globulin molecule or the segmental method of its antigen-specific, comprising:

The host cell of cultivation claim 11 under the condition of expression can take place at the described coding first immunoglobulin (Ig) subunit polypeptide or segmental first polynucleotide of its antigen-specific and the coding second immunoglobulin (Ig) subunit polypeptide or segmental second polynucleotide of its antigen-specific; With the described antigen specific immune globulin molecule of recovery or its antigen-specific fragment.

13. the process of claim 1 wherein that described immunoglobulin molecules is the human normal immunoglobulin molecule.

14. the process of claim 1 wherein that the described first immunoglobulin (Ig) subunit polypeptide is a heavy chain immunoglobulin, or its antigen-specific fragment.

15. the method for claim 14, wherein said heavy chain immunoglobulin are the heavy chain immunoglobulins of secreted form.

16. the method for claim 14, the heavy chain immunoglobulin that wherein said heavy chain immunoglobulin or its antigen-specific fragment are film combining form.

17. the method for claim 16, wherein said heavy chain immunoglobulin or its antigen-specific fragment comprise natural immunoglobulin (Ig) membrane spaning domain.

18. the method for claim 16, wherein said heavy chain immunoglobulin or its antigen-specific fragment are as the part of fusion rotein and attached on the described host cell.

19. the method for claim 18, wherein said fusion rotein comprises the allos membrane spaning domain.

20. the method for claim 18, wherein said fusion rotein comprises the fas death domain.

21. the method for claim 14, wherein said heavy chain immunoglobulin or its antigen-specific fragment are selected from the IgM heavy chain, IgD heavy chain, IgG heavy chain, IgA heavy chain, IgE heavy chain, and the antigen-specific fragment of any described heavy chain.

22. the method for claim 21, wherein said heavy chain immunoglobulin or its antigen-specific fragment comprise IgM heavy chain or its antigen-specific fragment.

23. the method for claim 14, wherein said immunoglobulin heavy chain constant region sequence comprises the modification that can support altered immunological effect subfunction.

24. the process of claim 1 wherein that the described second immunoglobulin (Ig) subunit polypeptide is a light chain immunoglobulin, or its antigen-specific fragment.

25. the method for claim 24, wherein said light chain immunoglobulin or its antigen-specific fragment can be united with described heavy chain immunoglobulin or its antigen-specific fragment, thereby produce immunoglobulin molecules or its antigen-specific fragment.

26. the method for claim 24, wherein said light chain immunoglobulin is selected from κ light chain and lambda light chain.

27. the process of claim 1 wherein that the described first polynucleotide library construction is in the eucaryon virus vector.

28. the process of claim 1 wherein that the described second polynucleotide library construction is in the eucaryon virus vector.

29. the method for claim 5, the polynucleotide of wherein said separation from the first polynucleotide library utilize the eucaryon virus vector to import.

30. the process of claim 1 wherein that the described second polynucleotide library construction is in plasmid vector.

31. the method for claim 27, wherein said host cell infects in about 1 to 10 the first polynucleotide library with MOI, and the described second polynucleotide library is imported into allowing each infected host cell can absorb under the condition that reaches 20 polynucleotide in the described second polynucleotide library.

32. the method for claim 5, wherein said separation imports described host cell from the polynucleotide in the first polynucleotide library in plasmid vector.

33. the method for claim 27, wherein said eucaryon virus vector is an animal virus vector.

34. the method for claim 28, wherein said eucaryon virus vector is an animal virus vector.

35. the method for claim 33, wherein said animal virus vector can produce infectious viral particle in mammalian cell.

36. the method for claim 35, the natural gene group of wherein said animal virus vector is DNA.

37. the method for claim 35, the natural gene group of wherein said animal virus vector is RNA.

38. the method for claim 36, the natural gene group of wherein said animal virus vector is a linear dsdna.

39. the method for claim 28, wherein said eucaryon virus vector is an animal virus vector, and this eucaryon virus vector is a linear dsdna.

40. the method for claim 38, wherein said animal virus vector is selected from adenovirus carrier, herpesvirus vector and poxvirus vector.

41. the method for claim 40, wherein said animal virus vector is a poxvirus vector.

42. the method for claim 41, wherein said poxvirus vector is selected from the vaccinia subgroup virus carrier, fowlpox virus carrier, goat capripoxvirus carrier, hare poxvirus carrier, entomopoxvirus carrier and pig pox virus carrier.

43. the method for claim 42, wherein said vaccinia subgroup virus carrier is the raccoonpox virus carrier.

44. the method for claim 42, wherein said host cell allows to produce the infectious viral particle of described virus.

45. the method for claim 40, the transcription regulatory region in the wherein said first polynucleotide library can play a role in by the kytoplasm of the cell of poxvirus infection.

46. the method for claim 30, wherein said plasmid vector instructs the described second immunoglobulin (Ig) subunit synthetic in by the kytoplasm of the cell of poxvirus infection by operably connecting transcription regulatory region.

47. the method for claim 45, wherein said transcription regulatory region comprises promotor.

48. the method for claim 47, wherein said promotor is a composing type.

49. the method for claim 48, wherein said promotor are vaccinia virus p7.5 promotors.

50. the method for claim 48, wherein said promotor are synthetic morning/late promoters.

51. the method for claim 47, wherein said promotor are activated T7 phage promoters in the cell of expressing t7 rna polymerase.

52. the method for claim 45, wherein said transcription regulatory region comprises transcription termination region.

53. the method for claim 38, the wherein said first polynucleotide library construction is in the eucaryon virus vector, and construction process comprises:

(a) the linear DNA viral genome of cutting and separating, thus first viral fragment and second viral fragment produced, and wherein said first fragment and second fragment do not have homology;

(b) provide the transferring plasmid group, these plasmids comprise the described heavy chain immunoglobulin group's that operably links together, encodes with transcription regulatory region described polynucleotide, side joint has 5 ' flanking region and 3 ' flanking region, wherein said 5 ' flanking region and the described first viral fragment homology, the 3 ' flanking region and the second viral fragment homology; And wherein said transferring plasmid can with the described first and second viral fragment homologous recombination, thereby the viral genome of form living;

(c) with the described transferring plasmid and first and second viral fragments, under this transferring plasmid and viral fragment can carry out the condition of homologous recombination in the body, import host cell, thereby produce the adorned live virus genome that contains Nucleotide more than the coding heavy chain immunoglobulin; And

(d) reclaim described adorned viral genome.

54. the method for claim 39, the wherein said second polynucleotide library construction is in the eucaryon virus vector, and construction process comprises:

(a) thus the linear DNA viral genome of cutting and separating produces first viral fragment and second viral fragment, wherein said first fragment and second fragment do not have homology;

(b) provide the transferring plasmid group, these plasmids comprise the described light chain immunoglobulin group's that operably links together, encodes with transcription regulatory region polynucleotide, side joint has 5 ' flanking region and 3 ' flanking region, wherein said 5 ' flanking region and the described first viral fragment homology, the 3 ' flanking region and the second viral fragment homology; And wherein said transferring plasmid can with the described first and second viral fragment homologous recombination, thereby the viral genome of form living;

(c) with the described transferring plasmid and first and second viral fragments, under this transferring plasmid and viral fragment can carry out the condition of homologous recombination in the body, import host cell, thereby produce the adorned live virus genome that contains Nucleotide more than the coding light chain immunoglobulin; And

(d) reclaim described adorned viral genome.

55. the process of claim 1 wherein that the polynucleotide of described coding for antigens specific immunoglobulin molecule are identified by detecting following effect:

(a) necrocytosis of antigen induction;

(b) the signal transmission of antigen induction; Perhaps

(c) antigen-specific combination.

56. the method for claim 5, the polynucleotide of wherein said coding for antigens specific immunoglobulin molecule are identified by detecting following effect:

(a) necrocytosis of antigen induction;

(b) the signal transmission of antigen induction; Perhaps

(c) antigen-specific combination.

57. the method for claim 55, wherein said effect are the necrocytosiss of antigen induction.

58. the method for claim 56, wherein said effect are the necrocytosiss of antigen induction.

59. the method for claim 57, wherein said host cell is at its surface expression immunoglobulin molecules, and these expression can the crosslinked generation of the described immunoglobulin molecules of the former inductive of facedown be replied by the experience apoptosis with the host cell of described antigen bonded immunoglobulin molecules.

60. the method for claim 58, wherein said host cell is at its surface expression immunoglobulin molecules, and these expression can the crosslinked generation of the described immunoglobulin molecules of the former inductive of facedown be replied by the experience apoptosis with the host cell of described antigen bonded immunoglobulin molecules.

61. the method for claim 55, wherein said effect are the signal transmission of antigen induction.

62. the method for claim 56, wherein said effect are the signal transmission of antigen induction.

63. the method for claim 61, wherein said host cell is at its surface expression immunoglobulin molecules, these expression can be with the host cell of described antigen bonded immunoglobulin molecules by expressing detectable reporter molecule to antigen inductive immunoglobulin molecules crosslinked generation reply.

64. the method for claim 62, wherein said host cell is at its surface expression immunoglobulin molecules, these expression can be with the host cell of described antigen bonded immunoglobulin molecules by expressing detectable reporter molecule to antigen inductive immunoglobulin molecules crosslinked generation reply.

65. the method for claim 63, wherein said reporter molecule is selected from luciferase, green fluorescent protein and beta-galactosidase enzymes.

66. the method for claim 64, wherein said reporter molecule is selected from luciferase, green fluorescent protein and beta-galactosidase enzymes.

67. the method for claim 55, wherein said effect are the antigen-specific combinations.

68. the method for claim 67 comprises:

(a) the expressed antigen specific immune globulin molecule of described host cell can with described antigen bonded condition under, the host cell pond is contacted with antigen; With

(b) duplicate the polynucleotide that reclaim the first polynucleotide library the pond from those expression and the host cell pond of described antigen generation bonded immunoglobulin molecules or the polynucleotide of before having reserved.

69. the method for claim 68 comprises in addition:

(c) the described polynucleotide that are recovered to are divided into a plurality of inferior ponds, these inferior ponds are imported the host cell group that can express described immunoglobulin molecules;

(d) allow described host cell expression immunoglobulin molecules or its antigen-specific fragment;

(e) the expressed antigen specific immune globulin molecule of described host cell can with described antigen bonded condition under, described pond is contacted with antigen; And

(f) duplicate the polynucleotide that reclaim the first polynucleotide library the pond from those expression and the host cell pond of described antigen generation bonded immunoglobulin molecules or the polynucleotide of before having reserved.

70. the method for claim 69, comprise in addition step (c)-(f) is repeated one or repeatedly, thereby the polynucleotide of the coding first immunoglobulin (Ig) subunit polypeptide in the described first polynucleotide library of enrichment, wherein this first immunoglobulin (Ig) subunit polypeptide can be specifically in conjunction with described antigen as an immunoglobulin molecules or the segmental part of its antigen-specific.

71. the method for claim 67, wherein said antigen are attached on the matrix, this matrix is selected from synthetic particle, polymkeric substance, the tissue culturing plate of magnetic bead and protein bag quilt.

72. the method for claim 67, wherein said antigen presentation are on the surface of the presenting cell of antigen expressed, the presenting cell of this antigen expressed does not make up by having antigenic presenting cell with the described antigenic polynucleotide transfection of operably encoding.

73. the method for claim 72, the presenting cell of wherein said antigen expressed are structured in the no antigen presenting cell that is selected from down group: L cell, Cos7 cell, 293 cells, HeLa cell and NIH 3T3 cell.

74. the method for claim 68, wherein said antigen has been puted together fluorescence labels, by fluorescence-activated cell sorting identify expression can with the host cell pond of antigen bonded immunoglobulin molecules.

75. the method for claim 56, wherein said effect are the antigen-specific combinations.

76. the method for claim 75 comprises:

(a) the expressed antigen specific immune globulin molecule of described host cell can with described antigen bonded condition under, the host cell pond is contacted with antigen; With

(b) duplicate the polynucleotide that reclaim the second polynucleotide library the pond from those expression and the host cell pond of described antigen generation bonded immunoglobulin molecules or the polynucleotide of before having reserved.

77. the method for claim 76 comprises in addition:

(c) the described polynucleotide that are recovered to are divided into a plurality of inferior ponds, these inferior ponds are imported the host cell group that can express described immunoglobulin molecules;

(d) allow described host cell expression immunoglobulin molecules, or its antigen-specific fragment;

(e) the expressed antigen specific immune globulin molecule of described host cell can with described antigen bonded condition under, described pond is contacted with antigen; And

(f) duplicate the polynucleotide that reclaim the second polynucleotide library the pond from those expression and the host cell pond of described antigen generation bonded immunoglobulin molecules or the polynucleotide of before having reserved.

78. the method for claim 77, comprise in addition step (c)-(f) is repeated one or repeatedly, thereby the polynucleotide of the coding first immunoglobulin (Ig) subunit polypeptide in the described first polynucleotide library of enrichment, wherein this first immunoglobulin (Ig) subunit polypeptide can be specifically in conjunction with described antigen as an immunoglobulin molecules or the segmental part of its antigen-specific.

79. the method for claim 75, wherein said antigen are attached on the matrix, this matrix is selected from synthetic particle, polymkeric substance, the tissue culturing plate of magnetic bead and protein bag quilt.

80. the method for claim 75, wherein said antigen presentation are on the surface of the presenting cell of antigen expressed, the presenting cell of this antigen expressed does not make up by having antigenic presenting cell with the described antigenic polynucleotide transfection of operably encoding.

81. the method for claim 80, the presenting cell of wherein said antigen expressed are structured in the no antigenic presenting cell that is selected from down group: L cell, Cos7 cell, 293 cells, HeLa cell and NIH3T3 cell.

82. the method for claim 76, wherein said antigen has been puted together fluorescence labels, by fluorescence-activated cell sorting identify expression can with the host cell pond of antigen bonded immunoglobulin molecules.

83. the method in preparation coding immunoglobulin (Ig) subunit polypeptide group's polynucleotide library in the eucaryon virus vector, this method comprises:

(a) the linear DNA viral genome of cutting and separating, thus first viral fragment and second viral fragment produced, and wherein said first fragment and second fragment do not have homology;

(b) provide the transferring plasmid group, these plasmids comprise the immunoglobulin (Ig) subunit polypeptide group's that operably links together, encodes with transcription regulatory region polynucleotide group, side joint has 5 ' flanking region and 3 ' flanking region, wherein said 5 ' flanking region and the described first viral fragment homology, the 3 ' flanking region and the second viral fragment homology; And wherein said transferring plasmid can with the described first and second viral fragment homologous recombination, thereby the viral genome of form living;

(c) with the described transferring plasmid and first and second viral fragments, under this transferring plasmid and viral fragment can carry out the condition of homologous recombination in the body, import host cell, thereby produce the adorned live virus gene group that respectively contains Nucleotide more than the coding immunoglobulin (Ig) subunit polypeptide; And

(d) reclaim described adorned virogene cohort.

84. the method for claim 83, wherein each immunoglobulin (Ig) subunit polypeptide comprises:

(a) be selected from first constant region for immunoglobulin of the group of forming by CH and constant region of light chain;

(b) corresponding to the immune globulin variable region of described first constant region; With

(c) can instruct the cell surface expression or the excretory signal peptide of the described first immunoglobulin (Ig) subunit polypeptide.

85. a test kit that is used to be chosen in the antigen-specific recombination immunoglobulin of expressing in the eukaryotic host cell wherein comprises:

(a) operably connect transcription regulatory region, the coding the first immunoglobulin (Ig) subunit polypeptide group the first polynucleotide library, wherein each first immunoglobulin (Ig) subunit polypeptide comprises:

(i) be selected from first constant region for immunoglobulin of the group of forming by CH and constant region of light chain,

(ii) with the corresponding immune globulin variable region of described first constant region, and

(iii) can instruct the cell surface expression or the excretory signal peptide of the described first immunoglobulin (Ig) subunit polypeptide,

The wherein said first polynucleotide library construction is in the eucaryon virus vector;

(b) operably connect transcription regulatory region, the coding the second immunoglobulin (Ig) subunit polypeptide group the second polynucleotide library, wherein each second immunoglobulin (Ig) subunit polypeptide comprises:

(i) be selected from second constant region for immunoglobulin of the group of being made up of CH and constant region of light chain, wherein this second constant region for immunoglobulin is different with first constant region for immunoglobulin,

(ii) with the corresponding immune globulin variable region of described second constant region, and

(iii) can instruct the cell surface expression or the excretory signal peptide of the described second immunoglobulin (Ig) subunit polypeptide,

The wherein said second immunoglobulin (Ig) subunit polypeptide can make up with the first immunoglobulin (Ig) subunit polypeptide, thereby forms immunoglobulin molecules, or its antigen-specific fragment, and this second polynucleotide library construction is in the eucaryon virus vector; With

(c) can express the host cell group of described immunoglobulin molecules;

The wherein said first and second polynucleotide libraries all provide with two kinds of forms of virion of infectious viral particle and deactivation, and the virion of described deactivation energy host cells infected, make it express the first and second immunoglobulin (Ig) subunit polypeptides, but do not carry out virus replication; And

The antigen specific immune globulin molecule of described host cell expression is by selecteed with antigenic interaction.

86. coded antibody or its antigen-specific fragment of polynucleotide that makes by method according to claim 1.

87. composition that comprises described antibody of claim 86 and pharmaceutical acceptable carrier.

88. the method for the antigen specific immune globulin molecule or the segmental polynucleotide of its antigen-specific in the single structure territory of selecting to encode comprises:

(a) the polynucleotide library that will operably connect transcription regulatory region, coding single structure territory immunoglobulin polypeptides group imports in the eukaryotic host cell group that can express described immunoglobulin molecules; Wherein each immunoglobulin polypeptides comprises:

(i) immunoglobulin heavy chain constant region,

The (ii) immunoglobulin heavy chain variable region of camel sourceization, and

(iii) can instruct the cell surface expression or the excretory signal peptide of described immunoglobulin (Ig) subunit polypeptide;

(b) allow described host cell expression immunoglobulin molecules or its antigen-specific fragment;

(c) described immunoglobulin molecules is contacted with antigen; And

(d) from express can with the host cell of described antigen bonded immunoglobulin molecules in reclaim the library polynucleotide.

Images