CA2953216A1 - Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications - Google Patents

Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications Download PDF

Info

Publication number
CA2953216A1
CA2953216A1 CA2953216A CA2953216A CA2953216A1 CA 2953216 A1 CA2953216 A1 CA 2953216A1 CA 2953216 A CA2953216 A CA 2953216A CA 2953216 A CA2953216 A CA 2953216A CA 2953216 A1 CA2953216 A1 CA 2953216A1
Authority
CA
Canada
Prior art keywords
nanostructure
oligonucleotides
antigen
oligonucleotide
lipids
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CA2953216A
Other languages
French (fr)
Other versions
CA2953216C (en
Inventor
Aleksandar Filip Radovic-Moreno
Richard Kang
Subbarao NALLAGATLA
Christopher C. Mader
Sergei Gryaznov
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Exicure Operating Co
Original Assignee
Exicure Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Exicure Inc filed Critical Exicure Inc
Publication of CA2953216A1 publication Critical patent/CA2953216A1/en
Application granted granted Critical
Publication of CA2953216C publication Critical patent/CA2953216C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/10Dispersions; Emulsions
    • A61K9/127Liposomes
    • A61K9/1271Non-conventional liposomes, e.g. PEGylated liposomes, liposomes coated with polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/0005Vertebrate antigens
    • A61K39/0011Cancer antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/02Bacterial antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/35Allergens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/385Haptens or antigens, bound to carriers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/39Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6905Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion
    • A61K47/6911Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a colloid or an emulsion the form being a liposome
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/04Immunostimulants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55555Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/555Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511Organic adjuvants
    • A61K2039/55561CpG containing adjuvants; Oligonucleotide containing adjuvants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2121/00Preparations for use in therapy

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Dispersion Chemistry (AREA)
  • Oncology (AREA)
  • Pulmonology (AREA)
  • Communicable Diseases (AREA)
  • Nanotechnology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Medical Informatics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Transplantation (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicinal Preparation (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Liposomal spherical nucleic acids that function as multivalent immune modulators are provided according to the invention. The liposomal spherical nucleic acids of the invention are useful prophylactic and therapeutic applications as well as research and diagnostic indications.

Description

MULTIVALENT DELIVERY OF IMMUNE MODULATORS BY LIPOSOMAL
SPHERICAL NUCLEIC ACIDS FOR PROPHYLACTIC OR THERAPEUTIC
APPLICATIONS
Related Application This application claims priority under 35 U.S.C. 119(e) to U.S. Provisional Application Serial No. 62/007,528, entitled " MULTIVALENT DELIVERY OF IMMUNE
MODULATORS BY LIPOSOMAL SPHERICAL NUCLEIC ACIDS FOR
PROPHYLACTIC OR THERAPEUTIC APPLICATIONS" filed on June 4, 2014, which is herein incorporated by reference in its entirety.
Background of the Invention The immune system is a complex network of cellular and humoral components that act in concert to recognize foreign and potentially dangerous substances in the body and eliminate them in a highly targeted and controlled fashion. It can generally be divided into the innate and adaptive immune systems. The innate immune system is germline encoded and is designed to respond to conserved motifs present on pathogens. The adaptive immune system develops its antigen specificity repertoire through controlled somatic recombination processes and can respond with exquisite specificity to a wide variety of antigen types.
Stimulating innate and adaptive immune responses have been shown to be an effective strategy to treat or prevent a wide variety of diseases in animals, animal disease models, and humans.
The success of immunomodulatory approaches in treating or preventing a variety of infectious diseases has been extraordinary. Despite this, there are potentially many more diseases that could be addressed using an immunotherapy approach. Two critical limitations remain: (1) properly priming innate immune cells with the right signals delivered at the optimal time and in optimal ratios to safely boost their function while also providing a suitable environment for inducing an adaptive immune response, and (2) identifying the right antigen or combination of antigens that should be targeted by the adaptive response.

Current approaches for stimulating an immune response largely depend on mixtures of compounds that are known to be immunomodulatory in isolation. At present, compounds that are used in the clinic are bulk mixtures of immune stimulants, optionally combined with antigens, which have been empirically determined to induce innate and adaptive immune responses, respectively. Despite almost a century of development, conventional approaches have yielded only two FDA approved immune stimulants: (1) alum, which is a combination of aluminum salts, and (2) monophosphoryl lipid A. While alum in particular has an impressive track record of safety and efficacy in infectious diseases, it is becoming increasingly clear that these agents do not appear sufficient to induce effective immune responses to combat more complex diseases, such as intracellular pathogens, cancer, allergies, and allergic diseases, among others. Efforts to develop new immunostimulants have largely been unsuccessful, primarily due to lack of efficacy or due to safety concerns.
The immune system evolved over millennia to respond to pathogens such as bacteria, viruses, fungi, and helminths. Consequently, most immune cells are optimized to recognize, phagocytose, process, and then respond to motifs present on microorganisms and have receptors that are "tuned" to the ratios typically present on these organisms.
Summary of the Invention Liposomal spherical nucleic acids that function as multivalent immune modulators are provided according to aspects of the invention. The invention is based, in some aspects, on a nanostructure, comprising a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell.
In other embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the
2 oligonucleotides form an oligonucleotide shell, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide, wherein the pattern recognition receptor modulating oligonucleotide is a TLR agonist.
In other embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide, wherein the pattern recognition receptor modulating oligonucleotide is a TLR
antagonist.
In other embodiments the TLR is selected from the group consisting of TLR3, TLR
7, TLR8, TLR9, and TLR13.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide, wherein the pattern recognition receptor modulating oligonucleotide is a RIG-I
agonist.
In other embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide, wherein the pattern recognition receptor modulating oligonucleotide is a RIG-I
antagonist.
In some embodiments the oligonucleotide shell is comprised of oligonucleotides and a carrier molecule.
3 In other embodiments wherein the oligonucleotide shell is comprised entirely of oligonucleotides.
In some embodiments the oligonucleotides are comprised of single-stranded or double-stranded DNA oligonucleotides.
In other embodiments the oligonucleotides are comprised of single-stranded or double-stranded RNA oligonucleotides.
In other embodiments the oligonucleotides are comprised of chimeric RNA-DNA
oligonucleotides.
In another embodiment the oligonucleotides are comprised of combinations of single-stranded or double-stranded DNA, RNA, or chimeric RNA-DNA
oligonucleotides.
In another embodiment the oligonucleotides of the oligonucleotide shell have structurally identical oligonucleotides.
In some embodiments the oligonucleotides of the oligonucleotide shell have at least two structurally different oligonucleotides.
In other embodiments the oligonucleotides of the oligonucleotide shell have 2-different nucleotide sequences.
In some embodiments the oligonucleotides have at least one phosphorothioate linkage.
In other embodiments the oligonucleotides do not have a phosphorothioate linkage.
In another embodiment the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides comprise CpG-motif containing oligonucleotides.
In some embodiments the CpG oligonucleotides are selected from the group consisting of A-class, B-class and C-class CpG oligonucleotides.
In another embodiment the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides comprise immunostimulatory single-stranded or double-stranded RNA.
4 In some embodiments at least one oligonucleotide has its 5'- terminus exposed to the outside surface of the nano structure.
In other embodiments all of the oligonucleotides have their 5'- terminus exposed to the outside surface of the nano structure.
In another embodiment the oligonucleotides are directly linked to the liposomal core.
In some embodiments the oligonucleotides are indirectly linked to the liposomal core through a linker.
In other embodiments the oligonucleotides are indirectly linked to the liposomal core through more than one linker.
In another embodiment the linker is one or more of the following linkers:
tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of
5
6 PCT/US2015/034226 glycerol, saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols and derivatives thereof.
In another embodiment the oligonucleotides comprise 2-1,000 oligonucleotides.
In some embodiments the liposomal core is comprised of one or more lipids selected from: sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymo sterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of glycerol, and saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols and derivatives thereof.
In another embodiment the liposomal core is comprised of one type of lipid.
In some embodiments the liposomal core is comprised of 2-10 different lipids.
In other embodiments wherein the immune stimulant is selected from the group consisting of monophosphoryl lipid A, lipid A from bacterial origin, 22:0 trehalose, dimethyldioctadecyl-ammonium, Kdo2 lipid A, inositol phosphates including IP3(1,3,4), IP3(1,3,5), IP3(1,4,5), IPR(1,3,4,5), LPA/S1P receptor selective agonists, PAF
and PAF
analogs, liponucleotides, cyclic LPA, bioactive ceramides, endocannabinoids, anandamides, lipid oxidation products, diacylglycerol phosphate, bacterial membrane lipids, N-acylglycine lipids, acyl carnitine lipids, mycolic acids, plant lipid extracts, FSL-1, PAM3CSK4, HKLM, LPS, FLA-ST, imiquimod, resiquimod, C12-IE-DAP, L18-MDP toll like receptor agonists, NOD receptor agonists, and pro-inflammatory immune receptor agonists.
In another embodiment the nanostructure further comprises an antigen.
In some embodiments the antigen is mixed together with the nanostructure.
In other embodiments the antigen is linked directly to the oligonucleotide shell.
In some embodiments the antigen is linked indirectly to the oligonucleotide shell through a linker.
In other embodiments the antigen is linked directly to the liposomal core.
In yet another embodiment the antigen is linked indirectly to the liposomal core through a linker.
In another embodiment wherein an antigen-oligonucleotide conjugate is linked to the liposomal core through oligonucleotide hybridization.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the immune stimulant is associated with the liposomal core by being embedded within the liposomal core.
In other embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the immune stimulant is associated with the liposomal core by being linked indirectly to the liposomal core.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the
7 immune stimulant is associated with the liposomal core by being linked directly to the liposomal core.
In some embodiments the nanostructure comprises a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core, wherein the oligonucleotides form an oligonucleotide shell, wherein the oligonucleotides of the oligonucleotide shell are oriented radially outwards.
In other embodiments the linker is selected from the group consisting of tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymo sterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of glycerol, saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols, and derivatives thereof.
8 In some embodiments the antigen is encapsulated within the liposomal core in an inner aqueous layer.
In other embodiments the antigen is attached non-covalently to the oligonucleotide of the oligonucleotide shell.
In other embodiments the antigen is selected from the group consisting of a cancer antigen, a bacterial antigen, a viral antigen, a parasitic antigen, a hapten, and an allergen.
In some embodiments the nanostructure is a self-assembling nanostructure.
Another aspect of the invention comprises a method for treating a subject, comprising administering to a subject a nucleic acid nanostructure in an effective amount to promote an immune response.
In one embodiment the subject has a disorder and wherein the method is a method for treating the disorder.
In another embodiment the disorder is cancer.
In some embodiments the disorder is infectious disease.
In other embodiments the infectious disease is a viral infection.
In some embodiments the infectious disease is a bacterial infection.
In another embodiment the disorder is allergy.
In some embodiments the disorder is asthma.
In another embodiment the disorder is autoimmune disease.
In some embodiments further comprising administering a therapeutic protocol to the subject.
In another embodiment the therapeutic protocol is surgery.
In some embodiments the therapeutic protocol is radiation.
In other embodiments the therapeutic protocol is a medicament.
In one embodiment the method further comprises administering an adjuvant.
In one embodiment the subject has a disorder and wherein the method is a method for treating the disorder, wherein the nanostructure is associated with a targeting molecule.
In one embodiment the subject has a disorder and wherein the method is a method for treating the disorder, wherein the nanostructure is delivered by a route selected from the
9 group consisting of oral, nasal, sublingual, intravenous, subcutaneous, mucosal, respiratory, direct injection, enema, and dermally.
In another aspect the composition for use in the treatment of disease comprises the nucleic acid nanostructure and embodiments thereof.
Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention. This invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the drawings. The invention is capable of other embodiments and of being practiced or of being carried out in various ways. The details of one or more embodiments of the invention are set forth in the accompanying Detailed Description, Examples, Claims, and Figures.
Other features, objects, and advantages of the invention will be apparent from the description and from the claims.
Brief Description of the Drawings The accompanying drawings are not intended to be drawn to scale. In the drawings, each identical or nearly identical component that is illustrated in various figures is represented by a like numeral. For purposes of clarity, not every component may be labeled in every drawing. In the drawings:
Figure 1 shows a general structure of an exemplary liposomal nanostructure of the invention for co-delivery of oligonucleotide and lipophilic immune stimulants.
The nanostructure includes: (1) a liposomal core, which contains lipophilic immune stimulants (TLR1, TLR2, TLR4, TLR5, TLR6, among others) attached to and possibly embedded in the lipid bilayer, and (2) an oligonucleotide shell, which has dual function in that it helps to target the entire construct to immune cells and also acts to stimulate immune receptors that can recognize nucleic acids (TLR3, TLR7, TLR8, TLR9, TLR13, RIG-I, among others).
Figure 2 shows a general structure of another exemplary antigen-conjugated liposomal nanostructure for co-delivery of oligonucleotide and lipophilic immune stimulants and antigen. The construct is similar to that shown in Figure 1 but includes an additional modification whereby an antigen-conjugated oligonucleotide is attached non-covalently to the parent structure. The antigen is conjugated to the liposomal SNA via interactions with the oligonucleotide shell.
Figure 3 shows another general structure of antigen-conjugated liposomal nanostructure for co-delivery of oligonucleotide and lipophilic immune stimulants and antigen. The antigen may also be encapsulated in the liposomal core.
Figure 4 is a graph showing that stimulating both TLR4 and TLR9 via liposomal nanostructures induce greater activation than either in isolation. Liposomal nanostructures which carry agonists of both TLR4 and TLR9 induce greater activation of the RAW Blue cells than either alone in isolation.
Figures 5A-5B are a set of bar graphs showing that activation of NF-kB by MPLA
is dependent on functional TLR4. Activation of NF-kB by liposomal SNAs containing MPLA
depended on functional TLR4, as the RAW Blue cell line (Figure 5A) but not the Ramos Blue cell line (Figure 5B) demonstrated NF-kB activation in response to stimulation. One-way ANOVA ****p<0.0001, ***p<0.001, **p<0.01.
Figures 6A-6B are a set of bar graphs showing that nanostructure co-delivery of CpG
and MPLA optimally activates both MyD88-dependent and ¨independent pathways.
Liposomal nanostructures that deliver both CpG 1826 and MPLA in a single construct demonstrate elevated TNF (Figure 6A) and IFN-alpha (Figure 6B) levels that cannot be replicated either by delivering each in isolation, or by delivering both components in the same well but not on the same construct. ANOVA, **p <0.01, ****p<0.0001.
Figures 7A-7B are a set of bar graphs showing liposomal nanostructure delivery of MPLA improves activation of NF-kB even without CpG motif. Figure 7A shows NF-kB
activation and Figure 7B shows TNF (OD). One-way ANOVA ****p<0.0001.
Figure 8 is a graph showing that increasing MPLA feed into nanostructures formulation above 3.8% but not beyond 7.7% improves activity. In the RAW Blue cell line, it was observed that increasing the MPLA feed up to 7.7% MPLA but not up to 11.5%
increased the potency of activation of the liposomal SNA.
Figure 9 is a set of graphs showing that phosphorothioate (PS) linkages increase potency but not maximal stimulation in murine immune cells at 11.5% MPLA (top panel) or 7.7% MPLA (bottom panel). In the RAW Blue cells, a shift was observed in the potency of the liposomal nanostructures but not in the maximal stimulation, though this is anticipated to be species dependent.
Figure 10 is a graph showing antigen-conjugated liposomal nanostructures demonstrates activation of immune cells.
Figure 11 is a graph showing that nanostructures induce cellular responses more effectively than free PS oligo and alum. C57BL/6 mice (N=4/group) were immunized with the indicated formulations on day 0 and 21 using ovalbumin as the model antigen. On day 28, splenocytes were collected and incubated overnight on IFN-y ELISPOT plates with 1 uM OVA(257-264). The number of IFN- y spots was quantified using an automated ELISPOT counter. *p<0.05, NS=non-significant Figure 12 is a graph showing that hollow nanostructures with antigen reduce tumor growth rates. C57BL/6 mice (N=10/group) were inoculated with 1x106 E.G7-OVA
cells on day 0 then treated with the indicated compounds on days 3, 7, 10.
Detailed Description of Certain Embodiments of the Invention Toll-like receptors (TLRs) are a family of pattern recognition receptors (PRRs) that trigger activation of innate immune cells, promoting their effector functions and bridging innate and adaptive immunity. Agents that stimulate TLRs are being investigated extensively as potential therapeutic and prophylactic compounds due to the central role these receptors play in coordinating immune responses. Similar to the way that multiple TLRs and immune receptors are stimulated when an immune cell processes a pathogen, it has been shown that stimulation of multiple TLRs with multiple compounds can yield greater efficacy. However, effectively delivering multiple TLR agonists in combination can be quite difficult for a number of reasons: (1) synergy is often observed only in a narrow window of fixed concentration ratios between the two compounds, due to their typically different IC50 or EC50 values, (2) different physicochemical properties such as different size, charge, and hydrophobicity can make attaching them to each other difficult or make them have drastically different PK/PD/ADME properties, (3) the toxic levels of the compounds tend to be different, and (4) the target receptors of one or more of the different compounds may be inaccessible, such as the cytosol, or located in a degradative compartment, such as endosomes or lysosomes.
A novel class of nanostructures having unexpectedly high immune modulating activity have been developed according to the invention. These nanostructures are supra-molecular assemblies, which are immune-modulating liposomal spherical nucleic acids (sometimes referred to as SNAs). These nanostructures can deliver combinations of immune modulating materials in a highly spatiotemporally controlled manner to cells (Examples are shown in Figures 1-3). A distinctive feature of these nanostructures is the incorporation of immune modulating materials both within the external shell as well as within the core, which work in concert to achieve unexpected immune modulating effects in terms of the magnitude and quality of the immune response. These immunomodulating effects cannot be achieved by delivering the materials individually or in combination but not physically associated together in the same construct. It has been demonstrated according to the invention that the assembly of all components into a single structure is vital to achieving optimal effects (Data is shown in Figures 6-7).
In addition to the above, a method for achieving co-delivery of antigen with the multivalent immune-modulating structures was also developed (Examples are depicted in Figures 2-3). This enables these constructs to deliver both antigenic and co-stimulatory signals to bridge innate and adaptive immunity to induce robust immune responses against a variety of diseases (stimulatory application) or to elicit antigen-specific tolerance by delivering antigen in the absence of co-stimulation, achieved by lack of a stimulatory signal or by blocking immune signaling with antagonist molecules, leading to effector cell anergy or induction of regulatory T cells (regulatory application).
Currently, methods used in the clinic to induce immunologic effects generally fall into two categories: 1) compounds that activate or potentiate immune responses, such as vaccines and adjuvants, small molecule agonists of toll-like receptors such as imiquimod and resiquimod, or oligonucleotides such as ISS 1018 (Dynavax Technologies Corporation), among several others, and 2) compounds that act to reduce unwanted immune responses, such as corticosteroids, cyclosporine, and tacrolimus. These compounds have significant limitations known to those in the art.

In general, immune stimulation attempts in the prior art have been limited by a lack of ability to activate robust cellular immune responses to target antigen, leading to failures to develop efficacious and cost-effective vaccines for various infectious diseases, such as HIV, tuberculosis, malaria, dengue, chlamydia, and others. Similarly, various experimental vaccine compounds for cancer have failed to reach their primary end point in late stage clinical trials. A key challenge that does not yet appear to be satisfactorily met is a formulation of antigen and immune stimulant that can achieve superior results.
The nanostructure of the invention achieved these goals, producing activation of strong cellular responses to antigen in vivo with evidence of significant (95%) reduction of tumor burden (Figure 12).
The nanostructure of the invention include: (1) a liposomal core having a lipid bilayer, which contains an immune stimulant embedded in or attached to the lipid bilayer, and (2) a layer of oligonucleotides, which may be an oligonucleotide shell, and which have dual function in that they help to target the nanostructure to immune cells and also act to stimulate immune receptors that can recognize nucleic acids (Figure 1).
Antigen may also be coupled to this construct, such that it will be delivered together with the co-stimulatory signals (Figure 2). A similar construct to that shown in Figure 1 undergoes an additional modification whereby an antigen-conjugated oligonucleotide is attached to the nanostructure. Alternatively or additionally a water-soluble immune stimulant or antigen can be encapsulated in the core.
The nanostructure of the invention includes a liposomal core. A liposomal core as used herein refers to a centrally located core compartment formed by a component of the lipids or phospholipids that form a lipid bilayer. "Liposomes" are artificial, self closed vesicular structure of various sizes and structures, where one or several membranes encapsulate an aqueous core. Most typically liposome membranes are formed from lipid bilayers membranes, where the hydrophilic head groups are oriented towards the aqueous environment and the lipid chains are embedded in the lipophilic core.
Liposomes can be formed as well from other amphiphilic monomeric and polymeric molecules, such as polymers, like block copolymers, or polypeptides. Unilamellar vesicles are liposomes defined by a single membrane enclosing an aqueous space. In contrast, oligo-or multilamellar vesicles are built up of several membranes. Typically, the membranes are roughly 4 nm thick and are composed of amphiphilic lipids, such as phospholipids, of natural or synthetic origin. Optionally, the membrane properties can be modified by the incorporation of other lipids such as sterols or cholic acid derivatives.
The lipid bilayer is composed of two layers of lipid molecules. Each lipid molecule in a layer is oriented substantially parallel to adjacent lipid bilayers, and two layers that form a bilayer have the polar ends of their molecules exposed to the aqueous phase and the non-polar ends adjacent to each other, as shown in the diagrams of Figures 1-3.
The central aqueous region of the liposomal core may be empty or filled fully or partially with water, an aqueous emulsion, antigen, immune stimulant, immune suppressor or other therapeutic or diagnostic agent.
"Lipid" refers to its conventional sense as a generic term encompassing fats, lipids, alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. Lipids usually consist of a hydrophilic and a hydrophobic moiety. In water lipids can self organize to form bilayers membranes, where the hydrophilic moieties (head groups) are oriented towards the aqueous phase, and the lipophilic moieties (acyl chains) are embedded in the bilayers core. Lipids can comprise as well two hydrophilic moieties (bola amphiphiles). In that case, membranes may be formed from a single lipid layer, and not a bilayer. Typical examples for lipids in the current context are fats, fatty oils, essential oils, waxes, steroid, sterols, phospholipids, glycolipids, sulpholipids, aminolipids, chromolipids, and fatty acids.
The term encompasses both naturally occurring and synthetic lipids. Preferred lipids in connection with the present invention are: steroids and sterol, particularly cholesterol, phospholipids, including phosphatidyl, phosphatidylcholines and phosphatidylethanolamines and sphingomyelins. Where there are fatty acids, they could be about 12-24 carbon chains in length, containing up to 6 double bonds. The fatty acids are linked to the backbone, which may be derived from glycerol. The fatty acids within one lipid can be different (asymmetric), or there may be only 1 fatty acid chain present, e.g.
lysolecithins. Mixed formulations are also possible, particularly when the non-cationic lipids are derived from natural sources, such as lecithins (phosphatidylcholines) purified from egg yolk, bovine heart, brain, liver or soybean.

The liposomal core can be constructed from one or more lipids known to those in the art including but not limited to: sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, and their derivatives.
An immune stimulant is associated with the lipid bilayer of the liposomal core. An immune stimulant, as used herein, is a substance that causes stimulation of the immune system such that one or more immune factors, i.e., cytokines, immune cells, antibodies, chemokines are induced or activated. The immune response may comprise a cellular and/or a humoral response. The immune stimulant can be, for example, a small molecule, a nucleic acid, a protein, or a combination thereof. The immune stimulant may also be capable of activating expression of immune stimulatory molecules on cells of a localized microenvironment.
The immune stimulant incorporated into the bilayer can be a wide variety of molecules including but not limited to: monophosphoryl lipid A, lipid A from bacterial origin, 22:0 trehalose, dimethyldioctadecyl-ammonium, Kdo2 lipid A, inositol phosphates including 13(1,3,4), 13(1,3,5), IP3(1,4,5), IPR(1,3,4,5), LPA/S1P receptor selective agonists, PAF and PAF analogs, liponucleotides, cyclic LPA, bioactive ceramides, endocannabinoids, anandamides, lipid oxidation products, diacylglycerol phosphate, bacterial membrane lipids, N-acylglycine lipids, acyl carnitine lipids, mycolic acids, plant lipid extracts, FSL-1, PAM3CSK4, HKLM, LPS, FLA-ST, imiquimod, resiquimod, C12-IE-DAP, L18-MDP and other compounds known to those in the art that can stimulate toll like receptors, NOD receptors, and other pro-inflammatory immune receptors that would be productive towards inducing an immune response.
The immune stimulant is associated with the liposomal core. It may be associated with by being embedded within the core or it may be attached or linked, either indirectly (i.e. non-covalently or covalently through other molecules such a linkers) or directly (i.e.
covalently).
The nanostructure of the invention also includes an oligonucleotide which is preferably a therapeutic oligonucleotide. An oligonucleotide, as used herein, refers to any nucleic acid containing molecule. The nucleic acid may be DNA, RNA, PNA, LNA, ENA or combinations or modifications thereof. It may also be single, double or triple stranded. A
therapeutic oligonucleotide is an oligonucleotide that can function as a therapeutic and or diagnostic agent.
The oligonucleotides are positioned on the exterior of the liposomal core. At least one oligonucleotide is on the exterior. In some embodiments at least 25, 50, 75, 100, 200, 300, 400, 500, 600, 700, 800, 900 or 1,000 oligonucleotides or any range combination thereof are on the exterior of the liposomal core. In some embodiments, 1-1000, 10-500, 50-250, or 50-300 oligonucleotides are present on the surface. In some instance the oligonucleotides form an oligonucleotide shell. An oligonucleotide shell is formed when at least 50% of the available surface area of the exterior surface of the liposomal includes an oligonucleotide. In some embodiments at least 60%, 70%, 80%, 90%, 95%, 96%, 97% 98%
or 99% of the available surface area of the exterior surface of the liposomal includes an oligonucleotide. The oligonucleotides of the oligonucleotide shell may be oriented in a variety of directions. In some embodiments the oligonucleotides are oriented radially outwards.
The oligonucleotides may be linked to the core or to one another and/or to other molecules such an antigens either directly or indirectly through a linker. The oligonucleotides may be conjugated to a linker via the 5' end or the 3' end.
E.g. [Sequence, 5'-3']-Linker or Linker-[Sequence, 5'-3']. Some or all of the oligonucleotides of the nanostructure may be linked to one another either directly or indirectly through a covalent or non-covalent linkage. The linkage of one oligonucleotide to another oligonucleotide may be in addition to or alternatively to the linkage of that oligonucleotide to liposomal core. One or more of the oligonucleotides may also be linked to other molecules such as an antigen.
The oligonucleotides may be linked to the antigen of the core either directly or indirectly through a covalent or non-covalent linkage.
The oligonucleotide shell can be a wide variety of molecules including but not limited to: single-stranded deoxyribonucleotides, ribonucleotides, and other single-stranded oligonucleotides incorporating one or a multiplicity of modifications known to those in the art, double-stranded deoxyribonucleotides, ribonucleotides, and other double-stranded oligonucleotides incorporating one or a multiplicity of modifications known to those in the art, oligonucleotide triplexes incorporating deoxyribonucleotides, ribonucleotides, or oligonucleotides that incorporate one or a multiplicity of modifications known to those in the art. In another embodiment one or a multiplicity of different oligonucleotides are present on the same surface of a single liposomal nanostructure.
The oligonucleotide shell may be anchored to the surface of the liposomal core through conjugation to one or a multiplicity of linker molecules including but not limited to:
tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, and their derivatives.The oligonucleotide may be a nucleic acid that interacts with a molecule or complex of molecules that when stimulated produce an immune response in response to that interaction. The molecule or complex of molecules may be a receptor. In some embodiments the oligonucleotide may be a pattern recognition receptor (PRR) modulating oligonucleotide. PRRs are a primitive part of the immune system composed of proteins expressed by cells of the innate immune system to identify pathogen-associated molecular patterns (PAMPs), which are associated with microbial pathogens or cellular stress, as well as damage-associated molecular patterns (DAMPs), which are associated with cell components released during cell damage. PRRs include but are not limited to membrane-bound PRRs, such as receptor kinases, toll-like receptors (TLR), and C-type lectin Receptors (CLR) (mannose receptors and asialoglycoprotein receptors);
Cytoplasmic PRRs such as RIG-I-like receptors (RLR), RNA Helicases, Plant PRRs, and NonRD kinases; and secreted PRRs. PRR modulating oligonucleotides include but are not limited to TLR agonists, agonists or antagonists of RIG-I, transcription factors, cellular translation machinery, cellular transcription machinery, nucleic-acid acting enzymes, and nucleic acid associating autoantigens. One example of this embodiment is the use of unmethylated 5' -cytosine-phosphate-guanosine-3' (CpG) motifs. Another is the use of 5'-UUG-3' or 5'-UUA-3' motifs. Still another is the use of long double stranded RNA.

A TLR agonist, as used herein is a nucleic acid molecule that interacts with and stimulates the activity of a TLR. Toll-like receptors (TLRs) are a family of highly conserved polypeptides that play a critical role in innate immunity in mammals. At least ten family members, designated TLR1 - TLR10, have been identified. The cytoplasmic domains of the various TLRs are characterized by a Toll-interleukin 1 (IL-1) receptor (TIR) domain.
Medzhitov R et al. (1998) Mol Cell 2:253-8. Recognition of microbial invasion by TLRs triggers activation of a signaling cascade that is evolutionarily conserved in Drosophila and mammals. The TIR domain-containing adaptor protein MyD88 has been reported to associate with TLRs and to recruit IL-1 receptor-associated kinase (IRAK) and tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) to the TLRs. The MyD88-dependent signaling pathway is believed to lead to activation of NF-KB
transcription factors and c-Jun NH2 terminal kinase (Jnk) mitogen-activated protein kinases (MAPKs), critical steps in immune activation and production of inflammatory cytokines. For a review, see Aderem A et al. (2000) Nature 406:782-87.
TLRs are believed to be differentially expressed in various tissues and on various types of immune cells. For example, human TLR7 has been reported to be expressed in placenta, lung, spleen, lymph nodes, tonsil and on plasmacytoid precursor dendritic cells (pDCs). Chuang T-H et al. (2000) Eur Cytokine Netw 11:372-8); Kadowaki Net al.
(2001) J Exp Med 194:863-9. Human TLR8 has been reported to be expressed in lung, peripheral blood leukocytes (PBL), placenta, spleen, lymph nodes, and on monocytes.
Kadowaki N et al. (2001) J Exp Med 194:863-9; Chuang T-H et al. (2000) Eur Cytokine Netw 11:372-8.
Human TLR9 is reportedly expressed in spleen, lymph nodes, bone marrow, PBL, and on pDCs, and B cells. Kadowaki N et al. (2001) J Exp Med 194:863-9; Bauer S et al. (2001) Proc Natl Acad Sci USA 98:9237-42; Chuang T-H et al. (2000) Eur Cytokine Netw 11:372-8.
Nucleotide and amino acid sequences of human and murine TLR7 are known. See, for example, GenBank Accession Nos. AF240467, AF245702, NM_016562, AF334942, NM_133211; and AAF60188, AAF78035, NP_057646, AAL73191, and AAL73192, the contents of all of which are incorporated herein by reference. Human TLR7 is reported to be 1049 amino acids long. Murine TLR7 is reported to be 1050 amino acids long.

polypeptides include an extracellular domain having a leucine-rich repeat region, a transmembrane domain, and an intracellular domain that includes a TIR domain.
Nucleotide and amino acid sequences of human and murine TLR8 are known. See, for example, GenBank Accession Nos. AF246971, AF245703, NM_016610, XM_045706, AY035890, NM_133212; and AAF64061, AAF78036, NP_057694, XP_045706, AAK62677, and NP_573475, the contents of all of which is incorporated herein by reference. Human TLR8 is reported to exist in at least two isoforms, one 1041 amino acids long and the other 1059 amino acids long. Murine TLR8 is 1032 amino acids long. TLR8 polypeptides include an extracellular domain having a leucine-rich repeat region, a transmembrane domain, and an intracellular domain that includes a TIR domain.
Nucleotide and amino acid sequences of human and murine TLR9 are known. See, for example, GenBank Accession Nos. NM_017442, AF259262, AB045180, AF245704, AB045181, AF348140, AF314224, NM_031178; and NP_059138, AAF72189, BAB19259, AAF78037, BAB19260, AAK29625, AAK28488, and NP_112455, the contents of all of which are incorporated herein by reference. Human TLR9 is reported to exist in at least two isoforms, one 1032 amino acids long and the other 1055 amino acids. Murine TLR9 is 1032 amino acids long. TLR9 polypeptides include an extracellular domain having a leucine-rich repeat region, a transmembrane domain, and an intracellular domain that includes a TIR
domain.
As used herein, the term "TLR signaling" refers to any aspect of intracellular signaling associated with signaling through a TLR. As used herein, the term "TLR-mediated immune response" refers to the immune response that is associated with TLR
signaling. The level of TLR signaling may be enhanced over a pre-existing level of signaling or it may be induced over a background level of signaling.
A TLR3-mediated immune response is a response associated with TLR3 signaling.
TLR3 agonists include but are not limited to dsRNA such as dsRNA having multiple AU
motifs.
A TLR7-mediated immune response is a response associated with TLR7 signaling.
TLR7-mediated immune response is generally characterized by the induction of IFN-a and IFN-inducible cytokines such as IP-10 and I-TAC. The levels of cytokines IL-1 a/13, IL-6, IL-8, MIP-la/13 and MIP-3a/I3 induced in a TLR7-mediated immune response are less than those induced in a TLR8-mediated immune response. TLR7 ligands include, without limitation, guanosine analogues such as C8-substituted guanosines, mixtures of ribonucleosides consisting essentially of G and U, guanosine ribonucleotides and RNA or RNA-like molecules (PCT/US03/10406), and adenosine-based compounds (e.g., 6-amino-9-benzy1-2-(3-hydroxy-propoxy)-9H-purin-8-ol, and similar compounds made by Sumitomo (e.g., CL-029)).
As used herein, the term "guanosine analogues" refers to a guanosine-like nucleotide (excluding guanosine) having a chemical modification involving the guanine base, guanosine nucleoside sugar, or both the guanine base and the guanosine nucleoside sugar.
Guanosine analogues specifically include, without limitation, 7-deaza-guanosine.
Guanosine analogues further include C8-substituted guanosines such as 7-thia-8-oxoguanosine (immunosine), 8-mercaptoguanosine, 8-bromoguanosine, 8-methylguanosine, 8-oxo-7,8-dihydroguanosine, C8-arylamino-2'-deoxyguanosine, C8-propynyl-guanosine, C8- and N7- substituted guanine ribonucleosides such as 7-ally1-8-oxoguanosine (loxoribine) and 7-methyl-8-oxoguanosine, 8-aminoguanosine, 8-hydroxy-2'-deoxyguanosine, 8-hydroxyguanosine, and 7-deaza 8-substituted guanosine.
A TLR8-mediated immune response is a response associated with TLR8 signaling.
This response is further characterized by the induction of pro-inflammatory cytokines such as IFN-y, IL-12p40/70, TNF-a, IL-la/13, IL-6, IL-8, MIP-1 a/I3 and MIP-3 a/13.

ligands include mixtures of ribonucleosides consisting essentially of G and U, guanosine ribonucleotides and RNA or RNA-like molecules (PCT/U503/10406). Additional ligands are also disclosed in Gorden et al. J. Immunol. 2005, 174:1259-1268).
As used herein, a "TLR7/8 agonist" collectively refers to any nucleic acid that is capable of increasing TLR7 and/or TLR8 signaling (i.e., an agonist of TLR7 and/or TLR8).
Some TLR7/8 ligands induce TLR7 signaling alone (e.g., TLR7 specific agonists), some induce TLR8 signaling alone (e.g., TLR8 specific agonists), and others induce both TLR7 and TLR8 signaling.
A TLR9-mediated immune response is a response associated with TLR9 signaling.
This response is further characterized at least by the production/secretion of IFN-y and IL-12, albeit at levels lower than are achieved via a TLR8-mediated immune response. As used herein, the term "TLR9 agonist" refers to any agent that is capable of increasing TLR9 signaling (i.e., an agonist of TLR9). TLR9 agonists specifically include, without limitation, immunostimulatory nucleic acids, and in particular CpG immunostimulatory nucleic acids.
"Immunostimulatory CpG nucleic acids" or "immunostimulatory CpG
oligonucleotides" refers to any CpG-containing nucleic acid that is capable of activating an immune cell. At least the C of the CpG dinucleotide is typically, but not necessarily, unmethylated. Immunostimulatory CpG nucleic acids are described in a number of issued patents and published patent applications, including U.S. Pat. Nos. 6,194,388;
6,207,646;
6,218,371; 6,239,116; 6,339,068; 6,406,705; and 6,429,199.
A TLR13-mediated immune response is a response associated with TLR13 signaling.
A TLR13 agonist is bacterial 23S rRNA.
The oligonucleotides may also be retinoic acid inducible gene-I (RIG-I) agonists or antagonists. RIG-I corresponds to GenBank Accession No. AF038963. RIG-I
agonists include but are not limited to dsRNA such as Poly(I:C). RIG-I antagonists include short 5'triphosphate DNA or RNA.
An "immunostimulatory oligonucleotide" is any nucleic acid (DNA or RNA) containing an immunostimulatory motif or backbone that is capable of inducing an immune response. An induction of an immune response refers to any increase in number or activity of an immune cell, or an increase in expression or absolute levels of an immune factor, such as a cytokine. Immune cells include, but are not limited to, NK cells, CD4+ T
lymphocytes, CD8+ T lymphocytes, B cells, dendritic cells, macrophage and other antigen-presenting cells. Cytokines include, but are not limited to, interleukins, TNF-a, IFN-a,13 and y, Flt-ligand, and co-stimulatory molecules. Immunostimulatory motifs include, but are not limited to CpG motifs and T-rich motifs.
A non-limiting set of immunostimulatory oligonucleotides includes:
dsRNA:
poly(A:C) and poly(I:C) ssRNA:
CCGUCUGUUGUGUGACUC (SEQ ID NO:4) GCCACCGAGCCGAAGGCACC (SEQ ID NO:6) UAUAUAUAUAUAUAUAUAUA (SEQ ID NO:7) UUAUUAUUAUUAUUAUUAUU (SEQ ID NO:8) UUUUAUUUUAUUUUAUUUUA (SEQ ID NO:9) UGUGUGUGUGUGUGUGUGUG(SEQ ID NO:10) UUGUUGUUGUUGUUGUUGUU (SEQ ID NO:11) UUUGUUUGUUUGUUUGUUUG (SEQ ID NO:12) UUAUUUAUUUAUUUAUUUAUUUAU (SEQ ID NO:13) UUGUUUGUUUGUUUGUUUGUUUGU (SEQ ID NO:14) GCCCGUCUGUUGUGUGACUC (SEQ ID NO:15) GUCCUUCAAGUCCUUCAA (SEQ ID NO:16) DNA:
GGTGCATCGATGCAGGGGGG (SEQ ID NO:5) TCCATGGACGTTCCTGAGCGTT (SEQ ID NO:17) TCGTCGTTCGAACGACGTTGAT (SEQ ID NO:18) TCGTCGACGATCCGCGCGCGCG (SEQ ID NO:19) GGGGTCAACGTTGAGGGGGG (SEQ ID NO:20) TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:21) TCGTCGTTGTCGTTTTGTCGTT (SEQ ID NO:22) GGGGGACGATCGTCGGGGGG (SEQ ID NO:23) GGGGACGACGTCGTGGGGGGG (SEQ ID NO:24) TCGTCGTTTTCGGCGCGCGCCG (SEQ ID NO:25) TCGTCGTCGTTCGAACGACGTTGAT (SEQ ID NO:26) The terms "oligonucleotide" and "nucleic acid" are used interchangeably to mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). Thus, the term embraces both DNA and RNA
oligonucleotides. The terms shall also include oligonucleosides (i.e., a oligonucleotide minus the phosphate) and any other organic base containing polymer.
Oligonucleotides can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by nucleic acid synthesis).
The oligonucleotides may be single stranded or double stranded. A double stranded oligonucleotide is also referred to herein as a duplex. Double-stranded oligonucleotides of the invention can comprise two separate complementary nucleic acid strands.
As used herein, "duplex" includes a double-stranded nucleic acid molecule(s) in which complementary sequences or partially complementary sequences are hydrogen bonded to each other. The complementary sequences can include a sense strand and an antisense strand. The antisense nucleotide sequence can be identical or sufficiently identical to the target gene to mediate effective target gene inhibition (e.g., at least about 98%
identical, 96% identical, 94%, 90% identical, 85% identical, or 80% identical) to the target gene sequence.
A double-stranded oligonucleotide can be double-stranded over its entire length, meaning it has no overhanging single-stranded sequences and is thus blunt-ended. In other embodiments, the two strands of the double-stranded oligonucleotide can have different lengths producing one or more single-stranded overhangs. A double-stranded oligonucleotide of the invention can contain mismatches and/or loops or bulges. In some embodiments, it is double-stranded over at least about 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% of the length of the oligonucleotide. In some embodiments, the double-stranded oligonucleotide of the invention contains at least or up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mismatches.
Oligonucleotides associated with the invention can be modified such as at the sugar moiety, the phosphodiester linkage, and/or the base. As used herein, "sugar moieties"
includes natural, unmodified sugars, including pentose, ribose and deoxyribose, modified sugars and sugar analogs. Modifications of sugar moieties can include replacement of a hydroxyl group with a halogen, a heteroatom, or an aliphatic group, and can include functionalization of the hydroxyl group as, for example, an ether, amine or thiol.
Modification of sugar moieties can include 2'-0-methyl nucleotides, which are referred to as "methylated." In some instances, oligonucleotides associated with the invention may only contain modified or unmodified sugar moieties, while in other instances, oligonucleotides contain some sugar moieties that are modified and some that are not.
In some instances, modified nucleomonomers include sugar- or backbone-modified ribonucleotides. Modified ribonucleotides can contain a non-naturally occurring base such as uridines or cytidines modified at the 5'-position, e.g., 5'-(2-amino)propyl uridine and 5'-bromo uridine; adenosines and guanosines modified at the 8-position, e.g., 8-bromo guanosine; deaza nucleotides, e.g., 7-deaza-adenosine; and N-alkylated nucleotides, e.g., N6-methyl adenosine. Also, sugar-modified ribonucleotides can have the 2'-OH
group replaced by an H, alkoxy (or OR), R or alkyl, halogen, SH, SR, amino (such as NH2, NHR, NR2,), or CN group, wherein R is lower alkyl, alkenyl, or alkynyl. In some embodiments, modified ribonucleotides can have the phosphodiester group connecting to adjacent ribonucleotides replaced by a modified group, such as a phosphorothioate group.
In some aspects, 2'-0-methyl modifications can be beneficial for reducing undesirable cellular stress responses, such as the interferon response to double-stranded nucleic acids. Modified sugars can include D-ribose, 2'-0-alkyl (including 2'-0-methyl and 2'-0-ethyl), i.e., 2'-alkoxy, 2'-amino, 2'-S-alkyl, 2'-halo (including 2'-fluoro), 2'-methoxyethoxy, 2'-allyloxy (-0CH2CH=CH2), 2'-propargyl, 2'-propyl, ethynyl, ethenyl, propenyl, and cyano and the like. The sugar moiety can also be a hexose.
The term "alkyl" includes saturated aliphatic groups, including straight-chain alkyl groups (e.g., methyl, ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, etc.), branched-chain alkyl groups (isopropyl, tert-butyl, isobutyl, etc.), cycloalkyl (alicyclic) groups (cyclopropyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl), alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, a straight chain or branched chain alkyl has 6 or fewer carbon atoms in its backbone (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and more preferably 4 or fewer.
Likewise, preferred cycloalkyls have from 3-8 carbon atoms in their ring structure, and more preferably have 5 or 6 carbons in the ring structure. The term C1-C6 includes alkyl groups containing 1 to 6 carbon atoms.
Unless otherwise specified, the term alkyl includes both "unsubstituted alkyls" and "substituted alkyls," the latter of which refers to alkyl moieties having independently selected substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone. The term "alkenyl" includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double bond.
Unless otherwise specified, the term alkenyl includes both "unsubstituted alkenyls" and "substituted alkenyls," the latter of which refers to alkenyl moieties having independently selected substituents replacing a hydrogen on one or more carbons of the hydrocarbon backbone.
The term "base" includes the known purine and pyrimidine heterocyclic bases, deazapurines, and analogs (including heterocyclic substituted analogs, e.g., aminoethyoxy phenoxazine), derivatives (e.g., 1-alkyl-, 1-alkenyl-, heteroaromatic- and 1-alkynyl derivatives) and tautomers thereof. Examples of purines include adenine, guanine, inosine, diaminopurine, and xanthine and analogs (e.g., 8-oxo-N6-methyladenine or 7-diazaxanthine) and derivatives thereof. Pyrimidines include, for example, thymine, uracil, and cytosine, and their analogs (e.g., 5-methylcytosine, 5-methyluracil, 5-(1-propynyl)uracil, 5-(1-propynyl)cytosine and 4,4-ethanocytosine). Other examples of suitable bases include non-purinyl and non-pyrimidinyl bases such as 2-aminopyridine and triazines.
In some aspects, the nucleomonomers of a oligonucleotide of the invention are RNA
nucleotides, including modified RNA nucleotides.
The term "nucleoside" includes bases which are covalently attached to a sugar moiety, preferably ribose or deoxyribose. Examples of preferred nucleosides include ribonucleosides and deoxyribonucleosides. Nucleosides also include bases linked to amino acids or amino acid analogs which may comprise free carboxyl groups, free amino groups, or protecting groups. Suitable protecting groups are well known in the art (see P. G. M.
Wuts and T. W. Greene, "Protective Groups in Organic Synthesis", 2nd Ed., Wiley-Interscience, New York, 1999).
As used herein, the term "linkage" used in the context of an internucleotide linkage includes a naturally occurring, unmodified phosphodiester moiety (-0-(P02-)-0-) that covalently couples adjacent nucleomonomers. As used herein, the term "substitute linkage"
or "modified linkage" or modified internucleotide linkage" includes any analog or derivative of the native phosphodiester group that covalently couples adjacent nucleomonomers.

Substitute linkages include phosphodiester analogs, e.g., phosphorothioate, phosphorodithioate, and P-ethyoxyphosphodiester, P-ethoxyphosphodiester, P-alkyloxyphosphotriester, methylphosphonate, and nonphosphorus containing linkages, e.g., acetals and amides. Such substitute linkages are known in the art (e.g., Bjergarde et al.
1991. Nucleic Acids Res. 19:5843; Caruthers et al. 1991. Nucleosides Nucleotides. 10:47).
In certain embodiments, non-hydrolizable linkages are preferred, such as phosphorothioate linkages.
In some aspects, oligonucleotides of the invention comprise 3' and 5' termini (except for circular oligonucleotides). The 3' and 5' termini of a oligonucleotide can be substantially protected from nucleases, for example, by modifying the 3' or 5' linkages (e.g., U.S. Pat. No.
5,849,902 and WO 98/13526). Oligonucleotides can be made resistant by the inclusion of a "blocking group." The term "blocking group" as used herein refers to substituents (e.g., other than OH groups) that can be attached to oligonucleotides or nucleomonomers, either as protecting groups or coupling groups for synthesis (e.g., FITC, propyl (CH2-CH2-CH3), glycol (-0-CH2-CH2-0-) phosphate (P032-), hydrogen phosphonate, or phosphoramidite).
"Blocking groups" also include "end blocking groups" or "exonuclease blocking groups"
which protect the 5' and 3' termini of the oligonucleotide, including modified nucleotides and non-nucleotide exonuclease resistant structures.
Exemplary end-blocking groups include cap structures (e.g., a 7-methylguanosine cap), inverted nucleomonomers, e.g., with 3'-3' or 5'-5' end inversions (see, e.g., Ortiagao et al. 1992. Antisense Res. Dev. 2:129), methylphosphonate, phosphoramidite, non-nucleotide groups (e.g., non-nucleotide linkers, amino linkers, conjugates) and the like.
The 3' terminal nucleomonomer can comprise a modified sugar moiety. The 3' terminal nucleomonomer comprises a 3'-0 that can optionally be substituted by a blocking group that prevents 3'-exonuclease degradation of the oligonucleotide. For example, the 3'-hydroxyl can be esterified to a nucleotide through a 3'¨>3' internucleotide linkage. For example, the alkyloxy radical can be methoxy, ethoxy, or isopropoxy, and preferably, ethoxy. Optionally, the 3'¨>3'linked nucleotide at the 3' terminus can be linked by a substitute linkage. To reduce nuclease degradation, the 5' most 3'¨>5' linkage can be a modified linkage, e.g., a phosphorothioate or a P-alkyloxyphosphotriester linkage. Preferably, the two 5' most 3'¨>5' linkages are modified linkages. Optionally, the 5' terminal hydroxy moiety can be esterified with a phosphorus containing moiety, e.g., phosphate, phosphorothioate, or P-ethoxyphosphate.
In some aspects, oligonucleotides can be chimeric RNA-DNA oligonucleotides which include both DNA and RNA.
The oligonucleotides are preferably in the range of 6 to 100 bases in length.
However, nucleic acids of any size greater than 4 nucleotides (even many kb long) are capable of inducing a biological response according to the invention if sufficient stimulatory motifs are present. Preferably the nucleic acid is in the range of between 8 and 100 and in some embodiments between 8 and 50 or 8 and 30 nucleotides in size.
In some embodiments the oligonucleotides have a modified backbone such as a phosphorothioate (PS) backbone. In other embodiments the oligonucleotides have a phosphodiester (PO) backbone. In yet other embodiments oligonucleotides have a mixed or chimeric PO and PS backbone.
The nanostructure may also include an antigen. An antigen as used herein is a molecule capable of provoking an immune response in the body, especially the production of antibodies. Antigens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts and muticellular organisms such as parasites and allergens. The term antigen broadly includes any type of molecule which is recognized by a host immune system as being foreign. Antigens include but are not limited to cancer antigens, microbial antigens, and allergens.
Antigen can be attached to the structures by the externally-facing oligonucleotide through covalent or non-covalent, e.g. Watson/Crick hybridization.
Alternatively or additionally the antigen may be incorporated into the liposomal bilayer via conjugation to a hydrophobic moiety (Figures 2-3). The data presented herein demonstrates that this form of antigen delivery provokes unexpectedly more potent induction of immune stimulatory effects in vitro (Figure 10) and induces effective antigen processing and presentation, leading to effective induction of an anti-tumor immune response in vivo at highly unexpected levels (Figure 11-12). In yet another embodiment, antigen may be incorporated inside the inner aqueous layer of the liposome (Figure 3).
In one embodiment, antigen is conjugated to the liposomal nanostructure via interactions with the oligonucleotide shell (Figure 2). In some instances the antigen ¨oligonucleotide conjugate is linked to the liposomal core through oligonucleotide hybridization. In other words the oligonucleotide is hybridized to a complementary or partially complementary oligonucleotide to form a duplex or partial duplex. One or both of the oligonucleotides of the duplex is linked directly to the liposomal core and the antigen which is external facing (on the outside of the lipid bilayer) or which is internal (in the inner aqueous layer) and not directly linked to the liposomal core is linked to one or both of the oligonucleotides in the duplex. In another embodiment, antigen is conjugated to the liposomal nanostructure via direct interactions with the liposomal core (Figure 3). The antigen can be anchored to the surface of the liposomal core through conjugation to one or a multiplicity of linker molecules including but not limited to: tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymo sterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethy1-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, and their derivatives.
A cancer antigen as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al., 1994, Cancer Research, 54:1055, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens. Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion of, or a whole tumor or cancer.
Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
A microbial antigen as used herein is an antigen of a microorganism and includes but is not limited to virus, bacteria, parasites, and fungi. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to those of ordinary skill in the art.
Examples of viruses that have been found in humans include but are not limited to:
Retroviridae (e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HDTV-III, LAVE or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP;
Picornaviridae (e.g. polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis);
Togaviridae (e.g. equine encephalitis viruses, rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis viruses, yellow fever viruses); Coronoviridae (e.g.
coronaviruses);
Rhabdoviradae (e.g. vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza viruses);
Bungaviridae (e.g.
Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. reoviruses, orbiviurses and rotaviruses);
Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses);
Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses);
Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus; Poxviridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and other viruses (e.g. the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), Hepatitis C; Norwalk and related viruses, and astroviruses).
Both gram negative and gram positive bacteria serve as antigens in vertebrate animals. Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species.
Specific examples of infectious bacteria include but are not limited to, Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M.
intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocyto genes, Streptococcus pyo genes (Group A
Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aero genes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia, and Actinomyces israelli.
Examples of fungi include Cryptococcus neofonnans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albi cans.
Other infectious organisms (i.e., protists) include Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii. Blood-borne and/or tissues parasites include Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
Other medically relevant microorganisms have been described extensively in the literature, e.g., see C.G.A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incorporated by reference.
As used herein, the terms "cancer antigen" and "tumor antigen" are used interchangeably to refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells. Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells.
These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those carried on RNA and DNA tumor viruses.
The nanostructures of the invention may be delivered to a subject in vivo or ex vivo for therapeutic and/or diagnostic use or may be used in vitro, ex vivo or in vivo for research purposes. Alternatively the nanostructures may be used for the purpose of provoking an immune response for generating reagents such as antibodies or cytokines which can be harvested.
The nanostructures may be administered alone or in any appropriate pharmaceutical carrier, such as a liquid, for example saline, or a powder, for administration in vivo. They can also be co-delivered with larger carrier particles or within administration devices. The nanostructures may be formulated or unformulated. The formulations of the invention can be administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
In some embodiments, nanostructures are mixed with a substance such as a lotion (for example, aquaphor) and are administered to the skin of a subject, whereby the nanostructures are delivered through the skin of the subject. It should be appreciated that any method of delivery of nanoparticles known in the art may be compatible with aspects of the invention.
The nanostructures may also be sterile.
For use in therapy, an effective amount of the nanostructures can be administered to a subject by any mode that delivers the nanostructures to the desired cell.
Administering pharmaceutical compositions may be accomplished by any means known to the skilled artisan. Routes of administration include but are not limited to oral, parenteral, intramuscular, intravenous, subcutaneous, mucosal, intranasal, sublingual, intratracheal, inhalation, ocular, vaginal, dermal, rectal, and by direct injection.
Thus, the invention in one aspect involves the finding that the nanostructures of the invention are highly effective in mediating immune stimulatory effects. These nanostructures (stimulatory and regulatory) are useful therapeutically and prophylactically for modulating the immune system to treat cancer, infectious diseases, allergy, asthma, autoimmune disease, and other disorders and to help protect against opportunistic infections following cancer chemotherapy.
Thus the nanostructures of the invention are useful as a vaccine for the treatment of a subject at risk of developing or a subject having allergy or asthma, an infection with an infectious organism or a cancer in which a specific cancer antigen has been identified. The nanostructures can also be formulated without an antigen or allergen for protection against infection, allergy or cancer, and in this case repeated doses may allow longer term protection. A subject at risk as used herein is a subject who has any risk of exposure to an infection causing pathogen or a cancer or an allergen or a risk of developing cancer. For instance, a subject at risk may be a subject who is planning to travel to an area where a particular type of infectious agent is found or it may be a subject who through lifestyle or medical procedures is exposed to bodily fluids which may contain infectious organisms or directly to the organism or even any subject living in an area where an infectious organism or an allergen has been identified. Subjects at risk of developing infection also include general populations to which a medical agency recommends vaccination with a particular infectious organism antigen. If the antigen is an allergen and the subject develops allergic responses to that particular antigen and the subject may be exposed to the antigen, i.e., during pollen season, then that subject is at risk of exposure to the antigen.
A subject having an infection is a subject that has been exposed to an infectious pathogen and has acute or chronic detectable levels of the pathogen in the body. The nanostructures can be used with or without an antigen to mount an antigen specific systemic or mucosal immune response that is capable of reducing the level of or eradicating the infectious pathogen. An infectious disease, as used herein, is a disease arising from the presence of a foreign microorganism in the body. It is particularly important to develop effective vaccine strategies and treatments to protect the body's mucosal surfaces, which are the primary site of pathogenic entry.
A subject having a cancer is a subject that has detectable cancerous cells.
The cancer may be a malignant or non-malignant cancer. Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer;
choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms;
lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell);
melanoma;
neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer;
rectal cancer;
sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas. In one embodiment the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma.
A subject shall mean a human or vertebrate animal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, turkey, chicken, primate, e.g., monkey, and fish (aquaculture species), e.g. salmon. Thus, the invention can also be used to treat cancer and tumors, infections, autoimmune disease and allergy/asthma in non-human subjects.
As used herein, the term treat, treated, or treating when used with respect to an disorder such as an infectious disease, autoimmune disease, cancer, allergy, or asthma refers to a prophylactic treatment which increases the resistance of a subject to development of the disease (e.g., to infection with a pathogen) or, in other words, decreases the likelihood that the subject will develop the disease (e.g., become infected with the pathogen) as well as a treatment after the subject has developed the disease in order to fight the disease (e.g., reduce or eliminate the infection) or prevent the disease from becoming worse.
The nanostructures of the invention may also be coated with or administered in conjunction with an anti-microbial agent. An anti-microbial agent, as used herein, refers to a naturally-occurring or synthetic compound which is capable of killing or inhibiting infectious microorganisms. The type of anti-microbial agent useful according to the invention will depend upon the type of microorganism with which the subject is infected or at risk of becoming infected. Anti-microbial agents include but are not limited to anti-bacterial agents, anti-viral agents, anti-fungal agents and anti-parasitic agents. Phrases such as "anti-infective agent", "anti-bacterial agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic agent" and "parasiticide" have well-established meanings to those of ordinary skill in the art and are defined in standard medical texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and include antibiotics as well as other synthetic or natural compounds having similar functions. Antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more bacterial functions or structures which are specific for the microorganism and which are not present in host cells. Anti-viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting viruses. Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections. Anti-parasite agents kill or inhibit parasites.
The nanostructures of the invention may also be used for regulating the immune response such that the level of some immune factors are decreased. Achieving specific immune downregulation or "tolerance" is a significant challenge, as the prior art, in general, acts by broadly downregulating immune responses. This non-specific approach can lead to a high incidence of side effects, toxicity, and an increased risk of acquiring infectious diseases, among others. No commercially available compounds or structures have demonstrated the ability to induce potent and specific anti-inflammatory effects in the clinic.

A challenge is delivery of the appropriate signals to immune cells, such as antigen, in the absence of additional co-stimulatory signals.
The nanostructures of the invention solve some of these problems encountered by the prior art. In some embodiments an antigen can be delivered intracellularly efficiently via conjugation to a nanostructure of the invention in a manner that achieves or promotes tolerance. The methods may involve antagonizing toll-like receptors during the antigen delivery process in order to enhance the ability to induce antigen-specific tolerance. The nanostructures used for these embodiments of the invention include a liposomal core which is attached to an immune suppressor, such as a TLR 4 immune suppressor and oligonucleotides positioned on the exterior of the core.
These regulatory nanostructures are useful for downregulating an immune response or anytime it is desirable to induce tolerance. For instance, they are useful for treating and preventing autoimmune disease, allergy, asthma, or other conditions where a component of the pathology involves an overactive immune response, such as liver fibrosis or idiopathic pulmonary fibrosis.
A subject having an allergy is a subject that has or is at risk of developing an allergic reaction in response to an allergen. An allergy refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, conjunctivitis, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
An allergen refers to a substance (antigen) that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander dust, fungal spores and drugs (e.g. penicillin).
Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g.
Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g.
Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella gennanica); Apis (e.g. Apis multiflorum); Cupressus (e.g.
Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g.
Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei);
Thuya (e.g.
Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g.
Periplaneta americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale);
Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis glomerata); Festuca (e.g. Festuca elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g.
Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g.
Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense);
Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum notatum);
Sorghum (e.g.
Sorghum halepensis); and Bromus (e.g. Bromus inermis).
Autoimmune disease is a class of diseases in which an subject's own antibodies react with host tissue or in which immune effector T cells are autoreactive to endogenous self peptides and cause destruction of tissue. Thus an immune response is mounted against a subject's own antigens, referred to as self antigens. Autoimmune diseases include but are not limited to rheumatoid arthritis, Crohn's disease, multiple sclerosis, systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, myasthenia gravis (MG), Hashimoto's thyroiditis, Goodpasture's syndrome, pemphigus (e.g., pemphigus vulgaris), Grave's disease, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma with anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic Addison's disease, autoimmune-associated infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), bullous pemphigoid, Sjogren's syndrome, insulin resistance, and autoimmune diabetes mellitus.
A "self-antigen" as used herein refers to an antigen of a normal host tissue.
Normal host tissue does not include cancer cells. Thus an immune response mounted against a self-antigen, in the context of an autoimmune disease, is an undesirable immune response and contributes to destruction and damage of normal tissue, whereas an immune response mounted against a cancer antigen is a desirable immune response and contributes to the destruction of the tumor or cancer. Thus, in some aspects of the invention aimed at treating autoimmune disorders it is not recommended that the nanostructure be formulated with self antigens, particularly those that are the targets of the autoimmune disorder.
In other instances, the nanostructures may include small amounts of self-antigens. A
number of animal studies have demonstrated that mucosal administration of low doses of antigen can result in a state of immune hyporesponsiveness or "tolerance." The active mechanism appears to be a cytokine-mediated immune deviation away from a Th 1 towards a predominantly Th2 and Th3 (i.e., TGF-I3 dominated) response. The active suppression with low dose antigen delivery can also suppress an unrelated immune response (bystander suppression) which is of considerable interest in the therapy of autoimmune diseases, for example, rheumatoid arthritis and SLE. Bystander suppression involves the secretion of Thl-counter-regulatory, suppressor cytokines in the local environment where proinflammatory and Thl cytokines are released in either an antigen-specific or antigen-nonspecific manner. "Tolerance" as used herein is used to refer to this phenomenon.
Indeed, oral tolerance has been effective in the treatment of a number of autoimmune diseases in animals including: experimental autoimmune encephalomyelitis (EAE), experimental autoimmune myasthenia gravis, collagen-induced arthritis (CIA), and insulin-dependent diabetes mellitus. In these models, the prevention and suppression of autoimmune disease is associated with a shift in antigen-specific humoral and cellular responses from a Th 1 to Th2/Th3 response.
In another aspect, the present invention is directed to a kit including one or more of the compositions previously discussed. A "kit," as used herein, typically defines a package or an assembly including one or more of the compositions of the invention, and/or other compositions associated with the invention, for example, as previously described. Each of the compositions of the kit, if present, may be provided in liquid form (e.g., in solution), or in solid form (e.g., a dried powder). In certain cases, some of the compositions may be constitutable or otherwise processable (e.g., to an active form), for example, by the addition of a suitable solvent or other species, which may or may not be provided with the kit.
Examples of other compositions that may be associated with the invention include, but are not limited to, solvents, surfactants, diluents, salts, buffers, emulsifiers, chelating agents, fillers, antioxidants, binding agents, bulking agents, preservatives, drying agents, antimicrobials, needles, syringes, packaging materials, tubes, bottles, flasks, beakers, dishes, frits, filters, rings, clamps, wraps, patches, containers, tapes, adhesives, and the like, for example, for using, administering, modifying, assembling, storing, packaging, preparing, mixing, diluting, and/or preserving the compositions components for a particular use, for example, to a sample and/or a subject.
In some embodiments, a kit associated with the invention includes one or more components of the nanostructure. For instance the kit may include liposomes for forming a liposome core, an immune stimulant or TLR4 immune suppressor and or oligonucleotides for the exterior of the nanostructure. A kit can also include one or more antigens and or other therapeutic agents.
A kit of the invention may, in some cases, include instructions in any form that are provided in connection with the compositions of the invention in such a manner that one of ordinary skill in the art would recognize that the instructions are to be associated with the compositions of the invention. For instance, the instructions may include instructions for the use, modification, mixing, diluting, preserving, administering, assembly, storage, packaging, and/or preparation of the compositions and/or other compositions associated with the kit. In some cases, the instructions may also include instructions for the use of the compositions, for example, for a particular use, e.g., to a sample. The instructions may be provided in any form recognizable by one of ordinary skill in the art as a suitable vehicle for containing such instructions, for example, written or published, verbal, audible (e.g., telephonic), digital, optical, visual (e.g., videotape, DVD, etc.) or electronic communications (including Internet or web-based communications), provided in any manner.
Examples In order that the invention described herein may be more fully understood, the following examples are set forth. The examples described in this application are offered to illustrate the compounds, pharmaceutical compositions, and methods provided herein and are not to be construed in any way as limiting their scope.
Example 1.

In one embodiment reduced to practice, oligonucleotides of sequence 5'-TCCATGACGTTCCTGACGTT-3' (SEQ ID NO:1; designated as "CpG 1826") were 3'-modified with alpha-tocopherol and incorporated into small unilamellar vesicles composed of (92% w/w) 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) mixed with (8% w/w) monophosphoryl lipid A (Figure 1). In a sub-embodiment, these structures were further conjugated with ovalbumin, a model protein antigen via Watson-Crick type hybridization of an ovalbumin-oligo construct, where the oligo portion was complementary to CpG
1826 (5'-AACGTCAGGAACGTCATGGA-3' SEQ ID NO:2) (Figure 2). The oligonucleotide here was selected on the basis of its ability to stimulate TLR9, whereas MPLA was selected for its ability to stimulate TLR4.
Liposomal SNA (nanostructure) Synthesis 25 mg of 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) dissolved in 4 mL
dichloromethane (DCM) was mixed with 1 mg monophosphoryl lipid A (MPLA) dissolved in 1 mL of chloroform in a glass container. The lipids were then dried onto the walls of the glass container in a thin film by gently drying under argon until all solvent has evaporated.
Any residual solvent was removed by overnight lyophilization. The next day, the lipids were reconstituted in 10 mL of liposome buffer (150 mM NaC1, 20 mM HEPES) by vortex and sonication, then passed through 2-5 freeze thaw cycles prior to serial extrusion through 100 nm, 50 nm, then 30 nm extrusion membranes. Following extrusion, 1 umol of oligonucleotide (5'-TCCATGACGTTCCTGACGTT-3' SEQ ID NO:1) with a 3'-alpha-tocopherol group covalently attached) was mixed with the 26 mg of lipid and incubated overnight at 4C to form the liposomal SNAs. The following day, the liposomal SNAs were purified by tangential flow filtration using a 300 kDa membrane cutoff filter using >5 volume exchanges of lx PBS.
Some liposomal SNAs were additionally modified to contain ovalbumin by conjugating the ovalbumin first to an oligonucleotide complementary to CpG
1826 (5'-AACGTCAGGAACGTCATGGA-3' SEQ ID NO:2). This ovalbumin-oligonucleotide conjugate was then hybridized to the liposomal SNAs by incubating at a 2-fold excess of ovalbumin-oligonucleotide conjugate relative to oligonucleotide on the liposomal SNA for 3 hours at 37C, followed by overnight incubation at 4C. Excess ovalbumin-oligonucleotide conjugate was removed by tangential flow filtration.
In Vitro Testing The compounds were serially diluted 1:4. 20 uL of this mixture was seeded in duplicate in a 96 well plate. RAW Blue cells (InVivoGen), a reporter murine macrophage cell line derived from RAW 264.7 cells containing a NF-kB inducible secreted alkaline phosphatase (SEAP) were seeded at 100k cells/well in 180 uL per well and added to the test compounds on the 96 well plate. Ramos Blue cells (InvivoGen), a reporter human B cell line derived from Ramos cells containing a NF-kB inducible SEAP were seeded at 306k cells/well in 180 uL per well and added to the test compounds on the 96 well plate.
Importantly, Ramos Blue cells do not have functional signaling through TLR4.
The cells were incubated with the test compound overnight at 37C, 5% CO2 in a humidified chamber.
The following day, the supernatants were probed for SEAP activity using the QuantiBlue reagent (InVivoGen) following the manufacturer recommended protocol. The results show that liposomal SNAs which carry agonists of both TLR4 and TLR9 induce greater activation of the RAW Blue cells that either alone in isolation (Figure 4). Importantly, the results show that activation of NF-kB by liposomal SNAs containing MPLA depended on functional TLR4, as the RAW Blue cell line but not the Ramos Blue cell line demonstrated NF-kB
activation in response to stimulation (Figure 5).
To further profile the response triggered by liposomal SNAs containing both and TLR4 agonists, the ability of liposomal SNAs to induce activation of MyD88-dependent and MyD88-independent pathways was tested, as measured by activation levels of TNF and IFN-alpha, respectively. For this, 6 million human peripheral blood mononuclear cells (PBMCs) were resuspended at 1 million/mL in RPMI-1640 supplemented with 10%
FBS
and 1% penicillin/streptomycin and seeded at 180k/well with 20 uL of test compound.
Following overnight incubation, the supernatant was probed for TNF and IFN-alpha levels by ELISA. The results show that liposomal SNAs that deliver both CpG 1826 and MPLA in a single construct demonstrate elevated TNF and IFN-alpha levels that cannot be replicated either by delivering each in isolation, or by delivering both components in the same well but not on the same construct (Figure 6). Even when a sequence that did not activate TLR9 (designated as "CTL-ps": 5'- TCCATGAGCTTCCTGAGCTT-3' SEQ ID N0:3) was used to construct the liposomal SNA, enhanced activity of MPLA was observed (Figure 7), suggesting that the liposomal SNA delivers MPLA more efficiently than a liposomal formulation.
Next, parameters that might modulate the efficacy of the liposomal SNAs were identified. The quantity of MPLA feed into the liposomal formulation step might play a role, as well as the internucleotide linkage chemistry (PO vs PS). Accordingly, liposomal SNAs were developed with increasing MPLA feed from 3.8% (w/w) to 11.5% (w/w) and constructs containing both PO and PS linkages and tested them for activity in RAW Blue cells. In this cell line, it was observed that increasing the MPLA feed up to 7.7% MPLA but not up to 11.5% increased the potency of activation of the liposomal SNA
(Figure 8). In the RAW Blue cells, a shift was observed in the potency of the liposomal SNA but not in the maximal stimulation (Figure 9), though this is anticipated to be species dependent.
Finally, the ability of antigen-conjugated liposomal SNAs to activate immune cells was tested. Ovalbumin loaded liposomal SNAs were incubated as described with RAW Blue cells overnight at the level of SEAP probed by QuantiBlue assay. Conjugation of antigen to the liposomal SNAs appeared to increase their activity (Figure 10). It is possible that this occurs due to the presence of additional CpG motifs introduced by the complementary oligonucleotide that is attached to the ovalbumin, which formed duplexes with CpG 1826.
In Vivo Testing This form of antigen delivery has been shown to induce more potent induction of immune stimulatory effects in vitro (Figure 10) and induce effective antigen processing and presentation, leading to effective induction of an anti-tumor immune response in vivo (Figures 11-12).
C57BL/6 mice (N=4/group) were immunized (200 [t.L s.c., 100 lug ovalbumin equivalent dose) with the indicated formulations on day 0 and 21 using ovalbumin as the model antigen (Figure 11). On day 28, splenocytes were collected and incubated overnight on IFN-y ELISPOT plates with 1 uM OVA(257-264). The number of IFN-y spots was quantified using an automated ELISPOT counter. This study shows that SNAs induce cellular responses more effectively than free PS oligo and alum. *p<0.05, NS=non-significant.
In another experiment, C57BL/6 mice (N=11/group) were inoculated with lx106 E.G7-OVA cells (ATCC #CRL-2113) on day 0 then treated with the indicated compounds on days 3, 7, 10 (200 [t.L s.c., 100 lug ovalbumin equivalent dose). Tumor volume was calculated by measuring the length and width of the subcutaneous tumor and applying the formula tumor volume = (length) x (width) x (width)/2. The results demonstrate activation of strong cellular responses to antigen in vivo with evidence of significant (95%) reduction of tumor burden (Figure 12).
In the claims articles such as "a," "an," and "the" may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one or all of the group members are present in, employed in or otherwise relevant to a given product or process.
Furthermore, the invention encompasses all variations, combinations, and permutations in which one or more limitations, elements, clauses, and descriptive terms from one or more of the listed claims is introduced into another claim. For example, any claim that is dependent on another claim can be modified to include one or more limitations found in any other claim that is dependent on the same base claim. Where elements are presented as lists, e.g., in Markush group format, each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements and/or features, certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements and/or features. For purposes of simplicity, those embodiments have not been specifically set forth in haec verba herein. It is also noted that the terms "comprising" and "containing" are intended to be open and permits the inclusion of additional elements or steps. Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or sub¨range within the stated ranges in different embodiments of the invention, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
This application refers to various issued patents, published patent applications, journal articles, and other publications, all of which are incorporated herein by reference. If there is a conflict between any of the incorporated references and the instant specification, the specification shall control. In addition, any particular embodiment of the present invention that falls within the prior art may be explicitly excluded from any one or more of the claims. Because such embodiments are deemed to be known to one of ordinary skill in the art, they may be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the invention can be excluded from any claim, for any reason, whether or not related to the existence of prior art.
Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments described herein.
The scope of the present embodiments described herein is not intended to be limited to the above Description, but rather is as set forth in the appended claims. Those of ordinary skill in the art will appreciate that various changes and modifications to this description may be made without departing from the spirit or scope of the present invention, as defined in the following claims.

Claims (66)

We claim:
1. A nanostructure, comprising a liposomal core having a lipid bilayer, wherein an immune stimulant or an immune suppressor is associated with the lipid bilayer, and oligonucleotides positioned on the exterior of the liposomal core.
2. The nanostructure of claim 1, wherein the oligonucleotides form an oligonucleotide shell.
3. The nanostructure of claim 2, wherein the oligonucleotide shell is comprised of at least one pattern recognition receptor modulating oligonucleotide.
4. The nanostructure of claim 3, wherein the pattern recognition receptor modulating oligonucleotide is a TLR agonist.
5. The nanostructure of claim 3, wherein the pattern recognition receptor modulating oligonucleotide is a TLR antagonist.
6. The nanostructure of any one of claims 4-5, wherein the TLR is selected from the group consisting of TLR3, TLR 7, TLR8, TLR9, and TLR13.
7. The nanostructure of claim 3, wherein the pattern recognition receptor modulating oligonucleotide is a RIG-I agonist.
8. The nanostructure of claim 3, wherein the pattern recognition receptor modulating oligonucleotide is a RIG-I antagonist.
9. The nanostructure of any one of claims 2-8, wherein the oligonucleotide shell is comprised of oligonucleotides and a carrier molecule.
10. The nanostructure of any one of claims 2-8, wherein the oligonucleotide shell is comprised entirely of oligonucleotides.
11. The nanostructure of any one of claims 1-9, wherein the oligonucleotides are comprised of single-stranded or double-stranded DNA oligonucleotides.
12. The nanostructure of any one of claims 1-9, wherein the oligonucleotides are comprised of single-stranded or double-stranded RNA oligonucleotides.
13. The nanostructure of any one of claims 1-9, wherein the oligonucleotides are comprised of chimeric RNA-DNA oligonucleotides.
14. The nanostructure of any one of claims 1-9, wherein the oligonucleotides are comprised of combinations of single-stranded or double-stranded DNA, RNA, or chimeric RNA-DNA oligonucleotides.
15. The nanostructure of any one of claims 2-14, wherein the oligonucleotides of the oligonucleotide shell have structurally identical oligonucleotides.
16. The nanostructure of any one of claims 2-14, wherein the oligonucleotides of the oligonucleotide shell have at least two structurally different oligonucleotides.
17. The nanostructure of any one of claims 2-14, wherein the oligonucleotides of the oligonucleotide shell have 2-10 different nucleotide sequences.
18. The nanostructure of any one of claims 1-17, wherein the oligonucleotides have at least one phosphorothioate linkage.
19. The nanostructure of any one of claims 1-17, wherein the oligonucleotides do not have a phosphorothioate linkage.
20. The nanostructure of claim 1, wherein the oligonucleotides comprise CpG-motif containing oligonucleotides.
21. The nanostructure of claims 20, wherein the CpG oligonucleotides are selected from the group consisting of A-class, B-class and C-class CpG
oligonucleotides.
22. The nanostructure of claim 1, wherein the oligonucleotides comprise immunostimulatory single-stranded or double-stranded RNA.
23. The nanostructure of any one of claims 1-22, wherein at least one oligonucleotide has its 5'- terminus exposed to the outside surface of the nanostructure.
24. The nanostructure of any one of claims 1-22, wherein all of the oligonucleotides have their 5'- terminus exposed to the outside surface of the nanostructure.
25. The nanostructure of any one of claims 1-24, wherein the oligonucleotides are directly linked to the liposomal core.
26. The nanostructure of any one of claims 1-24, wherein the oligonucleotides are indirectly linked to the liposomal core through a linker.
27. The nanostructure of any one of claims 1-24, wherein the oligonucleotides are indirectly linked to the liposomal core through more than one linker.
28. The nanostructure of any one of claims 26 or 27, wherein the linker is one or more of the following linkers: tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethyl-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of glycerol, saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols and derivatives thereof.
29. The nanostructure of any one of claims 1-28, wherein the oligonucleotides comprise 2-1,000 oligonucleotides.
30. The nanostructure of any one of claims 1-29, wherein the liposomal core is comprised of one or more lipids selected from: sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethyl-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of glycerol, and saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols and derivatives thereof.
31. The nanostructure of any one of claims 1-30, wherein the liposomal core is comprised of one type of lipid.
32. The nanostructure of any one of claims 1-30, wherein the liposomal core is comprised of 2-10 different lipids.
33. The nanostructure of any one of claims 1-32, wherein the immune stimulant is selected from the group consisting of monophosphoryl lipid A, lipid A from bacterial origin, 22:0 trehalose, dimethyldioctadecyl-ammonium, Kdo2 lipid A, inositol phosphates including IP3(1,3,4), IP3(1,3,5), IP3(1,4,5), IPR(1,3,4,5), LPA/S1P receptor selective agonists, PAF
and PAF analogs, liponucleotides, cyclic LPA, bioactive ceramides, endocannabinoids, anandamides, lipid oxidation products, diacylglycerol phosphate, bacterial membrane lipids, N-acylglycine lipids, acyl carnitine lipids, mycolic acids, plant lipid extracts, FSL-1, PAM3CSK4, HKLM, LPS, FLA-ST, imiquimod, resiquimod, C12-IE-DAP, L18-MDP toll like receptor agonists, NOD receptor agonists, and pro-inflammatory immune receptor agonists.
34. The nanostructure of any one of claims 1-33, further comprising an antigen.
35. The nanostructure of claim 34, wherein the antigen is mixed together with the nanostructure.
36. The nanostructure of claim 34, wherein the antigen is linked directly to the oligonucleotide shell.
37. The nanostructure of claim 34, wherein the antigen is linked indirectly to the oligonucleotide shell through a linker.
38. The nanostructure of claim 34, wherein the antigen is linked directly to the liposomal core.
39. The nanostructure of claim 34, wherein the antigen is linked indirectly to the liposomal core through a linker.
40. The nanostructure of claim 34, wherein an antigen-oligonucleotide conjugate is linked to the liposomal core through oligonucleotide hybridization.
41. The nanostructure of claim 1, wherein the immune stimulant is associated with the liposomal core by being embedded within the liposomal core.
42. The nanostructure of claim 1, wherein the immune stimulant is associated with the liposomal core by being linked indirectly to the liposomal core.
43. The nanostructure of claim 1, wherein the immune stimulant is associated with the liposomal core by being linked directly to the liposomal core.
44. The nanostructure of claim 2, wherein the oligonucleotides of the oligonucleotide shell are oriented radially outwards.
45. The nanostructure of claim 37 or 39, wherein the linker is selected from the group consisting of tocopherols, sphingolipids such as sphingosine, sphingosine phosphate, methylated sphingosines and sphinganines, ceramides, ceramide phosphates, 1-0 acyl ceramides, dihydroceramides, 2-hydroxy ceramides, sphingomyelin, glycosylated sphingolipids, sulfatides, gangliosides, phosphosphingolipids, and phytosphingosines of various lengths and saturation states and their derivatives, phospholipids such as phosphatidylcholines, lysophosphatidylcholines, phosphatidic acids, lysophosphatidic acids, cyclic LPA, phosphatidylethanolamines, lysophosphatidylethanolamines, phosphatidylglycerols, lysophosphatidylglycerols, phosphatidylserines, lysophosphatidylserines, phosphatidylinositols, inositol phosphates, LPI, cardiolipins, lysocardiolipins, bis(monoacylglycero) phosphates, (diacylglycero) phosphates, ether lipids, diphytanyl ether lipids, and plasmalogens of various lengths, saturation states, and their derivatives, sterols such as cholesterol, desmosterol, stigmasterol, lanosterol, lathosterol, diosgenin, sitosterol, zymosterol, zymostenol, 14-demethyl-lanosterol, cholesterol sulfate, DHEA, DHEA sulfate, 14-demethyl-14-dehydrlanosterol, sitostanol, campesterol, ether anionic lipids, ether cationic lipids, lanthanide chelating lipids, A-ring substituted oxysterols, B-ring substituted oxysterols, D-ring substituted oxysterols, side-chain substituted oxysterols, double substituted oxysterols, cholestanoic acid derivatives, fluorinated sterols, fluorescent sterols, sulfonated sterols, phosphorylated sterols, and polyunsaturated sterols of different lengths, saturation states, saturated C8-C22 fatty acids, saturated C8-C22 ether derivatives of glycerol, saturated and unsaturated amide derivatives of C8-C22 fatty acids and mono-and 1,2- or 1, 3- di-amino glycerols, and derivatives thereof.
46. The nanostructure of claim 34, wherein the antigen is encapsulated within the liposomal core in an inner aqueous layer.
47. The nanostructure of claim 34, wherein the antigen is attached non-covalently to the oligonucleotide of the oligonucleotide shell.
48. The nanostructure of any one of claims 32-47, wherein the antigen is selected from the group consisting of a cancer antigen, a bacterial antigen, a viral antigen, a parasitic antigen, a hapten, and an allergen.
49. The nanostructure of any one of claims 1-48, wherein the nanostructure is a self-assembling nanostructure.
50. A method for treating a subject, comprising administering to a subject a nucleic acid nanostructure of any one of claims 1-44, in an effective amount to promote an immune response.
51. The method of claim 50, wherein the subject has a disorder and wherein the method is a method for treating the disorder.
52. The method of claim 51, wherein the disorder is cancer.
53. The method of claim 51, wherein the disorder is infectious disease.
54. The method of claim 53, wherein the infectious disease is a viral infection.
55. The method of claim 53, wherein the infectious disease is a bacterial infection.
56. The method of claim 51, wherein the disorder is allergy.
57. The method of claim 51, wherein the disorder is asthma.
58. The method of claim 51, wherein the disorder is autoimmune disease.
59. The method of any one of claims 51-58, further comprising administering a therapeutic protocol to the subject.
60. The method of claim 59, wherein the therapeutic protocol is surgery.
61. The method of claim 59, wherein the therapeutic protocol is radiation.
62. The method of claim 59, wherein the therapeutic protocol is a medicament.
63. The method of claim 51, further comprising administering an adjuvant.
64. The method of claim 51, wherein the nanostructure is associated with a targeting molecule.
65. The method of claim 51, wherein the nanostructure is delivered by a route selected from the group consisting of oral, nasal, sublingual, intravenous, subcutaneous, mucosal, respiratory, direct injection, enema, and dermally.
66. A composition for use in the treatment of disease, comprising the acid nanostructure of any one of claims 1-49.
CA2953216A 2014-06-04 2015-06-04 Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications Active CA2953216C (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201462007528P 2014-06-04 2014-06-04
US62/007,528 2014-06-04
PCT/US2015/034226 WO2015187966A1 (en) 2014-06-04 2015-06-04 Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications

Publications (2)

Publication Number Publication Date
CA2953216A1 true CA2953216A1 (en) 2015-12-10
CA2953216C CA2953216C (en) 2020-12-22

Family

ID=53887176

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2953216A Active CA2953216C (en) 2014-06-04 2015-06-04 Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications

Country Status (11)

Country Link
US (3) US10434064B2 (en)
EP (2) EP3508198A1 (en)
JP (1) JP6581604B2 (en)
KR (1) KR102290205B1 (en)
CN (1) CN106535876B (en)
AU (1) AU2015269412B2 (en)
CA (1) CA2953216C (en)
ES (1) ES2725948T3 (en)
PL (1) PL3164113T3 (en)
TR (1) TR201908550T4 (en)
WO (1) WO2015187966A1 (en)

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100233270A1 (en) 2009-01-08 2010-09-16 Northwestern University Delivery of Oligonucleotide-Functionalized Nanoparticles
US10894963B2 (en) 2013-07-25 2021-01-19 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
US10568898B2 (en) 2013-08-13 2020-02-25 Northwestern University Lipophilic nanoparticles for drug delivery
MX2016007287A (en) 2013-12-03 2017-05-03 Univ Northwestern Liposomal particles, methods of making same and uses thereof.
US10413565B2 (en) 2014-04-30 2019-09-17 Northwestern University Nanostructures for modulating intercellular communication and uses thereof
CN106535876B (en) * 2014-06-04 2020-09-11 埃克西奎雷股份有限公司 Multivalent delivery of immunomodulators through liposomal spherical nucleic acids for prophylactic or therapeutic applications
AU2015328242A1 (en) 2014-10-06 2017-04-27 Exicure, Inc. Anti-TNF compounds
EP3220895B1 (en) 2014-11-21 2022-08-31 Northwestern University The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
WO2016085986A1 (en) 2014-11-24 2016-06-02 Northwestern University High density lipoprptein nanoparticles for inflammation
EP3247796A4 (en) 2015-01-14 2018-07-11 Exicure, Inc. Nucleic acid nanostructures with core motifs
WO2016134104A1 (en) * 2015-02-18 2016-08-25 Exicure, Inc. Immuno-regulatory lipid containing spherical nucleic acids
US10078092B2 (en) 2015-03-18 2018-09-18 Northwestern University Assays for measuring binding kinetics and binding capacity of acceptors for lipophilic or amphiphilic molecules
US20200297867A1 (en) * 2016-02-01 2020-09-24 Exicure, Inc. Surface functionalization of liposomes and liposomal spherical nucleic acids (snas)
EP3452598A4 (en) 2016-05-06 2020-04-29 Exicure, Inc. Liposomal spherical nucleic acid (sna) constructs presenting antisense oligonucleotides (aso) for specific knockdown of interleukin 17 receptor mrna
CA3023445A1 (en) * 2016-05-06 2017-11-09 Exicure, Inc. Spherical nucleic acid tlr9 agonists
EP3452600A4 (en) * 2016-05-06 2020-01-15 Exicure, Inc. Tlr9-targeted spherical nucleic acids having potent antitumor activity
WO2018039629A2 (en) 2016-08-25 2018-03-01 Northwestern University Micellar spherical nucleic acids from thermoresponsive, traceless templates
WO2019184991A1 (en) * 2018-03-29 2019-10-03 中国医学科学院基础医学研究所 Application of compound or traditional chinese medicine extract in preparation of nucleic acid delivery agent, and related products
CA3058231A1 (en) * 2017-03-29 2018-10-04 Chengyu Jiang Application of compound or traditional chinese medicine extract in the prepration of a nucleic acid delivery reagent and related products thereof
US20200248183A1 (en) * 2017-04-03 2020-08-06 Subbarao Nallagatla Tlr9-targeted spherical nucleic acids having potent antitumor activity
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
WO2018209270A1 (en) * 2017-05-11 2018-11-15 Northwestern University Adoptive cell therapy using spherical nucleic acids (snas)
AU2018314159A1 (en) 2017-07-13 2020-01-30 Northwestern University General and direct method for preparing oligonucleotide-functionalized metal-organic framework nanoparticles
EP4123034A1 (en) * 2017-11-02 2023-01-25 Janssen Pharmaceutica NV Oligonucleotide constructs and uses thereof
WO2019118883A1 (en) * 2017-12-15 2019-06-20 Northwestern University Structure-function relationships in the development of immunotherapeutic agents
CA3098623A1 (en) 2018-05-07 2019-11-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery
AU2020223028A1 (en) * 2019-02-12 2021-09-23 Exicure Operating Company Combined spherical nucleic acid and checkpoint inhibitor for antitumor therapy
CN110559263B (en) * 2019-10-10 2021-05-14 中国海洋大学 Delta 5-cholest sulfate compound liposome and preparation method thereof
US20210220454A1 (en) * 2020-01-22 2021-07-22 Northwestern University Design of immunostimulatory protein-core spherical nucleic acids
EP4304640A1 (en) * 2021-03-12 2024-01-17 Northwestern University Antiviral vaccines using spherical nucleic acids

Family Cites Families (486)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4179337A (en) 1973-07-20 1979-12-18 Davis Frank F Non-immunogenic polypeptides
US4489055A (en) 1978-07-19 1984-12-18 N.V. Sopar S.A. Process for preparing biodegradable submicroscopic particles containing a biologically active substance and their use
US4289872A (en) 1979-04-06 1981-09-15 Allied Corporation Macromolecular highly branched homogeneous compound based on lysine units
US4469863A (en) 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US5023243A (en) 1981-10-23 1991-06-11 Molecular Biosystems, Inc. Oligonucleotide therapeutic agent and method of making same
US4476301A (en) 1982-04-29 1984-10-09 Centre National De La Recherche Scientifique Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon
JPS5927900A (en) 1982-08-09 1984-02-14 Wakunaga Seiyaku Kk Oligonucleotide derivative and its preparation
FR2540122B1 (en) 1983-01-27 1985-11-29 Centre Nat Rech Scient NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION
US4605735A (en) 1983-02-14 1986-08-12 Wakunaga Seiyaku Kabushiki Kaisha Oligonucleotide derivatives
US4587044A (en) 1983-09-01 1986-05-06 The Johns Hopkins University Linkage of proteins to nucleic acids
US5008050A (en) 1984-06-20 1991-04-16 The Liposome Company, Inc. Extrusion technique for producing unilamellar vesicles
US5550111A (en) 1984-07-11 1996-08-27 Temple University-Of The Commonwealth System Of Higher Education Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof
FR2567892B1 (en) 1984-07-19 1989-02-17 Centre Nat Rech Scient NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS
US5430136A (en) 1984-10-16 1995-07-04 Chiron Corporation Oligonucleotides having selectably cleavable and/or abasic sites
US5258506A (en) 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US5367066A (en) 1984-10-16 1994-11-22 Chiron Corporation Oligonucleotides with selectably cleavable and/or abasic sites
US4828979A (en) 1984-11-08 1989-05-09 Life Technologies, Inc. Nucleotide analogs for nucleic acid labeling and detection
FR2575751B1 (en) 1985-01-08 1987-04-03 Pasteur Institut NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS
US5235033A (en) 1985-03-15 1993-08-10 Anti-Gene Development Group Alpha-morpholino ribonucleoside derivatives and polymers thereof
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US5317098A (en) 1986-03-17 1994-05-31 Hiroaki Shizuya Non-radioisotope tagging of fragments
JPS638396A (en) 1986-06-30 1988-01-14 Wakunaga Pharmaceut Co Ltd Poly-labeled oligonucleotide derivative
DE3788914T2 (en) 1986-09-08 1994-08-25 Ajinomoto Kk Compounds for cleaving RNA at a specific position, oligomers used in the preparation of these compounds and starting materials for the synthesis of these oligomers.
US5541308A (en) 1986-11-24 1996-07-30 Gen-Probe Incorporated Nucleic acid probes for detection and/or quantitation of non-viral organisms
US5276019A (en) 1987-03-25 1994-01-04 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5264423A (en) 1987-03-25 1993-11-23 The United States Of America As Represented By The Department Of Health And Human Services Inhibitors for replication of retroviruses and for the expression of oncogene products
US5229490A (en) 1987-05-06 1993-07-20 The Rockefeller University Multiple antigen peptide system
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
DE3851889T2 (en) 1987-06-24 1995-04-13 Florey Howard Inst NUCLEOSIDE DERIVATIVES.
JP3012244B2 (en) 1987-09-21 2000-02-21 ジェン―プローブ インコーポレイテッド Non-nucleotide ligation reagent for nucleotide probes
US5188897A (en) 1987-10-22 1993-02-23 Temple University Of The Commonwealth System Of Higher Education Encapsulated 2',5'-phosphorothioate oligoadenylates
US4924624A (en) 1987-10-22 1990-05-15 Temple University-Of The Commonwealth System Of Higher Education 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof
DE3855864T2 (en) 1987-11-30 1997-09-25 Univ Iowa Res Found DNA MOLECULES STABILIZED BY MODIFICATIONS ON THE 3'-TERMINAL PHOSPHODIESTERBINDING, THEIR USE AS NUCLEIC ACID PROBE AND AS A THERAPEUTIC AGENT FOR INHIBITING THE EXPRESSION OF SPECIFIC TARGET GENES
WO1989009221A1 (en) 1988-03-25 1989-10-05 University Of Virginia Alumni Patents Foundation Oligonucleotide n-alkylphosphoramidates
US5278302A (en) 1988-05-26 1994-01-11 University Patents, Inc. Polynucleotide phosphorodithioates
US5216141A (en) 1988-06-06 1993-06-01 Benner Steven A Oligonucleotide analogs containing sulfur linkages
US5262536A (en) 1988-09-15 1993-11-16 E. I. Du Pont De Nemours And Company Reagents for the preparation of 5'-tagged oligonucleotides
US5194599A (en) 1988-09-23 1993-03-16 Gilead Sciences, Inc. Hydrogen phosphonodithioate compositions
US5457183A (en) 1989-03-06 1995-10-10 Board Of Regents, The University Of Texas System Hydroxylated texaphyrins
US5391723A (en) 1989-05-31 1995-02-21 Neorx Corporation Oligonucleotide conjugates
US5256775A (en) 1989-06-05 1993-10-26 Gilead Sciences, Inc. Exonuclease-resistant oligonucleotides
US4958013A (en) 1989-06-06 1990-09-18 Northwestern University Cholesteryl modified oligonucleotides
US5451463A (en) 1989-08-28 1995-09-19 Clontech Laboratories, Inc. Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides
US5134066A (en) 1989-08-29 1992-07-28 Monsanto Company Improved probes using nucleosides containing 3-dezauracil analogs
US5591722A (en) 1989-09-15 1997-01-07 Southern Research Institute 2'-deoxy-4'-thioribonucleosides and their antiviral activity
US5721218A (en) 1989-10-23 1998-02-24 Gilead Sciences, Inc. Oligonucleotides with inverted polarity
US5399676A (en) 1989-10-23 1995-03-21 Gilead Sciences Oligonucleotides with inverted polarity
US5264562A (en) 1989-10-24 1993-11-23 Gilead Sciences, Inc. Oligonucleotide analogs with novel linkages
US5264564A (en) 1989-10-24 1993-11-23 Gilead Sciences Oligonucleotide analogs with novel linkages
EP0497875B1 (en) 1989-10-24 2000-03-22 Isis Pharmaceuticals, Inc. 2' modified oligonucleotides
US5177198A (en) 1989-11-30 1993-01-05 University Of N.C. At Chapel Hill Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates
US5130302A (en) 1989-12-20 1992-07-14 Boron Bilogicals, Inc. Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5486603A (en) 1990-01-08 1996-01-23 Gilead Sciences, Inc. Oligonucleotide having enhanced binding affinity
US5578718A (en) 1990-01-11 1996-11-26 Isis Pharmaceuticals, Inc. Thiol-derivatized nucleosides
US5955589A (en) 1991-12-24 1999-09-21 Isis Pharmaceuticals Inc. Gapped 2' modified oligonucleotides
US5459255A (en) 1990-01-11 1995-10-17 Isis Pharmaceuticals, Inc. N-2 substituted purines
US5681941A (en) 1990-01-11 1997-10-28 Isis Pharmaceuticals, Inc. Substituted purines and oligonucleotide cross-linking
US5587470A (en) 1990-01-11 1996-12-24 Isis Pharmaceuticals, Inc. 3-deazapurines
US5587361A (en) 1991-10-15 1996-12-24 Isis Pharmaceuticals, Inc. Oligonucleotides having phosphorothioate linkages of high chiral purity
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5149797A (en) 1990-02-15 1992-09-22 The Worcester Foundation For Experimental Biology Method of site-specific alteration of rna and production of encoded polypeptides
US5220007A (en) 1990-02-15 1993-06-15 The Worcester Foundation For Experimental Biology Method of site-specific alteration of RNA and production of encoded polypeptides
WO1991013080A1 (en) 1990-02-20 1991-09-05 Gilead Sciences, Inc. Pseudonucleosides and pseudonucleotides and their polymers
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US5321131A (en) 1990-03-08 1994-06-14 Hybridon, Inc. Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling
US5470967A (en) 1990-04-10 1995-11-28 The Dupont Merck Pharmaceutical Company Oligonucleotide analogs with sulfamate linkages
US5264618A (en) 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5677437A (en) 1990-07-27 1997-10-14 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
EP0544824B1 (en) 1990-07-27 1997-06-11 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
US5489677A (en) 1990-07-27 1996-02-06 Isis Pharmaceuticals, Inc. Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms
US5602240A (en) 1990-07-27 1997-02-11 Ciba Geigy Ag. Backbone modified oligonucleotide analogs
US5623070A (en) 1990-07-27 1997-04-22 Isis Pharmaceuticals, Inc. Heteroatomic oligonucleoside linkages
US5618704A (en) 1990-07-27 1997-04-08 Isis Pharmacueticals, Inc. Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling
US5608046A (en) 1990-07-27 1997-03-04 Isis Pharmaceuticals, Inc. Conjugated 4'-desmethyl nucleoside analog compounds
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
US5688941A (en) 1990-07-27 1997-11-18 Isis Pharmaceuticals, Inc. Methods of making conjugated 4' desmethyl nucleoside analog compounds
US5541307A (en) 1990-07-27 1996-07-30 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogs and solid phase synthesis thereof
US5610289A (en) 1990-07-27 1997-03-11 Isis Pharmaceuticals, Inc. Backbone modified oligonucleotide analogues
US5245022A (en) 1990-08-03 1993-09-14 Sterling Drug, Inc. Exonuclease resistant terminally substituted oligonucleotides
DK0541722T3 (en) 1990-08-03 1996-04-22 Sterling Winthrop Inc Compounds and Methods for Inhibiting Gene Expression
US5177196A (en) 1990-08-16 1993-01-05 Microprobe Corporation Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof
US5512667A (en) 1990-08-28 1996-04-30 Reed; Michael W. Trifunctional intermediates for preparing 3'-tailed oligonucleotides
US5214134A (en) 1990-09-12 1993-05-25 Sterling Winthrop Inc. Process of linking nucleosides with a siloxane bridge
US5561225A (en) 1990-09-19 1996-10-01 Southern Research Institute Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages
CA2092002A1 (en) 1990-09-20 1992-03-21 Mark Matteucci Modified internucleoside linkages
US5432272A (en) 1990-10-09 1995-07-11 Benner; Steven A. Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases
US5672697A (en) 1991-02-08 1997-09-30 Gilead Sciences, Inc. Nucleoside 5'-methylene phosphonates
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
FR2677272B1 (en) 1991-06-05 1995-03-03 Biovecteurs As PARTICULATE VECTOR WITH SELECTIVE TROPISM, PREPARATION METHOD AND PHARMACEUTICAL COMPOSITION.
US5371241A (en) 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
US5571799A (en) 1991-08-12 1996-11-05 Basco, Ltd. (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response
DE59208572D1 (en) 1991-10-17 1997-07-10 Ciba Geigy Ag Bicyclic nucleosides, oligonucleotides, processes for their preparation and intermediates
EP1331011A3 (en) 1991-10-24 2003-12-17 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5484908A (en) 1991-11-26 1996-01-16 Gilead Sciences, Inc. Oligonucleotides containing 5-propynyl pyrimidines
TW393513B (en) 1991-11-26 2000-06-11 Isis Pharmaceuticals Inc Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines
US5792608A (en) 1991-12-12 1998-08-11 Gilead Sciences, Inc. Nuclease stable and binding competent oligomers and methods for their use
US5359044A (en) 1991-12-13 1994-10-25 Isis Pharmaceuticals Cyclobutyl oligonucleotide surrogates
US5700922A (en) 1991-12-24 1997-12-23 Isis Pharmaceuticals, Inc. PNA-DNA-PNA chimeric macromolecules
FR2687679B1 (en) 1992-02-05 1994-10-28 Centre Nat Rech Scient OLIGOTHIONUCLEOTIDES.
US5814666A (en) 1992-04-13 1998-09-29 The United States As Represented By The Department Of Health And Human Services Encapsulated and non-encapsulated nitric oxide generators used as antimicrobial agents
US5633360A (en) 1992-04-14 1997-05-27 Gilead Sciences, Inc. Oligonucleotide analogs capable of passive cell membrane permeation
ATE143730T1 (en) 1992-04-22 1996-10-15 Ecole Polytech LIPID MEMBRANES FOR BIOSENSOR APPLICATIONS
US5434257A (en) 1992-06-01 1995-07-18 Gilead Sciences, Inc. Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages
EP0577558A2 (en) 1992-07-01 1994-01-05 Ciba-Geigy Ag Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates
ATE171210T1 (en) 1992-07-02 1998-10-15 Hybridon Inc SELF-STABILIZED OLIGONUCLEOTIDES AS THERAPEUTICS
US5652355A (en) 1992-07-23 1997-07-29 Worcester Foundation For Experimental Biology Hybrid oligonucleotide phosphorothioates
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
GB9304618D0 (en) 1993-03-06 1993-04-21 Ciba Geigy Ag Chemical compounds
ATE155467T1 (en) 1993-03-30 1997-08-15 Sanofi Sa ACYCLIC NUCLEOSIDE ANALOGUES AND OLIGONUCLEOTIDE SEQUENCES CONTAINING THEM
AU6412794A (en) 1993-03-31 1994-10-24 Sterling Winthrop Inc. Oligonucleotides with amide linkages replacing phosphodiester linkages
DE4311944A1 (en) 1993-04-10 1994-10-13 Degussa Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them
DE69431669T2 (en) 1993-09-02 2003-10-23 Ribozyme Pharmaceuticals, Inc. ENZYMATIC NUCLEIC ACID THAT CONTAINS NON-NUCLEOTIDS
US5502177A (en) 1993-09-17 1996-03-26 Gilead Sciences, Inc. Pyrimidine derivatives for labeled binding partners
US5457187A (en) 1993-12-08 1995-10-10 Board Of Regents University Of Nebraska Oligonucleotides containing 5-fluorouracil
CN1048254C (en) 1993-12-09 2000-01-12 托马斯杰弗逊大学 Compounds and methods for site-directed mutations in eukaryotic cells
US5446137B1 (en) 1993-12-09 1998-10-06 Behringwerke Ag Oligonucleotides containing 4'-substituted nucleotides
US5519134A (en) 1994-01-11 1996-05-21 Isis Pharmaceuticals, Inc. Pyrrolidine-containing monomers and oligomers
US5596091A (en) 1994-03-18 1997-01-21 The Regents Of The University Of California Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
US5625050A (en) 1994-03-31 1997-04-29 Amgen Inc. Modified oligonucleotides and intermediates useful in nucleic acid therapeutics
US5646269A (en) 1994-04-28 1997-07-08 Gilead Sciences, Inc. Method for oligonucleotide analog synthesis
US5525711A (en) 1994-05-18 1996-06-11 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Pteridine nucleotide analogs as fluorescent DNA probes
US20030026782A1 (en) 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
ES2320315T5 (en) 1994-07-15 2012-12-05 University Of Iowa Research Foundation Immunostimulatory oligonucleotides
US6429199B1 (en) 1994-07-15 2002-08-06 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules for activating dendritic cells
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US5597909A (en) 1994-08-25 1997-01-28 Chiron Corporation Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use
EP0824541B1 (en) 1995-05-04 2009-12-16 Gilead Sciences, Inc. Nucleic acid ligand complexes
US5912340A (en) 1995-10-04 1999-06-15 Epoch Pharmaceuticals, Inc. Selective binding complementary oligonucleotides
US5780448A (en) 1995-11-07 1998-07-14 Ottawa Civic Hospital Loeb Research DNA-based vaccination of fish
AU3379597A (en) 1996-06-19 1998-01-07 Hybridon, Inc. Modulation of tetraplex formation by chemical modifications of a g4-containing oligonucleotide
US7098320B1 (en) 1996-07-29 2006-08-29 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US6582921B2 (en) 1996-07-29 2003-06-24 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses thereof
US6750016B2 (en) 1996-07-29 2004-06-15 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
JP4245664B2 (en) 1996-07-29 2009-03-25 ナノスフェアー インコーポレイテッド Method for detecting the target acid using gold nanoparticles with oligonucleotides
US6361944B1 (en) 1996-07-29 2002-03-26 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US20020172953A1 (en) 1996-07-29 2002-11-21 Mirkin Chad A. Movement of biomolecule-coated nanoparticles in an electric field
US6506564B1 (en) 1996-07-29 2003-01-14 Nanosphere, Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
US5849902A (en) 1996-09-26 1998-12-15 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US6056973A (en) 1996-10-11 2000-05-02 Sequus Pharmaceuticals, Inc. Therapeutic liposome composition and method of preparation
US20060002949A1 (en) 1996-11-14 2006-01-05 Army Govt. Of The Usa, As Rep. By Secretary Of The Office Of The Command Judge Advocate, Hq Usamrmc. Transcutaneous immunization without heterologous adjuvant
EP0856579A1 (en) 1997-01-31 1998-08-05 BIOGNOSTIK GESELLSCHAFT FÜR BIOMOLEKULARE DIAGNOSTIK mbH An antisense oligonucleotide preparation method
AU738513B2 (en) 1997-02-28 2001-09-20 University Of Iowa Research Foundation, The Use of nucleic acids containing unmethylated CpG dinucleotide in the treatment of LPS-associated disorders
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
US6426334B1 (en) 1997-04-30 2002-07-30 Hybridon, Inc. Oligonucleotide mediated specific cytokine induction and reduction of tumor growth in a mammal
US20030104044A1 (en) 1997-05-14 2003-06-05 Semple Sean C. Compositions for stimulating cytokine secretion and inducing an immune response
WO1998052581A1 (en) 1997-05-20 1998-11-26 Ottawa Civic Hospital Loeb Research Institute Vectors and methods for immunization or therapeutic protocols
JP4236812B2 (en) 1997-09-12 2009-03-11 エクシコン エ/エス Oligonucleotide analogues
DE69935507T2 (en) 1998-04-03 2007-12-06 University Of Iowa Research Foundation METHOD AND PRODUCTS FOR STIMULATING THE IMMUNE SYSTEM BY IMMUNOTHERAPEUTIC OLIGONUCLEOTIDES AND CYTOKINES
US6271209B1 (en) 1998-04-03 2001-08-07 Valentis, Inc. Cationic lipid formulation delivering nucleic acid to peritoneal tumors
US6287765B1 (en) 1998-05-20 2001-09-11 Molecular Machines, Inc. Methods for detecting and identifying single molecules
DE69932717T2 (en) 1998-05-22 2007-08-09 Ottawa Health Research Institute, Ottawa METHODS AND PRODUCTS FOR INDUCING MUCOSAL IMMUNITY
US6562798B1 (en) 1998-06-05 2003-05-13 Dynavax Technologies Corp. Immunostimulatory oligonucleotides with modified bases and methods of use thereof
CA2248592A1 (en) 1998-08-31 2000-02-29 Christopher D. Batich Microspheres for use in the treatment of cancer
FR2783170B1 (en) 1998-09-11 2004-07-16 Pasteur Merieux Serums Vacc IMMUNOSTIMULATING EMULSION
US6228642B1 (en) 1998-10-05 2001-05-08 Isis Pharmaceuticals, Inc. Antisense oligonucleotide modulation of tumor necrosis factor-(α) (TNF-α) expression
US6194328B1 (en) 1998-12-09 2001-02-27 Advanced Micro Devices, Inc. H2 diffusion barrier formation by nitrogen incorporation in oxide layer
EP1141297B1 (en) 1999-01-11 2009-09-30 Schering Corporation Interleukin-17 related mammalian cytokines. polynucleotides encoding them . uses
EP1053751A1 (en) 1999-05-17 2000-11-22 Institut National De La Sante Et De La Recherche Medicale (Inserm) Compositions and methods for treating cell proliferation disorders
US6656730B1 (en) 1999-06-15 2003-12-02 Isis Pharmaceuticals, Inc. Oligonucleotides conjugated to protein-binding drugs
WO2001000876A1 (en) 1999-06-25 2001-01-04 Mirkin Chad A Nanoparticles having oligonucleotides attached thereto and uses therefor
ES2327026T3 (en) 1999-07-08 2009-10-23 Cap Biotechnology, Inc. STRUCTURES CONTAINING CALCIUM AND MANUFACTURING AND USE PROCEDURES OF THE SAME.
DE19935756A1 (en) 1999-07-27 2001-02-08 Mologen Forschungs Entwicklung Covalently closed nucleic acid molecule for immune stimulation
WO2001012223A2 (en) 1999-08-19 2001-02-22 Dynavax Technologies Corporation Methods of modulating an immune response using immunostimulatory sequences and compositions for use therein
TR200503031T2 (en) 1999-09-25 2005-09-21 University Of Iowa Research Foundation Immunostimulatory nucleic acids
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
NZ517928A (en) 1999-09-27 2004-09-24 Coley Pharm Gmbh Methods related to immunostimulatory nucleic acid-induced interferon
US6585947B1 (en) 1999-10-22 2003-07-01 The Board Of Trustess Of The University Of Illinois Method for producing silicon nanoparticles
US7223398B1 (en) 1999-11-15 2007-05-29 Dynavax Technologies Corporation Immunomodulatory compositions containing an immunostimulatory sequence linked to antigen and methods of use thereof
US6677153B2 (en) 1999-11-29 2004-01-13 Avi Biopharma, Inc. Antisense antibacterial method and composition
US20030181412A1 (en) 1999-12-21 2003-09-25 Ingeneus Corporation Method for modifying transcription and/or translation in an organism for therapeutic, prophylactic and/or analytic uses
IL150476A0 (en) 1999-12-30 2002-12-01 Aventis Pharma Sa Compositions comprising nucleic acids incorporated in bilaminar mineral particles
WO2001051665A2 (en) 2000-01-13 2001-07-19 Nanosphere Inc. Nanoparticles having oligonucleotides attached thereto and uses therefor
AT409085B (en) 2000-01-28 2002-05-27 Cistem Biotechnologies Gmbh PHARMACEUTICAL COMPOSITION FOR IMMUNULATING AND PRODUCING VACCINES
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20020156033A1 (en) 2000-03-03 2002-10-24 Bratzler Robert L. Immunostimulatory nucleic acids and cancer medicament combination therapy for the treatment of cancer
US20040131628A1 (en) 2000-03-08 2004-07-08 Bratzler Robert L. Nucleic acids for the treatment of disorders associated with microorganisms
US20030129251A1 (en) 2000-03-10 2003-07-10 Gary Van Nest Biodegradable immunomodulatory formulations and methods for use thereof
US7129222B2 (en) 2000-03-10 2006-10-31 Dynavax Technologies Corporation Immunomodulatory formulations and methods for use thereof
AU2001249609A1 (en) 2000-03-28 2001-10-08 Department Of Veterans Affairs Methods for increasing a cytotoxic T lymphocyte response in vivo
ATE487136T1 (en) 2000-03-28 2010-11-15 Nanosphere Inc NANOPARTICLES WITH BONDED OLIGONUCLEOTIDES AND USES THEREOF
ES2298269T3 (en) 2000-09-26 2008-05-16 Idera Pharmaceuticals, Inc. MODULATION OF THE IMMUNO-STIMULATING ACTIVITY OF OLIGONUCLEOTIDIC ANALOGS IMMUNO-STIMULANTS THROUGH POSITIONAL CHEMICAL CHANGES.
US7083958B2 (en) 2000-11-20 2006-08-01 The Board Of Trustees Of The University Of Illinois Membrane scaffold proteins
AU2002225670B2 (en) 2000-11-20 2006-05-11 The Board Of Trustees Of The University Of Illinois Membrane scaffold proteins
ES2728168T3 (en) 2000-12-01 2019-10-22 Max Planck Gesellschaft Small RNA molecules that mediate RNA interference
ATE398175T1 (en) 2000-12-08 2008-07-15 Coley Pharmaceuticals Gmbh CPG-TYPE NUCLEIC ACIDS AND METHODS OF USE THEREOF
DE10065475A1 (en) 2000-12-28 2002-07-18 Switch Biotech Ag Use of intermediate-conductance potassium channel proteins for the diagnosis, prevention and treatment of disorders associated with disturbed keratinocyte activity, especially psoriasis
US7563618B2 (en) 2001-03-23 2009-07-21 Geron Corporation Oligonucleotide conjugates
US7176296B2 (en) 2001-04-30 2007-02-13 Idera Pharmaceuticals, Inc. Modulation of oligonucleotide CpG-mediated immune stimulation by positional modification of nucleosides
GB0111279D0 (en) 2001-05-10 2001-06-27 Nycomed Imaging As Radiolabelled liposomes
US20060019917A1 (en) 2001-05-18 2006-01-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA)
AU2002239726A1 (en) 2001-05-25 2002-12-09 Northwestern University Non-alloying core shell nanoparticles
CN100384480C (en) 2001-05-30 2008-04-30 斯克里普斯研究学院 Delivery system for nucleic acids
CN100334228C (en) 2001-06-21 2007-08-29 戴纳瓦克斯技术公司 Cimeric immunomodulatory compounds and methods of using the same
EP1990040A1 (en) 2001-07-10 2008-11-12 North Carolina State University Nanoparticle delivery vehicle
US7666674B2 (en) 2001-07-27 2010-02-23 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Use of sterically stabilized cationic liposomes to efficiently deliver CPG oligonucleotides in vivo
CA2456328C (en) 2001-08-07 2015-05-26 Dynavax Technologies Corporation Complexes of a short cpg-containing oligonucleotide bound to the surface of a solid phase microcarrier and methods for use thereof
EP2196217A1 (en) 2001-09-14 2010-06-16 Cytos Biotechnology AG Packaging of immunostimulatory substances into virus-like particles: method of preparation and use
US20030134810A1 (en) 2001-10-09 2003-07-17 Chris Springate Methods and compositions comprising biocompatible materials useful for the administration of therapeutic agents
US7276489B2 (en) 2002-10-24 2007-10-02 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by optimal presentation of 5′ ends
TW200303759A (en) 2001-11-27 2003-09-16 Schering Corp Methods for treating cancer
ATE443133T1 (en) 2002-02-01 2009-10-15 Life Technologies Corp OLIGONUCLEOTIDE COMPOSITIONS WITH IMPROVED EFFICIENCY
US8088388B2 (en) 2002-02-14 2012-01-03 United Biomedical, Inc. Stabilized synthetic immunogen delivery system
JP4846200B2 (en) 2002-04-04 2011-12-28 コーリー ファーマシューティカル ゲーエムベーハー Immunostimulatory G and U-containing oligoribonucleotides
US20040038303A1 (en) 2002-04-08 2004-02-26 Unger Gretchen M. Biologic modulations with nanoparticles
WO2003101386A2 (en) 2002-05-30 2003-12-11 Memorial Sloan-Kettering Cancer Center Kinase suppressor of ras inactivation for therapy of ras mediated tumorigenesis
CA2388049A1 (en) 2002-05-30 2003-11-30 Immunotech S.A. Immunostimulatory oligonucleotides and uses thereof
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
AU2003259827B2 (en) 2002-08-12 2008-09-04 Dynavax Technologies Corporation Immunomodulatory compositions, methods of making, and methods of use thereof
AR040996A1 (en) 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
ZA200503511B (en) 2002-10-29 2006-10-25 Coley Pharmaceutical Group Ltd Use of CPG oligonucleotides in the treatment of hepatitis C virus infection
GB0227738D0 (en) 2002-11-28 2003-01-08 Univ Liverpool Nanoparticle conjugates and method of production thereof
US8158768B2 (en) 2002-12-23 2012-04-17 Dynavax Technologies Corporation Immunostimulatory sequence oligonucleotides and methods of using the same
KR101178816B1 (en) 2002-12-23 2012-09-07 다이나박스 테크놀로지 코퍼레이션 Immunostimulatory sequence oligonucleotides and methods of using the same
EP2572714A1 (en) 2002-12-30 2013-03-27 3M Innovative Properties Company Immunostimulatory Combinations
US20060105343A1 (en) 2003-01-09 2006-05-18 Children's Medical Center Corporation Methods for diagnosis and prognosis of cancer
AU2004206820B2 (en) 2003-01-16 2010-06-10 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties of oligonucleotide-based compounds by utilizing modified immunostimulatory dinucleotides
US7354907B2 (en) 2003-02-07 2008-04-08 Idera Pharmaceuticals, Inc. Short immunomodulatory oligonucleotides
JP2004315433A (en) 2003-04-16 2004-11-11 Woong-Shick Ahn PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING PAPILLOMA VIRUS-INDUCED DISEASE CONTAINING ANTIGENIC PROTEIN OF PAPILLOMA VIRUS AND CpG-OLIGODEOXYNUCLEOTIDE
CA2526212C (en) 2003-05-16 2013-08-27 Hybridon, Inc. Synergistic treatment of cancer using immunomers in conjunction with chemotherapeutic agents
US7727969B2 (en) 2003-06-06 2010-06-01 Massachusetts Institute Of Technology Controlled release nanoparticle having bound oligonucleotide for targeted delivery
MXPA05013658A (en) 2003-06-11 2006-03-02 Hybridon Inc Stabilized immunomodulatory oligonucleotides.
US20050096263A1 (en) 2003-10-30 2005-05-05 Keay Susan K. Novel antiproliferative factor and methods of use
WO2005004907A1 (en) 2003-07-10 2005-01-20 Cytos Biotechnology Ag Packaged virus-like particles
JP2007531699A (en) 2003-07-15 2007-11-08 イデラ ファーマシューティカルズ インコーポレイテッド Synergistic stimulation of the immune system using immunostimulatory oligonucleotides and / or immunomeric compounds in combination with cytokines and / or chemotherapeutic agents or radiation therapy
US20080057128A1 (en) 2003-07-18 2008-03-06 Omeros Corporation Biodegradable triblock copolymers, synthesis methods therefore, and hydrogels and biomaterials made there from
MXPA06002660A (en) 2003-09-09 2006-09-04 Geron Corp Modified oligonucleotides for telomerase inhibition.
EP1663316A2 (en) 2003-09-25 2006-06-07 Coley Pharmaceutical Group, Inc. Nucleic acid lipophilic conjugates
US6979738B2 (en) 2003-10-22 2005-12-27 Academia Sinica Quadruplex stabilizer
NZ546275A (en) 2003-10-30 2009-05-31 Coley Pharm Gmbh C-class oligonucleotides analogs with enhanced immunostimulatory potency
US7713535B2 (en) 2003-12-08 2010-05-11 Idera Pharmaceuticals, Inc. Modulation of immunostimulatory properties by small oligonucleotide-based compounds
US7846412B2 (en) 2003-12-22 2010-12-07 Emory University Bioconjugated nanostructures, methods of fabrication thereof, and methods of use thereof
EP1550458A1 (en) * 2003-12-23 2005-07-06 Vectron Therapeutics AG Synergistic liposomal adjuvants
EP1547581A1 (en) * 2003-12-23 2005-06-29 Vectron Therapeutics AG Liposomal vaccine for the treatment of human hematological malignancies
WO2005080567A1 (en) 2004-02-20 2005-09-01 Mologen Ag Substituted, non-coding nucleic acid molecule used for the therapeutic and prophylactic immune stimulation in humans and higher animals
ATE490260T1 (en) 2004-02-26 2010-12-15 Layerlab Aktiebolag OLIGONUCLEOTIDES RELATED TO LIPID MEMBRANE ATTACHMENTS
AU2005243250A1 (en) 2004-04-02 2005-11-24 Coley Pharmaceutical Gmbh Immunostimulatory nucleic acids for inducing IL-10 responses
US20080274454A1 (en) 2004-04-07 2008-11-06 Mirkin Chad A Reversible and Chemically Programmable Micelle Assembly With Dna Block-Copolymer Amphiphiles
GB0409940D0 (en) 2004-05-04 2004-06-09 Glaxosmithkline Biolog Sa Vaccine
US20080213177A1 (en) 2004-05-24 2008-09-04 Thomas William Rademacher Nanoparticles Comprising Rna Ligands
GB0411537D0 (en) 2004-05-24 2004-06-23 Midatech Ltd Nanoparticles comprising rna ligands
CA2567741A1 (en) 2004-05-25 2006-03-30 Chimeracore, Inc. Self-assembling nanoparticle drug delivery system
EP1753453A2 (en) 2004-06-08 2007-02-21 Coley Pharmaceutical GmbH Abasic oligonucleotide as carrier platform for antigen and immunostimulatory agonist and antagonist
EP1604669A1 (en) 2004-06-10 2005-12-14 Institut National De La Sante Et De La Recherche Medicale (Inserm) Use of ATP analogues for treatment of cardiovascular diseases
US7498425B2 (en) 2004-06-15 2009-03-03 Idera Pharmaceuticals, Inc. Immunostimulatory oligonucleotide multimers
MXPA06014915A (en) 2004-06-15 2007-08-20 Idera Pharmaceuticals Inc Immunostimulatory oligonucleotide multimers.
AU2005269733B2 (en) 2004-07-20 2008-10-30 Schering Corporation Induction of apoptosis in Toll-like receptor expressing tumor cells
WO2006012695A1 (en) 2004-08-04 2006-02-09 Panvax Limited An immunogenic composition
WO2006015560A1 (en) 2004-08-09 2006-02-16 Mologen Ag Immunomodulating agent used in conjunction with chemotherapy
WO2006044660A2 (en) 2004-10-14 2006-04-27 Vanderbilt University Functionalized solid lipid nanoparticles and methods of making and using same
MY159370A (en) 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
KR100721928B1 (en) 2004-11-05 2007-05-28 주식회사 바이오씨에스 Pharmaceutical composition for treating or preventing dermatitis comprising CpG oligodeoxynucleotide
CA2586913A1 (en) 2004-11-09 2006-05-18 University Of Southern California Targeted innate immunity
EP1829887B1 (en) 2004-11-29 2011-08-24 Changchun Huapu Biotechnology Co., Ltd. Cpg single-strand deoxynucleotides for use as adjuvant
US7404969B2 (en) 2005-02-14 2008-07-29 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
AU2006336384B2 (en) 2005-02-14 2010-12-16 Sirna Therapeutics, Inc. Lipid nanoparticle based compositions and methods for the delivery of biologically active molecules
CN101218254A (en) 2005-02-14 2008-07-09 惠氏公司 Interleukin-17F antibodies and other IL-17F signaling antagonists and uses therefor
SG160336A1 (en) 2005-03-04 2010-04-29 Dynavax Tech Corp Vaccines comprising oligonucleotides having immunostimulatory sequences (iss) wherein the iss are conjugated to antigens and stabilized by buffer conditions and further excipients
JP2008533157A (en) 2005-03-14 2008-08-21 マサチューセッツ・インスティテュート・オブ・テクノロジー Nanocells for diagnosis and treatment of diseases and disorders
WO2006110350A2 (en) 2005-03-29 2006-10-19 The Board Of Trustees Of The Leland Stanford Junior University Method of fabricating lipid bilayer membranes on solid supports
DE102005016873A1 (en) 2005-04-12 2006-10-19 Magforce Nanotechnologies Ag New nano-particle useful for production of composition to treatment and/or prophylaxis of proliferative illnesses, cancer and bacterial infections, where nano-particle is bonded therapeutic substance
US8246995B2 (en) 2005-05-10 2012-08-21 The Board Of Trustees Of The Leland Stanford Junior University Hydrophobic nanotubes and nanoparticles as transporters for the delivery of drugs into cells
EP1880019A1 (en) 2005-05-12 2008-01-23 Arizona Board Regents, a body corporate of the State of Arizona, acting for and on behalf of Arizona State University Self-assembled nucleic acid nanoarrays and uses therefor
EP2669269B1 (en) 2005-05-27 2019-05-22 The University of North Carolina At Chapel Hill Nitric oxide-releasing particles for nitric oxide therapeutics and biomedical applications
WO2006138145A1 (en) 2005-06-14 2006-12-28 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
JP2009500412A (en) 2005-07-07 2009-01-08 コーリー ファーマシューティカル グループ,インコーポレイテッド Combination therapy of anti-CTLA-4 antibody and CPG motif-containing synthetic oligodeoxynucleotide for the treatment of cancer
US8067571B2 (en) 2005-07-13 2011-11-29 Avi Biopharma, Inc. Antibacterial antisense oligonucleotide and method
WO2007027718A1 (en) 2005-08-31 2007-03-08 The Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods of altering an immune response induced by cpg oligodeoxynucleotides
US20090221095A1 (en) 2005-10-13 2009-09-03 Northwestern University Colorimetric Screening of DNA Binding/Intercalating Agents with Gold Nanoparticle Probes
US20070093439A1 (en) 2005-10-25 2007-04-26 Idera Pharmaceuticals, Inc. Short immunomodulatory oligonucleotides
FR2892819B1 (en) 2005-10-28 2008-02-01 Centre Nat Rech Scient PERSISTENT LUMINESCENCE NANOPARTICLES FOR THEIR USE AS A DIAGNOSTIC AGENT FOR IN VIVO OPTICAL IMAGING
EP2371956A3 (en) 2005-11-07 2012-01-04 Idera Pharmaceuticals Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides
US7776834B2 (en) 2005-11-07 2010-08-17 Idera Pharmaceuticals, Inc. Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides
JP2009514525A (en) 2005-11-07 2009-04-09 イデラ ファーマシューティカルズ インコーポレイテッド Immunostimulatory properties of oligonucleotide-based compounds, including modified immunostimulatory dinucleotides
US7470674B2 (en) 2005-11-07 2008-12-30 Idera Pharmaceuticals, Inc. Immunostimulatory properties of oligonucleotide-based compounds comprising modified immunostimulatory dinucleotides
JP5122474B2 (en) 2005-12-01 2013-01-16 プロネイ・セラピューティクス・インコーポレイテッド Amphoteric liposome preparation
WO2007063421A2 (en) 2005-12-01 2007-06-07 The Provost, Fellows And Scholars Of The College Of The Holy And Undivided Trinity Of Queen Elizabeth, Near Dublin Compositions and methods relating to treatment of cancer and infectious diseases
WO2007067733A2 (en) 2005-12-09 2007-06-14 Massachusetts Institute Of Technology Compositions and methods to monitor rna delivery to cells
RU2451523C2 (en) 2005-12-14 2012-05-27 Цитос Биотехнологи Аг Particles packed in immunostimulating nucleic acid that intended for hypersensitivity treatment
WO2007075626A2 (en) 2005-12-20 2007-07-05 Idera Pharmaceuticals, Inc. Immunostimulatory activity of palindromic immune modulatory oligonucleotides (imo tm) contiaining different lengths of palindromic segments
MX2008008278A (en) 2005-12-20 2008-10-01 Idera Pharmaceuticals Inc Novel synthetic agonists of toll-like receptors containing cg dinucleotide modifications.
EP1978997A1 (en) 2005-12-22 2008-10-15 Apollo Life Sciences Limited Transdermal delivery of pharmaceutical agents
US20070148251A1 (en) 2005-12-22 2007-06-28 Hossainy Syed F A Nanoparticle releasing medical devices
AU2007239095B2 (en) 2006-01-09 2012-05-03 The Regents Of The University Of California Immunostimulatory combinations for vaccine adjuvants
WO2007089607A2 (en) 2006-01-26 2007-08-09 University Of Massachusetts Rna silencing agents for use in therapy and nanotransporters for efficient delivery of same
US7723045B2 (en) 2006-02-10 2010-05-25 The Regents Of The University Of California Assays to predict atherosclerosis and dysfunctional high-density lipoprotein
EP1991678B2 (en) 2006-02-15 2020-07-15 Rechtsanwalt Thomas Beck Compositions and methods for oligonucleotide formulations
EP1820804A1 (en) 2006-02-20 2007-08-22 Humboldt-Universität zu Berlin Lipidated oligonucleotides
US8361494B2 (en) 2006-03-10 2013-01-29 The Trustees Of The University Of Pennsylvania Biomimetic iron-oxide-containing lipoprotein and related materials
EP2012772A1 (en) 2006-04-26 2009-01-14 The Uab Research Foundation Reducing cancer cell invasion using an inhibitor of toll like receptor signaling
MX2008014380A (en) 2006-05-11 2009-03-02 Mologen Ag Multimer for immunostimulation.
WO2007137117A2 (en) 2006-05-17 2007-11-29 Massachusetts Institute Of Technology Aptamer-directed drug delivery
US8017237B2 (en) 2006-06-23 2011-09-13 Abbott Cardiovascular Systems, Inc. Nanoshells on polymers
US20090280188A1 (en) 2006-06-23 2009-11-12 Northwestern University Asymmetric functionalizated nanoparticles and methods of use
AU2007280690C1 (en) * 2006-07-31 2012-08-23 Curevac Gmbh Nucleic acid of formula (I): GIXmGn, or (II): CIXmCn, in particular as an immune-stimulating agent/adjuvant
US20080124366A1 (en) 2006-08-06 2008-05-29 Ohlfest John R Methods and Compositions for Treating Tumors
WO2008021908A2 (en) 2006-08-08 2008-02-21 Board Of Regents Of The University Of Texas Multistage delivery of active agents
EP2486938B1 (en) 2006-09-26 2018-05-09 Infectious Disease Research Institute Vaccine composition containing synthetic adjuvant
US20100099858A1 (en) 2006-09-28 2010-04-22 Mirkin Chad A Maximizing Oligonucleotide Loading on Gold Nanoparticle
EP1914234A1 (en) 2006-10-16 2008-04-23 GPC Biotech Inc. Pyrido[2,3-d]pyrimidines and their use as kinase inhibitors
US7976743B2 (en) 2006-10-16 2011-07-12 Northwestern University Gas-containing liposomes
CA2671883A1 (en) 2006-12-12 2008-06-19 Idera Pharmaceuticals, Inc. Synthetic agonists of tlr9
US20080181928A1 (en) 2006-12-22 2008-07-31 Miv Therapeutics, Inc. Coatings for implantable medical devices for liposome delivery
WO2008089248A2 (en) 2007-01-19 2008-07-24 The Board Of Trustees Of The University Of Illinois Amphiphilic substances and triggered liberation from lipid vesicles
WO2008089771A1 (en) 2007-01-24 2008-07-31 Syddansk Universitet Dna controlled assembly of lipid membranes
CA2691066C (en) 2007-02-09 2018-07-31 Northwestern University Particles for detecting intracellular targets
AU2008239495A1 (en) 2007-02-27 2008-10-23 Northwestern University Molecule attachment to nanoparticles
BRPI0809852A2 (en) 2007-03-30 2014-09-23 Hirofumi Takeuchi TRANSPULMONARY LIPOSOMA TO CONTROL PHARMACEUTICAL ARRIVAL
JP2010523595A (en) 2007-04-04 2010-07-15 マサチューセッツ インスティテュート オブ テクノロジー Poly (amino acid) targeting part
US7806276B2 (en) 2007-04-12 2010-10-05 Hanuman, Llc Buoy suspension fractionation system
DK2170353T3 (en) 2007-05-18 2015-07-27 Adiutide Pharmaceuticals Gmbh The phosphate-modified oligonucleotide analogs with immunostimulatory activity
CA2689923A1 (en) 2007-05-30 2008-12-11 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
CN103961315A (en) 2007-05-31 2014-08-06 安特里奥公司 Nucleic acid nanoparticles and uses therefor
DK2152897T3 (en) 2007-06-05 2015-04-27 Biocistronix Ab Methods and materials related to hårpigmentering and cancer
CA2692161C (en) 2007-07-09 2015-09-29 Idera Pharmaceuticals, Inc. Stabilized immune modulatory rna (simra) compounds
ATE554170T1 (en) 2007-07-23 2012-05-15 Univ Aarhus NANOPARTICLE-MEDIATED TREATMENT FOR INFLAMMATORY DISEASES
BRPI0813981A2 (en) 2007-08-01 2017-05-09 Idera Pharmaceuticals Inc synthetic agonists of tlr9.
NZ582972A (en) 2007-08-13 2011-09-30 Coley Pharm Gmbh Rna sequence motifs in the context of defined internucleotide linkages inducing specific immune modulatory profiles
US8853375B2 (en) 2007-08-15 2014-10-07 Idera Pharmaceuticals, Inc. Toll like receptor modulators
US8563527B2 (en) 2007-08-20 2013-10-22 Pharmain Corporation Oligonucleotide core carrier compositions for delivery of nucleic acid-containing therapeutic agents, methods of making and using the same
US9421254B2 (en) 2007-09-24 2016-08-23 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Immunostimulatory combinations of TLR ligands and methods of use
WO2009049208A1 (en) 2007-10-12 2009-04-16 The University Of North Carolina At Chapel Hill Use of nitric oxide to enhance the efficacy of silver and other topical wound care agents
AU2008318778B2 (en) 2007-10-29 2014-10-02 Regulus Therapeutics Inc. Targeting microRNAs for the treatment of liver cancer
EP2058397A1 (en) 2007-11-07 2009-05-13 Mologen AG Multimere assembly for immunostimulation
MX2010005089A (en) 2007-11-09 2010-05-21 Univ Northeastern Self-assembling micelle-like nanoparticles for systemic gene delivery.
US20090148384A1 (en) 2007-12-10 2009-06-11 Fischer Katrin Functionalized, solid polymer nanoparticles comprising epothilones
CN105903029A (en) 2007-12-12 2016-08-31 大学健康网络 High-density lipoprotein-like peptide-phospholipid scaffold (hpps) nanoparticles
WO2009089115A1 (en) 2008-01-04 2009-07-16 Hormel Foods Corporation Encapsulation of oxidatively unstable compounds
CA2716326A1 (en) 2008-02-21 2009-08-27 University Of Kentucky Research Foundation Ultra-small rnas as toll-like receptor-3 antagonists
CA2719614C (en) 2008-03-25 2018-05-01 Juvaris Biotherapeutics, Inc. Enhancement of an immune response by administration of a cationic lipid-dna complex (cldc)
EP2105145A1 (en) 2008-03-27 2009-09-30 ETH Zürich Method for muscle-specific delivery lipid-conjugated oligonucleotides
BRPI0907260A2 (en) 2008-04-21 2015-07-14 3M Innovative Properties Co "methods, devices and compositions that release nitric oxide"
CA2722183C (en) 2008-04-25 2018-09-18 Northwestern University Nanostructures suitable for sequestering cholesterol and other molecules
ES2570973T3 (en) * 2008-05-02 2016-05-23 Products and methods for stimulating an immune response
US8063131B2 (en) 2008-06-18 2011-11-22 University Of Washington Nanoparticle-amphipol complexes for nucleic acid intracellular delivery and imaging
WO2009158678A1 (en) 2008-06-27 2009-12-30 Children's Hospital & Research Center At Oakland Lipophilic nucleic acid delivery vehicle and methods of use therefor
US20100035967A1 (en) 2008-07-28 2010-02-11 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 9 expression by antisense oligonucleotides
US20100047188A1 (en) 2008-08-04 2010-02-25 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 8 expression by antisense oligonucleotides
US8153605B2 (en) 2008-08-04 2012-04-10 Idera Pharmaceuticals, Inc. Modulation of toll-like receptor 3 expression by antisense oligonucleotides
AU2009279524A1 (en) 2008-08-08 2010-02-11 Idera Pharmaceuticals, Inc. Modulation of myeloid differentiation primary response gene 88 (MYD88) expression by antisense oligonucleotides
MX2011002267A (en) 2008-08-28 2011-03-30 Glaxosmithkline Biolog Sa Vaccine.
WO2010037402A1 (en) 2008-10-02 2010-04-08 Dako Denmark A/S Molecular vaccines for infectious disease
PL2350043T3 (en) 2008-10-09 2014-09-30 Tekmira Pharmaceuticals Corp Improved amino lipids and methods for the delivery of nucleic acids
CA2737352C (en) 2008-10-16 2017-06-27 University Of Saskatchewan Combination adjuvant formulation
US8574582B2 (en) 2008-10-31 2013-11-05 Janssen Biotech, Inc. Methods for mediating fibrotic response
US20130090457A1 (en) 2008-10-31 2013-04-11 Janssen Biotech, Inc. Toll-Like Receptor 3 Antagonists for the Treatment of Metabolic and Cardiovascular Diseases
TW201021852A (en) 2008-11-17 2010-06-16 Enzon Pharmaceuticals Inc Releasable fusogenic lipids for nucleic acids delivery systems
CA2781591A1 (en) * 2008-11-24 2010-05-27 Schubert Holdings Llc Implantable liposome embedded matrix composition, uses thereof, and polycaprolactone praticles as scaffolds for tissue regeneration
MX2011005429A (en) 2008-11-24 2011-06-21 Univ Northwestern Polyvalent rna-nanoparticle compositions.
EP2759306B1 (en) 2008-12-09 2016-04-06 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
US8298765B2 (en) 2009-01-01 2012-10-30 Cornell University Multifunctional nucleic acid nano-structures
JP5801205B2 (en) 2009-01-08 2015-10-28 ノースウェスタン ユニバーシティ Inhibition of bacterial protein production by multivalent oligonucleotide modified nanoparticle conjugates
US20100233270A1 (en) 2009-01-08 2010-09-16 Northwestern University Delivery of Oligonucleotide-Functionalized Nanoparticles
US20120040004A1 (en) 2009-01-28 2012-02-16 Region Midtjylland Treatment of radiation-induced fibrosis
MX2011008067A (en) 2009-01-30 2011-08-17 Idera Pharmaceuticals Inc Synthetic agonists of tlr 9.
WO2010091293A1 (en) 2009-02-06 2010-08-12 The Regents Of The University Of California Plasmonic system for detecting binding of biological molecules
AR070368A2 (en) 2009-02-12 2010-03-31 Smithkline Beecham Biolog PROCEDURE FOR THE PREPARATION OF A VACCINE COMPOSITION THAT INCLUDES AN IMMUNOSTIMULATING AN ANTIGEN AND A METAL SALT AND USE OF SUCH COMPOSITION TO PREPARE A MEDICINAL PRODUCT. VACCINE COMPOSITION
CA2754043A1 (en) 2009-03-12 2010-09-16 Alnylam Pharmaceuticals, Inc. Lipid formulated compositions and methods for inhibiting expression of eg5 and vegf genes
AU2010223888A1 (en) 2009-03-13 2011-10-06 Egen, Inc. Compositions and methods for the delivery of biologically active RNAs
JP6145270B2 (en) 2009-04-15 2017-06-07 ノースウェスタン ユニバーシティ Delivery of oligonucleotide functionalized nanoparticles
EP2246433A1 (en) 2009-04-30 2010-11-03 Mologen AG Concatamers for immune modulation
WO2010147387A2 (en) 2009-06-18 2010-12-23 Industry Academic Cooperation Foundation, Hallym University Immunostimulatory compositions comprising liposome-encapsulated oligonucleotides as active ingredients
CN103977394B (en) 2009-07-17 2016-03-09 翰林大学校产学协力团 Comprise the oligonucleotide of liposome encapsulate and the immunostimulatory composition of epi-position
WO2011017382A2 (en) * 2009-08-03 2011-02-10 The Regents Of The University Of California Nanofibers and morphology shifting micelles
US20120277283A1 (en) 2009-08-04 2012-11-01 Mirkin Chad A Localized Delivery of Gold Nanoparticles for Therapeutic and Diagnostic Applications
US20120269730A1 (en) 2009-08-07 2012-10-25 Northwestern University Intracellular Delivery of Contrast Agents with Functionalized Nanoparticles
EP2960333B1 (en) 2009-08-27 2017-10-04 Idera Pharmaceuticals, Inc. Composition for inhibiting gene expression and uses thereof
US20120244230A1 (en) 2009-09-01 2012-09-27 Massachusetts Institute Of Technology Polyvalent polynucleotide nanoparticle conjugates as delivery vehicles for a chemotherapeutic agent
AU2010289483A1 (en) 2009-09-01 2012-03-29 Northwestern University Delivery of therapeutic agents using oligonucleotide-modified nanoparticles as carriers
US20110053829A1 (en) 2009-09-03 2011-03-03 Curevac Gmbh Disulfide-linked polyethyleneglycol/peptide conjugates for the transfection of nucleic acids
WO2011044545A2 (en) 2009-10-09 2011-04-14 Sigalov Alexander B Methods and compositions for targeted imaging
KR101132626B1 (en) 2009-10-12 2012-04-02 주식회사 녹십자 Method for preparing HDL nanoparticles for the delivery of hydrophobic drugs
US20110111974A1 (en) 2009-10-23 2011-05-12 Northwestern University Short Duplex Probes for Enhanced Target Hybridization
CA2779099C (en) 2009-10-30 2021-08-10 Northwestern University Templated nanoconjugates
EP3403647A1 (en) 2009-12-01 2018-11-21 Translate Bio, Inc. Delivery of mrna for the augmentation of proteins and enzymes in human genetic diseases
WO2011072133A1 (en) 2009-12-09 2011-06-16 William Marsh Rice University Therapeutic compositions and methods for delivery of active agents cleavably linked to nanoparticles
SG181823A1 (en) 2009-12-23 2012-07-30 Max Planck Gesellschaft Influenza targets
US20130178610A1 (en) 2009-12-24 2013-07-11 Chad A. Mirkin Oligonucleotide specific uptake of nanoconjugates
JP5863670B2 (en) 2010-01-19 2016-02-17 ノースウェスタン ユニバーシティ Synthetic nanostructures containing nucleic acids and / or other components
EP2399608B1 (en) 2010-03-05 2020-07-08 Sebastian Fuchs Immunomodulating nanoparticulate composition for use in inhalation therapy
US20130101512A1 (en) 2010-03-12 2013-04-25 Chad A. Mirkin Crosslinked polynucleotide structure
RU2595872C2 (en) 2010-03-19 2016-08-27 Массачусетс Интитут Оф Текнолоджи Composition of lipid vesicles and methods of application
WO2011127405A1 (en) 2010-04-08 2011-10-13 Sanford-Burnham Medical Research Institute Methods and compositions for enhanced delivery of compounds
BR112012027745A2 (en) 2010-04-27 2017-01-10 Univ Johns Hopkins method and immunogenic composition for treatment of neoplasia
US9238042B2 (en) 2010-05-13 2016-01-19 Sarepta Therapeutics, Inc. Antisense modulation of interleukins 17 and 23 signaling
KR101198715B1 (en) 2010-05-14 2012-11-13 한국생명공학연구원 Asymmetric liposomes with higher encapsulation efficiency of nucleic acids and hydrophilic anion chemicals
KR20130108984A (en) 2010-05-26 2013-10-07 셀렉타 바이오사이언시즈, 인크. Synthetic nanocarrier combination vaccines
NZ603527A (en) 2010-05-28 2014-10-31 Zoetis Belgium S A Vaccines comprising cholesterol and cpg as sole adjuvant - carrier molecules
US20130089614A1 (en) 2010-06-14 2013-04-11 Xuefeng Zhang Magnetic Nanoparticles and Uses Thereof
EA201291357A1 (en) 2010-06-16 2013-11-29 Дайнэвокс Текнолоджиз Корпорейшн TREATMENT METHODS USING TLR7 AND / OR TLR9 INHIBITORS
WO2012006634A2 (en) 2010-07-09 2012-01-12 The Board Of Trustees Of The University Of Illiniois Prostate specific antigen (psa) peptide therapy
EP3269811B1 (en) 2010-07-28 2020-10-07 Advanced Innovation Development Co. Ltd. Nucleic acid having adjuvant activity and use thereof
KR101761388B1 (en) 2010-07-30 2017-07-25 큐어백 아게 Complexation of nucleic acids with disulfide-crosslinked cationic components for transfection and immunostimulation
GB201014026D0 (en) 2010-08-20 2010-10-06 Ucl Business Plc Treatment
US9549901B2 (en) 2010-09-03 2017-01-24 The Brigham And Women's Hospital, Inc. Lipid-polymer hybrid particles
JP5927194B2 (en) 2010-09-24 2016-06-01 マリンクロッド エルエルシー Aptamer conjugates for targeting therapeutic and / or diagnostic nanocarriers
US20130095039A1 (en) 2010-09-30 2013-04-18 The Board Of Trustees Of The University Of Illinois Nucleic acid-mediated shape control of nanoparticles
JP6027011B2 (en) * 2010-10-26 2016-11-16 エーシー イミューン ソシエテ アノニム Liposome-based constructs containing peptides modified by hydrophobic moieties
WO2012068470A2 (en) 2010-11-19 2012-05-24 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
WO2012084991A1 (en) 2010-12-21 2012-06-28 Index Pharmaceuticals Ab Biologically active oligonucleotides capable of modulating the immune system ii
GB201021873D0 (en) 2010-12-23 2011-02-02 Mologen Ag DNA expression construct
GB201021867D0 (en) 2010-12-23 2011-02-02 Mologen Ag Non-coding immunomodulatory DNA construct
JP5902197B2 (en) 2011-01-11 2016-04-13 アルニラム・ファーマシューティカルズ・インコーポレーテッド PEGylated lipids and their use for drug delivery
CN106518851A (en) 2011-01-12 2017-03-22 帆德制药股份有限公司 Substituted benzoazepines as toll-like receptor modulators
HUE051400T2 (en) 2011-04-28 2021-03-01 Platform Brightworks Two Ltd Improved parenteral formulations of lipophilic pharmaceutical agents and methods for preparing and using the same
US9675561B2 (en) 2011-04-28 2017-06-13 President And Fellows Of Harvard College Injectable cryogel vaccine devices and methods of use thereof
US9693957B2 (en) * 2011-07-08 2017-07-04 The University Of North Carolina At Chapel Hill Metal bisphosphonate nanoparticles for anti-cancer therapy and imaging and for treating bone disorders
US9517277B2 (en) 2011-07-15 2016-12-13 University Of Georgia Research Foundation, Inc. Immune-stimulating photoactive hybrid nanoparticles
EP2548571A1 (en) 2011-07-22 2013-01-23 Institut Curie Compositions having means for targeting at least one antigen to dendritic cells
CN103702687A (en) 2011-07-29 2014-04-02 西莱克塔生物科技公司 Synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte (CTL) immune responses
JP6170047B2 (en) 2011-08-31 2017-07-26 ユニバーシティ・オブ・ジョージア・リサーチ・ファウンデイション・インコーポレイテッド Apoptosis-targeting nanoparticles
CA2848359A1 (en) 2011-09-11 2013-03-14 Aurasense, Llc Cellular uptake control systems
EP3533873A1 (en) 2011-09-14 2019-09-04 Translate Bio MA, Inc. Multimeric oligonucleotide compounds
WO2013040499A1 (en) 2011-09-14 2013-03-21 Northwestern University Nanoconjugates able to cross the blood-brain barrier
JP2014527983A (en) 2011-09-19 2014-10-23 ザ ジョンズ ホプキンス ユニバーシティー Cancer immunotherapy
WO2013043569A1 (en) 2011-09-20 2013-03-28 Vical Incorporated Synergistic anti-tumor efficacy using alloantigen combination immunotherapy
JP6240077B2 (en) 2011-10-06 2017-11-29 イムノバクシーン・テクノロジーズ・インコーポレイテッドImmunovaccine Technologies Inc. Liposome composition comprising an adjuvant that activates or increases its activity and its use
SG11201403756PA (en) 2012-01-01 2014-11-27 Qbi Entpr Ltd Endo180-targeted particles for selective delivery of therapeutic and diagnostic agents
WO2013113326A1 (en) 2012-01-31 2013-08-08 Curevac Gmbh Pharmaceutical composition comprising a polymeric carrier cargo complex and at least one protein or peptide antigen
US9107904B2 (en) 2012-04-05 2015-08-18 Massachusetts Institute Of Technology Immunostimulatory compositions and methods of use thereof
SG10201603896RA (en) 2012-05-04 2016-07-28 Pfizer Prostate-associated antigens and vaccine-based immunotherapy regimens
CA2873745A1 (en) 2012-05-16 2013-11-21 Aadigen, Llc Multi-target modulation for treating fibrosis and inflammatory conditions
CA2871477A1 (en) 2012-05-23 2013-11-28 The Ohio State University Lipid nanoparticle compositions for antisense oligonucleotides delivery
CA2879066C (en) 2012-07-13 2019-08-13 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant
CN103566377A (en) 2012-07-18 2014-02-12 上海博笛生物科技有限公司 Targeted immunotherapy for cancer
US9931418B2 (en) 2012-08-07 2018-04-03 Northeastern University Compositions for the delivery of RNA and drugs into cells
US9095625B2 (en) 2012-08-31 2015-08-04 University Of Massachusetts Graft-copolymer stabilized metal nanoparticles
US9868955B2 (en) 2012-09-29 2018-01-16 Dynavax Technologies Corporation Human toll-like receptor inhibitors and methods of use thereof
CA2899155A1 (en) 2013-02-05 2014-08-14 1Globe Health Institute Llc Biodegradable and clinically-compatible nanoparticles as drug delivery carriers
US9968673B2 (en) 2013-02-26 2018-05-15 Commissariat á l'ènergie atomique et aux ènergies alternatives Immunogenic composition in emulsion form comprising two dispersed phases, one comprising an antigen and the other comprising an immunostimulating agent
CN103212089B (en) 2013-04-07 2016-08-24 中国科学院上海应用物理研究所 A kind of preparation method and applications of carbon nanomaterial-immunossequencery sequencery compound
US9617544B2 (en) 2013-04-11 2017-04-11 The Board Of Trustees Of The University Of Illinois Nanoparticle mediated delivery of siRNA
AR095882A1 (en) 2013-04-22 2015-11-18 Hoffmann La Roche ANTIBODY COMBINATION THERAPY AGAINST HUMAN CSF-1R WITH A TLR9 AGONIST
GB2514591A (en) 2013-05-30 2014-12-03 Mologen Ag Predictive biomarker for cancer therapy
WO2014201245A1 (en) 2013-06-12 2014-12-18 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Tlr-9 agonist with tlr-7 and/or tlr-8 agonist for treating tumors
US10894963B2 (en) 2013-07-25 2021-01-19 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
AU2014292928A1 (en) 2013-07-25 2016-03-03 Exicure, Inc. Spherical nucleic acid-based constructs as immunoregulatory agents
US20150037374A1 (en) 2013-07-31 2015-02-05 Csl Limited Anti-tumor compositions and uses thereof
US10568898B2 (en) 2013-08-13 2020-02-25 Northwestern University Lipophilic nanoparticles for drug delivery
WO2015023941A1 (en) 2013-08-16 2015-02-19 Rana Therapeutics, Inc. Oligonucleotides targeting euchromatin regions of genes
ES2724300T3 (en) 2013-09-25 2019-09-10 Univ Cornell Compounds for inducing antitumor immunity and methods thereof
KR101465365B1 (en) 2013-10-15 2014-11-25 성균관대학교산학협력단 Lipid-supported polymeric functional particles and method thereof
WO2015077657A2 (en) 2013-11-22 2015-05-28 City Of Hope Stat3 inhibitors and uses thereof
MX2016007287A (en) 2013-12-03 2017-05-03 Univ Northwestern Liposomal particles, methods of making same and uses thereof.
CA2934073A1 (en) 2013-12-20 2015-06-25 The Broad Institute, Inc. Combination therapy with neoantigen vaccine
EP3095459A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
EP3095461A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
WO2015108046A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having anti-allergic activity, and anti-allergic agent
US10619210B2 (en) 2014-02-07 2020-04-14 The Johns Hopkins University Predicting response to epigenetic drug therapy
GB2523187A (en) 2014-02-18 2015-08-19 Mologen Ag Covalently closed non-coding immunomodulatory DNA construct
US10155950B2 (en) 2014-02-28 2018-12-18 Bayer Animal Health Gmbh Immunostimulatory plasmids
EP3932392A1 (en) 2014-03-05 2022-01-05 Orbis Health Solutions LLC Vaccine delivery systems using yeast cell wall particles
AU2015240567A1 (en) 2014-04-03 2016-10-20 Exicure, Inc. Self assembling nucleic acid nanostructures
JP6426268B2 (en) 2014-04-04 2018-11-21 バイオニア コーポレーションBioneer Corporation Novel double helix oligo RNA and pharmaceutical composition for preventing or treating fibrosis or respiratory disease comprising the same
US10413565B2 (en) 2014-04-30 2019-09-17 Northwestern University Nanostructures for modulating intercellular communication and uses thereof
JP7348708B2 (en) 2014-04-30 2023-09-21 プレジデント・アンド・フェロウズ・オブ・ハーバード・カレッジ Combination vaccine device and method for killing cancer cells
EP3136858A4 (en) 2014-05-02 2018-01-03 Nitor Therapeutics Guanosine as an immunepotentiator mediated through toll receptors
CN106535876B (en) 2014-06-04 2020-09-11 埃克西奎雷股份有限公司 Multivalent delivery of immunomodulators through liposomal spherical nucleic acids for prophylactic or therapeutic applications
TW201620526A (en) 2014-06-17 2016-06-16 愛羅海德研究公司 Compositions and methods for inhibiting gene expression of alpha-1 antitrypsin
US9919058B2 (en) 2014-07-15 2018-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Polyketal particles including a CpG oligodeoxynucleotide for the treatment of lung cancer
EP3183345B1 (en) 2014-08-20 2021-06-16 Northwestern University Biocompatible infinite coordination polymer nanoparticle-nucleic acid conjugates for antisense gene regulation
AU2015328242A1 (en) 2014-10-06 2017-04-27 Exicure, Inc. Anti-TNF compounds
EP3247796A4 (en) 2015-01-14 2018-07-11 Exicure, Inc. Nucleic acid nanostructures with core motifs
WO2016134104A1 (en) 2015-02-18 2016-08-25 Exicure, Inc. Immuno-regulatory lipid containing spherical nucleic acids
US10078092B2 (en) 2015-03-18 2018-09-18 Northwestern University Assays for measuring binding kinetics and binding capacity of acceptors for lipophilic or amphiphilic molecules
EP4414028A2 (en) 2015-05-19 2024-08-14 Yale University Compositions for treating pathological calcification conditions, and methods using same
EP3322407A4 (en) 2015-07-14 2019-07-10 Exicure, Inc. Spherical nucleic acid (sna)-mediated delivery of lipid-complexes to cells
JP2018525037A (en) 2015-08-24 2018-09-06 ハロー−バイオ・アールエヌエーアイ・セラピューティックス、インコーポレイテッド Polynucleotide nanoparticles and their use for regulation of gene expression
US20200297867A1 (en) 2016-02-01 2020-09-24 Exicure, Inc. Surface functionalization of liposomes and liposomal spherical nucleic acids (snas)
US20170240960A1 (en) * 2016-02-24 2017-08-24 Aurasense, Llc Spherical nucleic acids (sna) flare based fluorescence in situ hybridization
WO2017184427A1 (en) 2016-04-19 2017-10-26 Exicure, Inc. Topical administration of therapeutic agents and oligonucleotide formulations
EP3452598A4 (en) 2016-05-06 2020-04-29 Exicure, Inc. Liposomal spherical nucleic acid (sna) constructs presenting antisense oligonucleotides (aso) for specific knockdown of interleukin 17 receptor mrna
CA3023445A1 (en) 2016-05-06 2017-11-09 Exicure, Inc. Spherical nucleic acid tlr9 agonists
EP3452600A4 (en) 2016-05-06 2020-01-15 Exicure, Inc. Tlr9-targeted spherical nucleic acids having potent antitumor activity
US11052149B2 (en) 2016-09-19 2021-07-06 The University Of North Carolina At Chapel Hill Methods and compositions for inducing an immune response
US20200248183A1 (en) 2017-04-03 2020-08-06 Subbarao Nallagatla Tlr9-targeted spherical nucleic acids having potent antitumor activity
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
US20210002640A1 (en) 2018-02-28 2021-01-07 Exicure, Inc. Liposomal spherical nucleic acid (sna) constructs for survival of motor neuron (sma) inhibitors
WO2019168558A1 (en) 2018-02-28 2019-09-06 Exicure, Inc. Liposomal spherical nucleic acid (sna) constructs for survival of motor neuron (sma) inhibitors
AU2020223028A1 (en) 2019-02-12 2021-09-23 Exicure Operating Company Combined spherical nucleic acid and checkpoint inhibitor for antitumor therapy
US20220362398A1 (en) 2019-04-26 2022-11-17 Exicure Operating Company Administration of spherical nucleic acids for ophthalmological uses

Also Published As

Publication number Publication date
KR20170005499A (en) 2017-01-13
PL3164113T3 (en) 2019-09-30
EP3164113A1 (en) 2017-05-10
CN106535876B (en) 2020-09-11
US10434064B2 (en) 2019-10-08
JP6581604B2 (en) 2019-09-25
WO2015187966A1 (en) 2015-12-10
US11123294B2 (en) 2021-09-21
US20170157048A1 (en) 2017-06-08
ES2725948T3 (en) 2019-09-30
AU2015269412B2 (en) 2020-03-12
US20220257512A1 (en) 2022-08-18
CA2953216C (en) 2020-12-22
EP3164113B1 (en) 2019-03-27
JP2017524658A (en) 2017-08-31
AU2015269412A1 (en) 2016-12-22
CN106535876A (en) 2017-03-22
EP3508198A1 (en) 2019-07-10
TR201908550T4 (en) 2019-07-22
US20200069587A1 (en) 2020-03-05
KR102290205B1 (en) 2021-08-20
US11957788B2 (en) 2024-04-16

Similar Documents

Publication Publication Date Title
US11957788B2 (en) Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
US10837018B2 (en) Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
JP5737937B2 (en) Stabilized immunomodulatory RNA (SIMRA) compounds
US20170175121A1 (en) Self assembling nucleic acid nanostructures
ES2486298T3 (en) Immunostimulatory oligonucleotide analogs containing modified sugars
US20160194642A1 (en) Spherical nucleic acid-based constructs as immunoregulatory agents
JP2012517226A (en) Synthetic RNA-based agonists of TLR7
ES2544484T3 (en) Phosphate modified oligonucleotide analogues with immunostimulatory activity
US20200297867A1 (en) Surface functionalization of liposomes and liposomal spherical nucleic acids (snas)
WO2016149323A1 (en) Immunomodulatory spherical nucleic acids

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20200601