CA2794163C - Bacillus pumilus bilirubin oxidase and applications thereof - Google Patents

Bacillus pumilus bilirubin oxidase and applications thereof Download PDF

Info

Publication number
CA2794163C
CA2794163C CA2794163A CA2794163A CA2794163C CA 2794163 C CA2794163 C CA 2794163C CA 2794163 A CA2794163 A CA 2794163A CA 2794163 A CA2794163 A CA 2794163A CA 2794163 C CA2794163 C CA 2794163C
Authority
CA
Canada
Prior art keywords
bod
bilirubin
electrode
liquid sample
oxidation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CA2794163A
Other languages
French (fr)
Other versions
CA2794163A1 (en
Inventor
Nicolas Mano
Fabien Durand
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of CA2794163A1 publication Critical patent/CA2794163A1/en
Application granted granted Critical
Publication of CA2794163C publication Critical patent/CA2794163C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/001Enzyme electrodes
    • C12Q1/005Enzyme electrodes involving specific analytes or enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/26Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving oxidoreductase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/001Oxidoreductases (1.) acting on the CH-CH group of donors (1.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y103/00Oxidoreductases acting on the CH-CH group of donors (1.3)
    • C12Y103/03Oxidoreductases acting on the CH-CH group of donors (1.3) with oxygen as acceptor (1.3.3)
    • C12Y103/03005Bilirubin oxidase (1.3.3.5)
    • HELECTRICITY
    • H01ELECTRIC ELEMENTS
    • H01MPROCESSES OR MEANS, e.g. BATTERIES, FOR THE DIRECT CONVERSION OF CHEMICAL ENERGY INTO ELECTRICAL ENERGY
    • H01M4/00Electrodes
    • H01M4/86Inert electrodes with catalytic activity, e.g. for fuel cells
    • H01M4/90Selection of catalytic material
    • HELECTRICITY
    • H01ELECTRIC ELEMENTS
    • H01MPROCESSES OR MEANS, e.g. BATTERIES, FOR THE DIRECT CONVERSION OF CHEMICAL ENERGY INTO ELECTRICAL ENERGY
    • H01M8/00Fuel cells; Manufacture thereof
    • H01M8/16Biochemical fuel cells, i.e. cells in which microorganisms function as catalysts
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E60/00Enabling technologies; Technologies with a potential or indirect contribution to GHG emissions mitigation
    • Y02E60/30Hydrogen technology
    • Y02E60/50Fuel cells

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Electrochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Manufacturing & Machinery (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Sustainable Development (AREA)
  • Sustainable Energy (AREA)
  • Materials Engineering (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

The present invention relates to a novel Bacillus pumilus bilirubin oxidase, to the method for preparing same and also to the use thereof in particular for assaying bilirubin and for using enzymatic biofuel cells.

Description

BACILLUS PUMILUS BILIRUBIN OXIDASE
AND APPLICATIONS THEREOF
The present invention relates to a novel bilirubin oxidase, to the method for preparing same and also to the use thereof in particular for assaying bilirubin and for the use of enzymatic biofuel cells using oxygen as fuel.
Bilirubin oxidase or BOD (B.C. 1.3.3.5.) is an enzyme which catalyses the reaction for oxidation of bilirubin to biliverdin:
bilirubin + 02 -* biliverdin + H20 BOD has four sites for binding to copper atoms; these four copper atoms are necessary for correct activity of the enzyme;
it has in fact been shown that the absence of a copper in the CotA protein of Bacillus subtilis (a protein with bilirubin oxidase activity sold, as BOD, by the company Genzyme Diagnostics) is sufficient to reduce the activity of the enzyme (table 3 of the article by Durao et al., in J Biol Inorg Chem.
2008 Feb; 13(2): 183-93).
Bilirubin is a yellow substance formed in the blood by the decomposition of haemoglobin; it is one of the main pigments produced in the liver.
BOD is of interest for various applications, such as the assaying of bilirubin, making it possible, for example, to diagnose excess bilirubin in the blood; it can also be used to prepare enzymatic biofuel cells where it will capture cathode electrons, reducing oxygen to water (see the schematic representation of an enzymatic biofuel cell where the BOD is attached in a redox polymer to the cathode, in Figure LA) or as an oxygen biosensor.
There are many sources of BOD; this enzyme can be produced from microorganisms such as those of the Bacillus genus [Bacillus subtilis, the CotA of which has a bilirubin oxidase activity, see Sakasegawe et al. 2006 Applied and Environmental Microbiology 72, No. 1, 972-975; Bacillus licheniformis (US
4,770,997)], or from mycetes, among which, those of the genus
- 2 -Penicillium [Penicillium janthinellum (patent application EP 0 295 101)], Trachyderma (US 4,600,689), Myrothecium (Tanaka at al. 1982 Agric. Biol. Chem. 46, 2499-2503) or else Schizophyllum, Coprinus, Trametes, Coriolus, Pholiota, Pleurotus, Lenzites or Fomitopsis (US 4,677,062).
This enzyme can also be extracted from plants such as of the type Alfalfa (US 5,624,811), Solanaceae, Musaceae and Liliaceae (EP 0 140 004) or else Compositae, such as the artichoke (EP 0 247 846).
Among these enzymes, the BODs having the most advantageous enzymatic properties, in particular activity and stability, have been selected to be marketed; they are Bacillus subtilis CotA having bilirubin oxidase activity (it is sold as BOD by the company Genzyme Diagnostics and will subsequently be denoted BOD) and Myrothecium verrucaria BOD (sold by the companies Sigma-Aldrich and Amano).
The inventors have now identified a novel BOD produced by Bacillus pumilus which is more active and/or more stable than the commercially available BODs; they have also developed a method for preparing this novel BOD which is simpler and faster than those used to date for the other known BODs.
According to a first subject, the invention relates to the wild-type BOD of Bacillus pumilus; in particular, the bilirubin oxidase, in particular the purified bilirubin oxidase (purity > 95%) according to the invention has a percentage identity of at least 80%, and by order of increasing preference at least 85%, 90%, 95%, 97%, 98% and 99% identity, with respect to the wild-type BOD of Bacillus pumilus of SEQ ID No. 2; it catalyses the reaction for oxidation of bilirubin to biliverdin and is bound to four copper atoms.
The invention also relates to a BOD electrode comprising a conductive material coated with a deposit comprising at least one purified bilirubin oxidase (BOD), characterized in that said BOD has a percentage identity of at least 97% with respect - 2a -to the BUD of Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction for oxidation of bilirubin to biliverdin and in that it is bound to four copper atoms.
The invention also relates to a BUD electrode comprising a conductive material coated with a deposit comprising at least one purified bilirubin oxidase (BUD), characterized in that said BUD is the BUD of Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction for oxidation of bilirubin to biliverdin and in that it is bound to four copper atoms.
The invention also relates to a use of the BUD electrode as defined herein, for measuring a bilirubin concentration in a liquid sample.
The invention also relates to a kit for assaying bilirubin, characterized in that it comprises a BUD electrode of the invention, buffers, standard solutions of bilirubin for producing calibration curves, and a set of instructions.
The invention also relates to a method for assaying bilirubin in solution in a liquid sample, characterized in that it comprises the following steps:
a) measuring the absorbance at X. = 440 nm of said liquid sample before enzymatic reaction;
b) introducing into said liquid sample a BUD electrode as defined herein;
c) measuring the absorbance at ?max = 440 nm of said liquid sample after enzymatic reaction;
d) calculating the difference in absorbances measured in steps a) and c) and comparing with differences in absorbances measured for standard solutions having a known bilirubin content;
e) determining the bilirubin concentration of said liquid sample.
The invention also relates to a use of the BUD electrode as defined herein, for degrading bilirubin present in a sample.
The invention also relates to a use of the BUD electrode as - 2b -defined herein, as a reagent in a composition for an oxidation dyeing of keratin fibres.
The invention also relates to a use of the SOD electrode as defined herein, for treating wood pulp.
The invention also relates to a use of the SOD electrode as defined herein, for discolouring dyes used in industrial media.
The invention also relates to a bilirubin biosensor, characterized in that it is constituted of the electrode as defined herein.
The invention also relates to an oxygen sensor, characterized in that it is constituted of the electrode as defined herein.
The invention also relates to an enzymatic biofuel cell comprising an anode on which an enzyme catalysing an oxidation reaction is immobilized and the electrode as defined herein as cathode.
SEQ ID No. 2 corresponds to the wild-type BCD of the Bacillus pumilus strain SAFRO32. By way of example, the present invention also relates to the wild-type BODs of other Bacillus pumilus strains, for instance the BOD of the ATCC 7061 strain of SEQ ID
No. 6, which has a ______________________________________________
- 3 -percentage identity of 98% with the POD of SEQ ID
No. 2; the preferred BOD according to the invention is the wild-type BOD of the Bacillus pumilus strain SAFRO32 of SEQ ID No. 2.
The identity of a sequence with respect to the sequence of the wild-type BOD of Bacillus pumilus (SEQ ID No. 2) as reference sequence is assessed according to the percentage of amino acid residues which are identical, when the two sequences are aligned, so as to obtain the maximum correspondence between them.
Protein sequences predicted f-om -the systematic sequencing of the Bacillus pumilus genome are described in the UniProt database (accession number A8FAG9 "Outer Spore Coat Protein A" of 13 November 2007 and accession number 54AIB1 "Spore Coat Protein A" of 23 September 2008); it should be underlined chat the information presented in the UniProt database is predictive and putative, it does not result from the experimental isolation and characterization of Bacillus pumilus proteins. In addition, the indications appearing in this database did not make it possible to predict any POD activity for these proteins, since, among the various CotA characterized to date from the organisms E. subtilis, B. licheniformis (Koschorreck, K., et al., Cloning and characterization of a new laccase from Bacillus licheniformis catalysing dimerization of phenolic acids. Appl Microbic] Biotechnol, 2008. 79(2):
p. 217-24; Koschorreck, K., R.D. Schmid, and V.B. Urlacher, Improving the functional expression of a Bacillus licheniformis laccase by random and site-directed mutagenesis. BMC Biotechnol, 2009. 9: p. 12), B. halodurans, and B. HR03, before Lhe BOD of B. pumilus, only that of B. subtilis has been characterized as a BOD, the others being laccases (enzymes having a weak tetrapyrrole-oxidizing activity, unlike BODs).
The percentage identity can be calculated by those skilled in the art using a sequence comparison computer program such as, for example, that of the BLAST series
- 4 -(Altschul et al., NAR, 25, 3389-3402). The BLAST
programs are implemented on the window of comparison consisting of the entire SEQ ID No. 2 indicated as reference sequence.
A peptide having an amino acid sequence having at least X% identity with a reference sequence is defined, in the present invention, as a peptide of which the sequence can include up to 100-X modifications per 100 amino acids of the reference sequence, while retaining the functional properties of said reference peptide, in the case in point its bilirubin oxidation enzymatic activity. For the purpose of the present invention, the term "modification" includes consecutive or dispersed deletions, substitutions or insertions of amino acids in the reference sequence.
The novel ROD according to the invention has improved properties compared with Lhe commercially available BODs derived from Myrothecium verrucaria or Bacillus subtilis.
In particular, the Bacillus pumilus ROD has better enzymatic propertfes (activity, cataiytic efficiency kcat and affinity of the substrate for the enzyme Km) with respect to catalysis of the oxidation of 2,2'-azinobis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS), Lhan the BODs of Myrothecium verrucaria or of Bacillus subtilis.
The enzymatic properties can be determined as described in part 4 of the example which follows.
Sable I below gives the catalyr_ic efficiency kcat, i.e.
the number of molecules of substrate converted to product per molecule of enzyme and per unit time, and the Michaelis constant Km which represents file affinity of the substrate (ABTS) for the BODs of B. subtilis and of B. pumilus.
The enzymatic properties of the BODs of B. pumilus and of B. subtilis can easily be compared since these two enzymes have very similar optimal conditions for use:
pH between 3 and 4 and temperature between 75 and 80 C.
- 5 -BOD kõt (for ABTS) Km B. pumilus 391.3 s-1 31.7 pM
B. subtilis 322 s-1 124 pM
Table I: Enzymatic properties of the BODs of B. pumilus and of B. subtilis The enzymatic properties described for the M.
verrucaria BOD by Kataoka et al. (2005, Protein Expression and Purification, 41, 77-83) at pH 6.5 are a kcat of 115 s-1 and a Km of 250 pM. Moreover, Sakurai at al. (2008, Biochemical and Biophysical Research communication, 371, 416-419) have determined the specific activity of the M. verrucaria BOD for ABTS, which is 106 U/mg, the specific activity of the BOD
according to the invention itself being 375 U/mq.
In addition, the B. pumilus BOD has very good heat stabiliLy and good bilirubin oxidation enzymatic properties.
The present invention also relates to a nucleic acid molecule encoding the BOD according to the invention;
it is preferably a nucleic acid molecule having a sequence chosen from SEQ ID. No. 1 encoding the wild-type BOD of Bacillus pumilus SARF-032, SEQ ID No. 5 encoding the wild-type BOD of Bacillus pumilus ATCC 7061 or else SEQ ID No. 7 which corresponds to the sequence of the wild-type BOD of Bacillus pumilus SARF-032 which has been modified in order to improve the expression thereof by the yeast Pichia pastoris.
The nucleic acid molecule encoding the BOD according to the invenLion can be cloned into an expression vector, such as a plasmid, and then used to transform a suitable host, such as a bacterium, a yeast or else a cell culture.
The term "expression vector" is intended to mean a vector which has a region allowing the insertion of a coding nucleotide sequence between the signals essential for its expression, in particular a promoter (constitutive or inducible), a ribosome-binding site, a transcription stop signal and, optionally, a selectable marker, such as a gene for resistance to an antibiotic.
- 6 -The present invention also relates to an expression vector comprising said nucleic acid molecule and to a host cell transformed with said expression vector and expressing a BOD according to the invention.
The introducLion of the expression vector into the host cell can be carried out by any method known to those skilled in the art, in particular by a modification of the membrane permeability of the host cell, for example in the presence of calcium ions, or by electroporation.
After culture of the host cells transformed so as to express the HOD according to the invention, said cells can be recovered by centrifugation, and lysed in order to release the enzymes, including said BOD according to the invention.
If Escherichia coil is the host microorganism, the plasmids which can be used are in particular the plasmids pBluescript, pUC18, pET, pGEX, pGS, pMAL-c2, or the like.
According to a preferred method for preparing the BOD
according to the invention, the BOD is expressed by an E. coil bacterium transformed with a pET2la expression vector encoding an enzyme joined to a 6HIS tag in the C-terminal position.
This method, illustrated in the experimental section which follows (section 3), is advantageous owing to its rapidity and its simplicity; this is because the induction of the Bacillus pumilus BOD expression in the F. coil bacterium takes place in 4 to 24 hours, whereas the production of BOD derived from Myrothecium verrucaria requires induction periods that can reach 5 days (Kataoka et a/. Biochemistry. 2005 May 10;
44(18):7004-12; Kataoka et al., Biochem Biophys Res Commun. 2008 Jul 4; 371(3):416-9; Kataoka et al. K.
Protein Expr Purif. 2005 May; 41(1):77-83).
In addition, the 6HIS tag makes it possible to purify the Bacillus pumilus BOD by affinity chromatography on a nickel resin in a single step so as to obtain a pure enzyme; the small size of the tag (6 amino acids) makes it possible to do away with eliminating it since it
-7 -does not significantly disturb the activity of the enzyme. By way of comparison, the purification of the Nyrothecium verrucaria and B. subtilis BODs which is described, respectively, in the articles by Kataoka at al. (see above) and Durao et a/. (J Biol Inorg Chem.
2008 Feb; 13(2):183-93) require several chromatography steps.
The rapidity and the simplicity of this method therefore represent considerable advantages compared with the methods for preparing enzymes that are currently commercially available.
Those skilled in the art will select the host cell according to the expression vector used.
Preferably, when the pET2la expression vector is used, a host cell expressing the T7 RNA polymerase, such as the E. coil strains BL2.1 DE3, BLII-SI, EL21 pLys, Novablue(DE3) or BI,21 Star, will be selected.
Preferably, the Bacillus pumilus BOD according to the invention is produced in an Escherichia coli BL21 Star strain; the nucleic acid molecule which encodes it is obtained by PCR with the primers of SEQ ID Nos. 3 and 4 and cloned into the pET2la vector so as to give the transformed vector oFD1. The BOO thus produced is then purified, after lysis of the bacteria, by affinity chromatography.
According to another advantageous variant of the invention, the BOO according to the invention is produced by the Pichia pastoris yeast.
In order to allow the overproduction and the secretion of the BUD into the culfure medium of the Pichia pastoris yeast, the gene encoding the BCD, in particular chosen from the sequences SEQ ID No. 1, 3 or 7, preferably SEQ ID No. 7, is introduced by homologous recombination into the yeast genome, at the level of the A0X1 gene. For this, the pFD2 plasmid, once linearized by digestion with the pmeI enzyme, is intro-duced into the yeast by electroporation, and the positive clones are selected on YPD + agar medium containing zeocin at 100 pg/ml. A preculture of 200 ml
- 8 -of YPD medium supplemented with zeocin (100 ug/ml) is inoculated using an isolated clone on a Petri dish.
After shaking at 220 rpm overnight at 30 C, this pre-culture is then centrifuged for 10 min at 4000 rpm and the pellet is taken up in 200 ml of sterile water in order to remove any presence of glucose. After a second centrifugation, a 2L culture in MMH medium containing 1mM of CuSO4 in a 5L Erlenmeyer flask is then inoculated with this pellet. The yeasts are incubated at 25 C with shaking (220 rpm) for 2 hours, before the addition of 0.5% of methanol in order to initiate the induction.
This induction step will be repeated for 5 days in order to obtain the maximum amount of enzymes.
In order to implement this method, the following material can be used, without being limiting in nature:
- vector for expression in Pichia pastoris (pFD2):
pPICZa plasmid containing the DNA sequence encoding the Bacillus pumilus BOD, preferably optimized (SEQ ID
No. 7), in frame with the Saccharomyces cerevisiae a-factor secretion factor and containing the methanol-inducible A0X1 promoter;
- Pichia pastoris yeast strain GS115 used for producing biiirubin oxidase after integration of the cassette derived from the PFD2 vector containing the A0X1 promoter, the a-factor signal peptide and the DNA
sequence encoding the Bacillus pumilus BOD;
- culture media:
YPD rich medium (for yeast):
1% yeast extract 2% bactopeptone 2% glucose pH not adjusted, autoclaved for 20 min at 120 C
MPH minimum medium (for yeast):
1.34% yeast nitrogen base 1% Casamino acid 0.4% histidine 4x10-5% biotin pH not adjusted, autoclaved for 20 min at 120 C
- 9 -LB rich medium (for bacterium):
g/1 tryptone 5 g/1 yeast extract 5 g/1 NaCl 5 Distilled H20 qs 11 pH not adjusted, autoclaved for 20 min at 120 C.
The present invention also relates to a method for preparing a BOD according to the invention, comprising the steps of:
a) preparing host cells expressing the BOD according to
10 the invention;
b) culturing the host cells prepared in step a);
c) lysing the host cells;
d) treating the lysate obtained in step c) by affinity chromatography;
e) recovering said purified BOD.
According to one preferred embodiment, the method according to the invention is such that:
the Escherichia coil BL21 Star strain transformed with the pFD1 vector is prepared in step a);
the culture carried out in step b) is a liquid-phase culture, with shaking, under anaerobic conditions for a period of 4 to 30 h, preferably 24 h, at a temperature between 18 and 37 C, preferably 20 C, during which the BOD expression is induced by adding isopropyl-3-D-1-thiogalactopyranoside (IPTG).
When the method is implemented according to these preferred conditions, it allows the production of the BOD with a short induction time, of about 24 hours; the purification of the BOD
is carried out in a single affinity chromatography step and the BOD thus produced indeed comprises the four copper atoms necessary for its activity (see part 5 of the example).
It is also possible to produce a BOD in the presence of denaturing agents such as urea, guanidinium chloride, SDS, Triton', etc., the BOD thus produced will then be devoid of copper and may be activated by adding copper ions.
The invention also relates to the use of the Bacillus pumilus BOD according to the invention for assaying bilirubin in solution, i.e. measuring the bilirubin concentration in a sample, in particular a biological sample.
The term "biological sample" is intended to mean a biological fluid, such as blood, serum, lymph, bile, urine, cerebrospinal fluid, sweat, etc.
The presence of hiliruhin in the organism is normal, it comes from the degradation of haemoglobin and approximately 200 to 230 mg of bilirubin are formed per day in a healthy adult. In an individual in good health, the bilirubin is taken up by the liver and then degraded; its concentration should not therefore exceed certain thresholds, and the assaying of bilirubin is useful for detecting pathological conditions such as:
- cases of substantial haemolysls: congenital or acquired haemolytic anaemia, drug-related, toxic or infectious haemolysis, transfusion accidents, etc.;
- insufficient hepatic uptakes or conjugations:
Gilbert disease, Criggler-Najjar disease, the taking of rifampicin (antitubercular antibiotic);
- hepatic and biliary conditions: The various types of hepatitis (viral, toxic, drug-related), the various types of cirrhosis, rare metabolic abnormalities (Rotor's disease, Dubin-Johnson disease);
- biliary conditions;
- biliary lithiasis;
- pancreatitis;
- pancreatic or bile duct cancer.
The present invention thus relates to the use of the BOD according to the present invention for measuring the bilirubin concentration in a liquid sample, in particular a biological sample.
According to a first variant, the principle of the assaying of bilirubin with BOD is based on measuring the change in colour of the sample caused by the degradation of the bilirubin.
Bilirubin exhibits a light absorption peak (X.) at 440 nm; when it is enzymatically degraded by a BOD, the
- 11 -absorbance at 4,3õ of the sample in which it is present decreases; this decrease makes it possible to quantify the bilirubin initially present in the sample by comparison with the decrease in absorbance at 440 nm of calibration solutions containing known bilirubin contents measured under the same experimental conditions.
The present invention also relates to a kit for assaying bilirubin in solution, characterized in that it comprises a BOD according to the invention.
Typically, the assaying kit also contains the reagents necessary for carrying out the bilirubin assay test, in particular:
- the buffers;
- the standard solutions of bilirubin for producing calibration curves, and - the set of instructions necessary for carrying out the assay.
The present invention also relates to a method for assaying the bilirubin in solution in a liquid sample, characterized in that it comprises the following steps:
a) measuring the absorbance at kina. = 440 nm of said liquid sample before enzymatic reaction;
b) introducing a BOD according to the invention into said liquid sample;
c) measuring the absorbance at A = 440 nm of said liquid sample after enzymatic reaction;
d) calculating the difference in absorbances measured in steps a) and c) and comparing this difference with differences in absorbances measured for standard solutions having a known bilirubin content;
e) determining the initial concentration of bilirubin of said liquid sample.
According to another variant, the assaying of the bilirubin in a liquid sample is carried out by means of an electrochemical method which uses an electrode including the BOD according to the invention.
Thus, the present invention also relates to BOD
- 12 -electrodes comprising a conductive material, such as a conductive metal, in particular platinum, copper, silver, aluminium, gold or steel, or carbon, for instance vitreous carbon, carbon fibres, fibres of carbon nanotubes or alternatively which are made of diamond, etc., said conductive material being coated with a deposit comprising at least one BOD according to the invention, it also being possible for said deposit to comprise a redox polymer in order to improve the electrical conduction between the enzyme and the electrode and also the stability of the system.
The redox polymer can, for example, be chosen from ferrocene-based, osmium-based and ruthenium-based polymers and conducting polymers such as, for example, polypyrrole and polyanaline.
The methods for immobilizing the BOD on said conductive material can be chosen from the conventional methods available to those skilled in the art, which comprise, in particular, embedding of the BOD in a polymer matrix, adsorption of the BOD at the surface of the polymer membrane, attachment by covalent bonding, electrodeposition (Gao et al., Chem. Int. ED. 2002, 41, No. 5, 810-813) or else the technique described in United States patent application US 2009/0053582.
According to one embodiment variant, the BOD electrode on which the BOD is immobilized is also coated with a membrane which prevents the detachment of said enzyme from the electrode. According to the applications envisaged, said membrane can be constituted of nafioh, of cellulose or of any other biocompatible material, i.e. material compatible with a physiological environment.
The present invention thus also relates to a bilirubin biosensor constituted of a BOD electrode according to the invention. Generally, a biosensor consists of an electrode on which a bioreceptor capable of recognizing a biological target is immobilized; the binding of the biological target to the bioreceptor results in physicochemical modifications of the membrane and the
- 13 -producLion of an electrical signal by an electro-chemical (amperometric, potentiometric, conductometric, etc.) transducer joined to the electrode. In the present case, the biosensor is a BOD according to the invention and the biological target is bilirubin.
The present invention also relates to a method for assaying bilirubin in solution in a liquid sample with a bilirubin bicsensor according to the invention.
According to one variant of use of the bilirubin biosensor, the latter is implanted under the skin of an individual and makes it possible to record the bilirubin concentration in the blood of said individual.
The present invention also relates to an oxygen sensor constituted of an electrode according to the invention.
The BOD electrode according to the invention can also be advantageously used as a cathode in an enzymatic biofuel cell; Figure IA represents schematically the operating principle for an enzymatic biofuel cell. The enzymatic biofuel cells according to the invention are devices comprising a BOD electrode as a cathode and an anode where a substrate oxidation reaction takes place (catalysed by the "enzyme X"); by way of illustration, the substrate may be glucose and the "enzyme X" glucose oxidase; such a cell is of particular interest when the biofuel cell is implanted in an individual for a medical application. The substrate can also be chosen, for example, from nitrites, nitrates, sulphides, urates, ascorbates, glutamates, pyruvates, lactates, cellulose, etc., if an application in depollution is envisaged; the choice of the enzyme will then be made according to the substrate to be degraded; by way of example, the following enzymes can be used, the type of substrate that they can degrade is mentioned between parentheses: glucose oxidase (glucose or any sugars that are oxidized by this enzyme), lactate oxidase (lactate), pyruvate oxidase (pyruvate), alcohol oxidase (alcohol), cholesterol oxidase (cholesterol), glutamate oxidase (glitamate), pyranose oxidase (pyranose), - lE
choline oxidase (choline), cellobiose dehydrogenase (ceiloboise), glucose dehydrogenase (glucose or any sugars that are oxidized by this enzyme), pyranose dehydrogenase (pyranose), fructose dehydrogenase (fructose), aldehyde oxidase (aldehyde), gluconolactone oxidase (gluconolactone), alcohol dehydrogenase (alcohol), ascorbate oxidase (oxygen or ascorbate) or else sulphide dioxygenase (sulphide). The concomitant oxidation and reduction process at the electrodes of the biofuel cell produces an electric current.
Figure 1B illustrates more specifically a glucose-based enzymatic igiofuel cell; such an enzymatic biotuel cell consists of two electrodes modified by the immobilization of enzymes. A glucose oxidase (G0x) is attached to the anode (1) by means of a conducting polymer "1" and a bilirubin oxidase (BOD) is attached to the cathode (2) by means of a conducting polymer "//". In operating mode, at the anode, the electrons are transferred from the glucose present in the physic-logical fluid to the G0x, then from the GOx to the conducting polymer "/" and from the conducting polymer "I" to the anode. At the cathode, the electrons are transferred from the cathode to the conducting polymer "II", then to the BOD and, finally, from the BOD to the oxygen present in the physiological fluid.
It should be noted that a biofuel cell can also optionally operate by modifying the electrodes with their respective enzymes and adding soluble mediators, such as ferrocenemeLhanol for Lhe anode and potassium ferricyanide for the cathode, and adding, as appropriate, a membrane separating the anode and the cathode.
According to another aspect, the present invention relates to the use of a BOD according to the invention for degrading the bilirubin present in a sample, in particular a biological sample. This is because the presence of bilirubin in a sample is capable of distorting the detection of other substances (such as blood glucose or blood cholesterol) in particular when these other substances are detected by a colorimetric method.
Generally, the BODs according to the invention have many industrial applications, in particular in the textile and paper industries and in the food sector, in order, for example, to improve the stability and/or the quality of foods, such as beverages, or else foods containing vegetable oils, by deoxygenation.
More specifically, the BODs can be used for TO applications related Lo depollution; by way of example, mention may be made of the discoloration or the detoxification of wastewater and the degradation of xenobiotics; as organic synthesis reactants; for the preparation of antimicrobial compositions; for the production of articles made of wood and of cartons which have been detoxified or else for the production of detergent (Morozova et al. Biochemistry (Mosc.) 2007 Oct; 72(10):1136-50) and for the discoloration of dyes used in industrial media.
The BOD according to the invention can also be used for dimerizing phenolic acid (Koschorreck, K., et al. 2008.
Appl Microbial Diotechnol (2008) 79:217-224) and thus is of interest in the synthesis of pigments and dyes used in textile and food applications (R. Mustafa et al. Food Research International. Volume 38, Issues 8-9, October-November 2005, pages 995-1000); this dimerization reaction can also be used for the preparation of antioxidant compounds, for instance ferulic acid dimers (Garcia-Conesa MT, et al. Redox Rep. 1997 Oct-Dec; 3(5-6):319-23).
The 30D according to the invention can also be used as a reactant in a composition for the oxidation dyeing of keratin fibres, such as a hair-dyeing composition, comprising, in a medium suitable for dyeing, at least one oxidation base, a DOD according to the invention and, optionally, a donor for said BOD (such as a substrate, for instance biliruhin). The various ingredients, other than the BOD, that can be used in said composition are described in international application WO 99/15138; by way of example, the oxidation base(s) can be chosen from para-phenyiene-diamines, double bases, para-aminophenols, ortho-aminophenols and heterocyclic oxidation bases.
The BOD according to the invention can advantageously be used for treating wood pulp for its action on lignin degradation and/or for producing a paper which has a better wet strength (see international application WO 00/68500), In addition to the above arrangements, the Invention also comprises other arrangements which will emerge from the description that follows, which refer to exemplary embodiments of the present invention, and also to the appended figures in which:
Figures Figure 1A represents schematically the operating principle for an enzymatic biofuel cell; Figure 1B
represents a glucose-based enzymatic biofuel cell.
Figure 2 represents the plasmid map of the pFD1 vector.
Figure 3 is a graph illustrating the specific activity, in U/mg, of the Bacillus pumilus BOD as a function of the ABTS concentration at 37 C.
Figure 4 is a graphic representation of the Michaelis-Menten equation (ks, in s-1 as a function of the unconjugated bilirubin concentration) for the Bacillus pumilus BOD at 37 C.
Figure 5 represents the catalytic activity for oxidation of conjugated bilirubin by the Bacillus pumilus BOD at 37 C in a 50 mM citrate/phosphate buffer, pH 4.8.
Figure 6 represents the catalytic activity for oxidation of syringaldazine (SGZ) by the Bacillus pumilus BOD at 37 C in a 50 mM citrate/phosphate buffer, pH 6.2.
Figure 7 represents the catalytic activity for oxidation of DMP by the Bacillus pumilus BOD aL 37 C in a 50 mV citrate/phosphate buffer, pH 6.8.
Figure 8 represents the relative activity of the Bacillus pumilus BOD with respect to various substrates as a function of the pH.
Figures RA and 9B are graphs representing the stability as a function of pH of the Bacillus pumilus BOD on ARTS
oxidation at 4 C.
Figure 10 is a histogram representing ARTS oxidation as relaLive activity by the Bacillus pumilus BOD as a function of temperature.
Figures 11A and 11B represent graphically the stability (expressed as specific activity and as relative activity on ABTS oxidation) of the Bacillus pumilus BOB
as a function cf enzyme incubation time at 80 C.
Figures 12A and 12B represent graphically the activity (expressed as specific activity and as relative activity on ARTS oxidation) of the Bacillus pumilus BOD
as a function of urea concentration at 25 C or 37 C in a 100 mM citrate/phosphate buffer, pH 3.
Figure 13 represents the relative activity of the oxidation of SGZ by the Bacillus pumilus ROD as a function of NaC1 concentration.
Figure 14 represents the discoloration of RBBR at BO mg.1-1 by the Bacillus pumilus BOD a 37 C in a 50 mM
potassium phosphate buffer, pH 6, in the presence or absence of 10 pM APTS.
EXAMPLE
1. Materials 1.1 Escherichia coil bacterial strains D1151a: supE44, A/ac'S169, (c1)80 lacZDM15), hsdR17, recAl, gyrA96, thi-1, relAl (Hanahan, 1983).
This strain is used to amplify plasmids during the steps for constructing the protein expression vectors.
BL21 Star: F-ompT hsdSB(rB-, mB-) gal dcm rne131 (DE3) (Invitrogen).
This strain is used to produce the Bacillus pumilus BOD
In Erlenmeyer flasks.
This strain is then transformed with the pFD1 plasmid which contains the DNA sequence encoding the Bacillus pumilus BOD under the control of the T7 promoter in the pET2la vector.

/.2 Vector pFD1: pET21a plasmid containing the nucleic acid sequence SEQ ID No. 1 encoding the Bacillus pumilus BOD
cloned in-frame wiLh the 6xHis tag in the C-terminal position.
The plasmid map of the pFD1 vector is represented in Figure 2.
1.3 Culture medium LB rich medium:
10 g/1 tryptone 5 g/1 yeast ex7ract 5 g/1 NaC1 Distilled H20 qs 1L
pH not adjusted, autoclaved for 50 min aL 1 bar.
2. Genetic engineering techniques 2.1 Transformation of supercompetent bacteria Supercompetent DH5, bacteria are prepared using the SEM
method (Simple and Efficient Method) according to the protocol described by Inoue et al. (Inoue et a/. 1990, Gene 96:23-28).
2.2 DNA preparation A plasmid DNA purification kit (Quiagen) is used for the DNA preparations in small and large amounts.
2.3 Double-stranded DNA sequencing The double-stranded DNA is sequenced. The sequencing reactions are carried out with the BigDye Terminator v1.1 or v3.1 sequencing kit. The reagent contains the 4 ddNTPs with various fluorescent labels (BigDye Terminators), the AmpliTaq DNA polymerase, and all the other components necessary for the reaction. The extension products should be purified before being passed through an ABI 3130x1 sequencer, in order to remove the unincorporated labels, the salts and the other contaminants.
2.4 Construction of the BOD expression vector The PCR is carried out with the Phusion HF DNA
polymerase on Lhe genomic DNA of the Bacillus pumilus bacterium, strain SAFR-032. The two oligodeoxyribo-nucleotides, complementary to the 3' and 5' ends of the DNA sequence of the gene encoding the Bacillus pumilus BOD (SEQ -D No. 3 and 4) will be used as primers for the DNA synthesis.
The amplified product and also the pET2la plasmid are then treated with the two restriction enzymes Bam111 and Xho1, the recognition sequences of which have been introduced into the sense oligonucleotide for BamH1 and the antisense oligonucleotide for Xhol, respectively denoted SEQ ID No. 3 and 4. The digestion products are gel-purified with the "Nucleospin()" kit (NucleoSpine Extract II, Clontech Laboratories, Inc.) and the BOD
gene is then ligated into the plasmid by coincubation with T4 DNA ligase at 37 C overnight. The newly formed plasmids are then selected and amplified by transformation of DH5a bacteria on a plate containing ampicillin.
Primer name Sequence SEQ ID No.
B.pumilus S BamH1 CA?GGATCCATGAACCTAGAAAAATTTCTTGACGAG 3 1B.pumilus AS Xhol TACCTCGAGAATAATATCCATCGGCCTCATCATGIC
Table II: List of primers used 3. Production, purification and characterization of the Bacillus pumilus bilirubin oxidase enzyme 3./ Production of wild-type BOD enzymes The HOD enzyme is produced in the E. ccli BL21 star strain by the pET21a recombinant plasmid carrying Lhe sequence encoding wild-type BOD. A 50 ml preculture of LB medium supplemented with ampicillin (150 mg/1) (LBA) and 0.25 mM CuSO4 is inoculated with a clone isolated on an Li agar plate supplemented with ampicillin (100 mg/1), and left shaking, at 220 rpm, overnight at 37cC. Two litres of LBA medium contaThing 0.25 mM CuSO4, in a 5L Erlenmeyer flask, are then inoculated at 1/100th. The latter is incubated at 37 C with shaking (220 rpm) until an OD60onm of between 0.8 and 1 OD600/m1 is obtained. The culture is then induced with 200 uM of IPTG and left shaking (180-220 rpm) at 25 C for 4 hours. The cells are then transferred into a sterile 2L
Schott bottle containing a magnetic bar, so as to continue, for 20 hours, the culture and the protein induction with shaking under anaerobic conditions in order to increase the incorporation of copper into the bacteria. The cells harvested by centrifugation (4000 g, 4 C) are washed in water and stored at -20 C.
It is important to emphasize that the induction of the expression of this SOD in the E. coil bacterium is carried out in only 24 hours; this represents a considerable advantage compared with the protocols for induction of the commercial enzymes currently available. This is because the production of BODs derived from Myrothecium verrucaria can require induction periods of up to 5 days.
3.2 Purification of wild-type BOD enzymes 3.2.1 Rupture of cells and treatment with DNase I
The cell pellet, derived from two litres of culture, is taken up in 40 ml of 50 mM sodium phosphate buffer containing 500 mM NaC1 and 20 mM imidazole, pH 7.6, and sonicated ]0 times at a sonication power of 40 W for 3 minutes by cycle of a second of ultrasound and a second of interruption. The sample obtained, called crude extracL, is supplemented with a final concentration of 2 mM of MgCl2 and treated for 30 minutes at ambient temperature with DNase I (1 TJ/m1 of crude extract). The insoluble cell debris is then removed from the crude extract by centrifugation for 60 minutes at 20 000 g.
3.2.2 Affinity chromatography on nickel column The sonication supernatant filtered through a 0.22 pm filter and diluted to an ODno. of 10 is injected onto a HisPrep FR 16/10 affinity column (GC Healthcare), coupled to the AKTA purifier system (GC Healthcare), equilhbrated in a 50 mM sodium phosphate buffer containing 500 mM NaCl and 20 mM imidazole, pH 7.6. The elution is carried out with a gradient of 5% to 30% of a 50 mM sodium .phosphate buffer containing 500 mM NaCi and 1M imidazole, pH 1.6, at a flow rate of 1 mi/min.
The fractions containing the SOD protein are idenlified by means of an ABTS activity test and are combined, concentrated and desalified with a 50 mM sodium phosphate buffer, pH 7.6, by centrifugation on an Amicon YM20 membrane. At this stage, the BOD protein is pure and can be stored at -20 C in soluble form.
Here again, by comparing with the commercially available BOB purification methods, the clear advantage resulting from the use of this protein can be emphasized. This is because a single purification step is necessary in order to obtain a pure enzyme, as opposed to the succession of chromatographies (size exclusion, anion or cation exchange, hydrophobic, etc.) essential for the commercial BODs.
3.2.3 CharacLerization of wild-type BOO enzymes 3.2.3.1 Molecular weight determination The analysis of the weight of the whole protein was carried out on the LCQ Deca XP mass spectrometer coupled upstream of a nano liquid chromatography apparatus fitted with a C4 desalting and pre-concentrating column (p-PrecolumnTM Cartridge; Acclaim PepMap 300; internal 0 300 pm x 5m; LC Packings Dionex) and of a C4 analytical column (C4 PepMap 300; internal 0 75 pm x 5cm; LC Packings Dionex).
A weight of 61005.91 Da was obtained for the BUD, i.e.
a difference of 130.4 Da compared with the theoretical weight of the protein; the theoretical weight is calculated for the protein truncated at the N-terminal methionine, a difference of only 0.80 Da is found, which demonstrates cleavage of this amino-acid in the bacterium during the protein maturation process.
3.2.3.2 Concentration measurement The enzyme concentration of a solution is calculated according to the Bradford technique using BSA as standard (Bradford, anal. Biochimie 72:248, 1976).
3.2.3.3 Enzymatic assay The enzymatic assays are carried out using a Varian spectrophotometer in a 0.1M citrate/phosphate buffer at 37 C in a volume of 3 ml, with the oxidation of ABTS
being followed at 420 nm as a function of time (E423im -36 mM-1 cm-I). The specific activity of the enzyme is expressed in pmol of ABTS oxidized per minute and per mg of protein. The standard ARTS concentration used is mM. The enzyme is diluted so as to measure a slope between 0.05 and 0.3 OD170,,/min.
4. Techniques for studying the enzymatic properties of the wild-type Bacillus pumilus BOD enzyme 4.1 Determination of the kinetic (kcat) and Michaelis (1{11) constants in the stationary state 4.1.1 The substrate is 2,2'-azinobis(3-ethylbenzozhiazoline-6-sulphonic acid) (ABTS) The experiments are carried out at 37 C on a Varian spectrophotometer in a 0.1 M citrate/phosphate buffer, pH 3. The ABTS concentration varies in the test from 0 to 5 mM. The test is triggered by adding enzyme. The experimental points are analysed by nonlinear regression according to the Michaelis-Menten model using the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model: ks, kcaL * [S]/(Km + [S]) Results:
kcat = 391.3 s-1 and Km = 31.7 pM.
Figure 3 illustrates graphically the specific activity, in U/mg, of the Bacillus pumilus BOD as a function of ABTS concentration.
By way of comparison, the homologous CotA protein of Bacillus subtilis exhibits, with respect to ABTS under the same optimal activity conditions, a kõt of 322 s-1 for a Km of 124 pM (Martins et al., 2008. J Bid l Inorg Chem, 13:183-193).
4.1.2 The substrate is unconjugated bilirubin The experiments are carried out a71 37 C in a Varian spectrophotometer in a 50 mM sodium phosphate buffer, pH 7. The bilirubin concentration varies in the test from 0 to 60 pM. The test, triggered by the addition of enzyme, consists in following the oxidation of the bilirubin at 450 nm by colorimetric change ( ,E450nm 32 mM-1 cm-1). The experimental points are analysed by nonlinear regression according to the Michaelis-Menten model using the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model: kss = kcat * [ S] / (Km + [S]) Results:
kõt = 70 s-1 and Km = 22 pM.
Figure 4 is the graphic representation of the Michaelis-Menten equation (k,, in s-1 as a function of unconjugated bilirubin concentration) for the Bacillus pumilus SOD.
4.1.3 The substrate is conjugated bilirubin The experiments are carried out at 37 C on a Varian spectrophotometer in a 30 mM sodium phosphate buffer, pH 4.8. The bilirubin concentration varies in the test from 0 to 150 pM. The test, triggered by adding enzyme, consists in following the oxidation of the conjugated bilirubin at 440 nm by colorimetric change (644onm =
25 mMT1 cm-1). The experimental points are analysed by nonlinear regression according to the Michaelis-Menten model using the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model: kss = kcat * [S]/(Km + [S]) Results:
kcai = 66.8 s-1 and Km = 35.1 pM.
Figure 5 represents the catalytic activity for oxidation of the con4ugated bilirubin by the Bacillus pumilus HOD at 37 C in a 50 mM citrate/phosphate buffer, pH 4.8.
4.1.4 The substrate is syringaldazine (SGZ) The experiments are carried out at 37 C on a Varian spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2. The SCZ concentration, diluted in methanol, varies in the test from 0 to 300 pM. The Lest, triggered by adding the enzyme, consists in following the oxidation of the SGZ at 530 nm by coloroimetric change (Esmm = 64 mM-1 cm-1). The experimental points are analysed by nonlinear regression according to the Michaelis-Menten model with competitive inhibition, using the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model with competitive inhibition:
k,, = kcat * [S]/(Km + [S] [S32/K1) Results:
kcat - 116.1; Km = 45.6 pM and Xi = 82.9 pM.
Figure 6 represents the catalytic activity for oxidation of syringaldazine by the Bacillus pumilus BOD
at 37 C in a 50 mM citrate/phosphate buffer, pH 6.2.
4.1.5 The substrate is 2,6-dimethoxyphenol (DMP) The experiments arc carried out at 37 C on a Varian spectrophotometer in a 50 mM sodium phosphate buffer, pH 6.8. The 2,6-dimethoxyphenol concentration varies in the test from 0 to 4000 pM. The test, triggered by adding the enzyme, consists in following the oxidation of the DMP at 468 nm by coioroimetric change (64681m =
14.8 mM-1- mri-1). The experimental points are analysed by nonlinear regression according to the Michaelis-Menten model using the Sigma-plot 6.0 software according to the equation below:
Michaelis-Menten model: k, kcat * [S]/(Km + [S]) Results:
k, = 57.3 s-1 and Km = 822 pM.
Figure 7 represents the catalytic activity for oxidation of DMP by the Bacillus pumilus BOD at 37 C in a 50 mM citrate/phosphate buffer, pH 6.8.
4.2 Study as a function of pH
4.2.1 ActiviLy as a function of pH
4.2.1.1 ABTS
The study of the variation in the reaction rate constant as a function of pH is carried out on a pH
range of from 3 to 1 in a 0.1 M citrate/phosphate buffer, using 1 mM ABTS as substrate. The experimenLs are carried out at 37 C using a Varian spectrophotometer. The activity is followed by oxidation of the ABTS resulting in a colorimetric change measured at 420 nm. The test is triggered by adding enzyme.
The results of the oxidation of ABTS, as a function of pH, by the Bacillus pumilus BOD are represented as relative activity on the graph of Figure 8.

4.2.1.2 Unconjugated bilirubin The study of the variation in the reaction rate constant as a function of 0H is carried out on a pH
range of from 7 to 8.5 in a 0.2 M tris-HC1 buffer, using 30 pM unconjugated bilirubin as substrate. The experiments are carried out at 37 C using a Varian spectrophotometer. The activity is followed by oxidation of the bilirubin resulting in a colorimetric change measured at 450 nm ( ,E450nrn= 32 mM-1 cm-1). The test is triggered by adding enzyme.
The results of the oxidation of unconjugated bilirubin, as a function of pH, by the Bacillus pumilus BOO are represented as relative activity on the graph of Figure 8.
4.2.1.3 Conjugated bilirubin The study of the variation ir the reaction rate constant as a function of pH is carried out on a pH
range of from 3 to 7 in a 0.1 M citrate/phosphate buffer, using 100 pM conjugated bilirubin as substrate.
The experiments are carried out at 37 C using a Varian spectrophotometer. The activity is followed by oxidation of the conjugated bilirubin resulting in a colorimetric change measured at 440 nm. The test is triggered by adding enzyme.
The results of the oxidation of conjugated bilirubin, as a function of pH, by the Bacillus pumilus BOO are represented as relaLive activity on the graph of Figure 8.
4.2.1.4 Syringaldazine (SGZ) The study of the variation in the reaction rate constant as a function of pH is carried out on a pH
range of from 3 to 7.5 in a 0.1 M citrate/phosphate buffer, using 22 pM syringaldazine as substrate. The experiments are carried out at 37 C using a Varian spectrophotometer. The activity is followed by oxidation of the syringaldazine resulting in a colorimeLric change measured at 530 nm. The test is triggered by adding enzyme.
The results of the oxidation of syringaldazine, as a function of pH, by the Bacillus pumilus BOD are represented as relative activity on the graph of Figure 8.
4.2.1.5 2,6-Dimethoxyphenol (DMP) The study of the variation in the reaction rate constant as a function of pH is carried out on a pH
range of from 3 to 7.5 in a 0.1 M citrate/phosphate buffer, using 1 rriM DMP as substrate. The experiments are carried out at 37 C using a Varian spectrophotometer. The activity is followed by oxidation of the DMP resulting in a calorimetric change measured at 468 nm. The test is triggered by adding enzyme.
The results of the oxidation of DMP, as a function of pH, by the Bacillus pumilus BOD are represented as relative activity on the graph of Figure 8.
4.2.2 Stability as a function of pH
The stability as a function of pH, of the wild-type BOD, is determined by dilution of the enzyme, purified to homogeneity, in a mixed buffer ranging from pH 3 to 9 at ambient temperature. This mixed buffer is composed of 120 mM Tris, 30 mM imidazole and 30 mM acetic acid, the ionic strength of which is adjusted to 190 mM with NaCl. Various samples are taken as a function of time.
The residual activity is measured at 4 C using a Varian spectrophotometer, in a 0.1 M citrate/phosphate buffer, pH 3, containing 1 mM ABTS.
The results of specific activity and of relative activity of the oxidation of ABTS as a function of pH
at 4 C are represented in the graphs of Figures aA and 9B.
4.3 Study as a function of the temperature 4.3.1 Activity as a function of temperature The study of the variation in the reaction rate constant as a function of temperature is carried out in a 0.1 M citrate/phosphate buffer, pH 3, in the presence of 1 mM of ABTS.
The temperature ranges from 10 to 85 C. The activity is followed on a temperature-regulated Varian Cary UV

Biomelt spectrophotometer. The test is triggered by adding enzyme.
Figure 10 is a histogram representing the relative activity of the Bacillus pumilus BOB as a function of temperature on ABTS oxidation.
4.3.2 Stability of the enzyme as a function of temperature The enzyme is preincubated at a concentration of mg/ml in a dry bath at 80 C. 2 pl samples are taken 10 and the enzyme is diluted in a 50 mM sodium phosphate buffer, pH 7.6, so as to adjust the enzyme concentration for the activity test. The residual activity of the enzyme incubated at 80 C is determined using a Varian spectrophotometer, in a 0.1 M
citrate/phosphate buffer, pH 3, at 37 C, in the presence of 1 mM of ABTS. The test is triggered by adding enzyme.
Figures 11A and 11B represent graphically the stability (expressed as specific activity and as relative activity on ABTS oxidation) of the Bacillus pumilus BOD
as a function of enzyme incubation time at 80 C.
4.4 Study of the activity as a function of the presence of urea The protocol described above in point 4.1.1 was reproduced in the presence of a urea concentration ranging between 0 and 6 M.
Figures 12A and 123 represent graphically the activity (expressed as specific activity and as relative activity on ABTS oxidation) of the Bacillus pumilus BOD
as a function of urea concentration at 25 C and at 37 C.
At 25 C, an activating effect of the urea on the ROD is clearly observed. This effect could be due to a slight conformational modification of the active site of the enzyme that would be responsible for better enzymatic efficiency; this phcnomenon, which is known, has already been described for other proteins (see Hong-Jie Zhang et al. Biochemical and Biophysical Research Communications 238, 382-386 (1997) and Fan et al.

Biochem. J. (1996) 315, 97-102).
At 37 C, this effect is not found. It is possible to put forward the hypothesis that the combined effect of the temperature and of the urea results in too great a modification of the active site, consequently leading to a decrease in the performance levels of the enzyme.
4.5 Study of the activity as a function of the presence of NaC1 The experiments are carried out at 37 C on a Varian spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2, with increasing concentrations of NaC1, from 0 mM to 1000 mM. The concentration of SGZ, diluted in methanol, is fixed in the test at 50 pM. The test, triggered by adding enzyme, consists in following the oxidation of the SGZ at 530 nm by colorimetric change (g53onm = 64 mMl.cm1).
Figure 13 represents the relative activity of SGZ
oxidation by the Bacillus pumilus BOD as a function of NaC1 concentration.
4.6 Study of the activity as a function of the presence of DTT or of EDTA
The experiments are carried out at 37 C on a Varian spectrophotometer in a 50 mM citrate/phosphate buffer, pH 6.2, with increasing concentrations of DTT, from 0 mM to 50 pM, or else of EDTA, from 0 to 125 mM. The concentration of SGZ, diluted in methanol, is fixed in the test at 50 pM. The test, triggered by adding enzyme, consists in following the oxidation of the SGZ
at 530 nm by colorimetric change (653o/m - 64 mM-1.om-1).
Table III below collates the results obtained, presented in relative activity form.

Compound Concentration (mM) Relative activity (%) 0.1 97 1 1 99+5 95 + 1 0.001 99 4 0.005 93 2 DTT 0.01 93 4 0.015 94 3 0.03 85 + 1 0.05 81 4 Table III
4.7 Study of the Remazol Brilliant Blue R ORBREO
discoloration activity Like many other laccases and bilirubin oxidases, the 5 Bacillus pumilus BOD has a discolouring activity on dyes used in the textile industry. Remazol Brilliant hue R (RBBR) was selected as an example, and the discoloration thereof is measured over time in the presence or absence of a mediator such as ABTS.
10 The experiments are carried dull. al, 37 C on a Varian spectrophotometer, in a 50 mM potassium phosphate buffer, pH 6, in the absence or presence of ABTS at 3 ml. The RBBR concentration is fixed at 80 mg.1-i in each tank. The test, triggered by adding 10 pg of enzyme, consisLs in following, over time, the discoloration of the RBBR dye at 593 nm.
Figure 13 represents The discoloration of RBBR by the Bacillus pumilus BOD at 3.33 pg.m1-1 at 37 C in a 50 mM
potassium phosphate buffer, pH 6, in the absence or presence of ABTS at 10 uM.

5. Verification of the presence of the four coppers of the Bacillus pumilus bilirubin oxidase The presence of the 4 coppers is determined by means of a bioquinoline assay using a calibration range for copper concentration in order to measure the molar concentration of copper (Felsenfeld, G. 1960. Arch.
Biochem. Biophys., 87, 247-251; Griffiths et al. 1961, J. Biol. Chem., 236, 1850-1856); the results are given in Table III.
Each measurement, based on a colorimetric assay at 546 nm, is carried out in duplicate.
This techniques makes it possible to show the presence of 15.3 pM of copper for a BOD protein sample at 3.75 pM, i.e. a ratio of 4.08, and clearly confirms the presence of the four copper ions associated with the enzyme.
Finally, in order to confirm the presence of the 4 coppers in the BOD protein, an elemental analysis on the coppers of the protein was carried out by atomic absorption. The results clearly confirmed the presence of 4 coppers per protein.

Copper Imidazole -..i . 11 l 1. ne , solution buffer -(1111 Total Copper (solution concentration' Sample (solution (solution volume 3) in the sample 2) 1) (pi) (p1) (PM) (ul) (pi) 3 120 1080 1800 3000 12.59 4 120 1030 1803 3000 12.59 240 ' 960 ' 1800 3000 , 25.18 6 240 960 1300 3000 : 25.18 7 360 840 1300 3000 37.77 8 360 843 1800 3000 37.77 9 480 72D 1800 3000 50.36 480 720 2800 3000 50.36 11 ' 600 600 1800 3000 62.95 12 600 600 1800 3000 62.95 (3.75 450 750 1800 3000 15.7 pm) (3.75 450 750 1800 3000 15.3 pM) Table IV: Experimental protocol for the bioquinoline assay necessary for assaying the copper of the BOD.

Claims (18)

- 32 -
1. A BOD electrode comprising a conductive material coated with a deposit comprising at least one purified bilirubin oxidase (BOD), characterized in that said BOD is the BOD
of Bacillus pumilus of SEQ ID No. 2, in that it catalyses the reaction for oxidation of bilirubin to biliverdin and in that it is bound to four copper atoms.
2. The BOD electrode according to claim 1, wherein said conductive material is selected in the group consisting of platinium, copper, silver, aluminium, gold, steel and carbon.
3. The BOD electrode according to claim 1 or 2, wherein said deposit comprising said at least one purified BOD also comprises a redox polymer.
4. The BOO electrode according to any one of claims 1 to 3, wherein said electrode is coated with a membrane which prevents the detachment of said BOD from said electrode.
5. Use of the BOD electrode as defined in any one of claims 1 to 4, for measuring a bilirubin concentration in a liquid sample.
6. The use according to claim 5, wherein the liquid sample is a biological fluid.
7. The use according to claim 6, wherein the biological fluid is blood, serum, lymph, bile, urine, cerebrospinal fluid or sweat.
8. The use according to any one of claims 5 to 7, wherein the liquid sample or biological fluid is obtained from a patient suffering from - substantial haemolysis;
- insufficient hepatic uptake or conjugation;
- hepatic and biliary conditions;
- biliary condition;
- biliary lithiasis;
- pancreatitis;or - pancreatic or bile duct cancer.
9. The use according to claim 8, wherein - the substantial haemolysis is congenital or acquired haemolytic anaemia, drug-related, toxic or infectious haemolysis, or transfusion accidents;
- the insufficient hepatic uptake or conjugation is Gilbert disease, Criggler-Najjar disease, or due to the taking of antitubercular rifampicin antibiotic; or - the hepatic and biliary conditions are viral, toxic, or drug-related hepatitis, various types of cirrhosis, or rare metabolic abnormalities being selected from the group consisting of Rotor's disease and Dubin-Johnson disease.
10. Kit for assaying bilirubin, characterized in that it comprises a BOD electrode according to any one of claims 1 to 4, buffers, standard solutions of bilirubin for producing calibration curves, and a set of instructions.
11. Method for assaying bilirubin in solution in a liquid sample, characterized in that it comprises the following steps:
a) measuring the absorbance at .lambda. max = 440 nm of said liquid sample before enzymatic reaction;
b) introducing into said liquid sample a BOD electrode as defined in any one of claims 1 to 4;

c) measuring the absorbance at .lambda.max = 440 nm of said liquid sample after enzymatic reaction;
d) calculating the difference in absorbances measured in steps a) and c) and comparing with differences in absorbances measured for standard solutions having a known bilirubin content;
e) determining the bilirubin concentration of said liquid sample.
12. Use of the BOD electrode as defined in any one of claims 1 to 4, for degrading bilirubin present in a sample.
13. Use of the BOD electrode as defined in any one of claims 1 to 4, as a reagent in a composition for an oxidation dyeing of keratin fibres.
14. Use of the BOD electrode as defined in any one of claims 1 to 4, for treating wood pulp.
15. Use of the BOD electrode as defined in any one of claims 1 to 4, for discolouring dyes used in industrial media.
16. Bilirubin biosensor, characterized in that it is constituted of the electrode as defined in any one of claims 1 to 4.
17. Oxygen sensor, characterized in that it is constituted of the electrode as defined in any one of claims 1 to 4.
18. Enzymatic biofuel cell comprising an anode on which an enzyme catalysing an oxidation reaction is immobilized and the electrode as defined in any one of claims 1 to 4 as cathode.
CA2794163A 2010-03-24 2011-03-24 Bacillus pumilus bilirubin oxidase and applications thereof Active CA2794163C (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR1001167 2010-03-24
FR1001167A FR2957934B1 (en) 2010-03-24 2010-03-24 BILIRUBIN OXIDASE FROM BACILLUS PUMILUS AND ITS APPLICATIONS
PCT/IB2011/051258 WO2011117839A1 (en) 2010-03-24 2011-03-24 Bacillus pumilus bilirubin oxidase and applications thereof

Publications (2)

Publication Number Publication Date
CA2794163A1 CA2794163A1 (en) 2011-09-29
CA2794163C true CA2794163C (en) 2019-01-08

Family

ID=42335266

Family Applications (1)

Application Number Title Priority Date Filing Date
CA2794163A Active CA2794163C (en) 2010-03-24 2011-03-24 Bacillus pumilus bilirubin oxidase and applications thereof

Country Status (7)

Country Link
US (2) US20130078662A1 (en)
EP (1) EP2550293B1 (en)
JP (1) JP5865342B2 (en)
CA (1) CA2794163C (en)
DK (1) DK2550293T3 (en)
FR (1) FR2957934B1 (en)
WO (1) WO2011117839A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013081410A (en) * 2011-10-07 2013-05-09 Toyota Motor Corp Mutant type multi-copper oxidase, gene encoding the same, and bio-fuel cell using the same
WO2013099034A1 (en) 2011-12-29 2013-07-04 天野エンザイム株式会社 Dye for keratin fibers using indole analogue
US9284596B2 (en) * 2014-02-13 2016-03-15 Battelle Energy Alliance, Llc Methods for determining enzymatic activity comprising heating and agitation of closed volumes
FR3072386B1 (en) 2017-10-16 2020-09-25 Centre Nat Rech Scient ENZYMATIC MODIFICATION OF LIGNIN FOR ITS SOLUBILIZATION AND APPLICATIONS
FR3127127B1 (en) 2021-09-22 2025-11-21 Centre Nat Rech Scient USE OF WATER-SOLUBLE LIGNIN AS A UV FILTER
FR3154410A1 (en) 2023-10-24 2025-04-25 Centre National De La Recherche Scientifique Use of water-soluble lignin for the stabilization of emulsions
CN119972188B (en) * 2025-04-17 2025-07-01 四川大学 Bilirubin oxidase-like enzyme, enzyme-loaded gel microspheres, preparation method and application thereof

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS59198971A (en) 1983-04-28 1984-11-10 Kyowa Hakko Kogyo Co Ltd Production of bilirubin oxidase
US4701411A (en) 1983-09-01 1987-10-20 Eastman Kodak Company Bilirubin-specific enzyme preparation, assay compositions, analytical elements and methods using same
US4600689A (en) 1983-11-21 1986-07-15 Takara Shuzo Co., Ltd. Novel bilirubin oxidase, its production and use
JPH0653069B2 (en) 1985-02-05 1994-07-20 旭化成工業株式会社 Method for producing thermostable bilirubin oxidase
US4746606A (en) 1986-05-27 1988-05-24 Eastman Kodak Company Bilirubin-specific enzyme and its analytical use
JP2578430B2 (en) 1987-06-10 1997-02-05 旭化成工業株式会社 New bilirubin. Oxidase and method for producing the same
DE4406379A1 (en) 1993-03-24 1994-09-29 Boehringer Mannheim Gmbh Bilirubin oxidase from lucerne and use of the enzyme
FR2768617B1 (en) 1997-09-23 1999-10-22 Oreal KERATINIC FIBER OXIDATION DYE COMPOSITION AND DYEING METHOD USING THE SAME
AU766409B2 (en) 1999-05-06 2003-10-16 Novozymes A/S A process for production of paper materials with improved wet strength
JP3672888B2 (en) * 2002-04-24 2005-07-20 株式会社エス・ディー・エス バイオテック Wood processing method
JP2009044997A (en) 2007-08-20 2009-03-05 Sony Corp Method for coating bilirubin oxidase (BOD)
JP2009245920A (en) * 2008-03-11 2009-10-22 Sony Corp Fuel cell, electronic apparatus, and buffering liquid for fuel cell

Also Published As

Publication number Publication date
FR2957934A1 (en) 2011-09-30
EP2550293B1 (en) 2017-05-03
EP2550293A1 (en) 2013-01-30
JP2013521825A (en) 2013-06-13
US9617577B2 (en) 2017-04-11
DK2550293T3 (en) 2017-08-21
FR2957934B1 (en) 2014-10-17
WO2011117839A1 (en) 2011-09-29
CA2794163A1 (en) 2011-09-29
US20150096903A1 (en) 2015-04-09
US20130078662A1 (en) 2013-03-28
JP5865342B2 (en) 2016-02-17

Similar Documents

Publication Publication Date Title
US9617577B2 (en) Bacillus pumilus bilirubin oxidase and applications thereof
Goswami et al. An overview on alcohol oxidases and their potential applications
JP6134311B2 (en) Bilirubin oxidase from rice blast fungus and use thereof
US9873864B2 (en) Cellobiose dehydrogenase
KR20130038914A (en) Glucose dehydrogenase
US9200308B2 (en) Penicillium amagasakiense glucose oxidase mutants
JPWO2014045912A1 (en) Protein with flavin adenine dinucleotide-dependent glucose dehydrogenase activity
Fall et al. A thermostable bacterial catalase-peroxidase oxidizes phenolic compounds derived from lignins
Pisanelli et al. Pyranose 2-oxidase from Phanerochaete chrysosporium—expression in E. coli and biochemical characterization
US20150203825A1 (en) Laccase of Podospora Anserina and Uses of Same
Takeda et al. Discovery of a novel quinohemoprotein from a eukaryote and its application in electrochemical devices
JP5791025B2 (en) Thermostable protein having laccase activity, nucleic acid molecule encoding the protein, and method for producing the protein
KR101740099B1 (en) Biofuel cell comprising laccase
Koraj Production and purification of chimeric enzymes and establishment of deflavination method
Campbell Toward a General Dehydrogenase Enzymatic Scaffold for Industrial Biocatalysis

Legal Events

Date Code Title Description
EEER Examination request

Effective date: 20160205

MPN Maintenance fee for patent paid

Free format text: FEE DESCRIPTION TEXT: MF (PATENT, 14TH ANNIV.) - STANDARD

Year of fee payment: 14

U00 Fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U00-U101 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE REQUEST RECEIVED

Effective date: 20250319

U11 Full renewal or maintenance fee paid

Free format text: ST27 STATUS EVENT CODE: A-4-4-U10-U11-U102 (AS PROVIDED BY THE NATIONAL OFFICE); EVENT TEXT: MAINTENANCE FEE PAYMENT DETERMINED COMPLIANT

Effective date: 20250319