CA2432365A1

CA2432365A1 - Specific method of prostate cancer detection based on pca3, and kits therefore

Info

Publication number: CA2432365A1
Application number: CA002432365A
Authority: CA
Inventors: Jack A. Schalken; Gerald Verhaegh; Daphne Hessels; Frank Smit
Original assignee: Radboud University Medical Centre
Current assignee: Individual
Priority date: 2003-06-30
Filing date: 2003-06-30
Publication date: 2004-12-30
Also published as: ES2377485T3; US20120309006A1; ATE535618T1; AU2010201771A1; JP2011172574A; AU2010201771B2; WO2005003387A2; WO2005003387A3; AU2004254043A1; JP2009513103A; JP4741481B2; EP1639138B1; US20050164223A1; EP1639138A2; US20090233285A1

Abstract

The present invention relates, in general, to prostate cancer. More specifically, the present invention relates to a method to diagnose prostate cancer in a patient by detecting a PCA3 sequence, and more particularly a PCA3 ETA, the PCA3 sequence detected in a sample from the patient being specifically associated with prostate cancer. The invention also relates to kits containing nucleic acid primers and kits containing nucleic acid primers and nucleic acid probes to diagnose, assess, or prognose a human afflicted with prostate cancer.

Description

TITLE OF THE INVENTION
SPECIFIC METHOD OF PROSTATE CANCER
DETECTION BASED ON PCA3 GENE, AND KITS THEREFOR
FIELD OF THE INVENTION
The present invention relates, in general, to prostate cancer.
More specifically, the present invention relates to a method to diagnose prostate cancer in a patient by detecting a PCA3 sequence, and more particularly a PCA3RNA, the PCA3 sequence detected in a sample from the patient being specifically associated with prostate cancer. The invention also relates to kits containing nucleic acid primers and kits containing nucleic acid primers and nucleic acid probes to diagnose, assess, or prognose a human afflicted with prostate cancer.
BACKGROUND OF THE INVENTION
Over the last decade, cancer of the prostate has become the most commonly diagnosed malignancy among men and the second leading cause of male cancer deaths iin the western population, following lung cancer.
Early detection and treatment o~f prostate cancer before it has spread from the prostate gland reduces the mortality of the disease. This is particularly true for younger men who are at greater risk of dying from this pernicious but slowly growing malignancy. This realization has prompted increasing efforts for early diagnosis and treatment" Indeed, the American Cancer Society and American Urological Association recommend that male population at large undergo annual screening for prostate cancer beginning at age 50. The recommended age for screening is lowered to 40 for men giving a family history of prostate cancer or other risk factors.
With this increasing focus on prostate cancer screening, more men than ever before are being routinely tested for prostate cancer. Not surprisingly, this practice has increased early detection of onset of the disease, as reflected by an apparent increase in the incidence of prostate cancer and decrease in the apparent average age of diagnosis. The clinical hope is that earlier detection of prostate cancer before it metastasizes will reduce the overall mortality rate.
Healthcare payers look for early screening and detection to translate into a reduction in the healthcare burden, as early treatment can be less radical, more successful and therefore provided at a lower cost per treated patient. The key to accomplishing this goal remains providing better differential diagnostic tools.
Screening for prostate cancer now involves both palpation of the prostate by digital rectal examination and assay of plasma levels of prostate specific antigen (PSA). PSA is a serine protease produced by the prostatic epithelium that is normally secreted in the seminal fluid to liquefy it.
Disruption of the anatomic integrity of the prostate gland can compromise the cellular barners that normally restrict PSA to within the duct system of the prostate, allowing it to disperse into blood or urine. A number of conditions can result in leakage of PSA into the blood. They include inflammation of the prostate, urinary retention, prostatic infection, benign prostatic hy~~erplasi.a, and prostate cancer.
Physical manipulation of the prostate can also increase serum PSA levels, but a mild stimulus, such as digital rectal examination (DRE), does not normally increase serum PSA. It is therefore not surprising that screening of serum PSA
as an indicator of prostate; cancer is not absolutely predictive.
Despite the fact that measure of blood PSA levels can results from a variety of different causes, it is nonetheless the basis for primary screening for prostate cancer. lVl:easurement of total PSA (tPSA) as a diagnostic assay to predict prostate cancer has been in use since 1991. Levels of 4 ng/ml or greater in blood serum are considered abnormal and predictive of prostate cancer.
However, the sensitivity of such elevated tPSA levels is only 79%; thus leaving 21% of patients with prostate cancer undetected. The specificity far all tPSA values of 4 ng/ml or greater is very poor. In addition, estimates of specificity for tPSA
levels > 4.0 ng/ml are reported to be in the rage of 20% to 59%, averaging around 33%. The vast majority of false positives are ultimately shown to be benign prostatic hyperplasia. The specificity is lowest for modestly elevated tPSA, in the low so-called gray zone of 4 to lOng/ml. This low level of specificity results in additional more invasive and costly diagnostic procedures, such as transrectal ultrasounds and prostate biopsies. Such tests when unnecessary are also very traumatic for the patient. The psychological impact of being diagnosed as positive until proven as a false positive should not be understated either.
Because of the shortcomings of tPSA, research has been focused on attempting to develop PSA derivatives to increase the sensitivity and specificity of this general diagnostic approach.

One modification is free PSA (fPSA), which was FDA
approved in 1998. PSA in serum can be found either in an unbound form or complexed with circulating protease inhibitors, most commonly with alpha-1-antitrypsin (ACT). Clinicians have shown that the proportion of PSA bound to ACT was significantly higher in men with prostate cancer than in unaffected rnen or those with benign prostate hypertrophy (BPH). As a guideline, if 25% or less of total PSA is free, this is an indicator of possible prostate cancer. The fPSA
assay was approved for use in men with tPSA's for 4 to lOnglml. Thus, the fPSA
assay was positioned to improve the specificity over that of tPSA alone.
However, the predictivity of the fl'SA test is not as good in people with really low or really high tPSA levels. Very low tPSA, regardless of measured fPSA; is predictive of not having cancer, while the converse is true with very high tPSA levels. The diagnostic usefulness of fPSA is relatively limited as it can be associated with either BPH or prostate cancer. The use of fPSA in combination with tPSA has been shown to reduce t-.he number of unnecessary biopsies by about 20%.
Clearly, prostate biopsy is the gold standard for confirming prostate cancer. However, even a biopsy is not always 100% certain. The standard is the sextant biopsy where tissue sample collection is guided by transrectal ultrasound. Often the six samples do not detect the cancer and either a second biopsy procedure or more than six samples are required.
Despite the improvements to prostate cancer screening that have come along in l:he last ten years, there remains a large unmet need in diagnostic sensitivity and specificity, even when these tools are uscd in combination. Coupling this with the large incidence of prostate cancer and the need for early, accurai:e detection, the potential of a true differential diagrxostic tool is very significant.
A rtew prostate cancer marker, PCA3, was discovered a few years ago by differential display analysis intended to highlight genes associated with prostate cancer development (USN 09/402,713; 09/675,650; 09/996,953;
and 60/445,436). PCA3 is located on chromosome 9 and composed of four exons. It encodes at least four different transcripts which are generated by alternative splicing ands polyadenylation. By RT-PCR analysis, PCA3 expression was found to be limited to the prostate and absent in all other tissues, including testis, ovary, breast arhd bladder. Northern blot analysis showed that PCA3 is highly expressed in the vast majority of prostate cancers examined (47 out of 50) whereas no or very low expression is detected in benign prostate hyperplasia or normal prostate cells from tha same patients [Cancer Res 1999 I~ec 1;59(23):5975-9]. Moreover, a recent study comparing the clinical performance of RNA telomerase RT and RNA PCA3 detection in the case of prostate cancer S showed that the PCA.3 gene can be considered as a better marker [Cancer Res 2002 May 1;62(9):2695-8~.
The PCA3 gene is composed of 4 exons (el-e4) and 3 ixltrons (il-i3). While PCA3 appears t~ be recognized as i:he best prostate-cancer marker ever identified, this specificity has been contested in the literature. Fox example, Gandini et al. 2003, claim that the prostate-specific expression of PCA3 is restricted to that of exon 4 of the PCA3 gene. There thus remains a need to clarify the issue of the specificity of the PCA3 marker and provide tools that will specifically identify PCA3 sequences associated with prostate cancer.
The present invention seeks to meet these and other needs.
In view of the fact that advanced prostate cancer remains a life threatening disease reaching a t=cry significant proportion of the male population, there remains a need to provide the most specific, selective, and rapid prostate cancer detection methods and kits.
The present invention seeks to meet these and other needs.
The present description refers t:o a number of documents, the content of which is herein incorporated by reference in their entirety.
SITMMARY OF TIIE INVENTI~N
The present invention relates to diagnostic methods and kits which detect prostate cancer in a more specific and selective fashion than the methods and kits of the prior art.
One aim of this invention is to describe a method to detect prostate cancer in a patient and especially from a urine sample by detecting RNA which is associated with prostate cancer.
In one particular embodiment, the present invention relates to a method to assess prostate cancer in a patient, by detecting in a sample (e.g.
urine sample), the presence of PCA3 RNA which does not contain an intron (e.g.
il) between exons 1 and 2. In another embodiment the PCA3RNA which is detected is a spliced RNA which lacks an intron (i2) between exons 2 and 3. In yet another embodiment of the present invention, the :PCA3 RNA which is detected is a spliced F'1VA which lacks an intron (i3) between axons 3 and 4.
In a particularly preferred embodiment of the present invention, the PCA3 RNA which is detected is a spliced RNA which lacks introns between axon 1 and axon 3. In a particularly preferred embodiment of the present invention, the PCA3 RNA
'which is detected is a spliced RNA which lacks introns between axon 1 and axon 4 In a particularly preferred embodiment of the present invention, the PCA3 RNA which is detected is a spliced RNA which lacks at least an intron (il) between axons and 2. In one embodiment, a PCA3 RNA lacking at least a first intron between axons 1 and 2, is specifically targeted and detected. In a particular embodiment the detected PCA3 sequence is an intron-less PCA3 RNA.
In one particular embodiment of the present invention, the prostate cancer specific RNA encoded by the PCA3 gene (i.e. RNA) is detected using an amplification method which amplifies a second prostate-specific (which does not have to be associated with prostate cancer) sequence also contained in the sample. A number of such second prostate-specific sequences can be used as long as they can serve as a control for prostate RNA. Non-limiting examples of such prostate-specific sequences include PSA, and other kallikrein family members. The arnplific;ation of the prostate-cancer specific PCA3 RNA
sequences and the prostate-specific sequences can be carried out simultaneously.
The invention provides a method of detecting prostate cancer-specific PCA3 RNA in a sample.
The invention also provides kits for detecting the presence of prostate cancer-specific PCA3 RNA in a sample. In one embodiment, the invention provides a dr.agnostic kit comprising a first container means containing a pair of primers which can amplify the above-described prostate cancer-specific PCA3 RNA, and a second container means containing a pair of primers which can amplify the above-mentioned second prostate-specific sequence. In another embodiment, a third container means contains a probe which specifically hybridizes to the PCA3 amplification product. In a particular embodiment of the invention, the probe further increases the specificity of the method, by specifically hybridizing to a chosen axon-axon junction of PCA3. In yet another embodiment, a fourth container means contains a probe for another region of PCA3 or for the second prostate-specific sequence.
The: invention thus further provides a method of diagnosing the presence or predisposition to develop prostate cancer in a patient.

-6_ In another embodiment, the RNA encoded by the PCA3 gene is obtained from a cell contained in a voided urine sample from the patient.
In one embodiment of the present invention, the RNA is detected using an RNA amplification method. In one such embodiment, the RNA
amplification method is coupled to real-time detection of the amplified products using fluorescence specific probes. In yet a further embodiment, the amplification method is PCR. In an additional embodiment the PCR is real-time PCR or a related method enabling a detection in real-time of the amplified products.
In one embodiment, the urine sample is obtained after an attentive digital rectal examination (DRE). Of course, it should be understood that the present methods and kits could also be used on a urine sample obtained without digital rectal examination, or on other types of samples such as sperm, mixed urine and sperm (first urine sample following ejaculation), provided that the amplification method and/or detection method is sensitive enough to detect the targeted markers (PCA3 and second marker). Experiments showed that the methods and kits of the present invention could also be performed with these types of samples. Other samples which could be used include blood or serum.
In ~~ne embodiment, the cells collected from the urine sample are harvested and a total nucleic acid extraction is carried out. In one particular embodiment, total nucleic acid extraction is carried out using a solid phase band method on silica besets as described by BOOM et al. Of course, it should be understood that numerous nucleic acid extraction methods exists and thus, that other methods could be used in accordance with the present invention. One non-limiting example is a phenol/chloroform extraction method. Other such methods axe described in herein referenced textbooks.
In one additional embodiment RNA encoded by PCA3 gene is detected by an in vitro RNA amplification method named Nucleic Acid based Amplification (NASBA). Of course other RNA amplification methods are known and the instant methods and kits are therefore not limited to NASBA. Non-limiting examples of such RNA amplification methods include polymerase chain reaction (PCR), transcriptase mediated amplification (TMA) and ligase chain reaction (LCR).
In one embodiment, the amplified products are detected in homogenous phase using a fluorescent probe using the Beacon approach. In _ 7 _ another embodiment, the product is detected on solid phase using fluores<~ent or colorimetric method. It should be understood that numerous fluorescent, colorimetric or enzymatic methods could be used in accordance with the present invention to detect and/or quantify the targeted RNAs.
It should be understood by a person of ordinary skill that numerous statistical methods can be used in the context of the present invention to determine if the test is positive or negative.
Further objects and advantages of the present invention will be clear from the description that follows.
DEFINITIONS
In the description that follows, a number of terms used in DNA technology are extensively utilized. In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
Isolated Nucleic Acid Molecule. An "isolated nucleic acid molecule", as is generally understood and used herein, refers to a polymer of nucleotides, and includes but should not be limited to DNA and RNA. The "isolated" nucleic acid molecule is purified from its natural in vivo state.
DNA Segment. A DNA segment, as is generally understood and used herein, refers to a molecule comprising a linear stretch of nucleotides wherein the nucleotides are present in a sequence: that can encode, through the genetic code, a molecule comprising a linear sequence of amino acid residues that is referred to as a protean, a protein fragment or a polypeptide.
Gene. A DNA sequence related to a single polypeptide chain or protein, and as used herein includes the 5' and 3' untranslated ends. The polypeptide can be encoded by a full-length sequence or any portion of the coding sequence, so long as the functional activity of the protein is retained.
Complementary DNA (cDNA). Recombinant nucleic acid molecules synthesized by reverse transcription of messenger RNA ("RNA").
Stn.~ctural Gene. A DNA sequence that is transcribed into RNA that is then translated into a sequence of amino acids characteristic of a specific polypeptide.

- g -Agarose Gel Electrophoresis. The most commonly used technique (though not the only one) for fractionating double strand DNA is agarose gel electrophoresis. The principle of this method is that DNA
molecules migrate through the gel as though it were a sieve that retards the movement of the largest molecules to the greatest extent and the movement of the smallest molecules to the least extent. Note that the smaller the DNA fragment, the greater the mobility under electrophoresis in the agarose gel.
Tlve DNA fragments fractionated by agarose gel electrophoresis can be visualized directly by a staining procedure if the number of fragments included in the pattern is small. In order to visualize a small subset of these fragments, a methodology referred to as the Southern hybridization procedure can be appl.ed.
Southern Transfer Procedure. The purpose of the Southern transfer procedure (also referred to as blotting) is to physically transfer DNA
fractionated by agarose gel electrophoresis onto a nitrocellulose filter paper or another appropriate surface or method, while retaining the relative positions of DNA fragments resulting from the fractionation procedure. The methodology used to accomplish the transfer from agarose gel to nitrocellulose involves drawing the DNA from the gel into the nitrocellulose paper by capillary action.
Nucleic Acid Hybridization. Nucleic acid hybridization depends on the principle that two single-stranded nucleic acid molecules that have complementary base sequences will reform the thermodynamically favored double-stranded structure if they are mixed under the proper conditions. The double-stranded structure will be formed between two complementary single-stranded nucleic acids even if one is immobilized on a nitrocellulose filter.
In the Southern hybridization procedure, the latter situation occurs. As noted previously, the DNA of the individual to be tested is digested with a restriction endonuclease, fractionated by agarose gel electrophoresis, converted to the single-stranded form, and transferred to nitrocellulose paper, making it available for reannealing to the hybridization probe. Examples of hybridization conditions can be found in Ausubel, F.M. et al., Current protocols ih Molecular Biology, John Wily &
Sons, Inc., New York, NY (1989). A nitrocellulose filter is incubated overnight at 68°C
with labeled probe in a. solution containing 50% formamide, high salt (either Sx SSC[20X: 3M NaCI/0.3M trisodium citrate] or SX SSPE [20X: 3.6M NaCI/0.2M
NaH2P0~/0.02M EDTA, pH 7.7]), SX Denhardt's solution, 1% SDS, and 100 lag/ml denatured salrr~on sperm DNA. This is followed by several washes in 0.2X
SSC/0.1% SDS at a temperature selected based on the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 68°C
(high stringency). The temperature selected is determined based on the melting temperature (Tm) of the DNA hybrid.
Hybridization Probe. To visualize a particular DNA sequence in the Southern hybridization procedure (e.g. an amplification product), a labeled DNA molecule or hyhridization probe is reacted t:o the fractionated DNA bound to the nitrocellulose filter. The areas on the filter that carry DNA sequences complementary to the labeled DNA probe become labeled themselves as a consequence of the re-annealing reaction. The areas of the filter that exhibit such labeling are visualized. The hybridization prohe is generally produced by molecular cloning of a~ specific DNA sequence. In one particular embodiment the probe spans the 3' region of a first axon and the 5' region of a second axon, such that such a probe can only detect the amplification product if the first axon and second axon have been spliced into a contiguous position (i.e. by removing an intervening intronic sequence). Knowing the sequences of the axon boundaries, as well as those of tb.e different axons (see below), the numerous primers and probes which can be designed and used in the context of the present invention can be readily determined by a person of ordinary skill in the art to which the present invention pertains.
Oligonucleotide, Oligomer or oligo. A molecule comprised of two or more deoxyribonucleotides or rzbonucleotides, preferably more than three.
Its exact size will depend on many factors, which in turn depend on the ultimate function or use of tlhe oligonucleotide. An oligonucleotide can be derived synthetically or by cloning. Chimeras of deoxyribonucleotides and ribonucleotides may also be within the scope of the present invention.
Sequence Amplification. A method for generating large amounts of a target sequence. In general, one or more amplification primers are annealed to a nucleic acid sequence. Using appropriate enzymes, sequences found adjacent to, or in between the primers are amplified.
Amplification Primer. An oligonucleotide which is capable of annealing adjacent to a target sequence and serving as an initiation point for DNA
synthesis when placed under conditions in which s3mthesis of a primer extension product which is complementary to a nucleic acid strand is initiated.

Antisense nucleic acid molecule. An "antisense nucleic acid molecule" refers here;in to a molecule capable of forming a stable duplex or triplex with a portion of its targeted nucleic acid sequence (DNA or RNA). The design and modification of antisense nucleic acid molecules is well known in the art as described for example in WO 96/32966, WO 96/11266, WO 94/15646, WO
93/08845, and USP 5,593,974. Antisense nucleic acid molecules, as sense oligos, can be derived from the nucleic acid sequences of the present invention and modified in accordance to well known methods. For example, some antisense molecules (or sense oligos or sequences) can be designed to be more resistant to degradation, or if required, to increase their affinity to their targeted sequence, to affect their transport to chosen cell types or cell compartrr~ents, and/or to enhance their lipid solubility by using nucleotide analogs and/or substituting chosen chemical fragments thereof, as commonly known in the art. PCA3 gene is also described as DD3PC~.
lgRIEF DESCRIPTION OF TIIE DRAWINGS
Having thus generally described the invention, reference will now be made to the accompanying drawings, showing by way of illustration a preferred embodiment thereof, and in which:
Figural: Expression of PCA3 (DD3PCa.s)in several human tissues using 32 cycles of PCA3-specific RT-PCR with the following primers:
forward 5'-CAGGAAGCACAAAAGGAAGC-3' (axon 3, pos. 443-462) and reverse 5'-TCCTGCCCATCCTTTAAGG-3' (ex:on 4, pos. 593-575). 'The following tissues have: been analyzed: normal prostate (1), prostate cancer (2), testis (3), heart (4), lung (5) artery (6), kidney (7), liver (8), breast cancer (9), normal breast (10), cervix (11), endometrium (12), ovarium (13) and kidney cancer (14). The arrowhead indicates the spliced PCA3 transcript (151 bps) in prostate samples only and the arrow the non-spliced transcript (378 bps) in the other tissues. Note that the signals in lanes 1 and 2 are saturated. A beta-2-microglobulin PCR was performed as a control (lower panel).
Figure 2: Schematic; representation of the PCA3 transcription unit. Boxes indicate the four PCA3 axons; the solid arrowhead the prostate-specific PCA3 promoter and the arrows indicate the different (putative) PCA3 transcripts.
Figure 3: PCA3 expression (DD3PCA3) by RT-PCR.

~ther objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of preferred embodiments with reference to the accompanying drawialgs which are exemplary arid should not be interpreted as limiting the scope of the present invention.
DESCRIPTION ~F THE PREFERRED EMBODIMENT
For purposes of clarity of disclosure, and not by way of limitation, the detailed description of the invention is divided into the following subsections:
I. Synthesis of Nucleic Acid.
II. Nucleic Acid Primers and probes for the Specific Detection of prostate cancer specific PCA3 Nucleic Acid.
III. A Method of Detecting the Presence of PCA3 Nucleic Acid in a Sample.
IV. A Kit fox Detecting the Presence of PCA3 Nucleic Acid in a Sample.
V. Diagnostic Screening . -12-1. Synthesis of Nucleic Acid Isolated nucleic acid molecules of the present invention are also meant to include those chemically synthesized. Similarly, an oligomer which corresponds to the nucleic acid molecule, or to each of the divided fragments, can be synthesized. Such synthetic oligonucleotides can be prepared, for example, by the triester method of Matteucci et al., J. Am. Chem. Soc. 103:3185-3191 (1981) or by using an automated DNA synthesizer.
An oligonucleotide can be derived synthetically or by cloning.
If necessary, the 5'-ends of the oligomers can be phosphorylated using T4 polynucleotide kinase. Kinasing of single strands prior to annealing or for labeling can be achieved using an excess of the enzyme. If kinasing is for the labeling of probe, the ATP can contain high specific activity radioisotopes.
Then, the DNA oligomer can be subjected to annealing ;end ligation with T4 ligase or the like.
II. A Nucleic Acid fbr the Specific Detection of I'CA3 Nucleic Acid The; present invention relates to a nucleic acid for the specific detection, in a sample, of the presence of PCA3 nucleic acid sequences which are associated with prostate cancer, comprising the above-described nucleic acid molecules or at least a fragment thereof which binds under stringent conditions to PCA3 nucleic acid.
In one preferred embodiment, the present invention relates to oligos which specifically target and enable amplification (i.e. primers) of RNA sequences associated with prostate cancer.
In one embodiment, the amplified product can be detected following hybridizing with a probe which consists of an isolated nucleic acid consisting of 10 to 1000 nucleotides (prefererably, 10 to 500, 10 to 100, IO
to 50, 10 to 35, 20 to 1000, 2(D to 500, 20 to 100, 20 to 50, or 20 to 35) which hybridizes preferentially to an amplified product which originated from PCA3 RNA
associated withy prostate cancer, but preferentially not the PCA3 gene, wherein said nucleic acid probe is or is complementary to a nucleotide sequence consisting of at least 10 consecutive nucleotides (preferably, 15, 18, 20, 25, or 30) from the nucleic acid molecule comprising a polynucleotide sequence at least 90%
identical to a sequence ;elected from the group consisting of:

{a) a region of the nucleotide sequence of PCA3 SEQ ID NO:1 or 2, which is associated with prostate cancer;
(b) a nucleotide sequence which spans two axon junctions, preferably axons 1 and 2, axons 1 and 3 (axon 1 being contiguous to axon 3, S through alternative splicing), and axons 3 and 4;
(c) a nucleotide sequence which spans a sufficient number of the PCA3 axon junctions, wherein the axon junctions are defined as follows:
axon junction of axons 1 and 2, nucleotide positions 98-99 as set forth in SEQ ID NO:1; axon junction of axons 2 and 3, nucleotide positions 263-264 as set forth in SEQ ID NO: l; axon junction of axons 3 and 4a, nucleotide positions 446-447 as set forth in SEQ ID NO: l; and axon junction of axons 4a and 4b, nucleotide positions 985-986 as set forth in SEQ ID NO: l;
(d) a nucleotide sequence which spans a sufficient number of the PCA3 axon junctions, wherein the axon junctions are defined as follows:
axon junction of axons 1 and 2, nucleotide positions 120-121 as set forth in SEQ ID NO:2; axon junction of axons 2 and 3, nucleotide positions 285-286 as set forth in SEQ ID N0:2; axon junction of axons 3 and 4a, nucleotide positions 468-469 as set forth in SEQ ID N0:2; axon junction of axons 4a and 4b, nucleotide positions 1007-1008 as set forth in SEQ ID N0:2; axon junction of axons 4b and 4c, nucleotide positions 2066-2067 as set forth in SEQ ID N0:2;
and axon junction of axons 4c and 4d, ~:~ucleotide positions 2622-2623 as set forth in SEQ ID N0:2.
Preferably, a probe in accordance with the present invention does not specifically hybridize to nucleotides S 11-985 of SEQ ID NO:1, to nucleotides 567-961 of SEQ ID NO:1, to nucleotides 533-1007 of SEQ ID N0:2, or to nucleotides 589-983 of SEQ ID N0:2.
Complementary sequences are also known as antisense nucleic acids when they comprise sequences which are complementary to the coding strand.
Primers in accordance with the present invention can be designed as commonly known in the art based on the sequences of PCA3 provided herein. More preferably, the primers will be chosen to amplify a PCA3 RNA which is associated with prostate cancer. One such PCA3 RNA is a PCA3 RNA which lacks intron 1 (between axons 1 and 2). Another prostate-cancer specific PCA3 RNA in accordance with the present invention, lacks the intron between axon 3 and axon 4a. Of course different permutations of such prostate-cancer specific PCA3 RNAs are also encompassed by the present invention. For example, three non-limiting prostate-cancer specific PCA3 RNAs include a) a PCA3 RNA lacking at least intron 1, and PCA3 RNAs having the following contiguous axons: b) axons 1, 2, 3, 4a, 4b, 4c and 4d, and c) axons 1, 3, 4a, 4b, 4c and 4d.
In a preferred embodiment of the present invention, a primer which is designed to bind to axon I is used, together with a second primer designed to bind to axon 3 or to axon 4. Since intron 1 is a large intron (approximately 20 kb), the amplifying conditions can be selected so as to inhibit the production of such a large amplification product, should the intron be present in the PCA3 sequence. Alternatively, the conditions of amplification can be selected so as to enable the amplification of such large products. In such an embodiment, the presence of intron 1 in the PCA3 RNA can be ascertained by numerous means known in the art (including using an intronic probe and/or a probe which designed to bind to contiguous axon I-axon 2 sequences; two non-limiting examples thereof is shown in Table 1). It will be recognized by the person of ordinary skill that the position of the primer at the axon junction and the length of the primer can be varied, as known in the art.
In another preferred embodiment, a primer which is designed to bind to axon 1 is used, together with a second primer designed to bind a axon junction region of the present invention. Since axon 1 has been shown to be a preferred targeted axon to amplify prostate-cancer specific RNAs, such an embodiment is especially preferred since it can generate prostate cancer specific amplification products.
Examples of nucleic acid primers which can be derived from the axon sequences shown hereinbelow and specific primers designed to amplify an axon junction of the present invention are set forth in Table 1, below.
TABLE 2: NUCLEIC ACID PRIII~IERS
Sate (no. of bases) ~lucleotides Exon 1 98 1-98 of SEQ ID NO:1 Exon 2 165 99-263 of SEQ ID NO:1 Exon 3 183 264-446 of SEQ ID NO:1 Exon 4a 539 447-985 of SEQ ID NO:1 Exon 4b 1052 986-2037 of SEQ ID NO:1 Exon 1 120 1-120 of SEQ ID N0:2 Exon 2 165 121-285 of SEQ ID NO:2 Exon 3 183 286-468 of SEQ ID NO:2 Exon 4a 539 469-1007 of SEQ ID NO:2 Exon 4b lOS9 1008-2066 of SEQ ID N0:2 Exon 4c 556 2067-2622 of SEQ ID N0:2 Exon 4d 960 2623-3582 of SEQ ID N0:2 Exon junction 1 20 89-108 of SEQ ID NO:1 Exon junction 1 20 109-128 of SEQ ID N0:2 Exon junction 2 20 252-271 of SEQ ID NO;1 Exon junction 2 20 274-293 of SEQ ID N0:2 Exon junction 3 20 435-454 of SEQ ID NO: 3 Exon junction 3 20 457-476 of SEQ ID N0:2 Exon junction 4 20 974-993 of SEQ ID NO: l Exon junction 4 20 996-1015 of SEQ ID N0;2 Exon junction 5 20 2055-2074 of SEQ ID NU:2 Exon junction 6 20 2611-2630 of SEQ ID N0:2 While the present invention can be carried out without the use of a probe which targets equences, and preferably the PCA3 s exon junctions of PCA3 in accordance with the present invention, such probes can add a further specificity to the methods and kits of the present invention, Examples of specific nucleic acid probes which can be used in the present invention (and designed based on the exonic sequences shown in Table 1) are set forth in Table 2, below.
TABLE 2: NUCLEIC ACID PROBES
Size (no. of hTucleotides bases) Probe 1 20 1-20 of SEQ ID NO:1 Probe 2 30 1-30 of SEQ ID NO:
l Probe 3 40 1-40 of SEQ ID NO:1 Probe 4 20 1-20 of SEQ ID N0:2 Probe 30 1-30 of SEQ ID N0:2 Probe 6 20 1-40 of SEQ ID N0:2 TABLE 2: N~(JCLEIC ACID PROBES (Continued) Size (no. of bases) Nucleotides Probe 7 20 89-108 of SEQ ID NO:1 Probe 8 30 114-143 of SEQ ID NO:2 Probe 9 30 257-286 of SEQ ID NO:1 Probe 10 20 284-303 of SEQ ID N0:2 Probe 11 20 274-293 of SEQ ID NO:1 Of course, as will be understood by the person of ordinary skill, a multitude of additional probes can be designed from the same or other region of SEQ ID NO:1 as well as from SEQ ID N0:2 and other sequences of the present invention, whether they target axon junctions or not.
The hybridization probes of the present invention can be labeled by standard labeling techniques such as with a radiolabel, enzyme label, fluorescent label, biotin-avidin label, chemiluminescence, and the like. After hybridization, the probes can be visualized using known methods.
The nucleic acid probes of the present invention include RNA, as well as DNA probes, such probes being generated using techniques known in the art.
In one embodiment of the above described method, a nucleic acid probe is immobilized on a solid support. Examples of such solid supports include, but are not limited to, plastics such as polycarbonate, complex carbohydrates such as agarose and sepharose, and acrylic resins, such as polyacrylamide and latex beads. Techniques for coupling nucleic acid probes to such solid supports are well known in the art.
The test samples suitable for nucleic acid probing methods of the present invention include, for example, cells or nucleic acid extracts of cells, or biological fluids. The sample used in the above-described methods will vary based on the assay format, the detection method and. the nature of the tissues, cells or extracts to be assayed. Methods for preparing nucleic acid extracts of cells are well known in the art and can be readily adapted. in order to obtain a sample which is compatible with the method utilized. Preferably the sample is a urine sample.
lll. A Method of Detecting The Presence of PC~3 Nucleic flcid in a Sar7tple In another embodiment, the present invention relates to a method of detecting the presence of prostate cancer specific PCA3 nucleic acid in a sample comprising a) contacting the sample with the above-described nucleic acid primers, under specific amplification conditions, and b) detecting the presence of the amplified product. One skilled in the art would select the nucleic acid primers according to techniques known in the art as described above. In one particular embodiment one of the primers binds to axon I of PCA3. In another embodiment a probe is used to identify the amplification product. Samples to be tested include but should not be limited to RNA samples from human tissue.
IV. A Kit for Detectihg the Presence ~f PCA3 Nr~cleic Acid in a Sample In another embodiment, the present invention relates to a kit for detecting the presence of prostate cancer specific PCA3 nucleic acid in a sample comprising at least one container means having disposed therein at least one primer pair, (e.g. one binding to axon l, the other to axon 3; one binding to axon 1, the other to axon 4a;). one binding to axon 1, the other to exon3 -exon4a junction In a preferred embodiment, the kit further comprises other containers comprising one or more of the following: amplification reagents, probes, wash reagents and reagents capable of detecting the presence of bound nucleic acid probe. Examples of detection reagents include, but are not limited to radiolabelled probes, enzymatic labeled probes (horse radish peroxidase, alkaline phosphatase), and affinity labeled probes (biotin, avidin, or steptavidin).
In detail, a compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers or strips of plastic or paper. Such containers allow the efficient transfer of reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample, a container which contains the probe or primers used in the assay, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, and the like), and containers which contain the reagents used to detect the hybridized probe, bound antibody, amplified product, or the like.
One skilled in the art will readily recognizc that the nucleic acid probes described in the present invention can readily be incorporated into one of the established kit formats which are well known in the art.
X. Diagnostic Screehing It is to be understood that although the following discussion is specifically directed to human patients, the teachings are also applicable to any animal that expresses PCA3.
The diagnostic and screening methods of the invention are especially useful for a patient suspected of being at risk for developing a disease associated with an altered expression level of PCA3 based on family history, or a patient in which it is desired to diagnose a PCA3-related disease (ex.
prostate cancer).
According to the invention, presyrnptomatic screening of an individual in need of such screening is now possible using DNA encoding the PCA3 protein or the PCA3 gene of the invention or fragments thereof. The screening method of the invention allows a presymptornatic diagnosis, including prenatal diagnosis, of the presence of a missing or aberrant PCA3 gene in individuals, and thus an opinion concerning the Likelihood that such individual would develop or has developed a PCA3-associated disease. This is especially valuable for the identification of carriers of altered or missing PCA3 genes, for example, from individuals with a family history of a PCA3-associated disease.
Early diagnosis is also desired to maximize appropriate timely intervention.
In one preferred embodiment of the method of screening, a tissue sample would be taken from such individual, and screened for (1) the presence of prostate cancer-specific PCA3 nucleic acid.
More specifically, a method of diagnosing the presence or predisposition to develop prostate cancer in a patient is provided herein.
The screening and diagnostic methods of the invention do not require that the entire PCA3 sequence be used for the probe. Father, it is only necessary to use a fragment or length of nucleic acid that is sufficient to detect the presence of the PCA3 nucleic acid from a normal or affected individual, the absence of such nucleic acid, or an altered structure of such nucleic acid (such as an aberrant splicing pattern). Preferably, any of the probes as described above are used.
The present invention is described in further detail in the following non-limiting examples.
EXAI~IPLE 1 Gandini et al. claim that the pxostate-specific expression of PCA3 is restricted to exon 4 of the PCA3 gene (1). The authors show that RT-PCR amplification of the PCA3 transcript using primers specific for axons 1 and 3 also amplified a PCA3-specific product in several non-prostate tissues and cell lines. After our first description of the PCA3 gene (2), we now use the axon 1 forward and axon 3 reverse PCR primers exactl as being described in the letter by Gandini et czl. In the past four years we have amplified PCA3 in many samples using these primers, and have yet to observe non-prostatic expression of PCA3.
Although it is not cleax from the letter how many cycles of PCR amplification Gandini et al. performed, we never used more than 35 rounds of amplification.
We cannot exclude that using more rounds o:E" amplification low levels of expression will be detected. These levels of expression would be far below those observed in prostate cancer, normal prostate and even prostate cancer cell lines.
One interesting obser~ration made in our laboratory is that we could amplify PCA3 in non-prostatic tissues, using PCA3-specific primers spanning axons 3 and 4 (Fig.I). The level of expressi~n is lower than in normal prostatic tissue and far below the expression in prostate cancer tissue.
Strikingly, the PCA3 transcripts in non-prostatic tissues are NOT spliced like they are in prostate-derived samples. In normal prostatic tissue the non-spliced transcript is expressed at low levels. In prostate tumor tissue the non-spliced variant is not expressed or not detectable due to the high overexpression of spliced PCA3 that may be preferentially amplified in the PCR reactions. In RNA samples not subjected to reverse transcription, no amplification product was found (data not shown), indicating that the non-spliced PCA3 PCR products were not attributable to DNA contamination.
Several explanations for the presence of non-spliced PCA3 transcripts can be postulated (Fig.2). Firstly, in prostatic tissues the PCA3 transcript may be tissue-specifically spliced, a phenomenon that has been described far several other genes (3). Secondly, an alternative ubiquitous promoter may exist in the PCA3 gene, resulting in a second transcript that is not prostate-specific.
This option seems less likely, since the transcript is not spliced despite the strong splice consensus sequences flanking the PCA3 axons (2). Thirdly, a ubiquitous promoter may be present at the 3' end of the PCA.3 gene in reverse orientation, leading to an antisense PCA3 transcript in most tissues. It has recently been reported that antisense transcription occurs widespread in the human genome (4), and therefore it is not unlikely that an antisense PCA3 transcript exists.
Such antisense transcripts are often involved in gene regulation processes (4).

Therefore, such a putative PCA3 antisense transcript may be involved in the regulation of the PCA3 transcription in prostate cells, or vice versa in prostate cells the PCA3 transcript may affect tlie, so far unidentified, antisense transcribed gene. Currently, we are investigating whether alternative splicing or alternative transcription initiation mechanisms are responsible for the observed non-prostatic PCA3-like transcript.
Example 2 PCA3 expression by RT-PCR
With respect to figure 3, transcription of the PCA3 gene of a PCA3-like gene is evident in tissues other than the prostate. However, these transcripts are either not spliced or are complementary (i. e. antisense) to the PCA3 gene. We have yet to observe any alternatively spliced PCA3 variant (e.g. axon 1 to 3 product) in non-prostatic tissues. For the application of PCA3 as a marker for prostate cancer this has one major implication: preferred primers for the amplification of the PCA3 transcripts in patient samples should cross the large (16 kb) first intron. This region of the PCA3 gene may be present in the alternative non-spliced or antisense transcripts, but is lacking from the prostate-specific spliced form of PCA3. Therefore, using axon 1 to axon 3 or 4 primer pairs, only is one of the preferred means according to the present invention to detect amplified prostate-specific spliced form of PCA3 (especially in conditions whereby the large intron prevents amplification of this region in the non-spliced transcripts). We have developed two independent assays for the detection of PCA3 RNA in patient material, using an axon 1 forward and an axon 4 reverse primer and axon ~.-specific detection probes (5,6). The PCA3 detection assays have been applied on over 200 patient samples and have been shown to be very specific and sensitive with a strong negative predictive value (6). Analysis of over 100 control samples has yet to result in non-specific amplification products.
* * * * *
All publications mentioned hereinabove are hereby incorporated in their entirety by reference.
While the foregoing invention has been described in some detail for purposes of clarity and understanding, it will be appreciated by one skilled in the art from a reading of this disclosure that various changes in form and detail can be made without departing from the true scope of the invention and appended claims.

SEQUENCE LISTING
(1) GENERAL INFORMATION:
(i) APPLICANT: Nijmegen university (ii} TITLE OF INVENTION: SPECIFIC METHOD OF PROSTATE CANCER DETECTION
BASED ON PCA3, AND KITS THEREFOR
(iii) NUMBER OF SEQUENCES: 2 (2} INFORMATION FOR SEQ ID N0: 1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 2037 base pairs (B) TYPE: nucleic acid (C} STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi} SEQUENCE DESCRIPTION: SEQ ID N0: 1:

CCA CAC ACA CAG GAA GCA CAA AAG GAA GCA CAG AGA T'CC CTG GGA GAA 459 GGCCCAGGGG ATCTGTGAAC AGGCTGGGAA GCATCTCAAG ATCT'TTCCAG GGTTATACTT 1101 ACATGAGACAGCAAATACTA AAAGTGTAATTTGATT.ATAAGAGTTTAGATAAATATATGA 1701 AAAGGCAGGG AACCTCATAG TATCTTATAT AATATACTTC ATTTCTCTAT CTCTATCACA 1$21 (2) INFORMATION FOR SEQ ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 3582 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(xi) SEQUENCE DESCRIPTION: SEQ ID N0: 2:

CCC GAA

TCC CAT

GCC AGG

GTATAAAGTTAAAATGCTTAGCCTTGTACT GAGGC'I'GTATACAGCACAGC CTCTCCCCA'P1453 AAAGAAGGGA CACATATGAGATTCATCATC ACATGA.GACAGCAAATACTA AAAGTGTAAT1693 GGGCACGTTTGTAAGCCTGGGATGTGAAGCAAAGGCAGGGAACCTCATAGTATCTTATA'T1813 TGTACATGCC AAAGTGTGCC TCTCTCTCTT GACCCATTAT TTCAGACTTA AAACAAGCA'I' 2173 CTGGAAATGG ACAACCACAA TATGCATAAA TCTAAC'rCCT ACCATCAGCT ACACACTGCT 2353 AAATCCAACTCATTATCTTCTCTTTCTTTCACCTCC'CCTGCTCCTCTCCCTATATTACTG 3193 TGGATCATGCATGCAAGACTGCTGAAGCCAGAGGAT'GACTGATTACGCCTCATGGGTGGA 3313 CAGTGTCCTCTGCATCTCCCCTTTCTAATGAAGATCCATAGAATTTGCTA.CATTTGAGAA 3433 Although the present invention has been described hereinabove by way of preferred embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims.

References I. Gandini, O., Luci, L., Stigliano, A., Lucera, R., Di Silverio, F., Toscano, V., and Cardillo, M.R. Is DD3 a new prostate-specific gene? Anticancer Res., 23 (lA): 305-308, 2003.
2. Bussemakers, M.J., van Bokhoven, A., Verhaegh, G.W., Smi.t, F.P., Karthaus, H.F., Schalken, J.A., Debruyne, F.M., Ru, N., and Isaacs, W.B. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res., 59: 5975-5979, 1999.
IO 3. Black, D.L. Mechanisms of alternative pre-messenger RNA splicing. Annu.
Rev. Biochem., 2003, in press.
4. Yelin, R., Dahary, D., Sorek, R., Levanon, E.Y., Goldstein, O., Shoshan, A., Diber, A., Biton, S., Tamir, Y., Khosravi, R., Nemzer, S., Pinner, E., Walach, S., Bernstein, J., Savitsky, K., and Rotman, G. Widespread occurrence of IS antisense transcription in the human genome. I~'at. Biotechnol., 21: 379-386, 2003.
S. de Kok, J.B., Verhaegh, G.W., Roelofs, R.W., Hessels, D., Kiemeney, L.A., Aalders, T.W., Swinkels, D.W., and Schalken, J.A. PCA3, a very sensitive and specific marker for to detect prostate tumors. Cancer Res., 62: 2695-2698, 20 2002.

6. Hessels, D., Klein Gunnewiek, J., Oort, L, Karthaus, H.F.M., van Leenders, G.J.L., van Balken, B., Kiemeney, L.A., Witjes, J.A., and Schallcen, J.A.
PCA3-based molecular urine analysis for the diagnosis of prostate cancer.
Eur. Urol., 2003, in press.

Claims

1. A method to diagnose or prognose prostate cancer in a patient comprising amplifying a prostate cancer specific PCA3 RNA using a pair of primers, and detecting an amplification product derived therefrom, wherein said amplification product is associated with a presence of prostate cancer or predisposition thereto in said patient.

2. The method of claim 1, wherein said amplification product is generated from a PCA3 RNA which lacks at least one intron.

3. The method of claim 1 or 2, wherein one primer hybridizes to a sequence of exon 1 of PCA3.

4. The method of one of claims 1 to 3, wherein said pair of primers enables an amplification through an exon junction of PCA3.

5. The method of one of claims 1 to 4, further comprising a hybridization with a PCA3 specific probe.

6. The method of one of claims 1 to 5, wherein said probe is specific for an exon junction of PCA3.

7. The method of one of claim 1 to 6, wherein said PCA3 RNA is intron-less.

8. A diagnostic kit comprising a first container means containing a pair of primers according to the invention, designed to specifically amplify a prostate cancer-specific PCA3 RNA.