CA2414602A1 - Silicatein-mediated synthesis of amorphous silicates and siloxanes and their uses - Google Patents
Silicatein-mediated synthesis of amorphous silicates and siloxanes and their uses Download PDFInfo
- Publication number
- CA2414602A1 CA2414602A1 CA002414602A CA2414602A CA2414602A1 CA 2414602 A1 CA2414602 A1 CA 2414602A1 CA 002414602 A CA002414602 A CA 002414602A CA 2414602 A CA2414602 A CA 2414602A CA 2414602 A1 CA2414602 A1 CA 2414602A1
- Authority
- CA
- Canada
- Prior art keywords
- silicatein
- compounds
- silicates
- recombinant
- siloxanes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P3/00—Preparation of elements or inorganic compounds except carbon dioxide
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Tropical Medicine & Parasitology (AREA)
- Toxicology (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Silicates, Zeolites, And Molecular Sieves (AREA)
- Immobilizing And Processing Of Enzymes And Microorganisms (AREA)
- Silicon Polymers (AREA)
- Silicon Compounds (AREA)
- Formation Of Insulating Films (AREA)
- Enzymes And Modification Thereof (AREA)
- Detergent Compositions (AREA)
Abstract
Silicatein is an enzyme from silicate-producing organisms for the synthesis of the silica skeleton thereof. The invention relates to the use of well-expressed and highly-active silicatein from natural source silicatein, isolated after gene induction and silicatein fusion proteins for the synthesis of amorphous silicon dioxide (silicic acids and silicates), siloxanes and modifications of said compounds and the technical application thereof.
Description
Silicatein-mediated synthesis of amorphous silicates and siloxanes and their uses Description 1. State of the art Silicon is the second-most element of the earth's crust (more than 80% of the earth's crust consist out of silicates) and is present in all forms of different compounds.
Silicon compounds do not only represent most of the species of this class of minerals, but are also very important from an economical point of view. They are used in large scales and diverse forms. Class, porcelain, emaillie, clay products, cement and water glass are technically important materials that consist out of silicates. The catalytic properties of some of the silicates are used syntheti-cally. Their versatile uses are further expanded, if other elements, in particular aluminium, occupy some of the lattice positions that are otherwise occupied by silicon.
Feldspars and zeolithes, for example, belong to these alumo silicates; the importance of the latter is based in particular in their molecular sieve and ions exchange properties. Al- and Ca-silicates have become important as filling materials in the laque-, rubber-, plastics- and paper-industry, Mg-silicate (talcum) as an absorber and filling material in cosmetics and pharmaceuticals and al-kali-aluminium-silicates as exchange for phosphates in cleaning agents. For the setting of Portland cement, silicates play an important role. Since some silicates carry free OH-groups (analogous to the silanoles) on their surfaces, one can bind reactive groups thereto; these properties are used for immobilisation in the solid phase-technique.
1.l. Silicon dioxide Silicon dioxide (Si02) is a solid with a high melting point, which is present both in crystal-lised and amorphous forms. In all these forms of appearances, each silicon atom is tetraedri-cally surrounded by four oxygen-atoms (coordination number: 4). When crystallised, silicon-dioxide is present in different modifications (quartz, tridymite, cristobalite and others). The most common form of crystalline Si02 is quartz. Amorphous silicon dioxide minerals are, amongst others, achat, opal and flintstone. Quartz glass that is obtained by melting of quartz and slow cooling of the melted material does not anymore exhibit crystal surfaces. It is used for, amongst others, the production of quartz lamps (because of its permeability for ultraviolet ' , _2_ radiation), and heat resistant apparatuses. Furthermore, the shells of diatoms (diatomeen) con-sist out of amorphous Si02.
1.2. Silicic acids and silicates Silicon exhibits the coordination number 4 also in silicic acid and silicates.
The tetraedrically-built [Si02]4-ion tends to polymerisation by of Si04-subunits. In this case, two Si-atoms are bound to another linking by one O-atom.
From ortho-silicic acid, at first ortho-disilicic acid (gyro-silicic acid;
H6Si20~) is formed by splitting off water (condensation). Further condensation leads to the meta-silicic acids [(H2Si03)]" via the poly-silicic acids. In case of smaller numbers of Si04-units (n = 3, 4 or 6), by this also ring-shaped molecules can be formed.
The poly-silicic acids have an amorphous (unordered) structure.
The salts of the ortho-disilicic acids (ortho-silicates), having the structure MeZSi04, contain single [Si04]4- anions. The water-soluble alcalisilicates which can be obtained, for example, by melting of quarz with soda, brine or potassium carbonate, in addition to [Si04]4- anions, contain also [Si20~]6' and [Si301o]8' anions (and larger anions). Such "water glass" solutions, from which the solubilized particles can" be separated by dialysis at a membrane are suited, amongst others, for the cementation of glass and porcelain, for the impregnation of paper, as flame protective agent for wood and for the conservation of foods.
After the acidification of such an alkalisilicate solution, the acid molecules that have been formed out of the [Si04]4- and [SizO~]6- groups (and larger groups) by proton uptake, conden-sate with each other to form poly-silicic acids (see above), whereby the solution becomes gel-like. The polymers obtained at first consist out of chains or networks. Upon further progress of the condensation, three-dimensional structures are formed, which correspond to the com-position Si02.
The following classification can be obtained:
' ~ ~ , _3-1. Silicates with discrete anions:
a) Island-silicates: These are ortho-silicates with the anion [Si04]2~.
Example:
phenacit, olivin, zirconium.
b) Group-silicates: The Si04-tetraeders are linked to form short chain units.
Ex-amples: di-silicates with the anion [Si20~]6- and tri-silicates.
c) Ring-silicates: The Si04-tetraeders are arranged in ring form. Examples:
beni-toid (3-ring), axinite (4-ring), beryll (6-ring).
Silicon compounds do not only represent most of the species of this class of minerals, but are also very important from an economical point of view. They are used in large scales and diverse forms. Class, porcelain, emaillie, clay products, cement and water glass are technically important materials that consist out of silicates. The catalytic properties of some of the silicates are used syntheti-cally. Their versatile uses are further expanded, if other elements, in particular aluminium, occupy some of the lattice positions that are otherwise occupied by silicon.
Feldspars and zeolithes, for example, belong to these alumo silicates; the importance of the latter is based in particular in their molecular sieve and ions exchange properties. Al- and Ca-silicates have become important as filling materials in the laque-, rubber-, plastics- and paper-industry, Mg-silicate (talcum) as an absorber and filling material in cosmetics and pharmaceuticals and al-kali-aluminium-silicates as exchange for phosphates in cleaning agents. For the setting of Portland cement, silicates play an important role. Since some silicates carry free OH-groups (analogous to the silanoles) on their surfaces, one can bind reactive groups thereto; these properties are used for immobilisation in the solid phase-technique.
1.l. Silicon dioxide Silicon dioxide (Si02) is a solid with a high melting point, which is present both in crystal-lised and amorphous forms. In all these forms of appearances, each silicon atom is tetraedri-cally surrounded by four oxygen-atoms (coordination number: 4). When crystallised, silicon-dioxide is present in different modifications (quartz, tridymite, cristobalite and others). The most common form of crystalline Si02 is quartz. Amorphous silicon dioxide minerals are, amongst others, achat, opal and flintstone. Quartz glass that is obtained by melting of quartz and slow cooling of the melted material does not anymore exhibit crystal surfaces. It is used for, amongst others, the production of quartz lamps (because of its permeability for ultraviolet ' , _2_ radiation), and heat resistant apparatuses. Furthermore, the shells of diatoms (diatomeen) con-sist out of amorphous Si02.
1.2. Silicic acids and silicates Silicon exhibits the coordination number 4 also in silicic acid and silicates.
The tetraedrically-built [Si02]4-ion tends to polymerisation by of Si04-subunits. In this case, two Si-atoms are bound to another linking by one O-atom.
From ortho-silicic acid, at first ortho-disilicic acid (gyro-silicic acid;
H6Si20~) is formed by splitting off water (condensation). Further condensation leads to the meta-silicic acids [(H2Si03)]" via the poly-silicic acids. In case of smaller numbers of Si04-units (n = 3, 4 or 6), by this also ring-shaped molecules can be formed.
The poly-silicic acids have an amorphous (unordered) structure.
The salts of the ortho-disilicic acids (ortho-silicates), having the structure MeZSi04, contain single [Si04]4- anions. The water-soluble alcalisilicates which can be obtained, for example, by melting of quarz with soda, brine or potassium carbonate, in addition to [Si04]4- anions, contain also [Si20~]6' and [Si301o]8' anions (and larger anions). Such "water glass" solutions, from which the solubilized particles can" be separated by dialysis at a membrane are suited, amongst others, for the cementation of glass and porcelain, for the impregnation of paper, as flame protective agent for wood and for the conservation of foods.
After the acidification of such an alkalisilicate solution, the acid molecules that have been formed out of the [Si04]4- and [SizO~]6- groups (and larger groups) by proton uptake, conden-sate with each other to form poly-silicic acids (see above), whereby the solution becomes gel-like. The polymers obtained at first consist out of chains or networks. Upon further progress of the condensation, three-dimensional structures are formed, which correspond to the com-position Si02.
The following classification can be obtained:
' ~ ~ , _3-1. Silicates with discrete anions:
a) Island-silicates: These are ortho-silicates with the anion [Si04]2~.
Example:
phenacit, olivin, zirconium.
b) Group-silicates: The Si04-tetraeders are linked to form short chain units.
Ex-amples: di-silicates with the anion [Si20~]6- and tri-silicates.
c) Ring-silicates: The Si04-tetraeders are arranged in ring form. Examples:
beni-toid (3-ring), axinite (4-ring), beryll (6-ring).
2. Chain-silicates and ribbon-silicates. Chain-silicates consist out of chain-like Si04-tetraeders bound to each other; they are polymers of the anions [Si03]Z'. By linking several Si04-chains, ribbon-like molecules can be formed. Examples:
hornblende, as-bestos.
hornblende, as-bestos.
3. Layer-silicate (sheet-silicate): Layer-silicates contain even sheets made of Si04_ tet-raeders. These are held together by cations stored in-between. They are polymers of the anions [Sl4Olp]4-. Examples: talcum, caolinit.
4. Scaffold-silicates: In the scaffold-silicates, the tetraedic Si04-groups are bound to three-dimensional lattices. Examples: different modifications of silicon dioxide, like feldspatuses.
The condensation process that leads to the polysilicic acids or polysilicates, respectively, can be controlled by partial replacement of the OH-groups of the silicic acid by single-binding organyl residues, which do not participate in the condensation process (production of different silicones).
Synthetic silicic acids are amorphous, non-poisonous, and, in contrast to the crystalline Si02 modification, do not lead to the generation of a silicose.
General literature:
Hinz, Silicat-Lexikon (2"d vol.), Berlin: Adademie Verl. 1985 Liebau, Structural Chemistry of Silicates, Berlin: Springer 1985 Petzold and Hinz, Einfiihrung in die Grundlagen der Silicatchemie, Stuttgart:
Enke 1979 CD Rompp Chemie Lexikon - Version 1.0, Stuttgart/New York: Georg Thieme Verlag 1.3. Siloxanes, Silicones The methods that are used for the demonstration of silanoles and siloxanes according to the state of the art consist in that water is acting on organic silicon derivatives, such as trimethyl silicium chloride [(CH3)3SiC1], whereby first silanoles, such as trimethyl silanole, are formed:
(CH3)3SiC1 + H20 -~ (CH3)3Si-OH + HC1 From these, siloxanes, such as hexamethyl disiloxane [(CH3)3Si-O-Si(CH3)3] are generated by splitting off water:
2(CH3)3SiOH -~ (CH3)3S1-O-S1CH3)3 + H2O
Furthermore, compounds of high molecular weight with ring- or chain-like structures or three-dimensionally cross-linked macromolecules ("silicones") can be produced by reacting dimethyl or monomethyl silicon chloride with water (via the intermediate products dimethyl silanediol or methyl silanetriol, respectively):
(CH3)ZSiCIZ + 2 HZO ~ (CH3)ZSi(OH)2 + 2 HCl n(CH3)2Si(OH)2 -~ (CH3)zSiO" + n H20 The starting compounds R3SiOH (silanoles), R2Si(OH)2 (silandioles) and RSi(OH)3 (silantri-oles) as used for the demonstration of additional silicones, are commonly produced by hy-drolysis of the respective halogene compounds R3SiC12, and RZSiCI3 (R = ethyl, propyl, phenylgroups and others).
The condensation process that leads to the polysilicic acids or polysilicates, respectively, can be controlled by partial replacement of the OH-groups of the silicic acid by single-binding organyl residues, which do not participate in the condensation process (production of different silicones).
Synthetic silicic acids are amorphous, non-poisonous, and, in contrast to the crystalline Si02 modification, do not lead to the generation of a silicose.
General literature:
Hinz, Silicat-Lexikon (2"d vol.), Berlin: Adademie Verl. 1985 Liebau, Structural Chemistry of Silicates, Berlin: Springer 1985 Petzold and Hinz, Einfiihrung in die Grundlagen der Silicatchemie, Stuttgart:
Enke 1979 CD Rompp Chemie Lexikon - Version 1.0, Stuttgart/New York: Georg Thieme Verlag 1.3. Siloxanes, Silicones The methods that are used for the demonstration of silanoles and siloxanes according to the state of the art consist in that water is acting on organic silicon derivatives, such as trimethyl silicium chloride [(CH3)3SiC1], whereby first silanoles, such as trimethyl silanole, are formed:
(CH3)3SiC1 + H20 -~ (CH3)3Si-OH + HC1 From these, siloxanes, such as hexamethyl disiloxane [(CH3)3Si-O-Si(CH3)3] are generated by splitting off water:
2(CH3)3SiOH -~ (CH3)3S1-O-S1CH3)3 + H2O
Furthermore, compounds of high molecular weight with ring- or chain-like structures or three-dimensionally cross-linked macromolecules ("silicones") can be produced by reacting dimethyl or monomethyl silicon chloride with water (via the intermediate products dimethyl silanediol or methyl silanetriol, respectively):
(CH3)ZSiCIZ + 2 HZO ~ (CH3)ZSi(OH)2 + 2 HCl n(CH3)2Si(OH)2 -~ (CH3)zSiO" + n H20 The starting compounds R3SiOH (silanoles), R2Si(OH)2 (silandioles) and RSi(OH)3 (silantri-oles) as used for the demonstration of additional silicones, are commonly produced by hy-drolysis of the respective halogene compounds R3SiC12, and RZSiCI3 (R = ethyl, propyl, phenylgroups and others).
Accordingly, siloxanes (silicones) can be grouped into:
a) linear polysiloxanes of the type R3SiO~R2Si0]"SiR3.
b) branched polysiloxanes which contain tri-functional or tetra-functional siloxane-units at their branching sites.
c) cyclic polysiloxanes which are built of bi-functional siloxane-units.
e) crosslinked polymers, wherein chain- or ring-form molecules are linked into two- or three-dimensional networks.
The viscosity of the high molecular weight silicones (silicone oils), which consist of chain-form macromolecules, increases with increasing chain length. Silicones play an important role as technical materials. Chains that are cross-linked to a low extent exhibit rubber-elasticity (silicone rubber; use: sealings and others), silicones that are highly cross-linked are resin-like (silicone resins).
Due to their hydrophobic (water-repellent) properties based on their organic portion, silicones are used for impregnation purposes (of textiles, paper and others).
1.4. Silicatein Some of the above-mentioned silicon compounds can only be produced in a cost-intensive manner or are present only in small amounts as mineral resources, respectively, and can there-fore only be isolated with considerable effort. The process of the chemical synthesis of sili-cates requires drastic conditions, such as high pressure and high temperature.
In contrast, with the aid of specific enzymes organisms (in particular sponges and algae) are able to form silicate scaffolds under natural conditions, i.e. at low temperature and low pres-sure. The advantages of this pathway are: high specificity, coordinated formation, adjustabil-ity, and the possibility for synthesizing nanostructures.
' , _6_ The isolation and purification of a silicate-forming enzyme (silicatein) was recently described for the first time: Shimizu, K., et al., Proc. Natl. Acad. Sci. USA 95: 6234-6238 (1998).
Nevertheless, this results in the problem that the isolation and the purification of the enzyme (silicatein) is time-consuming and laborious, and that only relatively low amounts can be achieved.
One possible approach is the synthesis of the recombinant protein (recombinante silicatein) with the aid of the known cDNA- or gene-sequence. This allows for the effective enzymatic synthesis of silicates.
In case of the production of the recombinant silicateins from the sponges Suberites domun-cula and Tethya aurantia, the problem occurred that by using the methods according to the state of the art only very low yields could be achieved and that the recombinant protein ex-hibited only low enzymatic activity. The present invention describes that, by specific modifi-cation of the expression conditions, recombinant silicatein can be produced in high yields and with high specific activity. Furthermore, the modified recombinant enzyme exhibits a higher pH and temperature stability than the natural one and the recombinant one having a complete cDNA-sequence. The modified recombinant protein furthermore exhibits an enzymatic activ-ity over a broad pH (4.5-10), in contrast to the natural and recombinant protein with complete cDNA-sequence that is active at pH-values in the neutral range (pH 7.0).
By way of production of a specific polyclonal antibody and subsequent coupling to a solid phase, a fast and effective affinity-chromatography purification of the enzyme can be achieved.
The use of fusion proteins and the application of different starting substrates lead to numerous possibilities for variations and technical applications.
-2. Production of silicatein 2.1. Production of recombinant silicatein 2.1.1. Cloning of the cDNA from marine sponges The silicatein protein derived from sponges contains characteristic sequence portions, several of which shall be mentioned: region around the serine-rich amino acid-cluster (in case of S.
domuncula: amino acids 267-277); region around the cysteine, the first amino acid of the catalytic triade (in case of S. domuncula: amino acid 138), which is absent in silicatein and present in the related enzymes cathepsines; region around the transition between propeptide and the processed peptide (in case of S. domuncula: amino acids 112/113).
The gene for silicatein can be identified from cDNA-libraries by using the technique of the polymerise-chain reaction, e.g. in ZapExpress and in Escherichia coli XL1-Blue MRF', using suitable degenerated primers (for example: reverse primer 5'-GAA/GCAG/CCGIGAIGAA/GTCA/GTAG/CAC-3' together with the 5'-vector-specific primer [region around amino acids 267-277] - or the forward primer at the same protein-segment together with the 3'-vector-specific primer); for this, a corresponding vector-specific primer is used. The sythesis product obtained in this way is used for screening in the respec-tive cDNA-library. Thereafter, the identified clones) is/are sub-cloned into a vector (for ex-ample pGem-~ and subsequently sequenced. As an example, Figure 1 depicts the cDNA for silicatein of Suberites domuncula.
2.1.2. Expression and isolation of the recombinant silicatein The production of recombinant silicatein is preferably performed in E coli XL1-Blue. Nev-ertheless, the production in yeast and in mammalian cells is possible and was successfully performed. For this, the cDNA is cloned into a corresponding vector, e.g. pQE-30. In addi-tion, other expression vectors have proven to be suitable as well. After transformation of E.
coli, the expression of silicatein is usually performed by induction with IPTG
(isopropyl-(3-D-thiogalactopyranoside) (Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Smith, J.A., Seidmann, J.G. and Struhl, K., (1995) Current Protocols in Molecular Biology, John Wiley -g and Sons, New York). The expression of silicatein as well as the purification of the recombi-nant proteins using, e.g., the histidin-tag present at the recombinant protein, can be performed on the corresponding affinity columns, e.g. a Ni-NTA-matrix (Skorokhod, A., Schacke, H., Diehl-Seifert, B., Steffen, R., Hofmeister A., and Miiller W.E.G. Cell. Mol.
Biol. 43:509-519;
1997).
The expression of the complete sequence of silicatein in E. coli can, nevertheless, only be achieved with very low yields. The following modifications of the expression conditions sur-prisingly led to drastic improvements of said yield:
1. By truncating the sequence coding for the N-terminal end of the protein, a more than 100-fold increase of the expression (in comparison to the expression of the complete cDNA) was achieved. Preferrably, the start is put into the region of the propeptide.
Nevertheless, also a truncation in the region of the "ripe" protein in front of the first potential disulfide bridge (commonly at the amino acid 135) leads to the desired strong expression (Figure 2).
2. Furthermore, a more than 20-fold increased expression of silicatein could be achieved using a truncated cDNA that codes for the C-terminal end of the protein, in compari-son to the expression of the complete cDNA (Figure 2). The truncation of the gene at its 3'-end in the region of the sequence behind the last potential disulfide bridge (commonly at the amino acid 319) has proven to be successful as well. There, a stop-codon is inserted.
3. A more than 40-fold increase of the expression in E. coli is achieved by adding a pro-tease inhibitor-cocktail during the lysis of the cells. The following protease inhibitor-cocktails have been advantageously used: antipain (10 pg), bestatin (5 pg/ml), chymo-statin ( 10 pg/ml), leupeptin ( 1 ~.g/ml), pepstatin ( 1 pg/ml), aprotinin ( 1 pg/ml). This step was particularly unexpected, since the protocol that is commonly used for the isolation of the recombinant proteins, like in the BugBuster extration kit (Novagen), does not provide for this.
' , _9-4. After the lysis of the E. coli-bacteria, the resulting solution is very viscous. An effi-cient isolation of the recombinant protein is achieved by the addition of enzymes for the digestion of the nucleic acids. For this, the nuclease "benzonase" is suited.
5. In case of an expression of silicatein in E. coli, commonly, the recombinant protein is found in the "inclusion bodies". Therefore, the recombinant protein must be converted in its "native" form. For this, the following method has proven to be suitable: the E.
coli-bacteria are lysed using a solution of the BugBuster extraction kit;
after washing, the "inclusion bodies" are recovered by centrifugation. The "inclusion bodies"
are washed several times using the so-called IB Wash Buffer of the "Protein Refolding Kit (Novagen)". The instructions as supplied with the, e.g., "Protein Refolding Kit" are used in order to convert the recombinant silicatein in its "native" form.
Using this and other comparable methods, the recombinant silicatein will, nevertheless, be degraded.
Surprisingly, this process can be avoided by the omission of the enzyme lysozym.
Commonly, this lysozym step is a fixed step in a protocol for the extraction of recom-binant proteins from E. coli. Its function is, to remove associated bacterial membranes from the recombnant proteins. The final purification of the recombinant silicatein can be performed using affinity matrices, such as Ni-NTA matrices.
After application of these amendments of the method, a surprisingly high expression in E. coli is achieved (more than 100-fold); now, yields of approximately 10 mg/100 ml bacterial cul-ture medium of recombinant silicatein can be achieved (Figure 3).
2.1.3. Expression and isolation of the recombinant silicatein from other silicate-forming or-ganisms.
According to the procedure as described above, the isolation, cloning and expression of the cDNA for silicatein from additional silicon dioxide-producing organisms can be performed, for example from diatoms (e.g. Cylindrotheca fusiformis). The extraction of diatoms in axenic cultures is state of the art (Kroger, N. Bergsdorf, C. and Sumper M. Europ. J.
Biochem.
239:259-264; 1996).
-10_ 2.2 Isolation and purification of silicatein from animals and single cell-organisms Silicatein is the enzyme that synthesizes amorphous silicate, e.g. in sponges.
Therefore, sili-catein can be obtained from said organisms. For this, e.g. the spiculae (consisting of amor-phous silicate) from the sponge Suberites domuncula can be obtained by dissociation of the tissue in Cap and Mgr'-free seawater. The spiculae are obtained by sedimentation. The amorphous silicate of the spiculae is removed in alcalic milieu, e.g. in diluted sodium hy-droxide. The organic fibrilles of the spiculae, which contain the silicatein, are obtained by centrifugation (e.g. 20.000 x g; 1 hour; 4°C). The protein is brought in solution by high salt concentration, such as e.g. 1 M NaCI, but also by means of the "Protein Refolding-Kit".
Subsequently, the silicatein is purified on an affinity matrix. The affinity matrix is produced by immobilizing a silicatein-specific antibody onto a solid phase (CNBr-activated sepharose or other suitable carriers), and purified. As antibodies monoclonal or polyclonal antibodies against the silicatein are used which are produced according to standard methods (Osterman, L.A. Methods of Protein and Nucleic Acid Research Vol. 2; Springer-Verlag [Berlin] 1984).
The coupling of the antibody to the matrix of the column is performed according to the rec-ommendations of the manufacturer (Pharmacia). The elution of the pure silicatein takes place by means of a pH-shift or shift of the ionic strength. In addition, other affinity matrices, such as polymer silicates oder polymer silicates/germanates, have been successfully used. The elu-tion of the silicatein from these matrices takes place at a pH at the isoelectric point of sili-catein (in case of the S. domuncula-silicatein at a pH of approximately 6).
Analogous isolations of silicatein from other silicon dioxide-producing organisms, such as diatoms (e.g. Cylindrotheca fusiformis) have been performed according to the above-depicted method.
Furthermore, the invention is novel in that the silicatein-gene can be induced with suitable silicate concentrations in medium (commonly 60 ~M) and by myotrophin (1 ~g/ml) (figure 4 A,B).
3. Detection of silicatein-activity and synthesis of silicon-alkoxy-compounds Measuring the enzymatic activity of the recombinant silicatein is usually performed as fol-lows. The recombinant silicatein is dialysed over night against a buffer that is suitable for the reaction, such as 25 mM Tris-HCI, pH 6,8 (other buffers within the pH-ranges of 4.5 to 10.5 are also suited).
Commonly, 1-60 ~g of recombinant silicatein are solubilized in 1 ml of a suitable buffer, such as 25 mM Tris-HCl (pH 6.8) and 1 ml of usually, 1-4.5 mM tetraethoxysilane-solution. The enzymatic reaction can be performed at room temperature - but also at temperatures between 5°C and about 65°C. The average time of incubation is 60 min.
During this time-span, usually 300 nmoles of amorphous silicate per 100 ~g silicatein are synthesised (as molybdate-reactive soluble silicate). For the detection of the silicate products, the material is centrifuged in a desk centrifuge (12 000 x g; 15 min; +4°C), washed with ethanol and air-dried. Subsequently, the sediment is hydrolysed with e.g. 1 M NaOH. Silicate that is developed is quantitatively meas-ured in the solution using a molybdate-supported detection method, such as e.g. the silicone-assays (Merck).
Surprisingly, it could be found that in addition to the substrate tetraethoxysilane, silicatein further polymerises additional silane-alkoxides.
The method according to the invention is novel in that the following compounds can be used for the silicatein-mediated syntheses: tetraalkoxysilanes, trialkoxysilanoles, dialkoxysilan-dioles, monoalkoxysilantrioles, alkyl- or aryl-trialkoxysilanes, alkyl- or aryl- dialkoxysilano-les or alkyl- or aryl-monoalkoxysilandioles or the respective (alkyl-or aryl-substituted) alkoxy compounds of gallium (IV), tin (IV) or lead (IV). Mixtures of these substrates are also recog-nized by the enzyme, and polymerised. Therefore, also mixed polymers can be produced.
For an increase of the activity of the enzyme silicatein, the substrates, such as tetraethoxysi-lane, are solubilized in dimethylsulfoxides in a stock solution of commonly 500 mM and sub-sequently diluted into the desired final concentration.
4. Coupling of cDNA for silicatein with one or several cDNA(s) (open reading frames) of other proteins 4.1. Production of silicatein fusion proteins Fusion proteins with silicatein are obtained as follows. A suitable expression vector (for ex-ample pQE-30) is used. The silicatein-cDNA - with e.g. a BamHI-restriction side at the 5'-terminus and e.g. a SaII-restriction side at the 3'-terminus - is produced.
The stop codon in the silicatein-cDNA is removed. For this, the PCR-technique is used and primers which exhibit the respective restriction sides, are used for the amplification. The cDNA for the second pro-tein is accordingly obtained, exhibiting at the 5'-terminus the same restriction side as present at the 3'-terminus of the silicatein-cDNA (in the example SaII) and at the 3'-terminus one that is different from the others (e.g. a HindIII-side). In case that internal restriction sides are pres-ent in the respective cDNAs, alternative restriction enzymes can be used. In addition, linkers in-between both cDNAs can be employed (figure SA).
These two cDNAs are ligiated, purified and ligiated into the pQE-30 vector (Quiagen) ac-cording to standard procedures. The ligiation occurs directly after the histidine-tag (approxi-mately 6 histidine-codons). The expression and purification of the fusion protein can be achieved as described above (section 2.1.2).
4.2. Separate expression I
Alternatively to the method that is described at 4.1., a protease cleavage site (such as e.g. an enterokinase side) can be cloned between the cDNA for the silicatein and the cDNA for the bioactive protein. In this case, a codon for a new start methionine can be inserted in front of the coding region of the gene for the bioactive protein. After expression and purification, the (fusion)-protein is cleaved proteolytically. Now, both proteins are separately present (figure SB).
4.3. Separated expression II (cassette-expression) Alternatively, both proteins can be expressed on one construct - but separately. For this, in an expression vector the gene for silicate is following the his-tag. A stop codon is inserted at the end of the silicatein cDNA. Between the cDNA of the silicatein and the cDNA
for a bioactive protein, a ribosome binding side with a codon for a start methionine is cloned. Again, a his-tag is preceding the cDNA for the bioactive protein. This gene is additionally provided with a stop codon (figure SC).
The his-tags can be deleted when the proteins are used for functional analyses in the respec-tive host cells.
4.4. Extensions Bacterial as well as eukaryotic cells can be used for the expression as described at 4.1 to 4.3.
The expression as described at 4.1 to 4.3 can also be employed for three or more open reading frames.
5. Uses of the produced silicateins and silicatein fusion-proteins 5.1. Use of silicatein for the modification of surfaces of biomaterials The biological reaction of organisms (or biological extracts/products) to biomaterials (ex-posed and/or implanted) is ruled to a large extend by their surface structure and chemistry.
Therefore, a need for methods for the modification of surfaces of such biomaterials exists. It is always the aim, to preserve the advantagous chemical-physical properties of the bio-molecules. Thus, only the outermost surfaces should be modified, since their biological inter-actions will be affected.
Surface-modified biomaterials (such as, for example, by silicone and siloxan-containing block-copolymers, "silanisation") find their use in influencing the cell adhesion and growth, for the modification of the compatibility of blood or for control of the protein adsorption (re-duction of the absorption of contact lenses, pretreatment of ELISA-plates). In particular, the silanisation for a modification of material surfaces can be used for the modification of hy-droxylated or amine-rich surfaces, such as, for example, surfaces of glass, silicon, germanium, aluminium, quartz and other metal oxides, which are rich in hydroxyl groups. A
literature-overview can be found in: B.D. Ratner et al. (editor) Biomaterials Science -An Introduction to Materials in Medicine. Academic Press, San Diego, 1996.
In doing so, nevertheless, the problem occurs that under the conditions that are applied during the production of these modifications, often harmful (destructive) effects occur for the bio-materials used.
The modifications of biomaterials that are solely based on biochemical reactions using the method of the invention (use of recombinant/purified silicatein) (silicatein-mediated enzy-matic synthesis of amorphous Si02-, siloxan- or siloxan-block-copolymers-containing sur-faces) represent a "mild" method in comparison to the physical/chemical methods that are used.
The modified area on the surface of the material should, in most cases, be as thin as possible since modified surface layers, that are too thick, can import the mechanical and functional properties of the materials. This can be achieved in a simple manner by varying the reaction time and the concentration of the substrate in the silicatein-mediated enzymatic reaction.
By means of the silicatein-mediated enzymatic reaction, a plurality of different biomaterials and in fact biomaterials, including polymers, metals, ceramics and glasses can be used that either naturally have a protein (silicatein)-binding surface or which have been made able to bind proteins by a preceding modification.
Silanes can form two kinds of surface-structures. Very thin (monolayer) layers, in case only traces of surface-absorbed water are present or, if more water is present, thicker silane-layers that consist out of Si-O groups which are bound to the surface and of silane-units that form a three-dimensional polymeric network. Such modifications, for example, can be produced by the treatment of hydroxylated surfaces using n-propyl-trimethyoxysilane.
General literature: Pleuddemann, E. P. (1980) Chemistry of silane coupling agents. In Si-lyated Surfaces (D. E. Leyden, editor) Gordon & Breach, New York, pp. 31-53).
By means of the silicatein-mediated enzymatic reaction, in addition several kinds of surface-structures can be formed on a plurality of different biomaterials - using mild conditions that prevents the biomaterials from damage - wherein, since enzymatically mediated, their synthe-sis takes place in a control manner.
In particular, the outcome of this is the use of the recombinant or a silicatein being purified from different sources for the production of surface-modifications of biomaterials with sili-cone-like properties (such as silicone-breast-implants) and in medical implants and endo-prothesises, as well as in contact lenses.
5.2. Use of silicatein for the encapsulation of biomolecules By means of the controlled synthesis of Si02 or siloxane-coatings using the recombinant or a silicatein being purified from different sources, the outcome of this is a use for the encapsula-tion of biomolecules (including proteins and nucleic acids) as well as bioactive molecules (including hormones, pharmaca and cytokines), with the aim, to modify or improve their bio-logical properties (such as protease and nuclease resistance, temperature stability) or their release (controlled "drug-delivery", in addition an enablement for a topical drug-delivery).
a) Increasing the protease resistance (and temperature stability) of proteins.
Approach: Covering the protein with a silicatein-coating (for example by cross-linking) that synthesises an Si02-coating.
b) Increasing the nuclease resistance (and temperature stability) of nucleic acids.
Approach: Covering the nucleic acid with a silicatein-coating (for example by cross-linking) which synthesises an SiOz-coating.
Using the above-described manner, a production of depot-forms for pharmaceuticals (includ-ing peptides/proteohormones and cytokines) is possible. For this, the pharmaceuticals (in-chiding peptides/proteohormones and cytokines) are first modified by a) cross-linking with silicatein or (in case of proteins) b) the production of fusion proteins with silicatein.
_ , CA 02414602 2002-12-24 Then, the silicatein-mediated syntheses of the capsule material will take place.
WO 96/14832 A1 1996-OS-23 (US 9514261 1995-11-06) discloses a method for the produc-tion of synthetic liposomes from polyphosphates, in order to for increase the uptake of phar-maceuticals ("drug-delivery"). By design of such a liposome-stabilising coating, using sili-catein, the efficiency of the method can be increased.
Furthermore, this results in a use of the recombinant or a silicatein being purified from differ-ent sources in the production of new biomaterials (or composite-materials), such as replace-ment materials for bones or dental replacement materials by co-synthesising polysilicates, silicons or mixed polymers (produced by means of the recombined/purified silicatein) and polyphosphates (produced by means of the recombinant polyphosphate-kinase).
5.3. Use of silicatein for the encapsulation of cellsltissues in transplantations The controlled synthesis of Si02 or siloxane-coatings by means of the recombinant or a silicat being purified from different sources can also be used for the encapsulation of cells in trans-plantations (improvement of the biocompatibility).
This can be performed by coating the cells with silicatein or via the expression of silicatein-fusion proteins on the cell-surface.
5.4. Use of silicatein for surface-modification (treatment of contact zones) of (silicon)-semiconductors or silicon-chips and their use The recombinant as well as a silicatein being purified from different sources can also be used for the surface-modification of (silicon or germanium)-semiconductors or (silicon or germa-nium)-biosensor-chips. By this, a connection with cells or other structures consisting of or-ganic material can be achieved. These "matrices" can be used for measuring the electric prop-erties of cells. Such silicatein-modified semiconductors (or silicon-microchips) can also be used as biosensors.
5. 5 Use of silicatein for synthesis of silicon-containing gems and semi precious stones The recombinant as well as a silicatein being purified from different sources, is able to form amorphous Si02. Achat, jaspis, onyx and others belong to the amorphous or fine crystalline modifications of the SiOz (opals); respectively. The possibility to synthesise amorphous Si02 with the aim of the recombinant or a silicatein being purified from different sources under controlled conditions, whereby controllably foreign molecules/atoms can be introduced, con-sequently results in the use of the method according to the invention for the production of the above-mentioned and other gems/semi-precious stones.
With the aid of the recombinant or a silicatein being purified from different sources, it is also possible to apply thin Si0 and Si02-layers onto semiconductor-supports (for the production of integrated circuits) under controlled conditions.
5.6. Use of silicatein for the synthesis of silicon (gallium-, tin- or lead )-compounds (includ ing so-called sila pharmaca) Silicon is known as a trace element that is apparently needed for the formation of connective tissues and bones (mineralisation). The production of silicon-organic compounds as a basis for so-called sila-pharmaca (pharmaca, wherein C is replaced with Si, 'exhibiting differences in the mode of action for the organism) is of medical interest [see: Chem.
unserer Zeit 14, 197-207 (1980), as well as: Bioactive Organo-Silicon Compounds (Topics Curr.
Chem. 84), Berlin, Springer 1979)]; the synthesis of such compounds using mild (enzymatic) conditions is possible by means of the method according to the invention (use of the recombinant or puri-fied silicatein from different sources).
Additional uses of silicon-compounds being synthesised with the aid of the method according to the invention under mild (enzymatic) conditions (use of the recombinant or purified seli-catein from different sources) in medicine and cosmetics are: use of silicon-compounds that are accordingly synthesised as ingredient or basis of ointments, as well as parts of tooth pastes [for use in cosmetics, see: Parfum. Kosmet. 67, 232-239, 326-336, 384-389 (1986); 68,195-203 (1987)].
° -18-The silicon-compounds that are synthesised with the aid of the methods according to the in-vention under mild (enzymatic) conditions (use of the recombinant or silicateines being puri-fied from different sources) can be also used for additional purposes:
lubricants (processing of plastics), grease (plastic gears), anti-foaming compounds, mold release agents (providing hy-drophobicity to glass, ceramics, textiles, leather) and dielectrica (e.g. in transformators).
The compounds as synthesised with the aid of the method according of the invention also in-clude the siloxane-resins that are used in standard techniques, such as (more or less cross-linked) polymethyl or polymethylphenylsiloxanes.
The silantrioles RSi(OH)3 formed by condensation during the course of the silicatein-mediated catalysis lead to the synthesis of sheet-structure-like polymers of the gross compo-sition RZS12O3. The degree of cross-linking and the extension of these polymers can be varied by the controlled admixture of silandioles and silanoles. Thus, enzymatically tailored silicone structures can be produced having characteristic and regulateble properties.
The siloxane-scaffold can be linked to different kinds of hydrocarbon-residues. By this, its properties can be modified.
Due to their heat-resistibility and hydrophobicity, the silicones synthesised by the silicatein-mediated catalysis (not harmful according to experience) can be also used in cosmetic skin-care and plastic surgery.
General literature: Brinker et al., Polydimethylsiloxane in der Lebens- and Genul3mittelin-dustrie, Miinchen: Dow Corning 1981.
5.7. Modification of the properties of cells by transfection with a silicatein-gene%DNA-containing plasmid By transfection of cells with a silicatein-gene/cDNA-containing plasmid, the properties of the cells can be changed, resulting in a use in the production of bone replacement materials (ad-ditionally by the co-polymerisation of silicatein-synthesised Si02 and polyphosphates, pro-duced by transfection with a polyphosphate-kinase-cDNA containing plasmid).
5.8. Use of recombinant silicatein for the synthesis of nano-structures from amorphous silicon dioxide By means of the recombinant silicateins, the recombinant silicatein-fusion proteins or the pu-rified silicatein, it is possible to synthesise specific two- and three-dimensional, sieve-, net-, cage- or otherwise formed structures from amorphous silicon dioxide, siloxanes or other sili-con (IV)- [or gallium (IV)-, tin (IV)- or lead (IV)-]-compounds in a nanoscale wherein mac-romolecules (synthetic polymers or biopolymers) that are associated with these enzymes are used as "guiding tracks" for the synthesis. Such syntheses are also possible by using sponges or other silicatein-producing organisms kept in mariculture or in tanks, as well as organisms modified with genetic technology that initially are not able to synthesise silicate. The struc-tures being formed can be used in nano-technology (for example as a "miniature sieve" for separation processes in nanoscale).
Lesends to the figures In the following, the explanatory legends for the accompanying drawings are given. The fig-ores show:
Fisure 1:
cDNA together with deduced amino acid sequence for the suberites domuncula-silicatein.
Figure 2:
Amino acid sequence of silicatein from the sponge suberites domuncula. Some sites at the protein are indicated [ ] that, after truncation of the cDNA, lead to a strong increase of the expression of the recombinant protein. In addition, the amino acids of the catalytic triad (CT) as well as the cysteine-units are marked (~) that potentially lead to disulfide bridges.
Figure 3:
Production of a recombinant silicatein-protein in E. coli. According to the method as indi-cated, the pure silicatein was obtained from crude extracts. Lane a: protein extract from non-induced cells [- IPTG]; lane b and lane c: protein extract from induced cells [+ IPTG], 2.5 hours (lane b) and 8 hours (lane c) after addition of IPTG. Lane d: soluble protein extract of bacterial lysates after expression for 8 hours. Lane e: protein extract of the inclusion bodies.
. CA 02414602 2002-12-24 Lane f: purified silicatein derived from the inclusion bodies after purification of the protein on a Ni-NTA matrix. The molecular weight of the recombinant silicatein is approximately 33 kDa. On the left side, the molecular weight markers are indicated.
Fieure 4:
(A) Concentration of transcripts for silicatein in primmorphs of S. domuncula.
Primmorphs, which have formed from single cells after 5 day-incubation were incubated for 0 (controls;
Con) to 5 days, either in the absence of exogeneous silicate (minus silicate) or in the presence of 60 ~M Na-silicate (plus silicate). Then, the RNA was extracted and 5 ~,g of the total RNA
were separated according to its size; after the blot-transfer, the hybridisation with the sili-catein-probe of S. domuncula (SUBDOSILICA) was performed. (B) Effect of recombinant myotrophin on the expression of silicatein and primmorphs. The primmorphs were incubated for 0 (controls) up to 5 days in the absence (minus myotrophin) or presence of 1 ~g/ml my-trophin (plus myotrophin). Then, Nothern-Blotting using the SUBDOSILICA-probe for de-termining the extent of expression of silicatein was performed.
Figure 5:
Co-expression of silicatein and the gene that codes for a bioactive substance (scheme). A.
Production of the fusion protein silicatein-bioactive protein. Both cDNAs [silicatein and bio-active protein] were ligiated via a restriction site (e.g. SaII) and subsequently cloned into the restriction sites BamHI and HindIII of the vector pQE-30. The histidine-tag is located at the 5'-terminus. B. Separate protein expression. Both cDNAs were cloned into a suitable vector via a protease-restriction site. After expression and purification, the fusion protein is obtained separately by protease-digestion. C. Separate protein expression (as cassette-expression).
Both cDNAs are separately expressed from the same construct and purified using the His-tags.
, CA 02414602 2002-12-24 SEQUENCE LISTING
<110> E.G.
Muller, Werner <120> catein-mediated Sili synthesis of amorph silicates and siloxanes and uses <130> 16PCT
<140> EPO1/08423 PCT/
<141> -07-20 <160>
<170> ntIn version Pate 3.1 <210>
<211>
<212>
DNA
<213>
Suberites domuncula <400>
gaggatagaaagtctacaatctgtaaggacaatgcttgtcacagtggtagtactgggtct60 actggggtttgcttctgcagcccagcccaagtttgaatttgtagaagaatggcagctgtg.120 gaagtccactcactctaagatgtacgagtcacagttaatggaactcgaaagacatctgac180 gtggctctccaataagaaatatatcgagcaacacaatgtcaactcacacattttcggttt240 tactctggcaatgaaccagtttggagatctgagtgaattggagtatgctaactatcttgg300 ccagtatcgcattgaggataaaaaatctggcaactactcaaagacttttcagcgtgatcc360 tctacaggactaccctgaagctgtagactggagaaccaaaggagctgtcacggctgtcaa420 ggaccagggagactgtggtgctagctatgctttcagtgctatgggtgctttggagggtgc480 taatgctttagccaagggaaatgcagtatctctcagtgaacagaacatcattgattgctc540 gattccttacggtaaccacggttgtcatggaggcaatatgtatgatgcttttttgtatgt600 catcgctaacgagggggtcgatcaggacagtgcatatccatttgtaggaaagcaatccag660 ctgcaactataatagtaaatacaaaggtacatcaatgtcggggatggtgtcaatcaaaag720 tggtagtgagtctgacttacaagcagctgtttcaaacgttggccctgtatctgttgctat780 tgatggtgctaacagtgccttcaggttttactacagtggtgtctatgactcatcacgatg840 ctctagtagtagtcttaaccacgcaatggtagtcactggatacggatcatacaatgggaa900 aaaatactggctggccaagaatagctggggaactaactggggtaacagtggctatgtgat960 gatggctcgcaacaagtacaaccagtgtggaattgctaccgatgcatcttatcccaccct1020 ataaacttatatatatatagtcttagaaacattatccttttctttacccttgtctctata1080 ggccatagagtgattgtaggctgtttgcatttgatgactgtatataccctatcatttttt1190 gtgattctatctgattaaaaatcccatacccgaccaaaccatcaatttatcaaatcatga1200 <210>
<211>
<212>
PRT
. . , _2_ <213> Suberites domuncula <400> 2 Met Leu Val Thr Val Val Val Leu Gly Leu Leu Gly Phe Ala Ser Ala Ala Gln Pro Lys Phe Glu Phe Val Glu Glu Trp Gln Leu Trp Lys Ser Thr His Ser Lys Met Tyr Glu Ser Gln Leu Met Glu Leu Glu Arg His Leu Thr Trp Leu Ser Asn Lys Lys Tyr Ile Glu Gln His Asn Val Asn Ser His Ile Phe Gly Phe Thr Leu Ala Met Asn Gln Phe Gly Asp Leu Ser Glu Leu Glu Tyr Ala Asn Tyr Leu Gly Gln Tyr Arg Ile Glu Asp Lys Lys Ser Gly Asn Tyr Ser Lys Thr Phe Gln Arg Asp Pro Leu Gln Asp Tyr Pro Glu Ala Val Asp Trp Arg Thr Lys Gly Ala Val Thr Ala Val Lys Asp Gln Gly Asp Cys Gly Ala Ser Tyr Ala Phe Ser Ala Met Gly Ala Leu Glu Gly Ala Asn Ala Leu Ala Lys Gly Asn Ala Val Ser Leu Ser Glu Gln Asn Ile Ile Asp Cys Ser Ile Pro Tyr Gly Asn His Gly Cys His Gly Gly Asn Met Tyr Asp Ala Phe Leu Tyr Val Ile Ala Asn Glu Gly Val Asp Gln Asp Ser Ala Tyr Pro Phe Val Gly Lys Gln Ser Ser Cys Asn Tyr Asn Ser Lys Tyr Lys Gly Thr Ser Met Ser Gly Met Val Ser Ile Lys Ser Gly Ser Glu Ser Asp Leu Gln Ala Ala Val . . , _3_ Ser Asn Val Gly Pro Val Ser Val Ala Ile Asp Gly Ala Asn Ser Ala Phe Arg Phe Tyr Tyr Ser Gly Val Tyr Asp Ser Ser Arg Cys Ser Ser Ser Ser Leu Asn His Ala Met Val Val Thr Gly Tyr Gly Ser Tyr Asn Gly Lys Lys Tyr Trp Leu Ala Lys Asn Ser Trp Gly Thr Asn Trp Gly Asn Ser Gly Tyr Val Met Met Ala Arg Asn Lys Tyr Asn Gln Cys Gly Ile Ala Thr Asp Ala Ser Tyr Pro Thr Leu
a) linear polysiloxanes of the type R3SiO~R2Si0]"SiR3.
b) branched polysiloxanes which contain tri-functional or tetra-functional siloxane-units at their branching sites.
c) cyclic polysiloxanes which are built of bi-functional siloxane-units.
e) crosslinked polymers, wherein chain- or ring-form molecules are linked into two- or three-dimensional networks.
The viscosity of the high molecular weight silicones (silicone oils), which consist of chain-form macromolecules, increases with increasing chain length. Silicones play an important role as technical materials. Chains that are cross-linked to a low extent exhibit rubber-elasticity (silicone rubber; use: sealings and others), silicones that are highly cross-linked are resin-like (silicone resins).
Due to their hydrophobic (water-repellent) properties based on their organic portion, silicones are used for impregnation purposes (of textiles, paper and others).
1.4. Silicatein Some of the above-mentioned silicon compounds can only be produced in a cost-intensive manner or are present only in small amounts as mineral resources, respectively, and can there-fore only be isolated with considerable effort. The process of the chemical synthesis of sili-cates requires drastic conditions, such as high pressure and high temperature.
In contrast, with the aid of specific enzymes organisms (in particular sponges and algae) are able to form silicate scaffolds under natural conditions, i.e. at low temperature and low pres-sure. The advantages of this pathway are: high specificity, coordinated formation, adjustabil-ity, and the possibility for synthesizing nanostructures.
' , _6_ The isolation and purification of a silicate-forming enzyme (silicatein) was recently described for the first time: Shimizu, K., et al., Proc. Natl. Acad. Sci. USA 95: 6234-6238 (1998).
Nevertheless, this results in the problem that the isolation and the purification of the enzyme (silicatein) is time-consuming and laborious, and that only relatively low amounts can be achieved.
One possible approach is the synthesis of the recombinant protein (recombinante silicatein) with the aid of the known cDNA- or gene-sequence. This allows for the effective enzymatic synthesis of silicates.
In case of the production of the recombinant silicateins from the sponges Suberites domun-cula and Tethya aurantia, the problem occurred that by using the methods according to the state of the art only very low yields could be achieved and that the recombinant protein ex-hibited only low enzymatic activity. The present invention describes that, by specific modifi-cation of the expression conditions, recombinant silicatein can be produced in high yields and with high specific activity. Furthermore, the modified recombinant enzyme exhibits a higher pH and temperature stability than the natural one and the recombinant one having a complete cDNA-sequence. The modified recombinant protein furthermore exhibits an enzymatic activ-ity over a broad pH (4.5-10), in contrast to the natural and recombinant protein with complete cDNA-sequence that is active at pH-values in the neutral range (pH 7.0).
By way of production of a specific polyclonal antibody and subsequent coupling to a solid phase, a fast and effective affinity-chromatography purification of the enzyme can be achieved.
The use of fusion proteins and the application of different starting substrates lead to numerous possibilities for variations and technical applications.
-2. Production of silicatein 2.1. Production of recombinant silicatein 2.1.1. Cloning of the cDNA from marine sponges The silicatein protein derived from sponges contains characteristic sequence portions, several of which shall be mentioned: region around the serine-rich amino acid-cluster (in case of S.
domuncula: amino acids 267-277); region around the cysteine, the first amino acid of the catalytic triade (in case of S. domuncula: amino acid 138), which is absent in silicatein and present in the related enzymes cathepsines; region around the transition between propeptide and the processed peptide (in case of S. domuncula: amino acids 112/113).
The gene for silicatein can be identified from cDNA-libraries by using the technique of the polymerise-chain reaction, e.g. in ZapExpress and in Escherichia coli XL1-Blue MRF', using suitable degenerated primers (for example: reverse primer 5'-GAA/GCAG/CCGIGAIGAA/GTCA/GTAG/CAC-3' together with the 5'-vector-specific primer [region around amino acids 267-277] - or the forward primer at the same protein-segment together with the 3'-vector-specific primer); for this, a corresponding vector-specific primer is used. The sythesis product obtained in this way is used for screening in the respec-tive cDNA-library. Thereafter, the identified clones) is/are sub-cloned into a vector (for ex-ample pGem-~ and subsequently sequenced. As an example, Figure 1 depicts the cDNA for silicatein of Suberites domuncula.
2.1.2. Expression and isolation of the recombinant silicatein The production of recombinant silicatein is preferably performed in E coli XL1-Blue. Nev-ertheless, the production in yeast and in mammalian cells is possible and was successfully performed. For this, the cDNA is cloned into a corresponding vector, e.g. pQE-30. In addi-tion, other expression vectors have proven to be suitable as well. After transformation of E.
coli, the expression of silicatein is usually performed by induction with IPTG
(isopropyl-(3-D-thiogalactopyranoside) (Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Smith, J.A., Seidmann, J.G. and Struhl, K., (1995) Current Protocols in Molecular Biology, John Wiley -g and Sons, New York). The expression of silicatein as well as the purification of the recombi-nant proteins using, e.g., the histidin-tag present at the recombinant protein, can be performed on the corresponding affinity columns, e.g. a Ni-NTA-matrix (Skorokhod, A., Schacke, H., Diehl-Seifert, B., Steffen, R., Hofmeister A., and Miiller W.E.G. Cell. Mol.
Biol. 43:509-519;
1997).
The expression of the complete sequence of silicatein in E. coli can, nevertheless, only be achieved with very low yields. The following modifications of the expression conditions sur-prisingly led to drastic improvements of said yield:
1. By truncating the sequence coding for the N-terminal end of the protein, a more than 100-fold increase of the expression (in comparison to the expression of the complete cDNA) was achieved. Preferrably, the start is put into the region of the propeptide.
Nevertheless, also a truncation in the region of the "ripe" protein in front of the first potential disulfide bridge (commonly at the amino acid 135) leads to the desired strong expression (Figure 2).
2. Furthermore, a more than 20-fold increased expression of silicatein could be achieved using a truncated cDNA that codes for the C-terminal end of the protein, in compari-son to the expression of the complete cDNA (Figure 2). The truncation of the gene at its 3'-end in the region of the sequence behind the last potential disulfide bridge (commonly at the amino acid 319) has proven to be successful as well. There, a stop-codon is inserted.
3. A more than 40-fold increase of the expression in E. coli is achieved by adding a pro-tease inhibitor-cocktail during the lysis of the cells. The following protease inhibitor-cocktails have been advantageously used: antipain (10 pg), bestatin (5 pg/ml), chymo-statin ( 10 pg/ml), leupeptin ( 1 ~.g/ml), pepstatin ( 1 pg/ml), aprotinin ( 1 pg/ml). This step was particularly unexpected, since the protocol that is commonly used for the isolation of the recombinant proteins, like in the BugBuster extration kit (Novagen), does not provide for this.
' , _9-4. After the lysis of the E. coli-bacteria, the resulting solution is very viscous. An effi-cient isolation of the recombinant protein is achieved by the addition of enzymes for the digestion of the nucleic acids. For this, the nuclease "benzonase" is suited.
5. In case of an expression of silicatein in E. coli, commonly, the recombinant protein is found in the "inclusion bodies". Therefore, the recombinant protein must be converted in its "native" form. For this, the following method has proven to be suitable: the E.
coli-bacteria are lysed using a solution of the BugBuster extraction kit;
after washing, the "inclusion bodies" are recovered by centrifugation. The "inclusion bodies"
are washed several times using the so-called IB Wash Buffer of the "Protein Refolding Kit (Novagen)". The instructions as supplied with the, e.g., "Protein Refolding Kit" are used in order to convert the recombinant silicatein in its "native" form.
Using this and other comparable methods, the recombinant silicatein will, nevertheless, be degraded.
Surprisingly, this process can be avoided by the omission of the enzyme lysozym.
Commonly, this lysozym step is a fixed step in a protocol for the extraction of recom-binant proteins from E. coli. Its function is, to remove associated bacterial membranes from the recombnant proteins. The final purification of the recombinant silicatein can be performed using affinity matrices, such as Ni-NTA matrices.
After application of these amendments of the method, a surprisingly high expression in E. coli is achieved (more than 100-fold); now, yields of approximately 10 mg/100 ml bacterial cul-ture medium of recombinant silicatein can be achieved (Figure 3).
2.1.3. Expression and isolation of the recombinant silicatein from other silicate-forming or-ganisms.
According to the procedure as described above, the isolation, cloning and expression of the cDNA for silicatein from additional silicon dioxide-producing organisms can be performed, for example from diatoms (e.g. Cylindrotheca fusiformis). The extraction of diatoms in axenic cultures is state of the art (Kroger, N. Bergsdorf, C. and Sumper M. Europ. J.
Biochem.
239:259-264; 1996).
-10_ 2.2 Isolation and purification of silicatein from animals and single cell-organisms Silicatein is the enzyme that synthesizes amorphous silicate, e.g. in sponges.
Therefore, sili-catein can be obtained from said organisms. For this, e.g. the spiculae (consisting of amor-phous silicate) from the sponge Suberites domuncula can be obtained by dissociation of the tissue in Cap and Mgr'-free seawater. The spiculae are obtained by sedimentation. The amorphous silicate of the spiculae is removed in alcalic milieu, e.g. in diluted sodium hy-droxide. The organic fibrilles of the spiculae, which contain the silicatein, are obtained by centrifugation (e.g. 20.000 x g; 1 hour; 4°C). The protein is brought in solution by high salt concentration, such as e.g. 1 M NaCI, but also by means of the "Protein Refolding-Kit".
Subsequently, the silicatein is purified on an affinity matrix. The affinity matrix is produced by immobilizing a silicatein-specific antibody onto a solid phase (CNBr-activated sepharose or other suitable carriers), and purified. As antibodies monoclonal or polyclonal antibodies against the silicatein are used which are produced according to standard methods (Osterman, L.A. Methods of Protein and Nucleic Acid Research Vol. 2; Springer-Verlag [Berlin] 1984).
The coupling of the antibody to the matrix of the column is performed according to the rec-ommendations of the manufacturer (Pharmacia). The elution of the pure silicatein takes place by means of a pH-shift or shift of the ionic strength. In addition, other affinity matrices, such as polymer silicates oder polymer silicates/germanates, have been successfully used. The elu-tion of the silicatein from these matrices takes place at a pH at the isoelectric point of sili-catein (in case of the S. domuncula-silicatein at a pH of approximately 6).
Analogous isolations of silicatein from other silicon dioxide-producing organisms, such as diatoms (e.g. Cylindrotheca fusiformis) have been performed according to the above-depicted method.
Furthermore, the invention is novel in that the silicatein-gene can be induced with suitable silicate concentrations in medium (commonly 60 ~M) and by myotrophin (1 ~g/ml) (figure 4 A,B).
3. Detection of silicatein-activity and synthesis of silicon-alkoxy-compounds Measuring the enzymatic activity of the recombinant silicatein is usually performed as fol-lows. The recombinant silicatein is dialysed over night against a buffer that is suitable for the reaction, such as 25 mM Tris-HCI, pH 6,8 (other buffers within the pH-ranges of 4.5 to 10.5 are also suited).
Commonly, 1-60 ~g of recombinant silicatein are solubilized in 1 ml of a suitable buffer, such as 25 mM Tris-HCl (pH 6.8) and 1 ml of usually, 1-4.5 mM tetraethoxysilane-solution. The enzymatic reaction can be performed at room temperature - but also at temperatures between 5°C and about 65°C. The average time of incubation is 60 min.
During this time-span, usually 300 nmoles of amorphous silicate per 100 ~g silicatein are synthesised (as molybdate-reactive soluble silicate). For the detection of the silicate products, the material is centrifuged in a desk centrifuge (12 000 x g; 15 min; +4°C), washed with ethanol and air-dried. Subsequently, the sediment is hydrolysed with e.g. 1 M NaOH. Silicate that is developed is quantitatively meas-ured in the solution using a molybdate-supported detection method, such as e.g. the silicone-assays (Merck).
Surprisingly, it could be found that in addition to the substrate tetraethoxysilane, silicatein further polymerises additional silane-alkoxides.
The method according to the invention is novel in that the following compounds can be used for the silicatein-mediated syntheses: tetraalkoxysilanes, trialkoxysilanoles, dialkoxysilan-dioles, monoalkoxysilantrioles, alkyl- or aryl-trialkoxysilanes, alkyl- or aryl- dialkoxysilano-les or alkyl- or aryl-monoalkoxysilandioles or the respective (alkyl-or aryl-substituted) alkoxy compounds of gallium (IV), tin (IV) or lead (IV). Mixtures of these substrates are also recog-nized by the enzyme, and polymerised. Therefore, also mixed polymers can be produced.
For an increase of the activity of the enzyme silicatein, the substrates, such as tetraethoxysi-lane, are solubilized in dimethylsulfoxides in a stock solution of commonly 500 mM and sub-sequently diluted into the desired final concentration.
4. Coupling of cDNA for silicatein with one or several cDNA(s) (open reading frames) of other proteins 4.1. Production of silicatein fusion proteins Fusion proteins with silicatein are obtained as follows. A suitable expression vector (for ex-ample pQE-30) is used. The silicatein-cDNA - with e.g. a BamHI-restriction side at the 5'-terminus and e.g. a SaII-restriction side at the 3'-terminus - is produced.
The stop codon in the silicatein-cDNA is removed. For this, the PCR-technique is used and primers which exhibit the respective restriction sides, are used for the amplification. The cDNA for the second pro-tein is accordingly obtained, exhibiting at the 5'-terminus the same restriction side as present at the 3'-terminus of the silicatein-cDNA (in the example SaII) and at the 3'-terminus one that is different from the others (e.g. a HindIII-side). In case that internal restriction sides are pres-ent in the respective cDNAs, alternative restriction enzymes can be used. In addition, linkers in-between both cDNAs can be employed (figure SA).
These two cDNAs are ligiated, purified and ligiated into the pQE-30 vector (Quiagen) ac-cording to standard procedures. The ligiation occurs directly after the histidine-tag (approxi-mately 6 histidine-codons). The expression and purification of the fusion protein can be achieved as described above (section 2.1.2).
4.2. Separate expression I
Alternatively to the method that is described at 4.1., a protease cleavage site (such as e.g. an enterokinase side) can be cloned between the cDNA for the silicatein and the cDNA for the bioactive protein. In this case, a codon for a new start methionine can be inserted in front of the coding region of the gene for the bioactive protein. After expression and purification, the (fusion)-protein is cleaved proteolytically. Now, both proteins are separately present (figure SB).
4.3. Separated expression II (cassette-expression) Alternatively, both proteins can be expressed on one construct - but separately. For this, in an expression vector the gene for silicate is following the his-tag. A stop codon is inserted at the end of the silicatein cDNA. Between the cDNA of the silicatein and the cDNA
for a bioactive protein, a ribosome binding side with a codon for a start methionine is cloned. Again, a his-tag is preceding the cDNA for the bioactive protein. This gene is additionally provided with a stop codon (figure SC).
The his-tags can be deleted when the proteins are used for functional analyses in the respec-tive host cells.
4.4. Extensions Bacterial as well as eukaryotic cells can be used for the expression as described at 4.1 to 4.3.
The expression as described at 4.1 to 4.3 can also be employed for three or more open reading frames.
5. Uses of the produced silicateins and silicatein fusion-proteins 5.1. Use of silicatein for the modification of surfaces of biomaterials The biological reaction of organisms (or biological extracts/products) to biomaterials (ex-posed and/or implanted) is ruled to a large extend by their surface structure and chemistry.
Therefore, a need for methods for the modification of surfaces of such biomaterials exists. It is always the aim, to preserve the advantagous chemical-physical properties of the bio-molecules. Thus, only the outermost surfaces should be modified, since their biological inter-actions will be affected.
Surface-modified biomaterials (such as, for example, by silicone and siloxan-containing block-copolymers, "silanisation") find their use in influencing the cell adhesion and growth, for the modification of the compatibility of blood or for control of the protein adsorption (re-duction of the absorption of contact lenses, pretreatment of ELISA-plates). In particular, the silanisation for a modification of material surfaces can be used for the modification of hy-droxylated or amine-rich surfaces, such as, for example, surfaces of glass, silicon, germanium, aluminium, quartz and other metal oxides, which are rich in hydroxyl groups. A
literature-overview can be found in: B.D. Ratner et al. (editor) Biomaterials Science -An Introduction to Materials in Medicine. Academic Press, San Diego, 1996.
In doing so, nevertheless, the problem occurs that under the conditions that are applied during the production of these modifications, often harmful (destructive) effects occur for the bio-materials used.
The modifications of biomaterials that are solely based on biochemical reactions using the method of the invention (use of recombinant/purified silicatein) (silicatein-mediated enzy-matic synthesis of amorphous Si02-, siloxan- or siloxan-block-copolymers-containing sur-faces) represent a "mild" method in comparison to the physical/chemical methods that are used.
The modified area on the surface of the material should, in most cases, be as thin as possible since modified surface layers, that are too thick, can import the mechanical and functional properties of the materials. This can be achieved in a simple manner by varying the reaction time and the concentration of the substrate in the silicatein-mediated enzymatic reaction.
By means of the silicatein-mediated enzymatic reaction, a plurality of different biomaterials and in fact biomaterials, including polymers, metals, ceramics and glasses can be used that either naturally have a protein (silicatein)-binding surface or which have been made able to bind proteins by a preceding modification.
Silanes can form two kinds of surface-structures. Very thin (monolayer) layers, in case only traces of surface-absorbed water are present or, if more water is present, thicker silane-layers that consist out of Si-O groups which are bound to the surface and of silane-units that form a three-dimensional polymeric network. Such modifications, for example, can be produced by the treatment of hydroxylated surfaces using n-propyl-trimethyoxysilane.
General literature: Pleuddemann, E. P. (1980) Chemistry of silane coupling agents. In Si-lyated Surfaces (D. E. Leyden, editor) Gordon & Breach, New York, pp. 31-53).
By means of the silicatein-mediated enzymatic reaction, in addition several kinds of surface-structures can be formed on a plurality of different biomaterials - using mild conditions that prevents the biomaterials from damage - wherein, since enzymatically mediated, their synthe-sis takes place in a control manner.
In particular, the outcome of this is the use of the recombinant or a silicatein being purified from different sources for the production of surface-modifications of biomaterials with sili-cone-like properties (such as silicone-breast-implants) and in medical implants and endo-prothesises, as well as in contact lenses.
5.2. Use of silicatein for the encapsulation of biomolecules By means of the controlled synthesis of Si02 or siloxane-coatings using the recombinant or a silicatein being purified from different sources, the outcome of this is a use for the encapsula-tion of biomolecules (including proteins and nucleic acids) as well as bioactive molecules (including hormones, pharmaca and cytokines), with the aim, to modify or improve their bio-logical properties (such as protease and nuclease resistance, temperature stability) or their release (controlled "drug-delivery", in addition an enablement for a topical drug-delivery).
a) Increasing the protease resistance (and temperature stability) of proteins.
Approach: Covering the protein with a silicatein-coating (for example by cross-linking) that synthesises an Si02-coating.
b) Increasing the nuclease resistance (and temperature stability) of nucleic acids.
Approach: Covering the nucleic acid with a silicatein-coating (for example by cross-linking) which synthesises an SiOz-coating.
Using the above-described manner, a production of depot-forms for pharmaceuticals (includ-ing peptides/proteohormones and cytokines) is possible. For this, the pharmaceuticals (in-chiding peptides/proteohormones and cytokines) are first modified by a) cross-linking with silicatein or (in case of proteins) b) the production of fusion proteins with silicatein.
_ , CA 02414602 2002-12-24 Then, the silicatein-mediated syntheses of the capsule material will take place.
WO 96/14832 A1 1996-OS-23 (US 9514261 1995-11-06) discloses a method for the produc-tion of synthetic liposomes from polyphosphates, in order to for increase the uptake of phar-maceuticals ("drug-delivery"). By design of such a liposome-stabilising coating, using sili-catein, the efficiency of the method can be increased.
Furthermore, this results in a use of the recombinant or a silicatein being purified from differ-ent sources in the production of new biomaterials (or composite-materials), such as replace-ment materials for bones or dental replacement materials by co-synthesising polysilicates, silicons or mixed polymers (produced by means of the recombined/purified silicatein) and polyphosphates (produced by means of the recombinant polyphosphate-kinase).
5.3. Use of silicatein for the encapsulation of cellsltissues in transplantations The controlled synthesis of Si02 or siloxane-coatings by means of the recombinant or a silicat being purified from different sources can also be used for the encapsulation of cells in trans-plantations (improvement of the biocompatibility).
This can be performed by coating the cells with silicatein or via the expression of silicatein-fusion proteins on the cell-surface.
5.4. Use of silicatein for surface-modification (treatment of contact zones) of (silicon)-semiconductors or silicon-chips and their use The recombinant as well as a silicatein being purified from different sources can also be used for the surface-modification of (silicon or germanium)-semiconductors or (silicon or germa-nium)-biosensor-chips. By this, a connection with cells or other structures consisting of or-ganic material can be achieved. These "matrices" can be used for measuring the electric prop-erties of cells. Such silicatein-modified semiconductors (or silicon-microchips) can also be used as biosensors.
5. 5 Use of silicatein for synthesis of silicon-containing gems and semi precious stones The recombinant as well as a silicatein being purified from different sources, is able to form amorphous Si02. Achat, jaspis, onyx and others belong to the amorphous or fine crystalline modifications of the SiOz (opals); respectively. The possibility to synthesise amorphous Si02 with the aim of the recombinant or a silicatein being purified from different sources under controlled conditions, whereby controllably foreign molecules/atoms can be introduced, con-sequently results in the use of the method according to the invention for the production of the above-mentioned and other gems/semi-precious stones.
With the aid of the recombinant or a silicatein being purified from different sources, it is also possible to apply thin Si0 and Si02-layers onto semiconductor-supports (for the production of integrated circuits) under controlled conditions.
5.6. Use of silicatein for the synthesis of silicon (gallium-, tin- or lead )-compounds (includ ing so-called sila pharmaca) Silicon is known as a trace element that is apparently needed for the formation of connective tissues and bones (mineralisation). The production of silicon-organic compounds as a basis for so-called sila-pharmaca (pharmaca, wherein C is replaced with Si, 'exhibiting differences in the mode of action for the organism) is of medical interest [see: Chem.
unserer Zeit 14, 197-207 (1980), as well as: Bioactive Organo-Silicon Compounds (Topics Curr.
Chem. 84), Berlin, Springer 1979)]; the synthesis of such compounds using mild (enzymatic) conditions is possible by means of the method according to the invention (use of the recombinant or puri-fied silicatein from different sources).
Additional uses of silicon-compounds being synthesised with the aid of the method according to the invention under mild (enzymatic) conditions (use of the recombinant or purified seli-catein from different sources) in medicine and cosmetics are: use of silicon-compounds that are accordingly synthesised as ingredient or basis of ointments, as well as parts of tooth pastes [for use in cosmetics, see: Parfum. Kosmet. 67, 232-239, 326-336, 384-389 (1986); 68,195-203 (1987)].
° -18-The silicon-compounds that are synthesised with the aid of the methods according to the in-vention under mild (enzymatic) conditions (use of the recombinant or silicateines being puri-fied from different sources) can be also used for additional purposes:
lubricants (processing of plastics), grease (plastic gears), anti-foaming compounds, mold release agents (providing hy-drophobicity to glass, ceramics, textiles, leather) and dielectrica (e.g. in transformators).
The compounds as synthesised with the aid of the method according of the invention also in-clude the siloxane-resins that are used in standard techniques, such as (more or less cross-linked) polymethyl or polymethylphenylsiloxanes.
The silantrioles RSi(OH)3 formed by condensation during the course of the silicatein-mediated catalysis lead to the synthesis of sheet-structure-like polymers of the gross compo-sition RZS12O3. The degree of cross-linking and the extension of these polymers can be varied by the controlled admixture of silandioles and silanoles. Thus, enzymatically tailored silicone structures can be produced having characteristic and regulateble properties.
The siloxane-scaffold can be linked to different kinds of hydrocarbon-residues. By this, its properties can be modified.
Due to their heat-resistibility and hydrophobicity, the silicones synthesised by the silicatein-mediated catalysis (not harmful according to experience) can be also used in cosmetic skin-care and plastic surgery.
General literature: Brinker et al., Polydimethylsiloxane in der Lebens- and Genul3mittelin-dustrie, Miinchen: Dow Corning 1981.
5.7. Modification of the properties of cells by transfection with a silicatein-gene%DNA-containing plasmid By transfection of cells with a silicatein-gene/cDNA-containing plasmid, the properties of the cells can be changed, resulting in a use in the production of bone replacement materials (ad-ditionally by the co-polymerisation of silicatein-synthesised Si02 and polyphosphates, pro-duced by transfection with a polyphosphate-kinase-cDNA containing plasmid).
5.8. Use of recombinant silicatein for the synthesis of nano-structures from amorphous silicon dioxide By means of the recombinant silicateins, the recombinant silicatein-fusion proteins or the pu-rified silicatein, it is possible to synthesise specific two- and three-dimensional, sieve-, net-, cage- or otherwise formed structures from amorphous silicon dioxide, siloxanes or other sili-con (IV)- [or gallium (IV)-, tin (IV)- or lead (IV)-]-compounds in a nanoscale wherein mac-romolecules (synthetic polymers or biopolymers) that are associated with these enzymes are used as "guiding tracks" for the synthesis. Such syntheses are also possible by using sponges or other silicatein-producing organisms kept in mariculture or in tanks, as well as organisms modified with genetic technology that initially are not able to synthesise silicate. The struc-tures being formed can be used in nano-technology (for example as a "miniature sieve" for separation processes in nanoscale).
Lesends to the figures In the following, the explanatory legends for the accompanying drawings are given. The fig-ores show:
Fisure 1:
cDNA together with deduced amino acid sequence for the suberites domuncula-silicatein.
Figure 2:
Amino acid sequence of silicatein from the sponge suberites domuncula. Some sites at the protein are indicated [ ] that, after truncation of the cDNA, lead to a strong increase of the expression of the recombinant protein. In addition, the amino acids of the catalytic triad (CT) as well as the cysteine-units are marked (~) that potentially lead to disulfide bridges.
Figure 3:
Production of a recombinant silicatein-protein in E. coli. According to the method as indi-cated, the pure silicatein was obtained from crude extracts. Lane a: protein extract from non-induced cells [- IPTG]; lane b and lane c: protein extract from induced cells [+ IPTG], 2.5 hours (lane b) and 8 hours (lane c) after addition of IPTG. Lane d: soluble protein extract of bacterial lysates after expression for 8 hours. Lane e: protein extract of the inclusion bodies.
. CA 02414602 2002-12-24 Lane f: purified silicatein derived from the inclusion bodies after purification of the protein on a Ni-NTA matrix. The molecular weight of the recombinant silicatein is approximately 33 kDa. On the left side, the molecular weight markers are indicated.
Fieure 4:
(A) Concentration of transcripts for silicatein in primmorphs of S. domuncula.
Primmorphs, which have formed from single cells after 5 day-incubation were incubated for 0 (controls;
Con) to 5 days, either in the absence of exogeneous silicate (minus silicate) or in the presence of 60 ~M Na-silicate (plus silicate). Then, the RNA was extracted and 5 ~,g of the total RNA
were separated according to its size; after the blot-transfer, the hybridisation with the sili-catein-probe of S. domuncula (SUBDOSILICA) was performed. (B) Effect of recombinant myotrophin on the expression of silicatein and primmorphs. The primmorphs were incubated for 0 (controls) up to 5 days in the absence (minus myotrophin) or presence of 1 ~g/ml my-trophin (plus myotrophin). Then, Nothern-Blotting using the SUBDOSILICA-probe for de-termining the extent of expression of silicatein was performed.
Figure 5:
Co-expression of silicatein and the gene that codes for a bioactive substance (scheme). A.
Production of the fusion protein silicatein-bioactive protein. Both cDNAs [silicatein and bio-active protein] were ligiated via a restriction site (e.g. SaII) and subsequently cloned into the restriction sites BamHI and HindIII of the vector pQE-30. The histidine-tag is located at the 5'-terminus. B. Separate protein expression. Both cDNAs were cloned into a suitable vector via a protease-restriction site. After expression and purification, the fusion protein is obtained separately by protease-digestion. C. Separate protein expression (as cassette-expression).
Both cDNAs are separately expressed from the same construct and purified using the His-tags.
, CA 02414602 2002-12-24 SEQUENCE LISTING
<110> E.G.
Muller, Werner <120> catein-mediated Sili synthesis of amorph silicates and siloxanes and uses <130> 16PCT
<140> EPO1/08423 PCT/
<141> -07-20 <160>
<170> ntIn version Pate 3.1 <210>
<211>
<212>
DNA
<213>
Suberites domuncula <400>
gaggatagaaagtctacaatctgtaaggacaatgcttgtcacagtggtagtactgggtct60 actggggtttgcttctgcagcccagcccaagtttgaatttgtagaagaatggcagctgtg.120 gaagtccactcactctaagatgtacgagtcacagttaatggaactcgaaagacatctgac180 gtggctctccaataagaaatatatcgagcaacacaatgtcaactcacacattttcggttt240 tactctggcaatgaaccagtttggagatctgagtgaattggagtatgctaactatcttgg300 ccagtatcgcattgaggataaaaaatctggcaactactcaaagacttttcagcgtgatcc360 tctacaggactaccctgaagctgtagactggagaaccaaaggagctgtcacggctgtcaa420 ggaccagggagactgtggtgctagctatgctttcagtgctatgggtgctttggagggtgc480 taatgctttagccaagggaaatgcagtatctctcagtgaacagaacatcattgattgctc540 gattccttacggtaaccacggttgtcatggaggcaatatgtatgatgcttttttgtatgt600 catcgctaacgagggggtcgatcaggacagtgcatatccatttgtaggaaagcaatccag660 ctgcaactataatagtaaatacaaaggtacatcaatgtcggggatggtgtcaatcaaaag720 tggtagtgagtctgacttacaagcagctgtttcaaacgttggccctgtatctgttgctat780 tgatggtgctaacagtgccttcaggttttactacagtggtgtctatgactcatcacgatg840 ctctagtagtagtcttaaccacgcaatggtagtcactggatacggatcatacaatgggaa900 aaaatactggctggccaagaatagctggggaactaactggggtaacagtggctatgtgat960 gatggctcgcaacaagtacaaccagtgtggaattgctaccgatgcatcttatcccaccct1020 ataaacttatatatatatagtcttagaaacattatccttttctttacccttgtctctata1080 ggccatagagtgattgtaggctgtttgcatttgatgactgtatataccctatcatttttt1190 gtgattctatctgattaaaaatcccatacccgaccaaaccatcaatttatcaaatcatga1200 <210>
<211>
<212>
PRT
. . , _2_ <213> Suberites domuncula <400> 2 Met Leu Val Thr Val Val Val Leu Gly Leu Leu Gly Phe Ala Ser Ala Ala Gln Pro Lys Phe Glu Phe Val Glu Glu Trp Gln Leu Trp Lys Ser Thr His Ser Lys Met Tyr Glu Ser Gln Leu Met Glu Leu Glu Arg His Leu Thr Trp Leu Ser Asn Lys Lys Tyr Ile Glu Gln His Asn Val Asn Ser His Ile Phe Gly Phe Thr Leu Ala Met Asn Gln Phe Gly Asp Leu Ser Glu Leu Glu Tyr Ala Asn Tyr Leu Gly Gln Tyr Arg Ile Glu Asp Lys Lys Ser Gly Asn Tyr Ser Lys Thr Phe Gln Arg Asp Pro Leu Gln Asp Tyr Pro Glu Ala Val Asp Trp Arg Thr Lys Gly Ala Val Thr Ala Val Lys Asp Gln Gly Asp Cys Gly Ala Ser Tyr Ala Phe Ser Ala Met Gly Ala Leu Glu Gly Ala Asn Ala Leu Ala Lys Gly Asn Ala Val Ser Leu Ser Glu Gln Asn Ile Ile Asp Cys Ser Ile Pro Tyr Gly Asn His Gly Cys His Gly Gly Asn Met Tyr Asp Ala Phe Leu Tyr Val Ile Ala Asn Glu Gly Val Asp Gln Asp Ser Ala Tyr Pro Phe Val Gly Lys Gln Ser Ser Cys Asn Tyr Asn Ser Lys Tyr Lys Gly Thr Ser Met Ser Gly Met Val Ser Ile Lys Ser Gly Ser Glu Ser Asp Leu Gln Ala Ala Val . . , _3_ Ser Asn Val Gly Pro Val Ser Val Ala Ile Asp Gly Ala Asn Ser Ala Phe Arg Phe Tyr Tyr Ser Gly Val Tyr Asp Ser Ser Arg Cys Ser Ser Ser Ser Leu Asn His Ala Met Val Val Thr Gly Tyr Gly Ser Tyr Asn Gly Lys Lys Tyr Trp Leu Ala Lys Asn Ser Trp Gly Thr Asn Trp Gly Asn Ser Gly Tyr Val Met Met Ala Arg Asn Lys Tyr Asn Gln Cys Gly Ile Ala Thr Asp Ala Ser Tyr Pro Thr Leu
Claims (22)
1. A method for the production of recombinant silicatein in a host cell, characterised in that it comprises at least one of the steps:
a) truncating the recombinant silicatein to be expressed in the N-terminal coding region of its cDNA that extends up to the first disulfide bridge, b) truncating the recombinant silicatein to be expressed in the C-terminal coding region of its cDNA that extends up to the last disulfide bridge, c) adding a protease-inhibitor mixture after lysis of the cells, d) refolding without the addition of lysozyme, and e) inducing the expression by addition of myotrophin and/or silicate, and isolating the functional and highly active enzyme preparation.
a) truncating the recombinant silicatein to be expressed in the N-terminal coding region of its cDNA that extends up to the first disulfide bridge, b) truncating the recombinant silicatein to be expressed in the C-terminal coding region of its cDNA that extends up to the last disulfide bridge, c) adding a protease-inhibitor mixture after lysis of the cells, d) refolding without the addition of lysozyme, and e) inducing the expression by addition of myotrophin and/or silicate, and isolating the functional and highly active enzyme preparation.
2. Method for the production of recombinant silicatein in a host cell according to claim 1, characterised in that cells of Escherichia coli, yeast, mammals or primmorphs, such as marine sponges or diatoms are used as host cells.
3. Method for the production of recombinant silicatein in a host cell according to claim 1 or 2, characterised in that cells of Cylindrotheca fusiformis are used as host cells.
4. Method for the production of recombinant silicatein in a host cell according to one of the preceding claims, characterised in that the recombinant silicatein is expressed as (a) fusion protein (chimeric protein) or (b) in a separate protein expression (protease cleavage site) or (c) in a second separate protein expression (cassette-expression), and in form of a modified silicatein-cDNA-sequence.
5. Method for the production of recombinant silicatein in a host cell according to one of the preceding claims, characterised in that it as an additional step comprises purifica-tion of the silicatein by means of polyclonal antibodies or by means of a histidine-tag.
6. Method for the production of recombinant silicatein in a host cell according to claim 5, characterised in that the polyclonal antibody it coupled to a solid phase.
7. Recombinantly produced silicatein, produced according to a method according to any of claims 1 to 6.
8. Recombinantly produced silicatein according to claim 7, characterised in that the sili-catein or derivatives thereof is derived from Suberites domuncula, according to the se-quence indicated in figure 1.
9. Transgenic host cell, in particular host cells of Escherichia coli, yeasts, mammals or primmorphs, such as marine sponges, such as Suberites domuncula or diatoms, such as Cylindrotheca fusiformis, expressing a recombinant silicatein according to claim 7.
10. Method for the production of silicatein in a sponge, characterised in that it comprises the steps of: a) inducting the expression by the addition of myotrophin and/or silicate, and b) isolating the functional and highly active enzyme preparation.
11. Method for the production of silicatein in sponges according to claim 10, characterised in that Suberites domuncula as a sponge is used.
12. Silicatein, produced according to a method of claims 10 or 11.
13. Use of the silicatein according to claims 7 or 12 for the synthesis of specific two- and three-dimensional nanostructures (sieve-, net-, cage- or otherwise formed structures) from amorphous silicon dioxide (silicic acid and silicates), siloxanes or other silicon (IV)-, gallium (IV)-, tin (IV)- or lead (IV)-compounds for use in nanotechnology.
14. Method for the production of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, characterised in that tetraalkoxysilanes, trialkoxysilanoles, dialkoxysilandioles, monoalkoxysilantrioles, alkyl- or aryl-trialkoxysilanes, alkyl- or aryl-dialkoxysilanoles or alkyl- or aryl-monoalkoxysilandioles or the corresponding (alkyl- or aryl-substituted) alkoxy compounds of gallium (IV), tin (IV) or lead (IV) as substrates are converted with the silicatein produced according to one claims 1 to 6, 10 and 11.
15. Method for the production of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 14, characterised in that mixed polymers of defined composition are produced by using defined mixtures of the indicated compounds.
16. Method for the production of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 14 or 15, characterised in that the recombinant or silicatein fusion protein is immobilised on a surface made out of glass, metals, metal oxides, plastics, biopolymers or other materials.
17. Method for the production of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, according to one of the claims 14 to 16, characterised in that for the purification a spe-cific antibody or a specific silicatein-binding protein is immobilised on a solid phase.
18. Amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV), or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, produced according to a method ac-cording to one of claims 14 to 17.
19. Use of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 18 for the modification of surfaces of technical materials and biomaterials as well as for the encapsulation of biomolecules, pharmaca or other bioactive compounds in silicatein-synthesised silicon dioxide (SiO2)-coats or coats from silicatein-synthesised siloxanes or other silicon (IV)-, gallium (IV)-, tin (IV)- or lead (IV)-compounds in order to modify their biological and pharmacological properties or their release (controlled drug-delivery).
20. Use of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so-called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 18 for the encapsulation of cells or tissues in transplantations.
21. Use of amorphous silicon dioxide (silicic acids and silicates), siloxanes or other silicon (IV)-, or gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 18 for the treatment of surfaces (contact zones) of (silicon or germanium)-semiconductor-materials or (silicon or germanium)-biosensor-chips.
22. Use of amorphous silicon dioxide (silicic acids and silicates), siloxanes and other sili-con (IV)-, gallium (IV)-, tin (IV)- or lead (IV)-compounds (including so-called sila-pharmaca) as well as mixed polymers of these compounds, according to claim 18 for the synthesis of silicon-containing minerals, gems and semi-precious stones.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE10037270.8 | 2000-07-28 | ||
| DE10037270A DE10037270B4 (en) | 2000-07-28 | 2000-07-28 | Silicatein-mediated synthesis of amorphous silicates and siloxanes and their use |
| PCT/EP2001/008423 WO2002010420A2 (en) | 2000-07-28 | 2001-07-20 | Silicatein-mediated synthesis of amorphous silicates and siloxanes and use thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2414602A1 true CA2414602A1 (en) | 2002-02-07 |
Family
ID=7650838
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002414602A Abandoned CA2414602A1 (en) | 2000-07-28 | 2001-07-20 | Silicatein-mediated synthesis of amorphous silicates and siloxanes and their uses |
Country Status (11)
| Country | Link |
|---|---|
| US (1) | US7169589B2 (en) |
| EP (1) | EP1320624B1 (en) |
| JP (1) | JP2004516818A (en) |
| CN (1) | CN1261451C (en) |
| AT (1) | ATE277194T1 (en) |
| AU (2) | AU8971301A (en) |
| CA (1) | CA2414602A1 (en) |
| DE (2) | DE10037270B4 (en) |
| NO (1) | NO20030407D0 (en) |
| NZ (1) | NZ523474A (en) |
| WO (1) | WO2002010420A2 (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2248824A1 (en) | 2009-04-27 | 2010-11-10 | Matthias Dr. Wiens | Use of silintaphin for the structure-directed fabrication of (nano)composite materials in medicine and (nano) technology |
| EP2409682A1 (en) | 2010-07-19 | 2012-01-25 | Werner E. G. MÜLLER | Hydroxyapatite-binding nano- and microparticles for caries prophylaxis and reduction of dental hypersensitivity |
| EP2409710A1 (en) | 2010-06-29 | 2012-01-25 | NanotecMARIN GmbH | Injectable material and material to be used as drug or food supplement for prophylaxis or treatment of osteoporosis |
| WO2012101218A1 (en) | 2011-01-26 | 2012-08-02 | Nanotecmarin Gmbh | Food supplement and injectable material for prophylaxis and therapy of osteoporosis and other bone diseases |
Families Citing this family (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003054205A2 (en) * | 2001-12-20 | 2003-07-03 | The Procter & Gamble Company | Biosynthesis of cyclic siloxanes |
| US6811145B2 (en) * | 2002-05-07 | 2004-11-02 | Edward L. Gibbs | Barrier formed by resistance projection welding |
| DE10240035A1 (en) * | 2002-08-30 | 2004-03-11 | Rehm, Bernd H.A., PD Dr.rer.nat. | Biogenic polyester particles of a defined size with functionalized surfaces: manufacturing processes and pharmaceutical preparations containing them |
| DE10246186B4 (en) * | 2002-10-03 | 2005-07-07 | Johannes-Gutenberg-Universität Mainz | Degradation and modification of silicates and silicones by silicase and use of the reversible enzyme |
| DE10352433B4 (en) * | 2003-11-10 | 2012-10-11 | Nanotecmarin Gmbh | Polypeptide of a silicatein-ß from Suberites domuncula, nucleic acid coding therefor, their uses, vector comprising this nucleic acid and host cell expressing this polypeptide |
| US7455998B2 (en) * | 2004-03-03 | 2008-11-25 | Dow Corning Corporation | Methods for forming structurally defined organic molecules |
| US8523150B2 (en) * | 2004-03-15 | 2013-09-03 | Edward L. Gibbs | Fence with tiltable picket |
| DE102004021229A1 (en) * | 2004-04-30 | 2005-11-24 | Heiko Dr. Schwertner | Enzymatic process for the production of bioactive, osteoblast-stimulating surfaces and use |
| DE102004021230A1 (en) * | 2004-04-30 | 2005-11-24 | Heiko Dr. Schwertner | Enzyme- and template-directed synthesis of silica from non-organic silicon compounds as well as aminosilanes and silazanes and use |
| DE102005061248B4 (en) | 2005-12-20 | 2007-09-20 | Infineon Technologies Ag | System carrier with surfaces to be embedded in plastic compound, method for producing a system carrier and use of a layer as a primer layer |
| US20100047224A1 (en) * | 2006-08-23 | 2010-02-25 | Geurtsen Werner K | Biosilica-Adhesive Protein Nanocomposite Materials: Synthesis and Application in Dentistry |
| EP2246435A1 (en) | 2009-04-29 | 2010-11-03 | Consiglio Nazionale delle Ricerche - INFM Istituto Nazionale per la Fisica della Materia | Silicon derivate layers/films produced by silicatein-mediated templating and process for making the same |
| DE102009024603A1 (en) | 2009-06-10 | 2010-12-16 | Nanotecmarin Gmbh | Preparing bioactive, dental hard tissue sealed toothpaste comprises enzyme-catalyzed formation of nanoparticles comprising amorphous silicon dioxide using a polypeptide comprising animal, bacterial, plant or fungal silicatein domains |
| DE102016004090A1 (en) | 2015-04-16 | 2016-10-20 | Florian Draenert | COMPOSITION OF OUR BLOMATERAL |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6670438B1 (en) * | 1998-12-18 | 2003-12-30 | The Regents Of The University Of California | Methods, compositions, and biomimetic catalysts for in vitro synthesis of silica, polysilsequioxane, polysiloxane, and polymetallo-oxanes |
-
2000
- 2000-07-28 DE DE10037270A patent/DE10037270B4/en not_active Expired - Fee Related
-
2001
- 2001-07-20 AU AU8971301A patent/AU8971301A/en active Pending
- 2001-07-20 NZ NZ523474A patent/NZ523474A/en unknown
- 2001-07-20 CA CA002414602A patent/CA2414602A1/en not_active Abandoned
- 2001-07-20 US US10/343,104 patent/US7169589B2/en not_active Expired - Fee Related
- 2001-07-20 CN CNB01813484XA patent/CN1261451C/en not_active Expired - Fee Related
- 2001-07-20 EP EP01969458A patent/EP1320624B1/en not_active Expired - Lifetime
- 2001-07-20 WO PCT/EP2001/008423 patent/WO2002010420A2/en active IP Right Grant
- 2001-07-20 AT AT01969458T patent/ATE277194T1/en not_active IP Right Cessation
- 2001-07-20 DE DE50103793T patent/DE50103793D1/en not_active Expired - Lifetime
- 2001-07-20 JP JP2002516336A patent/JP2004516818A/en active Pending
- 2001-07-20 AU AU2001289713A patent/AU2001289713B2/en not_active Ceased
-
2003
- 2003-01-27 NO NO20030407A patent/NO20030407D0/en not_active Application Discontinuation
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2248824A1 (en) | 2009-04-27 | 2010-11-10 | Matthias Dr. Wiens | Use of silintaphin for the structure-directed fabrication of (nano)composite materials in medicine and (nano) technology |
| EP2409710A1 (en) | 2010-06-29 | 2012-01-25 | NanotecMARIN GmbH | Injectable material and material to be used as drug or food supplement for prophylaxis or treatment of osteoporosis |
| EP2409682A1 (en) | 2010-07-19 | 2012-01-25 | Werner E. G. MÜLLER | Hydroxyapatite-binding nano- and microparticles for caries prophylaxis and reduction of dental hypersensitivity |
| WO2012010520A1 (en) | 2010-07-19 | 2012-01-26 | Mueller Werner E G | Hydroxyapatite-binding nano- and microparticles for caries prophylaxis and reduction of dental hypersensitivity |
| WO2012101218A1 (en) | 2011-01-26 | 2012-08-02 | Nanotecmarin Gmbh | Food supplement and injectable material for prophylaxis and therapy of osteoporosis and other bone diseases |
| EP2489346A1 (en) | 2011-01-26 | 2012-08-22 | NanotecMARIN GmbH | Food supplement and injectable material for prophylaxis and therapy of osteoporosis and other bone diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1320624B1 (en) | 2004-09-22 |
| CN1460110A (en) | 2003-12-03 |
| WO2002010420A3 (en) | 2003-04-03 |
| DE10037270A1 (en) | 2002-02-14 |
| AU8971301A (en) | 2002-02-13 |
| US20030134391A1 (en) | 2003-07-17 |
| CN1261451C (en) | 2006-06-28 |
| DE10037270B4 (en) | 2007-09-13 |
| ATE277194T1 (en) | 2004-10-15 |
| AU2001289713B2 (en) | 2007-02-01 |
| DE50103793D1 (en) | 2004-10-28 |
| US7169589B2 (en) | 2007-01-30 |
| AU2001289713A2 (en) | 2002-02-13 |
| EP1320624A2 (en) | 2003-06-25 |
| NO20030407L (en) | 2003-01-27 |
| NO20030407D0 (en) | 2003-01-27 |
| WO2002010420A2 (en) | 2002-02-07 |
| JP2004516818A (en) | 2004-06-10 |
| NZ523474A (en) | 2005-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7169589B2 (en) | Silicatein-mediated synthesis of amorphous silicates and siloxanes and use thereof | |
| US20100047224A1 (en) | Biosilica-Adhesive Protein Nanocomposite Materials: Synthesis and Application in Dentistry | |
| US20070218044A1 (en) | Decomposition and modification of silicate and silicone by silicase and use of the reversible enzyme | |
| JP2007535320A (en) | Enzymatic method for producing osteoblast-stimulated surfaces with biological activity and use thereof | |
| US20080293096A1 (en) | Enzyme and Template-Controlled Synthesis of Silica from Non-Organic Silicon Compounds as Well as Aminosilanes and Silazanes and Use Thereof | |
| CN110904075B (en) | Salt-tolerant xylosidase mutant K321D and preparation method and application thereof | |
| US7794992B2 (en) | Enzymatic synthesis, modification and degradation of silicon(IV)- and other metal(IV)-compounds | |
| CN110904082B (en) | Salt-tolerant xylosidase mutant T326DH328D and preparation and application thereof | |
| Nomura et al. | The primary and higher order structures of sea urchin ovoperoxidase as determined by cDNA cloning and predicted by homology modeling | |
| KR101902848B1 (en) | Fusion flavonoid O-methyltransferase and use thereof | |
| Muller et al. | Selenium affects biosilica formation in the demosponge Suberites domuncula | |
| KR101494139B1 (en) | Preparation method of tf1-atpase recombinant protein and use thereof | |
| CA2620726A1 (en) | Pyroglue | |
| JP2000135091A (en) | Lytic protein derived from bacteriophage parasitic to palstonia solanacearum, dna coding for the protein, and transformant having the dna |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |
Effective date: 20130211 |