CA2413449A1 - Altered wool and hair fibres - Google Patents

Altered wool and hair fibres

Info

Publication number
CA2413449A1
CA2413449A1 CA 2413449 CA2413449A CA2413449A1 CA 2413449 A1 CA2413449 A1 CA 2413449A1 CA 2413449 CA2413449 CA 2413449 CA 2413449 A CA2413449 A CA 2413449A CA 2413449 A1 CA2413449 A1 CA 2413449A1
Authority
CA
Grant status
Application
Patent type
Prior art keywords
protein
wool
hair
proteins
fibres
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA 2413449
Other languages
French (fr)
Inventor
C. Simon Bawden
George Rogers
Simon Walker
Barry Powell
Original Assignee
SOUTH AUSTRALIAN RESEARCH AND DEVELOPMENT INSTITUTE
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00Rearing or breeding animals, not otherwise provided for; New breeds of animals
    • A01K67/027New breeds of vertebrates
    • A01K67/0275Genetically modified vertebrates, e.g. transgenic
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43513Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae
    • C07K14/43518Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from arachnidae from spiders
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • C07K14/43586Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects from silkworms
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4741Keratin; Cytokeratin
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/104Aminoacyltransferases (2.3.2)
    • C12N9/1044Protein-glutamine gamma-glutamyltransferase (2.3.2.13), i.e. transglutaminase or factor XIII
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00Genetically modified animals
    • A01K2217/05Animals comprising random inserted nucleic acids (transgenic)
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/102Caprine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/103Ovine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00Animals characterised by species
    • A01K2227/10Mammal
    • A01K2227/105Murine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/01Animal expressing industrially exogenous proteins
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01KANIMAL HUSBANDRY; CARE OF BIRDS, FISHES, INSECTS; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00Animals characterised by purpose
    • A01K2267/02Animal zootechnically ameliorated
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/008Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Abstract

A method of altering the physical and/or chemical properties of hair or wool fibres. The method includes the steps of expressing one or more exogenous proteins in follicle cells of the hair or wool fibre, and/or over-expressing or under-expressing one or more endogenous proteins in follicle cells of the hair or wool fibre. The protein is expressed in at least one compartment of the hair follicle so that is interacts physically and/or chemically with native KAP and/or IF structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre. In one specific embodiment, silk proteins are expressed in the cortex of hair or wool fibres to thereby alter the properties of the hair or wool fibre.

Description

ALTERED ~7VOOL AND HAIR FIBRES
FIELD OF THE INVENTION
This invention relates to a method of altering the physical and/or chemical properties of hair or wool fibres and to altered hair or wool fibres produced by the method.
BACKGROUND OF THE INVENTION
Hair and wool fibres are commonly used in textile manufacture because of their favourable physical properties for use in textiles, as well as the low relative cost of the fibres. For this reason, it is desirable to be able to modify hair or wool fibres to introduce new properties to the fibres.
Throughout this specification the terms hair fibres and hair follicles will be used and should be understood to include both hair and wool fibres and follicles respectively.
Hair. fibres are produced in the hair follicle which is a complex and dynamic structure composed of several different cell types which form the outer root sheath and inner root sheath, and the cortical and surrounding cuticle layers of the hair shaft. As the follicle bulb cells divide and rapidly differentiate into cuticle and cortical keratinocytes, a complex pattern of gene expression is observed in the follicle cortex, where different keratin genes are activated at different stages of cortical differentiation. Keratins are the structural proteins of the hair and form the bulk of the protein synthesised in terminally differentiating keratinocytes.
There are two major groups of keratin proteins: the keratin intermediate filament (IF) proteins and the keratin-associated proteins (KAP). The IF and KAP
proteins together form a keratin superstructure having an internal structure of IFs embedded in an intrafilamentous matrix of KAP proteins. The IF proteins form 8 to 10 nanometre filaments in the cytoplasm of epithelial cell types and the filaments are formed by a pairing of two IF protein types, the type I and type II
keratin IFs.
The physical and mechanical properties of wool and hair fibre arise at least in part from the keratin superstmcture of IF and KAP proteins. As such the physical and mechanical properties or hair or wool fibres can vary greatly from animal to animal and can be dependent on factors such as diet and the environment in which the animal is reared. Consequently in times of environmental stress synthesis of follicle proteins is suppressed, leading to imperfections in the wool or hair fibres produced. Imperfections ultimately lead to weak points in the fibre and to a reduction in fibre strength. In addition, wool and hair fibres are used extensively in textiles manufacture but their uses can be restricted somewhat by the inherent properties of the hair or wool, particularly when compared to the properties of many synthetic fibres. As a result there is considerable interest in making fibres with consistent physical properties, or whose properties are tailored for a particular application, such as for example, fibres having higher strength may find uses in textile manufacture as well as other industries which require high strength fibres. In addition to strength it would also be useful to be able to alter other physical properties to make the fibre more suitable for particular applications.
For example, there is considerable interest in making light weight, high strength and versatile fibres for use in the textile industry and in other manufactures. For instance the synthetic fibres made from polyamide polymers (for example ~NylonTM) and aramid fibres (for example KevlarTM) have a high strength but also have a high density and are relatively expensive. In contrast, wool and hair fibres provide a relatively low cost fibre that may not have sufficient strength andlor elasticity for a wide range of applications.
Another example is cashmere which is noted for its softness and this is believed to result at least in part from the relatively small amounts of certain cuticle proteins and also the lower average diameter of the fibres than that of wool.
Thus, for certain uses it would be desirable to tailor the properties of fibres to mimic those of cashmere.
It has been estimated that 50 to 100 proteins belonging to at least 10 distinct families are expressed in growing hair. The expression of the many genes to produce these proteins is a regulated event in which there is a specific program of expression of the different members of the protein families. It is presumed that the pattern of expression in hair formation is important for making the necessary component proteins available to incorporate correctly into the complex keratin superstructure of IF and KAP proteins. However the understanding ~of mechanisms that control development of the fibres and in particular the control of gene expression in wool fibres is not fully understood, mainly due to the large number of proteins expressed and the variety of timing of expression which renders the expression regime in the hair follicle extremely complex.
It has previously been found by the present inventors (Powell and Rogers, 1993) that when the coding region of the gene encoding the cysteine-rich KAP2.12 protein was linked to the K2.10 gene promoter, the I~AP2.12 protein was over-expressed in the cortex. A dramatic effect was observed on the hair growth of expressing transgenic mice that contained about 30 copies of the gene construct.
The over-expressed cysteine-rich KAP caused bundles of keratin complex (IF +
KAP) to be separated by deposits of what was presumably the KAP protein itself, whereas the spacing between individual IFs in the keratin structure was maintained, suggesting that the protein could not be incorporated into the hair structure. Thus the expressed protein formed agglomerates between filamentous material and as such disrupted the IF and KAP network and as a result the hairs were severely weakened to the point of breaking off at the skin surface.
Therefore over-expression of the protein had a detrimental effect on the physical properties of the hair.
Reference in this specification to a document is not to be taken as an admission that the disclosure therein constitutes common general knowledge in Australia.
OBJECT OF THE INVENTION
The object of the invention is to provide hair fibres that have altered physical and/or chemical properties and methods fox the production of those fibres, or at least to provide the public with a useful choice.
SUMMARY OF THE INVENTION
For the purposes of this specification the word 'comprising' means 'including but not limited to', and the word 'comprises' has a corresponding meaning.
The present invention arises out of the finding that the properties of hair or wool fibres can be altered by appropriate control of expression of proteins within the hair follicle. In one aspect, exogenous proteins including but not limited to, silk proteins, may be expressed in follicle cells and incorporated into the hair structure to thereby alter the properties of the hair or wool fibre. An exogenous protein is a protein that it is not naturally occurring or synthesised in the hair or wool fibre, or is not naturally occurring or synthesised in a particular compartment of the hair fibre.
In another aspect expression of endogenous hair or wool fibre proteins may be controlled to lead to over-expression or under-expression of endogenous proteins to thereby alter the properties of the hair or wool fibre. An endogenous protein is a protein that is naturally occurring or synthesised in the hair or wool fibre.
In one particular aspect the invention arises from the finding that silk proteins can be expressed in follicle cells. There are practical advantages to be derived from a method of producing wool or hair fibres containing silk proteins that may have consistent and altered mechanical properties.
The silk fibre normally produced as a cocoon by the larvae of the silkworm moth Bornbyx naorii or as a dragline by orb web spiders such as Nephila clavipes have previously been suggested as an alternative fibre for textile-related applications because of their high intrinsic strength and elasticity. Silk is composed of fibres formed from proteins, and natural spider silk fibres are composites of two or more -proteins and have twin filaments of fibroin proteins that are adhered together by sericin proteins. It is also possible to form silk fibres from fibroin proteins without the inclusion of sericin proteins.
Spider silk proteins are found to have primary amino acid sequences that can be characterised as indirect repeats of a short consensus sequence. For example the silk protein from the silkworm Bombyx naorii has a Gly-Ala-Gly-Ala-Gly-Ser (SEQ ID NO. 1) amino acid repeat unit. Two genes encoding silk protein from the golden orb spider NepIZila clavipes have been identified as having a 34.
amino acid repeat unit (Xu and Lewis, 1990). The orb web spider Araneus diadematus produces five different types of silk and the sequences of four (ADF 1 to 4) have been published (Guerrette et al., 1996). Production of such proteins by recombinant DNA methods in commercially useful quantities, in host cells such as bacteria or yeast invariably involve recovery and purification steps and the use of micro-spinneret apparatus to produce fibres of sufficiently low diameter.
Therefore in a first aspect, although not necessarily the broadest or only aspect, the invention could be said to reside in a transgenic mammal that expresses one or more genes encoding an exogenous silk protein containing repeat silk amino acid sequences, or variants thereof, operably linked to a control element specific for expression in the follicle of hair or wool fibres such that the mammal produces hair or wool fibres containing said exogenous silk protein.

5 The expression of silk proteins in the hair or wool follicle may therefore provide a means to alter the properties of wool and hair fibres, and to produce commercially useful quantities of a fibre with at least some of the properties of the silk protein.
The silk protein of the invention is an exogenous silk protein in that it is not naturally occurring or synthesised in the hair or wool fibre.
The silk protein may be any protein containing one or more amino acid repeat units taken from a natural spider silk or published recombinant silk protein sequences. Examples of suitable proteins can be those found in the silk protein from the silkworm Bombyx naorii, the silk protein from the golden orb spider Nephila clavipes, the orb web spider Araneus diadematus, as well as those found in US 5728810, US 5733771 and US 5756677 to Lewis et al.; Xu and Lewis, 1990; Guerrette et al., 1996; and EP 0230702 to Petty-Saphon et al., which references are included herein for the purpose of providing spider silk protein amino acid sequences. A further example of a suitable protein can be found in Figure 1.
Other silk proteins can be engineered based on published sequences of natural or recombinant silk proteins or variants thereof provided that the variants retain at least some of the mechanical and/or chemical properties of native spider silk proteins. Thus the engineered sequence may share at least 50% homology with a known silk sequence, preferably at least 70% homology, and more preferably at least 90% homology. Alternatively, the engineered sequence may contain amino acid repeat units whose sequence shares at least 50% homology with an amino acid repeat unit of a known silk sequence, preferably at least 70% homology, and more preferably at least 90% homology with an amino acid repeat unit of a known silk sequence. For example a sequence based on the Gly-Ala-Gly-Ala-Gly-Ser (SEQ ID NO. 1) amino acid repeat unit interspersed with sequences forming amorphous regions may be designed.

The silk protein may also be a spider silk-keratin hybrid protein or a spider silk-keratin associated hybrid protein. Thus, the silk protein may contain silk protein amino acid repeat units as discussed as well as keratin or keratin associated protein repeat amino acid units. It is possible that a silk-keratin or silk-keratin associated hybrid protein may integrate into the hair structure more efficiently than a protein that does not contain keratin or keratin associated amino acid repeat units.
Natural and synthetic exogenous spider silk protein sequences can be cloned as cDNA or designed and constructed by recombinant DNA techniques from published sequences.
The control element preferably regulates the expression of the silk protein in the cortex of the hair or wool follicle. It is expected that the cortex is the compartment of the follicle in which expression of the silk protein is most likely to provide a mechanical andlor chemical benefit to the wool or hair fibre. It is also expected that it may be necessary to express sufficient exogenous silk protein to form the exogenous protein structure within the hair or wool fibre cells.
Thus -the timing of expression of the transgene in the cortex may affect the mechanical and/or chemical properties of the resultant hair or wool fibre. Therefore it may be necessary for the transgene to be expressed early in the cortex to enable sufficient silk protein to be expressed. Alternatively, using a control element that turns transgene expression on late in the cortex could allow wool or hair filament formation to proceed to a point such that the introduction of the exogenous silk protein may cause minimal disturbance to the native wool or hair structure.
Thus the timing of expression of the transgene in the cortex may be controlled by selection of the appropriate control element, and the amount of exogenous silk protein expressed may be determined, at least in part, by selection of the appropriate control element.
The control element may include one or more promoter sequences to direct mRNA synthesis as well as appropriate regulatory elements to allow for regulation of the expression of the protein. Thus, the control element preferably includes one or more promoter sequences as well as wool or hair~follicle cell specific enhancer sequences for amplifying expression and enabling efficient and high level expression of homologous or heterologous coding regions within the cortex of the hair or wool follicle.

Expression in the cortex may be driven using enhancer elements and other non-promoter elements from the early-expressed type I and type II keratin intermediate filament genes including K1.1 (bowling et al., 1986; GenBank Accession #AF227758), K1.2 (Wilson et al., 1988; GenBank Accession #M23912), K1.3 (cough et al., 1978 and Parry, 1997), K2.9 , K2.10, K2.11, K2.12 (Powell et al., 1992), or the enhancer elements and other non-promoter elements for the genes encoding the late-expressed cysteine-rich keratin-associated protein families including the KAPl (Powell et al., 1983), KAP2 (Powell et al., 1991) and KAP3 (Frenkel et al., 1989) gene families (for nomenclature see Rogers and Powell, 1993; Powell and Rogers, 1994a).
Expression in the orthocortex may be driven using enhancer elements and other non-promoter elements from the genes encoding the glycine / tyrosine-rich proteins including the KAP6 gene family (Fratini et al., 1993), KAP7 and KAP8 genes (Kuczek and Rogers, 1987).
Expression in the paracortex may be driven using enhancer elements and other -non-promoter elements from the genes encoding the cysteine-rich proteins of the KAP4 or KAP12 gene families.
In one preferred form of the invention the control element is K2.10.
Alternatively, the control element may comprise the sequence of the LEF-1 l TCF-1 binding site found in many hair keratin IF and KAP genes. For example the LEF-1 site in the K2.10 control element is defined in the region from -150 to -350 in the proximal promoter (Dunn et al., 1998).
The mammal could be any hair or wool bearing mammal. Preferably the mammal is selected from the group including but not limited to mouse, sheep, goat, alpacca and llama. Most preferably the mammal is a sheep.
In another form of the first aspect, the invention could be said to reside in wool or hair fibres containing one or more exogenous silk proteins. The mechanical and/or chemical properties of the wool or hair fibres may be modified by the exogenous silk. proteins.

The invention also resides in a product made from the modified wool or hair fibre.
The modified wool or hair fibres may be produced by rearing the mammal of the first aspect of the invention and harvesting the hair or wool fibre from the mammal.
The mechanical, physical and/or chemical properties of the modified wool or hair may be influenced by not only the type of silk protein but also the timing of the expression of the protein. For example late expression of the spider silk protein may lead to the exogenous structural protein causing minimal disturbance to the native wool or hair structure. Conversely, early expression of the silk protein may lead to significant changes to the native wool or hair structure and hence to the mechanical and physical properties of the wool or hair fibres.
Depending on the strength and elasticity achieved, the fibres may find novel uses, perhaps in biomedicine as alternative ligature materials, or in industrial or military applications as alternative apparel, ballistic materials, or reinforcement -fibres for plastics and the like.
In a further form of the first aspect, the invention could be said to reside in a method of producing the transgenic mammal of the first aspect of the invention, the method including the steps of:
operably linking one or more genes encoding an exogenous silk protein to a control element specific for expression in the follicle of hair or wool fibres, to thereby form a transgene construct, and inserting the transgene construct into a chromosome of a mammalian cell to form a transgenic cell and either introducing the transgenic cell into an embryo to form a chimaeric mammal or growing the transgenic cell into a transgenic mammal, performing appropriate crossing to achieve a transgenic mamnnal, or growing the transgenic cell into a transgenic mammal, wherein the transgenic mammal produces hair or wool fibres having properties modified by said exogenous silk protein.
Insertion of the transgene construct into the genome of the mammal may be by any one of the techniques used to create transgenic animals in the art, including pronuclear injection of the transgene, nuclear transfection / nuclear transfer methodologies and injection of genetically altered stem cells into host embryos.
In a still further form of the first aspect, the invention could be said to reside in a recombinant transgene vector cassette into which the coding regions of DNA for an exogenous silk protein and a control element specific to the cortex of the hair or wool fibre can be cloned to form a transgene construct, wherein said transgene construct can be introduced into the genome of a mammal to produce a transgenic mammal having hair or wool fibre properties modified by said exogenous spider silk protein.
In another form of the first aspect, the invention could be said to reside in a nucleic acid sequence encoding a control element specific to the hair or wool fibre operably linked to one or more genes encoding an exogenous silk protein.
Preferably the nucleic acid sequence can be inserted into a mammalian cell to form a transgenic cell which can in turn be used to produce a transgenic mammal having hair or wool fibre properties modified by said exogenous silk protein.
The nucleic acid sequence may include, but is not limited to, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. The nucleic acid sequence may also include base analogues of DNA.
The nucleic acid sequence may contain the 5' and 3' untranslated and flanking regions including transcription, initiation and termination DNA sequence signals from hair or wool follicle cell-type specific control elements, known to enable expression of homologous or heterologous coding regions specifically in the cortex of the hair or wool follicle.
In a further form of the first aspect, the invention could be said to reside in a method of producing the transgenic mammal of the first aspect of the invention, the method including the steps of:
operably linking one or more genes encoding an exogenous silk protein to a control element specific for expression in the follicle of hair or wool fibres, to thereby form a.transgene construct, and inserting the transgene construct into a chromosome of a mammalian cell to form a transgenic cell and either introducing the transgenic cell into an embryo to form a chimaeric mammal or growing the transgenic cell into a transgenic mammal, 5 performing appropriate crossing to achieve a transgenic mammal, or growing the transgenic cell into a transgenic mammal, wherein the transgenic mammal produces hair or wool fibres having properties modified by said exogenous silk protein.

10 In one specific form of the first aspect, the invention could be said to reside in a method of altering the physical and/or chemical properties of hair or wool fibres including the step of expressing one or more exogenous silk proteins in follicle cells of the hair or wool fibre, wherein the protein is expressed in at least one compartment of the hair follicle so that it interacts physically andlor chemically with native KAP
and/or IF
structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool -fibre without substantially affecting the structural integrity of the fibre.
In a second aspect, the invention could be said to reside in a method of altering the physical and/or chemical properties of hair or wool fibres including the step of expressing one or more exogenous proteins in follicle cells of the hair or wool fibre, wherein the protein is expressed in at least one compartment of the hair follicle so that it interacts physically and/or chemically with native KAP
and/or IF
structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
It is expected that if the exogenous protein does not become relatively uniformly distributed throughout at least one compartment of the hair follicle and does not interact physically and/or chemically with the keratin superstructure it will introduce structural flaws which will disrupt the tensile strength and/or the load bearing capacity of the fibre and thereby disrupt the structural integrity of the fibre. Thus if the recombinant protein aggregates with itself and forms large agglomerates of protein within cortical cells it is less likely to have any chemical interaction between the keratin IF/KAP wool structure and the large agglomerates. However, expression of the protein relatively uniformly throughout at least one compartment of the hair or wool fibre may prevent localised interaction of the expressed protein with the IF and/or KAP phases which may introduce structural flaws. However, where a protein forms large regions of its own structure within the IF and/or the KAP phases but does form some chemical bonds with the KAP or IF proteins then a new and useful property may be added to the fibre. Therefore, in this context, uniform distribution may include the formation of large regions of expressed protein structure within the IF
and/or the KAP phases provided that the structure forms some chemical bonds with the KAP or IF proteins then a new and useful property may be added to the fibre. In one extreme, the recombinant protein may not form any of its own structure and may be integrated into the IF or I~AP phases.
The altered fibre may be produced by operably linking one or more genes encoding the recombinant protein to a control element capable of expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector.
The expression vector can then be inserted into a mammalian cell to form a transgenic cell which can be either introduced into an embryo to form a chimaeric mammal, or grown into a transgenic mammal. Appropriate crossing can then be performed to achieve a transgenic mammal in which the recombinant protein is expressed in the follicle of the hair or wool fibre and physically and/or chemically interacts with at least one endogenous structural KAP or IF protein so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the recombinant protein.
The recombinant protein molecules may physically interact with and/or become chemically connected to endogenous keratin IF and / or KAP molecules present in the structure. Alternatively the recombinant protein molecules may form their own structure alongside the endogenous keratin IF or KAP molecular phases but still physically interact with and chemically connect to the IF and/or KAP
molecular phases. Alternatively, the recombinant protein molecules may physically interact with and become chemically connected to only the endogenous keratin IF molecules present in the structure, or only the endogenous KAP
molecules present in the structure.

In the present context, a fibre may be considered structurally integral if it is suitable for further processing, for example into fabric. In the case of wool fibres, preferably the fibres are sutiable for scouring, carding, combing, spinning and weaving or knitting.
It is expected that if the recombinant protein molecules do not physically interact with and/or become chemically connected to endogenous keratin IF and / or KAP
molecules present in the structure then the physical properties of the fibre may render it not suitable for further processing. In addition, it is thought that in such a case the fibre may be structurally flawed and will not grow to a length suitable for harvesting and processing.
The invention includes expression in the cortex, including the ortho- and/or paracortex, or in the cuticle. The invention also includes expression of non-hair proteins generally or hair proteins in a different compartment to which they are normally expressed. Thus, in the latter case the recombinant proteins may be expressed in the cortex and may be the type I or type II keratin intermediate filaments normally found in other cell types, such as the intermediate filaments of -the inner root sheath and outer root sheath, including the companion layer, and the cytoskeletal intermediate filaments, the so called "soft" cytokeratins found in keratinising epithelial cells. Alternatively the recombinant molecule may be type III such as desmin, vimentin, glial fibrillary acidic protein, peripherin. The recombinant molecule may be type IV, such as neurofilaments and internexin.
The recombinant molecule may be type V, such as lamin molecules.
Examples of non hair proteins could include fibrous protein types such as silk or silk-like proteins having a GAGAGS (SEQ ID NO. 1) consensus repeat sequence, elastin or elastin-like proteins having a GVGVP (SEQ ID NO. 2) consensus repeat sequence, collagen or collagen-like proteins having a GPY (Y=hydroxy-P) (SEQ ID NO. 3) consensus repeat sequence, silk like protein SLP4 ((GAGAGS)t67 (SEQ ID NO. 4)), silk elastin combination SELP3 ([(GVGVP)g(GAGAGS)g] t l (SEQ ID NO. 5)), collagen like protein CLP3.1 ((GAPGAPGSQGAPGLQ)6g (SEQ ID NO. 6)), and human keratinocyte transglutaminase. The protein may also be a keratin hybrid of ariy one or more of the above proteins.

In the case of the type I and II intermediate filaments (IF) it is expected that they must pair with each other to form heteropolymeric filaments (Herding and Sparrow, 1991), and therefore it is expected that they need to be in a 1:l mole ratio in the cell to form the filaments. In contrast, the type III, IV and V
IF can form homopolymeric filaments.
Thus the invention may be said to reside in a method of producing a hair or wool fibre having altered physical and/or chemical properties, the method including the steps of operably linking one or more genes encoding a recombinant type I protein and one or more genes encoding a type II protein to a control element capable of expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector inserting the expression vector into a mammalian cell to form a transgenic cell and either introducing the transgenic cell into an embryo to form a chimaeric mammal, or growing the transgenic cell into a transgenic mammal performing appropriate crossing to achieve a transgenic mammal wherein the recombinant proteins are expressed in the follicle of the hair -or wool fibre to thereby form an IF protein that is integrated into the IF
and KAP
structure of the fibre so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the recombinant proteins.
Alternatively a transgenic mammal that expresses a recombinant type I protein may be mated with a transgenic mammal that expresses a recombinant type II
protein to thereby give offspring that are capable of expressing both type I
and type II proteins which are integrated into the IF and KAP structure of the fibre so that the offspring produce hair or wool fibres whose structure and properties are modified by the recombinant proteins.
The recombinant protein could be a keratin-exogenous protein hybrid that dimerises with a corresponding type I or II keratin protein to thereby form a filament. In this way the exogenous protein is integrated into the hair fibre structure. Alternatively, the recombinant protein may be a keratin IF-keratin associated protein (KAP) hybrid, including variations, mutations~and derivatives thereof.

In another form of the second aspect, the invention could be said to reside in hair or wool fibres having altered physical and/or chemical properties as produced by the second aspect of the invention.
In a further form of the second aspect, the invention could be said to reside in a transgenic mammal that produces hair or wool fibres of the second aspect of the invention.
In a still further form of the second aspect, the invention could be said to reside in a method of producing the transgenic mammal of the second aspect of the invention.
In a third aspect, the invention could be said to reside in a method of altering the physical and/or chemical properties of hair or wool fibres including the step of increasing expression of one or more endogenous KAP or IF proteins in follicle cells of the hair or wool fibre, wherein the protein is expressed in at least one compartment of the hair follicle so that it interacts physically and/or chemically with native KAP
and/or IF
-structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
Expression may be increased by linking with a gene promoter that results in higher expression than the native gene promoter. For example, the K2.10 gene promoter is known to be a high expression promoter and as discussed previously has been shown to drive over-expression of the KAP2.12 gene.
The expression of the one or more endogenous I~AP or IF proteins may be achieved by operably linking one or more genes encoding an endogenous protein to a control element capable of over-expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector. The expression vector may be inserted into a mammalian cell to form a transgenic cell which can then be either introduced into an embryo to form a chimaeric mammal or grown into a transgenic mammal. Appropriate crossing can then be performed to achieve a transgenic mammal in which the endogenous protein is over-expressed and integrated into the IF protein structure or the KAP matrix structure of the hair fibre so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the increased levels of the endogenous protein.
Whilst it will be appreciated that the vast majority of endogenous proteins that are 5 synthesised in the wool fibre cortex and cuticle are IF and KAP proteins, the proteins of the cell envelopes, hardened structures which are formed on the interior of the cell membrane, just beneath it, and which form the cell boundaries and cell-cell contacts may also be targets fox altering fibre properties. The total amount of these proteins in a wool fibres is small compared to the IF and KAP
10 protein levels. Nevertheless it is possible that the cell envelope proteins such as Elafin, Filaggrin, Loricrin, Involucrin and the small proline-rich proteins (SPRs) may be under- or over-expressed to thereby alter the properties of the fibre .
Proteins of the cell envelope also become linked to IF and KAP proteins (Steinert and Marekov, 1995) and therefore under or overexpression of IF or KAP proteins 15 may also be used to effect expression of the cell envelope proteins.
Preferably IF gene promters, or IF promoter elements linked to KAP gene promoters, are used to drive over-expression of the endogenous protein as it has -been found that IF gene promoters are more transcriptionally active than KAP
gene promoters. Preferably also, the over-expression characteristic is independent of the gene coding region to which the promoter is linked.
The control element may include promoters, enhancers and/or introns selected from genes in the list including, but not limited to : keratin type I control elements including those from genes Kl.l (bowling et al., 1986; GenBank Accession #AF227758), K1.2 (Wilson et al., 1988; GenBank Accession #M23912), K1.3 (Gough et al., 1978 and Parry, 1997), K1.4; keratin type II control elements including those from genes K2.9, K2.10, K2.11, K2.12 (Powell et al., 1992);
cysteine-rich keratin associated protein control elements of the KAP 1 (Powell et al., 1983), KAP2 (Powell et al., 1991) and KAP3 (Frenkel et al., 1989) gene families; glycine / tyrosine-rich protein control elements of the KAP6 gene family (Fratini et al., 1993), KAP7 and KAPB genes (Kuczek and Rogers, 1987);
cysteine-rich protein control elements of the KAP4 or KAP12 gene families;
cuticle-specific cysteine-rich protein control elements of the KAl'S
(MacKinnon et al., 1990) and KAP10 gene families (for nomenclature see Rogers and Powell, 1993; Powell and Rogers, 1994a).

The control element may also include a positive or negative control motif comprising the non-promoter elements of any of the control elements of the genes listed above as well as one or more promoter elements. Thus early expression may be achieved using enhancer elements and other non-promoter elements of the early-expressed type I and type II keratin intermediate filament genes including K1.1, K1.2, K1.3, K2.9, K2.10, K2.11, K2.12, whilst late expression may be achieved using enhancer elements and other non-promoter elements from genes of the late-expressed cysteine-rich keratin-associated protein families including KAP1, KAP2, KAP3.
Expression in the cortex may be driven using enhancer elements and other non-promoter elements from the early-expressed type I and type II keratin intermediate filament genes including K1.1, K1.2, K1.3, K2.9, K2.10, K2.11, K2.12, or the enhancer elements and other non-promoter elements for the genes encoding the late-expressed cysteine-rich keratin-associated protein families including KAPl, KAP2, KAP3.
Expression in the orthocortex may be driven using enhancer elements and other -non-promoter elements from the genes encoding the glycine / tyrosine-rich proteins including the KAP6 family, KAP7 and KAPB.
Expression in the paracortex may be driven using enhancer elements and other non-promoter elements from the genes encoding the cysteine-rich proteins of the KAP4 l KAP 12 families.
Expression in the cuticle may be driven using enhancer elements and other non-promoter elements from the early expressed cuticle specific type I and type II
keratin intermediate filament genes, or using enhancer elements and other non-promoter elements from the late-expressed cuticle specific keratin-associated proteins of the cysteine-rich gene families KAPS and KAP10.
The method may lead to alteration of the amount of IF proteins to thereby change the physical and chemical properties of the hair, or alternatively the method may lead to alteration of the amount of KAP proteins to thereby change the physical and chemical properties of the hair.

In the present context, a fibre may be considered structurally integral if it is suitable for further processing, for example into fabric. In the case of wool fibres, preferably the fibres are sutiable for scouring, carding, combing, spinning and weaving or knitting.
In a fourth aspect, the invention could be said to reside in a method of altering the physical andlor chemical properties of hair or wool fibres including the step of reducing the expression of one or more endogenous KAP andlor IF
proteins in follicle cells of the hair or wool fibre, wherein expression of the endogenous protein is reduced in at least one compartment of the hair follicle so that physical and/or chemical interactions of the under-expressed endogenous protein with other native endogenous KAP
andlor IF structural proteins are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
Expression of one or more specific endogenous KAP or IF proteins may be reduced using antisense RNA, that is specific antisense mRNA that reduces the - level of mRNA transcripts. Thus polynucleotides can be designed that are antisense to control regions of the gene of interest. For example, the KAP4 family of proteins may be under-expressed by linking a KAP4 promoter with an antisense mRNA sequence which includes the coding region of I~AP4.2.
Members of KAP 4 family have highly related coding region sequences and therefore use of the single antisense mRNA sequence may knockout some or all of the other expressed members of the I~AP4 family. Similarly inhibition of expression of the one or more genes can be achieved using triple helix base pairing which is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or regulatory molecules (fee et al., 1994).
Alternatively, expression of the one or more specific endogenous KAP or IF
proteins may be reduced using ribozymes which may be used to catalyse the specific cleavage of RNA. The mechanism of ribozyme action involves sequence-specific hybridisation of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage. Examples which may be used include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyse endonucleolytic cleavage of sequences encoding the IF or KAP protein of interest. Specific ribozyme cleavage sites within the potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences:
GUA, GUU, GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site may be evaluated for secondary structural features which may render the oligonucleotide inoperable. The suitability of candidate targets may also be evaluated by testing accessibility to hybridisation with complementary oligonucleotides using ribonuclease protection assays.
Alternatively, expression of the one or more specific endogenous KAP or IF
proteins may be reduced using 'nonsense' mRNA methods whereby excessive production of an alternative transgene mRNA species reduces the level of transcripts of endogenous genes that are turned on at the same time or later than the transgene, due to the competition for transcription factors and other components required for transcription.
Alternatively, expression of the one or more specific endogenous KAP or IF
-proteins may be reduced using 'gene knockout' methods. For example, intron blockers may be used to prevent the expression of the genes ifa vivo by binding the intron blockers to introns present in the genes to thereby inhibit expression of the gene. Therefore the cell of interest may be exposed to intron blockers having nucleotide sequences that bind at least one intron to prevent gene expression.
The intron blockers are modified so that they do not undergo extension and preferably also resist nucleotide replacement (exonuclease activity). The intron blockers have termini that do not undergo chain extension for example by modifying nucleotides to prevent extension (see for example Vinayagamoorthy et al. in US
5,944,528).
In the present context, a fibre may be considered structurally integral if it is suitable for further processing, for example into fabric. In the case of wool fibres, preferably the fibres are sutiable for scouring, carding, combing, spinning and weaving or knitting.
By way of a shorthand notation the following three and one letter abbreviations for amino acid residues are used in the specification as defined in Table 1.

Where a specific amino acid residue is referred to by its position in the polypeptide of an protein, the amino acid abbreviation is used with the residue number given in superscript (ie. Xaan) Amino Acid Three-letter One letter Abbreviation Abbreviation Alanine Ala A

Arginine Arg R

Asparagine Asn N

Aspartic Acid Asp D

Cysteine Cys C

Glutamine Gln Q

Glutamic acid Glu E

Glycine Gly G

Histidine His H

Isoleucine Ile I

Leucine Leu L

Lysine Lys K

Methionine Met M

Phenylalanine Phe F

Proline 'Pro P

Serine Ser S

Threonine Thr T

Tryptophan Trp W

Tyrosine Tyr Y

Valine Val V

BRIEF DESCRIPTION OF THE DRAWINGS
For a better understanding the invention will now be described with reference to a number of examples which are explained with reference to a number of drawings wherein, Figure 1 shows the single-letter amino acid code for the peptide sequence monomer (SEQ ID NO. 7) used to construct the NcDS.24 coding region. In that protein, 24 of these monomer units were ligated together. NH2 indicates the amino terminus of the 5 peptide and COOH the carboxy terminus of the peptide, Figure 2 shows the K2.10 promoter sequence (SEQ ID NO. S) showing the HindIII to SaII region. These restriction sites are shown in bold, as is the CATAAA (TATA) box. The point of initiation of 10 K2.10 transcription is marked by the arrow, Figure 3 shows the pBSK-NcSilk.01 plasmid. Grey shaded regions indicate the vector sequences for the ampicillin resistance ((3-lactamase) gene, the bacterial origin of replication (ColEl ori) 15 and the phage fl origin. The names and position (underlining) of diagnostic restriction sites are indicated. The total size of the plasmid is indicated in the centre of the figure, Figure 4 shows the pBSK-KIT plasmid. Grey shaded regions indicate 20 the vector sequences for the ampicillin resistance (~3-lactamase) gene, the bacterial origin of replication (ColEl ori) and the phage fl origin. The names and position (underlining) of diagnostic restriction sites are indicated. The position of methionine initiation (Met) and TGA stop codons is also shown.
The total size of the plasmid is indicated in the centre of the figure, Figure 5 shows the pBSK-NcSilk.n plasmid. Grey shaded regions indicate the vector sequences for the ampicillin resistance ((3-lactamase) gene, the bacterial origin of replication (ColEl ori) and the phage f 1 origin. The names and position (underlining) of diagnostic restriction sites are indicated. The total size of the plasmid is indicated in the centre of the figure. NcDS silk monomer units (NcSilk) which form the coding legion are indicated as boxed regions, Figure 6 shows the pMK2.10-5'A(7)N3' plasmid. K2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box. The 5' to 3' direction of K2.10 promoted transcription is through the SaII
site at position 2.68 toward the SacII site at position 2.80. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI / HindIII junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure.
The SmaI / NsiI site junction (position 2.98) and the ApaI /
SmaI site junction (position 3.08) in this base vector indicate the insertion of the NsiI / ApaI multiple cloning site polylinker sequence from Promega pGEM-7Zf(+) plasmid (with HindITI
site destroyed by end-fill with the Klenow Fragment [KF]) into a SmaI site engineered in the K2.10 gene 3'-untranslated region (see Bawden et al., 1998). Presence of this sequence allows transgene-specific mRNA to be detected and in sheep, for transgene mRNA to be distinguished from endogenous K2.10 mRNA present within the wool follicle, Figure 7 shows the pMK2.10-NcDS.24 plasmid. K2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box: The 5' to 3' direction of K2.10 promoted transcription is through the SaII
site at position 2.68 toward the SacII site at position 5.23. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI / HindIII junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure.
The position of the NcDS.24 coding region, from 2.68 to 5.20 kb is indicated by the grey-shaded box, Figure 8 shows a Northern transfer hybridisation analysis. Total RNA
prepared from the tail tissue of transgenic (#33; #75, #15, #95, #97, #100) and control non-transgenic (#34) mice was fractionated in a 1 % agarose-formaldehyde gel according to the protocol described in Sambrook et al., 1989, then transferred to Zetaprobe GT membrane according to the method described in Bawden et al., 1998. The radioactive probe used to detect NcDS.24 mRNA was prepared by oligolabelling a DNA
fragment containing the NcDS.24 coding region with a-32p_ dCTP. Phosphoimage analysis was used to detect binding of probe to NcDS mRNA. The positions of the 28S and 18S rRNA
species in the ethidium-stained agarose gel (panel A) and of the 3.5 kb NCDS.24 mRNA species in the probed Northern filter (panel B) are indicated by the arrows, Figure 9 shows the pMKAP2-NcDS.24 plasmid. KAP2 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box. The K1 gene intron (562 by PvuII fragment, see Wilson et al., 1988) is shown as a grey shaded box, from position 10.07 to position 10.64.
The 5' to 3' direction of KAP2 promoted transcription is through the NotI site at position 7.55 toward the HindIII site at position 10.30. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the KAP2 5' flanking sequence (SmaI l EcoRI(KF) junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure. The position of the NcDS.24 coding region, from 2.68 to 5.20 kb is indicated by the grey-shaded box, Figure 10 shows the pMK2.10-KI.NcDS24.K1 plasmid. K2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box. The 5' to 3' direction of K2.10 promoted transcription is through the SaII site at position 2.68 toward the SacII site at position 6.23. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI l HindIII junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure. The position of the K1 N- and C-terminal sequences are shown as striped boxes and the NcDS.24 coding region is indicated by the grey-shaded box, Figure 11 shows the pMK2.10-K2.NcDS24.K2 plasmid. K2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box. The 5' to 3' direction of K2.10 promoted transcription is through the SaII site at position 2.68 toward the SacII site at position 6.23. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI / HindIII junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure. The position of the K2 N- and C-terminal sequences are shown as striped boxes and the NcDS.24 coding region is indicated by the grey-shaded box, Figure 12 pMK2.10-hTGk plasmid. The K2.10 gene 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a wide-striped box. The 5' to 3' direction of K2.10-promoted transcription is through the SaII site at position 2.68 toward the SacII site at position 5.30.
The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI
/ HindIII junction at 0.00) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure.
The position of the human keratinocyte transglutaminase coding region, from 2.68 to 5.18 kb, is indicated by the fine-striped region, Figure 13 pK2.10-5'S(11)H3' plasmid. The K2.10 gene 5' flanking and 3' flanking DNA is coloured in black and the beta lactamase gene conferring ampicillin resistance (ampr; transcription direction indicated by the arrow) is shown as a fine-striped box. The 5' to 3' direction of K2.10-promoted transcription is through the SaII
site at position 2.68 toward the SacII site at position 2.80. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI /
HindIII junction at 0.00) are shown alongside their names. The total size of this base vector is 11.28 kb. The SmaI l SfiI site junction (position 2.98) and the HindIII / SmaI site junction (position 3.05) in the vector indicate the insertion of the SfiI /
HindIII multiple cloning site polylinker sequence from Promega pGEM-llZf(+) plasmid (with SaII site destroyed by end-fill with the Klenow Fragment [KF]) into a SmaI site engineered in the K2.10 gene 3'-untranslated region (see Bawden et al., 1998).
Presence of this sequence allows transgene-specific mRNA to be detected and in sheep, for transgene mRNA to be distinguished from endogenous K2.10 mRNA present within the wool follicle, Figure 14 pMK2.10-KAP5.1M plasmid. K2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequences (MAR) are shown as wide-striped boxes. The 5' to 3' direction of K2.10 promoted transcription is through the SaII site at position 2.68 toward the SacII site at position 3.53. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI l HindIII junction at 0.00) are shown alongside their names. The total size of the plasmid, indicated in the centre of the figure, is 13.18 kb. The position of the KAP5.1 coding region, from 2.68 to 3.41 kb, is indicated by the fine-striped box, Figure 15 shows the pMK2.10-KAP6.1 plasmid. K2.10 5' flanking and 3' flanking DNA is coloured ~in black and the matrix attachment region sequence (MAR) is shown as a striped box. The 5' to 3' direction of K2.10 promoted transcription is through the SaII site at position 2.68 toward the SacII site at position 3.09. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI l HindIII junction) are shown alongside their names. The total size of the plasmid is indicated in the centre of the figure. The position of the KAP6.1 coding region, from 2.68 to 2.97 kb, is indicated by the grey/white-spotted box, Figure 16 shows the results of a 2-D gel fractionation of S-carboxy-methylated wool proteins. Protein extracts from GO KAP6.1 transgenic and non-transgenic ewes were S-carboxy-methylated using ~4C-Iodoacetic acid (Powell and Rogers, 1994).
Approximately equal amounts of radioactively labelled products were fractionated and gels were electrophoresed in pairs, as shown. Autoradiography was carried out at -80 0C for 48 hours 5 using the Kodak BIOMAX signal intensification system. The direction of electrophoresis for the different dimensions in the 2D-gel electophoresis are shown at the top left of the figure, by the arrows. T = transgenic sample, C = Control non-transgenic sample. Arrows on the 2D-gel photo indicate the position of 10 electrophoresis of the KAP6.1 protein, Figure 17 shows load l extension curves for wool fibres from a I~AP6.1 transgenic sheep and a non-transgenic control. T = transgenic fibre load / extension trace, C = Control non-transgenic load /
15 extension trace, Figure 18 shows the pMK2.10-KAP4.2 plasmid. I~2.10 5' flanking and 3' flanking DNA is coloured in black and the matrix attachment region sequence (MAR) is shown as a striped box. The 5' to 3' 20 direction of K2.10 promoted transcription is through the SalI site at position 2.68 toward the SacII site at position 3.56. The coordinates of restriction sites, given as distance in kilobases (kb) from the beginning of the K2.10 5' flanking sequence (SmaI /
HindIII junction) are shown alongside their names. The total 25 size of the plasmid is indicated in the centre of the figure. The position of the KAP4.2 coding region, from 2.68 to 3.44 kb is indicated by the fine-striped box, Figure 19 shows load / extension curves for wool fibres from a KAP4.2 transgenic sheep and a non-transgenic control. T = transgenic fibre load / extension trace, C = Control non-transgenic load /
extension trace, Figure 20 is a diagram showing the protein sequence of the KAPl.I protein and a schematic representation of the position of conserved motifs identified within cloned members of the KAP1 protein family (from B. Powell et al., unpublished). The positions of decapaptide repeat units (shown in KAP1.1 sequence as bold lettering and boxed) in other KAP 1 proteins are shown as the shaded boxes. "HS" beneath the KAP 1 protein names indicate old nomenclature classifications of these proteins, Figure 21 is a diagram showing the protein sequence of the KAP5.1 protein and a schematic representation of the position of conserved motifs identified within cloned members of the KAP5 protein family (from B. Powell et al., unpublished). The positions of decapaptide repeat units (shown in KAPS.1 sequence as bold lettering and boxed) in other KAPS proteins are shown as the shaded boxes, Figure 22 shows results of RNA in situ hybridisation analysis of wool follicles in skin. Radioactively labelled (33P-rUTP) gene-specific cRNA probes used to detect endogenous K2.10 gene expression (panels a and b) and Transglutaminase gene expression (panels c and d) in the wool follicle cortex. Brightfield images (panels a and c); darkfield images (panels b and d). Transgene transglutaminase expression is driven in the wool follicle cortex by the K2.10 promoter. cRNA in situ hybridisation using radiolabelled probes was performed according to the method described in Powell and Rogers ( 1990), Figure 23 shows results of 2D-gel electrophoresis analysis of wool fibre proteins. Proteins isolated from wool fibres of control non-transgenic (panels a and c) and GO Transglutaminase (panel b) and GO KAP5 (panel d) transgenic animals by urea extraction were S-carboxy-methylated (14C-iodoacetic acid), fractionated via 2D gel electrophoresis in pairs and autoradiographed (previously described for Figure 16). The position of migration of keratin (K; boxed) and keratin-associated proteins (KAP) is indicated in panel a. The protein spot representing the KAPS
transgene product is marked (panel d; white arrow). Although exogenous transglutaminase enzyme activity could be detected in wool follicle cortex in frozen skin sections taken from sheep transgenic for human Transglutaminase (data not shown), no change to the protein profile for the fibres is evident (panel b), and Figure 24 shows transmission electron micrographs of wool fibre cross-sections at ~ 10,000X mag. Transmission electron micrographs of wool fibre cross-sections for fibres from a control non-transgenic sheep (upper panel) and a GO KAPS transgenic sheep (lower panel), prepared as described in Powell and Rogers (1994). The fibres are shown at ~ 10,000X magnification. Arrows on the right indicate the position of the fibre cuticle and cortex (control fibre) and KAPS protein deposits within the cortex (fibre from transgenic), and Figure 25 shows transmission electron micrographs of wool fibre cross-sections at ~100,000X mag. Transmission electron micrographs of wool fibre cortex cross-sections for fibres from a control non-transgenic sheep (left panel) and a GO Transglutaminase transgenic sheep (right panel), prepared as described in Powell and Rogers ( 1994). The fibre sections are shown at ~ 100,000X
magnification. Arrows indicate the position of para-crystalline lattice structures, visible in both the control and transgenic fibres and typical of the close-packed, orderly array of intermediate filaments within the wool fibre cortex. The letter m indicates the position of cell membrane junctions between adjacent cortical cells.
DETAILED DESCRIPTION OF THE INVENTION
For a better understanding the invention will now be described with reference to the following non-limiting examples.
Expression Of Exogenous Silk Protein Example 1 - Synthetic Spider Silk Gene Sequence A synthetic spider silk gene sequence was designed based upon the Nephila clavipes major ampullate gland dragline silk protein sequence (MaSpl; Xu and Lewis, 1990) and with a repeat unit sequence consensus close to that encoded by the partial cDNA encoding MaSpl (NcDS-1; Arcidiacono et al., 1998). A

monomer repeat unit from this protein was chosen for use in this work as the protein has been well characterised and such monomer repeats have been successfully expressed in E.coli from either the cDNA (Arcidiacono et al., 1998) or synthetic genes (Prince et al., 1995; Fahnestock and Irwin, 1997; Winkler et al., 1999). The repeat monomer unit of the designed protein sequence is shown in Figure 1.
The gene promoter used was K2.10 which has been used previously to drive overexpression of cortical proteins in the cortex (Bawden et al., 1998). The K2.10 control element is active early in follicle differentiation and is turned on to allow mRNA (and subsequent protein) synthesis just above the follicle bulb.
The K2.10 control element is a sheep gene control element but is also a functional gene control element in the mouse hair follicle (Keough et al., 1995). However until now the full DNA sequence of K2.10 has not been known. The DNA
sequence is shown in Figure 2 (SEQ ID NO. 8).
The 105 by DNA unit encoding this repeated monomer, constructed from four oligonucleotides, features codon usage optimised for sheep, according to the codon usage tables of the Kazusa DNA Research Institute Codon Usage database (GenBank), and with repeated amino acids encoded by different codon sequences, used in the proportion they are found in sheep proteins currently in the database.
The DNA sequence also includes 5' NheI and 3' SpeI restriction enzyme sites to allow directional multimerisation of the repeat unit in a fashion to resemble repeated units encoded by the cDNA sequence. The inclusion of these restriction site sequences has added a serine residue (S) and threonine residue (T) to the N-and C-termini of the repeat unit, respectively. In addition, to facilitate directional cloning of the monomer unit into EcoRI / SpeI-digested pBluescript SK+ vector, an EcoRI restriction site was added to the sense strand oligonucleotide at the 5' end of the sequence.
The full DNA sequence encoding the monomer unit insert, including EcoRI, NheI
and SpeI sites is shown in Figure 3, as it would appear, along with a map of the pBluescript SK+ vector, with relevant cloning sites indicated. The insert fragment has been cloned directionally into the EcoRI l Spel region of the pBluescript SK+ vector. The new recombinant clone is called pBSK-NcSi1k.01, to designate it as the first (.0l) pBluescript SK clone (pBSK) containing a monomer encoding Nephila clavipes Silk (NcSilk).

Following production of the pBSK-NcSi1k.01 clone, the NheI / SpeI region encompassing the entire Silk monomer coding region was excised and multimersied, by ligation, in a head-to-tail array containing from 15 to 20 copies of the monomer unit (i.e. approximately 1,575 to 2,100 bases of sequence).
This multimer was then cloned directionally into another base vector, pBSK- KIT, including unique 5' NheI and 3' SpeI sites flanked by additional DNA sequence providing for translation initiation and termination of the multimerised silk sequence coding region. The relevant sequence of the base vector pBSK-KIT, containing these processing signals along with a Kozak consensus for translation initiation immediately 5' (upstream) and including the ATG initiation codon itself, is shown in Figure 4. The multimer insert was then cloned into pBSK- KIT to replace the NheI l SpeI region. A new full length coding region clone was named pBSK- NcSilk.n, where n is the number of NcSilk monomer units contained in the coding region. A representation of this clone is shown in Figure 5.
Example 2 - Production of the Synthetic Silk Multimer Protein Transgene Fragment -The full length synthetic silk coding region in pBSK-NcSilk.n was excised using the SaII restriction enzyme sites of the original pBSK-KIT vector (see Figure 4) located 5' and 3' to the coding region and inserted into a transgene cassette vector for follicle-specific expression. As previously stated, the DNA sequences of the transgene cassette vectors include DNA of the 5' and 3' untranslated and flanking regions (including transcription initiation and termination DNA sequence signals) from wool follicle compartment-specific genes, known to enable efficient and high level expression of homologous or heterologous coding regions specifically in wool and hair follicle compartments such as the medulla, cortex and cuticle.
Such a transgene cassette vector, pMK2.10-5'A(7)N3', is shown in Figure 6.
Transgene cassettes such as this feature (i) a unique cloning site (see SaII
at position 2.68 kb on the map) into which a desired coding region may be inserted, (ii) 5' and 3' flanking regions and transcription initiation (promoter) and termination signals from a follicle compartment-specific gene (in this case the K2.10 intermediate filament gene, a cortical-specific gene) to ensure expression of the coding region, (iii) a matrix attachment region sequence (MAR;
Cockerill and Garrard, 1986) known to enhance establishment of the transgene locus as an expression site.(Bawden et al. unpublished) and (iv) sites able to be used to excise the whole transgene fragment for microinjection (in this case, the PvuI sites at positions 8.57 and 11.27 kb on the map). The excised transgene fragments are purified from low gelling temperature agarose by three successive phenol extractions followed by three ethanol precipitations.
Example 3 - Other Transgene Fragments A pMKAP2-NcDS.24 plasmid is shown in Figure 9. The 5' flanking DNA, including the gene promoter and the 3' flanking DNA including the polyadenyaltion signal and 3' processing sequences, is from the KAP2 gene. The coding regions of the synthetic NcDS.24 coding region are as used for the 10 plasmid pMK2.10-NcDS.24.
A pMK2.10-Kl.NcDS24.K1 plasmid is shown in Figure I0. The 5' flanking DNA including the gene promoter and the 3' flanking DNA, including the polyadenylation signal and 3' processing sequences, is from the K2.10 gene.
The 15 gene coding region is comprised of a fusion which includes (i) a type I
keratin intermeduiate filament N-terminal domain and rod segment 1A a-helix termination motif sequence, located at the N-ternninal end of the fusion, including ATG translation initiation colon, (ii) an in-frame NcDS.24 silk coding region (as described before but without the translation initiation or translation termination 20 colons) forming the central region of the fuision and (iii) the C-terminal end of the 2B rod segment and C-terminal domain of the same type I keratin intermediate filament protein, located at the C-terminal end of the fusion, including the translation termination colon. The kertain type I intermediate filament sequence is taken from the sequence of the 8c1 type I keratin 25 intermediate filament protein found in Parry, 1997.
A pMK2.10-K2.NcDS24.K2 plasmid is shown in Figure 11. The 5' flanking DNA including the gene promoter and the 3' flanking DNA, including the polyadenylation signal and 3' processing sequences, is from the K2.10 gene.
The 30 gene coding region is comprised of a fusion which includes (i) a type II
keratin intermediate filament N-terminal domain and rod segement 1A a-helix termination motif sequence, located at the N-terminal end of the fusion, including ATG translation initiation colon, (ii) an in-frame NcDS.24 silk coding region (as described previously without the translation initiation or translation termination colons) forming the central region of the fusion and (iii) the C-terminal end of the 2B rod segment and C-terminal domain of the same including the translation termination colon. The sequence of the type II keratin intermediate filament protein is taken from the sequence of the 7c type II keratin intermediate filament protein as found in Parry 1997.
Example 4 - Irzsertiorz of the Trarzsgerze Fragment for expression in tlae Wool Follicles of Sheep and Hair of Goats or Otlzer Arzirnals by Transgenesis arzd Production of Trarzsgenic Animals.
Pronuclear microinjection of transgene fragments into single-cell zygotes and transfer of microinjected embryos into recipient female animals (see Walker et al,. 1990) and analysis of resultant offspring for presence and expression of the transgene (see Bawden et al., 1995, 1998) were performed according to well established protocols. Embryology methods utilised in the production of transgenic sheep, including culture of embryos either in vitro or irz vivo, were carried out as detailed by Walker et al. (1990). Sheep used in this program were of the South Australian Merino breed.
Example 4.1 - Insertion of the Transgene Fragment into Mice and Production of Transgenic Mice for Expression in the Hair Follicle.
The techniques used to produce transgenic mice were essentially as described by w ~Brinster et al. (1981) and Hogan et al. (1986). These included maintenance of the CBA mouse strain, preparation of pseudopregnant female recipients, preparation of donor females / vasectomised males, collection and fertilisation of ova and micro-injection and transfer of embryos.
Example 5 - Expression Analysis Expression analyses include Northern hybridisation, RNA protection and RNA in situ hybridisation to establish the levels and specificity of expression of transgene loci (see Bawden et al., 1998), amino acid analysis and 2-D SDS polyacrylamide gel electrophoresis of wool and hair samples to determine levels of transgene protein produced (see Powell and Rogers, 1994b), electron microscopic-examination of fibres to determine ultrastructural effects of transgene expression (see Powell and Rogers, 1994b) and physico-chemical analyses of wool and whole fleeces. These expression analyses are best carried out upon G 1 generation animals, to avoid problems of analysis caused by transgene chimaerism, frequently seen in the GO founder generation animals. G1 animals are produced by natural mating of transgenic founders to non-transgenic animals. Homozygous transgenic animals may be made in subsequent generations by natural mating of transgenics.

Exanzple 5.1 - Analysis of Expression in K2.10 - NcDS.24 Transgenic Mice.
A total of 26 mice were identified transgenic for the K2.10 - NcDS.24 transgene via PCR and confirmed by Southern blot analysis of EcoRI-digested genomic DNA made from tail tissue according to the protocol described in Sambrook et al.
( 1989). The transgene was determined to be intact and inserted as loci comprising between 1 and ~30 copies in the genomes of the transgenic mice.
Expression of the K2.10 - NcDS.24 transgene in hair follicles was analysed by Reverse Transcriptase -PCR (RT-PCR) of mRNA made from tail tissue and by Northern transfer hybridisation analysis (Figure 8).
Example 6 - Mechanical arid Physical Properties of trarzsgerze modified wool The mechanical properties including the tensile strength and elasticity of modified hair or wool fibres produced may be tested using techniques known to those skilled in the art. Tests include those to determine the diameter and crimp of fibres, extensibility and intrinsic strength of fibres under load, the strength of wool staples, supercontraction properties of the fibres and the oc-helix-content and secondary structure of fibres (via Differential Scanning Calorimetry, single-fibre X-ray diffraction, Nuclear Magnetic Resonance Spectroscopy). Surface properties and internal features pertaining to fibre ultrastructure may be determined using Scanning Electron Microscopy and Transmission Electron Microscopy, respectively.
Example 7 - Uses of trarzsgene modij led wool or hair fibres Uses to which the modified hair or wool fibres could be put include weaving for use in the manufacture of general purpose apparel or in apparel with particular uses related to the new properties of the fibres made. Examples of such uses include the production of everyday apparel such as wool / cotton-blend stretch jeans, winter sports apparel with improved thermo-protective and elastic properties, water sports apparel with improved strength and thermo-protective qualities, external ligature materials to provide mechanical support to damaged skeletal joints (spinal / cranio-facial / limbs / hands / feet / digits) during rehabilitation periods and as ongoing supportive ligatures.
Other uses may include the production of industrial or military-grade materials with improved.tensile and / or mechano-elastic properties. Further uses may include the production of stronger and more versatile materials for domestic use, for example as fabrics and fibres commonly used to manufacture stain /
abrasion-resistant soft furnishings and carpets.
Expression of Other Exogenous Proteins Example 8 - Preparatio~i of Transgene Fragments Coding regions of genes encoding proteins of interest can be ligated into a MK2.10 transgene base vector clone (Figure 6). Transgene cassettes such as this feature (i) a unique cloning site (see SaII at position 2.68 kb on the map) into which a desired coding region may be inserted, (ii) 5' and 3' flanking regions and transcription initiation (promoter) and termination signals from a follicle compartment-specific gene (in this case the K2.10 intermediate filament gene, a cortical-specific gene) to ensure expression of the coding region, (iii) a matrix attachment region sequence (MAR; Cockerill and Garrard, 1986) known to enhance establishment of the transgene locus as an expression site (Bawden et al.
unpublished) and (iv) sites able to be used to excise the whole transgene fragment for microinjection (in this case, the PvuI sites at positions 8.57 and 11.27 kb on the map). The excised transgene fragments are purified from low gelling -temperature agarose by three successive phenol extractions followed by three ethanol precipitations.
Example 9 - Generation of Transgefaic Animals Pronuclear microinjection of transgene fragments into single-cell zygotes and transfer of microinjected embryos into recipient female animals (see Walker et al., 1990) and analysis of resultant offspring for presence and expression of the transgene (see Bawden et al., 1995, 1998) are performed according to established protocols. Initial testing to detect the presence of transgene DNA involved use of the Polymerase Chain Reaction (PCR) and primers specific f~r the transgene.
Determination of the integrity of inserted transgenes and transgene copy number was achieved by Southern transfer hybridisation analysis using transgene-specific radiolabelled DNA probes. Analysis of transgene expression was carried out via Northern transfer hybridisation analysis, cRNA in situ hybridisation analysis and Reverse Transcription-PCR.
Example 10 - Expressiora of the humafi keratinocyte transglutamiraase in wool A full length cDNA encoding the whole of human Keratinocye Transglutaminase (hTGk ; Phillips et al., 1990) was contained in a 2.5 kb EcoRI fragment, including 50 by of 5'-untranslated and only 5 by of 3'-untranslated sequence. The EcoRI
fragment was prepared from plasmid DNA, end-filled with Klenow fragment, isolated and cloned into SaII / KF - treated pMK2.I0-5'N(7)A3' vector. The orientation was determined by SmaI digestion and the resulting clone, some 14.5 kb, termed pMK2.10-hTGk. The transgene could be excised with PvuI and was 12.0 kb in size. The transgene fragment, purified as previously described, was microinjected into single-cell zygotes and the microinjected embryos were transferred into recipient ewes (Walker et al., 1990).
Example 1l - Expression of euticle protein, KAP5.1, ifa the wool fibre cortex The full coding region from the ovine KAP5.1 gene (a 72i~ by Ba131 / RsaI
fragment derived from a clone prepared for in vitro-transcription of KAP5.1;
see MacKinnon et al., 1990) was inserted into the Sal I site of the plasmid base vector pK2.10- 5'S(11)H (Figure 13). This base vector is similar to the base vector pMK2.10-5'N(7)A3' but with no MAR sequence 5' to the K2.10 5'-flanking DNA
and with the 71 by SfiI-HindIII multiple cloning site polylinker region from the Promega pGEM-llZf(+) plasmid (with SaII site destroyed by end-fill) inserted as part of the 3' non-coding region of the K2.10 gene sequence, in the place of the -95 by Nsi-ApaI polylinker from pGEM-7Zf(+) described previously (Figure 2).
The constructed K2.10-KAP5.1 sequence was excised from the intermediate clone and inserted into the cloning site of a plasmid vector, with MAR
sequences flanking the insert, to make pMK2.10-KAP5.1M (Figure 14). An 11.2 kb SaII /
NruI transgene fragment was excised from this clone, purified as previously described, microinjected into single-cell zygotes and the microinjected embryos were transferred into recipient ewes (Walker et al., 1990).
Over-expression of Endogenous Proteins Example 12 - Over-expression of KAP6.1 A 293 by AvaI / Hinfl fragment was isolated from a KAP 6.1 clone (see Fratini et al., 1993). The fragment was then end-filled with KF, isolated ligated into SaII /
KF / CIP pMK2.10-5'N(7)A3' vector. The transgene clone pMK2.10-KAP6.1 (Figure I5) is approximately 12.2 kb in size and the transgene fragment, 9.i3 kb in size, is excisable with PvuI.

The transgene fragment was then microinjected into single-cell zygotes and the microinjected embryos were transferred into recipient ewes (see Walker et al., 1990).
5 Expression of the othocortical-specific I~AP6.1 protein throughout the cortex as a transgene product was demonstrated by both cRNA in situ hybridisation analysis (data not shown) and 2-D gel electrophoresis. Production of large quantities of the glycine/tyrosine-rich KAP6.1 protein throughout the cortex of fibres (cf.
a predominance of glycineltyrosine-rich KAPs in the orthocortex in control fibres) 10 was indicated by the 2D-gel analysis of KAP6.1 G1 wool fibre extracts (Figure 16). The effect of over-expression of the KAP 6.1 protein throughout the cortex is shown in Figure 17.
2-D gel fractionation of S-carboxy-methylated wool proteins. Protein extracts 15 from GO KAP6.1 transgenic non-transgenic ewes were S-carboxy-methylated using 14C-Iodoacetic acid (Powell and Rogers, 1994). Approximately equal amounts of radioactively labelled products were fractionated and gels were electrophoresed in pairs, as shown in Figure 16. Arrows indicate the position of ~xnigration of the transgene product, KAP6.1 protein. Autoradiography was 20 carried out at -80 ~C for 48 hours using the Kodak BIOMAX signal intensification system.
Load (MPa) l Extension (% gauge length) curves were then determined for individual wool fibres from transgenic (T) and control (C) animals (Figure 17).
25 For each midside wool sample, 30 single fibres were broken. One single fibre breakage curve, representing a typical result from each 30-fibre group is shown.
Gauge length was 20 mm prior to extension and fibres were extended in water at 21 ~C and at a rate of 5mm per minute in an Instron Tensile Tester (model 4501).
Data was recorded and analysed using the Instron Series IX Automated Materials 30 Testing System software, version 5Ø Midside fibres tested were from a KAP6.1 transgenic and control non-transgenic sheep. At the point of fibre breakage, the degree of fibre extension was significantly lower for KAP6.1 transgenics versus non-transgenic controls (for KAP6.1 fibres, mean extension = 40.9 % +/_ 5.5 %
for transgenic, 49.6 % +/_ 6.3 % for control, p « 0.001). The load bearing 35 capacity of broken fibres from transgenic KAP6.1 (mean = 68.8 MPa +/_ 13.8 MPa) are significantly lower than fibres from non-transgenic controls (mean 150 MPa +/_ 25 MPa; p « 0.001).

Fibres from transgenic animals were harvested and processed by scouring, combing and spinning into yarn suitable for knitting or weaving. This shows that fibres produced by methods of the present invention retain their structural integrity and can be processed in the usual way.
Example 13 - Over-expression of KAP4.2 A 760 by EcoRI fragment from pKAP4.2 clone made by 5' RACE (N.Dillon, unpublished) and containing the full KAP4.2 coding region, was followed by KF
treatment, isolation then ligation blunt into SaII / KF / CIP pMK2.10-5'N(7)A3' vector. The transgene clone pMK2.10-KAP4.2 (Figure 18) was approximately 12.7 kb in size and the transgene fragment, 10.3 kb, is exciseable with PvuI.
The transgene fragment was then microinjected into single-cell zygotes and the microinjected embryos were transferred into recipient ewes (see Walker et al., 1990).
Expression of the paracortical-specific KAP4.2 protein (29 mol % cysteine) -throughout the cortex as a transgene product was demonstrated by both cRNA in situ hybridisation analysis and 2-D gel electrophoresis.
Load (MPa) / Extension (% gauge length) curves were prepared for individual wool fibres from transgenic (T) and control (C) animals (Figure 19). Fox each midside wool sample, 30 single fibres were broken. One single fibre breakage curve, representing a typical result from each 30-fibre group is shown. Gauge length was 20 mm prior to extension and fibres were extended in water at 21 ~C
and at a rate of 5mm per minute in an Instron Tensile Tester (model 4501).
Data was recorded and analysed using the Instron Series IX Automated Materials Testing System software, version 5Ø Midside fibres tested were from KAP4.2 transgenic and control non-transgenic sheep. At the point of fibre breakage, the degree of fibre extension was significantly lower for KAP4.2 transgenics versus non-transgenic controls (for KAP4.2 fibres, mean extension = 55.3 % +/_ 5.7 %
for transgenic, 59.3 % +/_ 5.6 % for control, p < 0.01). The load bearing capacity of broken fibres from transgenic KAP4.2 (mean = 115.3 MPa +/_ 25.8 MPa) are significantly lower than fibres from non-transgenic controls (mean ~ 150 MPa +/_ 25 MPa; p « 0.001 ).

Fibres from transgenic animals were harvested and processed by scouring, combing and spinning into yarn suitable for knitting or weaving. This shows that fibres produced by methods of the present invention retain their structural integrity and can be processed in the usual way.
Under-expression of Endogenous Proteins Exarzzple 14 - Antisetzse for the KAP4 family in the cortex.
Due to the high level of conservation between protein coding regions of members of the KAP4 protein family, the whole 760 by fragment used as a transgene in the transgenesis experiment described above may be cloned into the pMK2.10 5'N(7)A3' base vector in the antisense orientation. Antisense mRNA of motifs within the coding region that are conserved among all members of the KAP4 family would be able to bind to KAP4 mRNA in the nucleus. This double stranded RNA would then be destroyed by a ribonuclease within the nucleus which is specific for double-stranded RNA.
Example 1 S - Antise~zse for the KAPI family in the cortex.
-Due to the high level of conservation between protein coding regions of members of the KAP1 protein family, a region containing multiple copies of a conserved decapaptide motif (SIQTSCCQPT (SEQ ID NO. 9)) found within all known KAP 1 family members (see Figure 20) may be cloned into the pMI~2.10-5'N(7)A3' base vector in the antisense orientation. Antisense mRNA of these motifs would be able to bind to KAP 1 family mRNAs in the nucleus, within their coding regions, and thus lead to destruction of I~AP1 mRNAs.
Example 16 - Antisense for the KAPS family in the cuticle.
Due to the high level of conservation between protein coding regions of members of the KAP5 protein family, a region containing multiple copies of a conserved decapaptide motif found within all known KAPS family members (see Figure 21) can be cloned into the pMK2.10-5'N(7)A3' base vector in the antisense orientation. Antisense mRNA of these motifs would be able to bind to KAPS
family mRNAs in the nucleus, within their coding regions, and thus lead to destruction of KAPS mRNAs.
Example 17 - Mechanical and Physical Properties of transgene modified wool The mechanical properties including the tensile strength and elasticity of modified hair or wool fibres produced may be tested using techniques known to those skilled in the art. Tests include those to determine the diameter and crimp of fibres, extensibility and intrinsic strength of fibres under load, the strength of wool staples, supercontraction properties of the fibres and the cc-helix-content and secondary structure of fibres (via Differential Scanning Calorimetry, single-fibre X-ray diffraction, Nuclear Magnetic Resonance Spectroscopy). Surface properties and internal features pertaining to fibre ultrastructure may be determined using Scanning Electron Microscopy and Transmission Electron Microscopy, respectively.
Example I8 - Uses of transgene modified wool or hair fibres Uses to which the modified hair or wool fibres could be put include weaving for use in the manufacture of general purpose apparel or in apparel with particular uses related to the new properties of the fibres made. Examples of such uses include the production of everyday apparel such as wool / cotton-blend stretch jeans, winter sports apparel with improved thermo-protective and elastic properties, water sports apparel with improved strength and thermo-protective -qualities, external ligature materials to provide mechanical support to damaged skeletal joints (spinal / cranio-facial / limbs / hands / feet / digits) during rehabilitation periods and as ongoing supportive ligatures.
Other uses may include the production of industrial or military-grade materials with improved tensile and / or mechano-elastic properties. Further uses may include the production of stronger and more versatile materials for domestic use, for example as fabrics and fibres commonly used to manufacture stain /
abrasion-resistant soft furnishings and carpets.

REFERENCES
Arcidiacono, S., et al. (1998) Appl. Microbiol Biotechnol. 49: 31-38.
Bawden, C. S., et al. (1995) Transgenic Res. 4: 87-104.
Bawden, C. S., et al. (1998) Trarzsgenic Res. 7: 273-287.
Cockerill, P. N. and Garrard, W. T. (I986) Cell44: 273-282.
Fratini, A., et al. (1993) J. Biol. Chem. 268: 4511-4518.
Frenkel, M.J., et al. (1989) Gerzomics 4: 182-191.
Gee, J.E. et al. (1994) In: Huber, B.E. and B.I. Carr, Molecular and Immunologic Approaches, Futura Publishing Co., Mt. Kisco, NY.
Gough, K. H., et al. (1978) Biochem J. 173: 373-385.
Guerrette et al. (1996) Science 272:112-115.
Healing, J., and Sparrow, L.G. (1991) Int. J. Biol. Macromol. 13:115-119.
Keough, R., et al. (1995) J. Cell Scierzce 108: 957-966.
Kuczek, E. S, and Rogers, G. E. (1987) Eur. J. Biochem. 166:79-85.
MacKinnon, P.J. et al. (I990) J. CeII Biol. 111: 2587-2600.
Parry, D. (1997) in Jolles P, Zahn H, Hooker H (eds.). Formation afzd Structure of Humafz Hair. Birkhauser Verlag, Berlin, 1997, pp 177-207 Phillips, M.A. et al. (1990) Proc. Natl. Acad. Sci. 87: 9333-9337.
Powell, B. C., et al. (1983) Nucl. Acids. Res. 11: 5327-5346.
Powell, B. C., et al. (1991) Ann. N. Y. Acad. Sci. 642: 1-20.
Powell, B. C., et al. (1992) Development 114: 417-433.
Powell, B. C. and Rogers, G. E. (1990) EMBO J 9:1485-1493.
Powell, B. C. and .Rogers, G. E. ( 1994) The Keratinocyte Handbook, (Leigh L, Watt F., and Lane E.B. eds), pp. 401- 436, Cambridge University Press.
Powell, B. C. and Rogers, G. E. (1997) Formation and Structure of Human Hair, (Jones, P., Zahn, H. and Hooker, H. eds.), pp. 59-148, Birkhauser Verlag, B asel.
Prince, J. T., et al. (1995) Biochemistry 34: 10879- 10885.
Raju, K. and Anwar, R. A. (1987) J. Biol. Clzern. 262: 5755-5762.
Rogers, G.E. and Powell, B.C., (1993) J. Investigative Dermatology 101: 50S-55S.
Steinert, P.M., and Marekov, L.N. (1995) J. Biol Chem. 270: 17702-17711.
Walker, S. K., et al. (1990) Reprod. Fertil. Dev. 2: 633-640.
Wilson, B. W., et al. (1988) Gene 73: 21-31 Winkler, S., et.al. (I999) Int. J. Biol. Macromol. 24: 265-270.
Xu, M. and Lewis, R. ( 1990) Proc. Natl. Acad. Sci. 87: 7120-7124.

Sequence Listing <110> Luminis Pty South Australian Ltd. and Research Institute <120> Altered wool fibxes and hair <160> 9 <210> 1 <211> 6 <212> PRT

<213> Bombyx morii <220> Repeat <223> Silk-like sensus repeat sequence protein con <400> 1 Gly Ala Gly Ala Gly Ser <210> 2 <211> 5 <212> PRT

<213> Artificial Sequence <220> Repeat <223> Elastin-like consensus repeat protein sequence <400> 2 Gly Val Gly Val Pro <210> 3 <211> 3 <212> PRT

<213> Artificial Sequence <220> Repeat <223> Collagen-likeconsensus repeat protein sequence <400> 3 Gly Pro 4Hyp <210> 4' <211> 6 <212> PRT

<213> Artificial Sequence <220> Repeat 167 <223> Silk-like protein SLP4 <400> 4 Gly Ala Gly Ala Gly Ser <210> 5 <211> 88 <212> PRT

<213> Artificial Sequence <220> Repeat 11 <223> Silk elastin combination protein <400> 5 Gly Val Gly Val Gly Val Pro Gly Val Pro Pro Gly Val Gly Val Gly Val G1y Val Gly Val Pro Gly Val Pro Pro Gly Val Gly Val Gly Val Gly Val Gly Val Pro Gly Ala Gly Pro Gly Val Gly Ala Ser Gly Ala Gly Gly Ala Gly Ala Gly Ala Ala Gly Ser Ser Gly Gly Ala Gly Ser Ala Gly Ser Gly Ala Gly Gly Ala Gly Gly Ala Ser Gly Ala Gly Gly Ala Gly Ala Gly Ala Gly Ser Ser <210> 6 <211> 15 <212> PRT

<213> Artificial Sequence <220> Repeat 68 <223> Collagen-likeCLP3.1 protein <400> 6 Gly Ala G1y Ala Gln Pro Pro Gly Ser Gln Gly Ala Pro Gly Leu <210>

<211>

<212>
PRT

<213>
Artificial Sequence <220>
Repeat <223> silk Synthetic protein spider <400>

Ser Gly Gly Gly Ala Arg Leu Gly Gly Gln Gly Ala Gly Ala Ala 1 5 10 l5 A1a Ala Gly Ala Gly Leu Gly Gly Gly Gln Ser Gly Gly 4Hyp Gly Gln Gly Thr <210>

<211>

<212>
DNA

<213>
Ovis aries <220>
Promoter <223> Promoter K2.10 sequence <400>

aagcttgctgaggcggcttgattgcctcataaagctgtcgggctattttctgctcacacg60 aggatgatacttcacagccaatgctcactgacccttggcaaggtcctgctggtccctgtt120 agtatacagtgtaggggggagcacctcctgcctccaagcatgctcctcatcctcccaata180 ttccagcaaagtctggattgcattcatattttacagataaggaatctgggaagcataact240 tatcacaggtcacaaagctagtaagtggcagagccaagctgccaacagtgcttttcatct300 ccagagtctacgctcccatcaggaccgggacctgggtacactcacggctcccccaaccca360 aggagatgggtgtgtctacacagagaccctcagtgaagagtacagtttggataccgagcc420 cactggatccaggtagatgagcaggatcagaggacagaggcaattaggagtgtggcgaca480 gatggaggatccaccgtcttcatccacagcatttgaccaagaattaatctcacataacca540 ttggacatacagtgagaaacttccagaagctcaccagttccagctgagacaagaggagag600 aaatatctggttgtgtgttggcagatgtttgagtcagcaagggctgagcaagaaagtacc660 aaccagcacacctcccaccgaatcacccccaaagtcccactgggcattcagctggattca720 gtcacccccaaactcctaggctgcctcctgtgtgtctctcacagctgatgcccctatccc780 acagaacccactccaggcacaggagtctgtggaaatctgtgcctagggctcaagaggagg840 ggctgcgaaggtctattttcagctccgagtgtatgttgcccagctccctgccagatctcc900 acagttcacccattccctgccctcccagaatagatggcccctccctcaccctgggacata960 actgaccactcacctgagaggtggtagggagggcaaaagg'tgaggctctgggagaatgct1020 tggaaggctatttttagcccagactgggtcagcatttggtggcagtgggtcaggaaacag1080 gttcatcagaggagtcatcctcaagtacaaagctgctcaagagacatacgctcggaaggg1140 tttataggctcacattctcagattagggaaacctcctgtctcagtcccatagtccaccca1200 tcaaagtcatcagtggcccacctgcaaaaggaggggggca~aaataagggaatttggcttt1260 caggacagccatatgaatcccccacctctgctcacccaaggattcctctgatgggaggac1320 cacttcaggactcttggtgacaccacttcatggactcttggtgacctcccctacctccaa1380 caccttttcactcttccagttgggcgcatacacaccgacagtcatcactcagcttccctg1440 ctaggaaactgaaggacttccaccccaccaacatctgaccccagctcaacctgggcatta1500 ggggcttcctcctacctgtgacctctccccttcccacagtgaacaagccttggcatccct1560 gggtccacgccaaccctctcctacctccacatacctccagtctctgctggattcccagga1620 cctagcaaggtgcgtggctggcactggataagaatgtaccgaatgaatgaaagaactagt1680 gatggcacggtttccaaatcagaactgaactccttcctcgtctcccaccaaccctagcct1740 taccccaccctggtcctccttaaacacacctccaaggaggctccctggattaatcctgca1800 gctctggggtgttctgctctcactcctgcccctggcccaccagtgtgtgctcagttgctt1860 cagtcgtgtccgactctttgtgaccctttggacactatggacccaccaagttcctctgtc1920 catggggattctccaggcaagaatgctggagtgcgttgtcatccccttctccaggggagc1980 ttcctgacccagcagtcaaacctgcatctcttaagtctcctgcattggcaggcaggttct2040 ttaccactagtgcctcctgggaagcccaccagtagtgatgcctagaactctgaagaacaa2100 ccttggttctctcctgaactctctgactcaggttctcccatgtcccagtggatgccccat2160 ggctcctgccctcctaggaatatccaaagtgcaggggtcatgctctctcccaaatctctc2220 ccccaacccccatcacggaataggctctgggtaggaacagcttaagagaagctcattttg2280 acggtgaaggatgggacatactttaagagataaaggcaaagaggcccataacgagaggtt2340 gttcaggacaagccaccccctcatgggacaggccaaccactctaccccaaggccaggtca2400 taggtccagggcccatggtccagccctgtgccttccagaaaaggatttggggaccaggct2460 ctaccccaggtcactgcaactatcgcctgcactcagagcatggagtccaactagatactt2520 ctaggaggtctccacttccagtagcaatgggagggggagaagaagctcgtaaacggcttt2580 gaagatgaaacaggcctgaggccgagattgttgacacagctctactgaataggcaaacag2640 ttggctcttaagaggccagggtgatgccaagccaataaaatgcagctgttgtctctttgc2700 tgccccttttactgccagctatcctggtgcataaaagggcctgccacagctcagggagca2760 caggcctttg gctcagtcct ctgccagctt ctccactgtc cagacacctc cctgtcgaca 2820 acatg <210> 9 <211> 10 <212> PRT
<213> Ovis cries <220> Repeat <223> KAP1 protein <400> 9 Ser Ile Gln Thr Ser Cys Cys Gln Pro Thr

Claims (86)

1. A method of altering the physical and/or chemical properties of hair or wool fibres including the step of expressing one or more exogenous proteins in follicle cells of the hair or wool fibre, wherein the protein is expressed in at least one compartment of the hair follicle so that it interacts physically and/or chemically with native KAP
and/or IF
structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
2. A method as in claim 1 wherein the altered fibre is produced by operably linking one or more genes encoding the recombinant protein to a control element capable of expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector, the expression vector is then inserted into a mammalian cell to form a transgenic cell which can be either introduced into an embryo to form a chimaeric mammal, or grown into a transgenic mammal, appropriate crossing is then performed to achieve a transgenic mammal in which the recombinant protein is expressed in the follicle of the hair or wool fibre and physically and/or chemically interacts with at least one endogenous structural KAP or IF protein so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the recombinant protein.
3. A method as in claim 2 wherein the altered fibre is suitable fox further processing.
4. A method as in claim 3 wherein expression of the exogenous protein does not substantially disrupt the tensile strength of the fibre.
5. A method as in claim 4 wherein the fibre is a wool fibre that is able to extend by at least 30% before breakage.
6. A method as in either claim 4 or claim 5 wherein the fibre is a wool fibre that has a load bearing capacity of at least 40 MPa.
7. A method as in claim 3 wherein the exogenous proteins form their own structure alongside the endogenous keratin IF or KAP molecular phases but still physically interact with and chemically connect to the IF and/or KAP molecular phases.
8. A method as in claim 7 wherein the exogenous proteins physically interact with and become chemically connected to only the endogenous keratin IF
molecules present in the structure, or only the endogenous KAP molecules present in the structure.
9. A method as in claim 3 wherein non-hair proteins are expressed.
10. A method as in claim 9 wherein the recombinant protein is selected from the list including silk or silk-like proteins having a GAGAGS (SEQ ID NO. 1) consensus repeat sequence, elastin or elastin-like proteins having a GVGVP
(SEQ
ID NO. 2) consensus repeat sequence, collagen or collagen-like proteins having a GPY (Y=hydroxy-P) (SEQ ID NO. 3) consensus repeat sequence, silk like protein SLP4 ((GAGAGS)167) (SEQ ID NO. 4), silk elastin combination SELP3 ([(GVGVP)8(GAGAGS)8]11) (SEQ ID NO. 5), collagen like protein CLP3.1 ((GAPGAPGSQGAPGLQ)68) (SEQ ID NO. 6), and human keratinocyte transglutaminase.
11. A method as in claim 9 wherein the protein is a keratin hybrid of any one or more of the proteins of claim 10.
12. A method as in claim 10 wherein the control element includes promoters, enhancers and/or introns selected from genes in the list including: keratin type I
control elements including those from genes K1.1, K1.2, K1.3, K1.4; keratin type II control elements including those from genes K2.9, K2.10, K2.11, K2.12;
cysteine-rich keratin associated protein control elements of the KAP1, KAP2 and KAP3 gene families; glycine / tyrosine-rich protein control elements of the gene family, KAP7 and KAP8 genes; cysteine-rich protein control elements of the KAP4 or KAP12 gene families; and cuticle-specific cysteine-rich protein control elements of the KAP5 and KAP10 gene families.
13. A method as in claim 12 wherein the control element is from the K2.10 gene and the exogenous protein is selected from the list including: silk protein which includes the sequence of Seq ID No. 7; a silk-IF type I hybrid protein;
a silk-IF type II hybrid; and human keratinocyte transglutaminase.
14. A method as in claim 12 wherein the control element is from the KAP 2 gene and the exogenous protein is a silk protein which includes the sequence of Seq ID No. 7.
15. A method as in claim 3 wherein the exogenous protein includes one or more hair proteins that are expressed in a different compartment of the hair follicle to which they are normally expressed.
16. A method as in claim 15 wherein the exogenous hair proteins are expressed in the cortex and are selected from one or more of the list including:
type I or type II keratin intermediate filaments normally found in other cell types;
type III proteins selected from the list including desmin, vimentin, glial fibrillary acidic protein, peripherin; type IVproteins selected from the list including neurofilaments and internexin; and type V proteins including lamin.
17. A method of producing a hair or wool fibre having altered physical and/or chemical properties, the method including the steps of operably linking one or more genes encoding a recombinant type I protein and one or more genes encoding a type II protein to a control element capable of expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector inserting the expression vector into a mammalian cell to form a transgenic cell and either introducing the transgenic cell into an embryo to form a chimaeric mammal, or growing the transgenic cell into a transgenic mammal performing appropriate crossing to achieve a transgenic mammal wherein the recombinant proteins are expressed in the follicle of the hair or wool fibre to thereby form an IF protein that is integrated into the IF and KAP
structure of the fibre so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the recombinant proteins.
18. A method as in claim 17 wherein a transgenic mammal that expresses a recombinant type I protein is mated with a transgenic mammal that expresses a recombinant type II protein to thereby give offspring that are capable of expressing both type I and type II proteins which are integrated into the IF
and/or KAP structure of the fibre so that the offspring produce hair or wool fibres whose structure and properties are modified by the recombinant proteins.
19. A method as in claim 17 wherein the recombinant protein is a keratin-exogenous protein hybrid that dimerises with a corresponding type I or II
keratin protein to thereby form a filament.
20. A method as in claim 17 wherein the recombinant protein is a keratin IF-keratin associated protein (KAP) hybrid, including variations, mutations and derivatives thereof.
21. Hair or wool fibres having altered physical and/or chemical properties as produced by the method of claim 3.
22. Hair or wool fibres as in claim 21 wherein the fibre is a wool fibre that is able to extend by at least 30% before breakage.
23. Hair or wool fibres as in either claim 21 or claim 22 wherein the fibre is a wool fibre that has a load bearing capacity of at least 40 MPa.
24. A transgenic mammal that produces hair or wool fibres of claim 21.
25. A method of producing the transgenic mammal of claim 24.
26. A transgenic mammal that expresses one or more genes encoding an exogenous silk protein containing repeat silk amino acid sequences, or variants thereof, operably linked to a control element specific for expression in the follicle of hair or wool fibres such that the mammal produces hair or wool fibres containing said exogenous silk protein.
27. A mammal as in claim 26 wherein the silk protein contains one or more amino acid repeat units taken from a natural spider silk or published recombinant silk protein sequences.
28. A mammal as in claim 27 wherein the silk protein sequence is selected from one or more of the list including those found in the silk protein from the silkworm Bombyx morii, the silk protein from the golden orb spider Nephila clavipes, the orb web spider Araneus diadematus.
29. A mammal as in claim 27 wherein the silk protein sequence includes the sequence of Seq ID No. 7.
30. A mammal as in claim 27 wherein the silk protein sequence is engineered based on published sequences of natural or recombinant silk proteins or variants thereof provided that the variants retain at least some of the mechanical and/or chemical properties of native spider silk proteins.
31. A mammal as in claim 30 wherein the engineered sequence shares at least 50% homology with a known silk sequence.
32. A mammal as in claim 30 wherein the engineered sequence shares at least 70% homology with a known silk sequence.
33. A mammal as in claim 30 wherein the engineered sequence shares at least 90% homology with a known silk sequence.
34. A mammal as in claim 30 wherein the engineered sequence contains amino acid repeat units whose sequence shares at least 50% homology with an amino acid repeat unit of a known silk sequence.
35. A mammal as in claim 30 wherein the engineered sequence contains amino acid repeat units whose sequence shares at least 70% homology with an amino acid repeat unit of a known silk sequence.
36. A mammal as in claim 30 wherein the engineered sequence contains amino acid repeat units whose sequence shares at least 90% homology with an amino acid repeat unit of a known silk sequence.
37. A mammal as in claim 30 wherein the engineered sequence contains amino acid repeat units whose sequence is based on a GAGAGS (SEQ ID NO. 1) amino acid repeat unit.
38. A mammal as in claim 30 wherein the silk protein is a spider silk-keratin hybrid protein or a spider silk-keratin associated hybrid protein.
39. A mammal as in claim 27 wherein the control element regulates the expression of the silk protein in the cortex of the hair or wool follicle.
40. A mammal as in claim 39 wherein the transgene is expressed early in the cortex to enable sufficient silk protein to be expressed to alter the properties of wool and hair fibres.
41. A mammal as in claim 39 wherein the transgene is expressed late in the cortex to allow wool or hair filament formation to proceed to a point such that the introduction of the exogenous silk protein causes minimal disturbance to the native wool or hair structure.
42. A mammal as in claim 39 wherein the control element includes one or more promoter sequences as well as wool or hair follicle cell specific enhancer sequences for amplifying expression and enabling efficient and high level expression of homologous or heterologous coding regions within the cortex of the hair or wool follicle.
43. A mammal as in claim 40 wherein expression in the cortex is driven using enhancer elements and other non-promoter elements from the early-expressed type I and type II keratin intermediate filament genes seleceted from the list including one or more of K1.1, K1.2, K1.3, K2.9 , K2.10, K2.11, and K2.12.
44. A mammal as in claim 41 wherein expression in the cortex is driven using enhancer elements and other non-promoter elements for the genes encoding the late-expressed cysteine-rich keratin-associated protein families selected from the list including the KAP1, KAP2 and KAP3 gene families.
45. A mammal as in claim 27 wherein expression in the orthocortex is driven using enhancer elements and other non-promoter elements from the genes encoding the glycine / tyrosine-rich proteins including the KAP6 gene family, KAP7 and KAP8 genes.
46 46. A mammal as in claim 27 wherein expression in the paracortex is driven using enhancer elements and other non-promoter elements from the genes encoding the cysteine-rich proteins of the KAP4 or KAP12 gene families.
47. A mammal as in either claim 27 or claim 29 wherein the control element is K2.10.
48. A mammal as in either claim 27 or claim 29 wherein the control element includes the sequence of the LEF-1 / TCF-1 binding site found in hair keratin IF
and KAP genes.
49. A mammal as in claim 27 wherein the mammal is selected from the group including mouse, sheep, goat, alpacca and llama.
50. A mammal as in claim 49 wherein the mammal is a sheep.
51. Wool or hair fibres in which mechanical and/or chemical properties of the fibres are altered by one or more exogenous silk proteins.
52. A product made from the altered wool or hair fibres of claim 51.
53. A method of producing the transgenic mammal of claim 26, the method including the steps of:
operably linking one or more genes encoding an exogenous silk protein to a control element specific for expression in the follicle of hair or wool fibres, to thereby form a transgene construct, and inserting the transgene construct into a chromosome of a mammalian cell to form a transgenic cell and either introducing the transgenic cell into an embryo to form a chimaeric mammal or growing the transgenic cell into a transgenic mammal, performing appropriate crossing to achieve a transgenic mammal, or growing the transgenic cell into a transgenic mammal, wherein the transgenic mammal produces hair or wool fibres having properties modified by said exogenous silk protein.
54. A method of altering the physical and/or chemical properties of hair or wool fibres including the step of increasing the expression of one or more endogenous KAP and/or IF
proteins in follicle cells of the hair or wool fibre, wherein the protein is expressed in at least one compartment of the hair follicle so that it interacts physically and/or chemically with native KAP
and/or IF
structural proteins and the interactions are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
55. A method as in claim 54 wherein expression of the one or more endogenous KAP or IF proteins is achieved by operably linking one or more genes encoding an endogenous protein to a control element capable of over-expressing the protein in the follicle of hair or wool fibres to thereby form an expression vector, the expression vector is inserted into a mammalian cell to form a transgenic cell which can then be either introduced into an embryo to form a chimaeric mammal or grown into a transgenic mammal, appropriate crossing is then performed to achieve a transgenic mammal in which the endogenous protein is over-expressed and integrated into the IF protein structure or the KAP
matrix structure of the hair fibre so that the transgenic mammal produces hair or wool fibres whose structure and properties are modified by the increased levels of the endogenous protein.
56. A method as in claim 55 wherein the altered fibre is suitable for further processing.
57. A method as in claim 56 wherein the fibre is a wool fibre that is able to extend by at least 30% before breakage.
58. A method as in either claim 58 or claim 59 wherein the fibre is a wool fibre that has a load bearing capacity of at least 40 MPa.
59. A method as in claim 56 wherein the control element includes a gene promoter that results in higher expression than the native gene promoter.
60. A method as in claim 59 wherein the gene promoter is the K2.10 gene promoter.
61. A method as in claim 56 wherein cell envelope proteins selected from the list including Elafin, Filaggrin, Loricrin, Involucrin and the small proline-rich proteins (SPRs) are over-expressed to thereby alter the properties of the fibre.
62. A method as in claim 61 wherein under or overexpression of IF or KAP
proteins is used to affect expression of the cell envelope proteins.
63. A method as in claim 59 wherein IF gene promters, or IF promoter elements linked to KAP gene promoters, are used to drive over-expression of the endogenous protein.
64. A method as in claim 59 wherein the control element includes promoters, enhancers and/or introns selected from genes in the list including: keratin type I
control elements including those from genes K1.1, K1.2, K1.3, K1.4; keratin type II control elements including those from genes K2.9, K2.10, K2.11, K2.12;
cysteine-rich keratin associated protein control elements of the KAP1, KAP2 and KAP3 gene families; glycine / tyrosine-rich protein control elements of the gene family, KAP7 and KAP8 genes; cysteine-rich protein control elements of the KAP4 or KAP12 gene families; and cuticle-specific cysteine-rich protein control elements of the KAP5 and KAP10 gene families.
65. A method as in claim 64 wherein the control element includes a positive or negative control motif comprising the non-promoter elements of any of the control elements of the genes listed in claim 59 as well as one or more promoter elements.
66. A method as in claim 59 wherein early expression is achieved using enhancer elements and other non-promoter elements of the early-expressed type I
and type II keratin intermediate filament genes including K1.1, K1.2, K1.3, K2.9, K2.10, K2.11, and K2.12.
67. A method as in claim 59 wherein late expression is achieved using enhancer elements and other non-promoter elements from genes of the late-expressed cysteine-rich keratin-associated protein families including KAP1, KAP2, KAP3.
68. A method as in claim 59 wherein expression in the cortex is driven using enhancer elements and other non-promoter elements from the early-expressed type I and type II keratin intermediate filament genes including K1.1, K1.2, K1.3, K2.9, K2.10, K2.11, K2.12, or the enhancer elements and other non-promoter elements for the genes encoding the late-expressed cysteine-rich keratin-associated protein families including KAP1, KAP2, KAP3.
69. A method as in claim 59 wherein expression in the orthocortex is driven using enhancer elements and other non-promoter elements from the genes encoding the glycine / tyrosine-rich proteins including the KAP6 family, KAP7 and KAP8.
70. A method as in claim 59 wherein expression in the paracortex is driven using enhancer elements and other non-promoter elements from the genes encoding the cysteine-rich proteins of the KAP4 / KAP12 families.
71. A method as in claim 59 wherein expression in the cuticle is driven using enhancer elements and other non-promoter elements from the early expressed cuticle specific type I and type II keratin intermediate filament genes, or using enhancer elements and other non-promoter elements from the late-expressed cuticle specific keratin-associated proteins of the cysteine-rich gene families KAP5 and KAP10.
72. A method as in claim 59 wherein the method leads to alteration of the amount of IF proteins to thereby change the physical and chemical properties of the fibre.
73. A method as in claim 59 wherein the method leads to alteration of the amount of KAP proteins to thereby alter the physical and chemical properties of the fibre.
74. A method as in claim 64 wherein the control element is from the K2.10 gene and the protein is either KAP6.1 or KAP4.2.
75. A method of altering the physical and/or chemical properties of hair or wool fibres including the step of reducing the expression of one or more endogenous KAP and/or IF
proteins in follicle cells of the hair or wool fibre, wherein expression of the endogenous protein is reduced in at least one compartment of the hair follicle so that physical and/or chemical interactions of the under-expressed endogenous protein with other native endogenous KAP
and/or IF structural proteins are relatively uniform in distribution throughout the compartment to thereby alter the properties of the hair or wool fibre without substantially affecting the structural integrity of the fibre.
76. A method as in claim 75 wherein the altered fibre is suitable for further processing.
77. A method as in claim 76 wherein expression of the one or more specific KAP or IF proteins is reduced using antisense RNA.
78. A method as in claim 77 wherein the antisense RNA is a polynucleotide that is antisense to control regions of a gene that controls expression of an endogenous KAP and / or IF protein.
79. A method as in claim 78 wherein the KAP4 family of proteins are under-expressed by linking a KAP4 promoter with an antisense mRNA sequence which includes the coding regions of KAP4.2.
80. A method as in claim 76 wherein expression of the one or more specific KAP or IF proteins is reduced using ribozymes which catalyse the specific cleavage of RNA.
81. A method as in claim 80 wherein the ribozymes include engineered hammerhead motif ribozyme molecules that catalyses endonucleolytic cleavage of sequences encoding a specific IF or KAP protein.
82. A method as in claim 81 wherein specific ribozyme cleavage sites within the potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, GUC, then short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site are evaluated for secondary structural features which render the oligonucleotide inoperable.
83. A method as in claim 76 wherein expression of the one or more specific KAP or IF proteins is reduced using 'nonsense' mRNA methods whereby excessive production of an alternative transgene mRNA species reduces the level of transcripts of endogenous genes that are turned on at the same time or later than the transgene.
84. A method as in claim 76 wherein expression of the one or more specific KAP or IF proteins is reduced using 'gene knockout' methods.
85. A method as in claim 84 wherein intron blockers are used to prevent the expression of the genes in vivo by binding the intron blockers to introns present in the genes to thereby inhibit expression of the gene.
86. A method as in claim 85 wherein a cell of interest is exposed to intron blockers having nucleotide sequences that bind at least one intron to prevent gene expression, wherein the intron blockers are modified so that they do not undergo extension and also resist nucleotide replacement and the intron blockers have terminii that do not undergo chain extension.
CA 2413449 2000-06-28 2001-06-28 Altered wool and hair fibres Abandoned CA2413449A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AUPQ8459 2000-06-28
AUPQ846000 2000-06-28
AUPQ8460 2000-06-28
AUPQ845900 2000-06-28
PCT/AU2001/000779 WO2002000016A1 (en) 2000-06-28 2001-06-28 Altered wool and hair fibres

Publications (1)

Publication Number Publication Date
CA2413449A1 true true CA2413449A1 (en) 2002-01-03

Family

ID=25646371

Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2413449 Abandoned CA2413449A1 (en) 2000-06-28 2001-06-28 Altered wool and hair fibres

Country Status (2)

Country Link
CA (1) CA2413449A1 (en)
WO (1) WO2002000016A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006076711A3 (en) 2005-01-14 2007-07-05 Tufts College Fibrous protein fusions and use thereof in the formation of advanced organic/inorganic composite materials
US20110281256A1 (en) 2010-05-17 2011-11-17 Michael Glenn Davis Systems and Methods of Detecting and Demonstrating Hair Damage Via Evaluation of Protein Fragments
CN103421782B (en) * 2012-11-27 2015-01-07 华中农业大学 Isolation, cloning and expression pattern identification of sheep hair follicle specific expression promoter fragment

Also Published As

Publication number Publication date Type
WO2002000016A1 (en) 2002-01-03 application

Similar Documents

Publication Publication Date Title
McGinnis et al. Human Hox-4.2 and Drosophila deformed encode similar regulatory specificities in Drosophila embryos and larvae
Uemura et al. numb, a gene required in determination of cell fate during sensory organ formation in Drosophila embryos
Fuchs et al. The human keratin genes and their differential expression
Saccone et al. The Ceratitis capitata homologue of the Drosophila sex-determining gene sex-lethal is structurally conserved, but not sex-specifically regulated
Kuziora et al. A homeodomain substitution changes the regulatory specificity of the deformed protein in Drosophila embryos
Komatsu et al. Mutations in a cyclic nucleotide–gated channel lead to abnormal thermosensation and chemosensation in C. elegans
Kao et al. Keratin 12-deficient mice have fragile corneal epithelia.
Zheng et al. The deaf jerker mouse has a mutation in the gene encoding the espin actin-bundling proteins of hair cell stereocilia and lacks espins
Hayashi et al. What determines the specificity of action of Drosophila homeodomain proteins?
US20020132290A1 (en) Coordinate cytokine regulatory sequences
Schumacher et al. Spnr, a murine RNA-binding protein that is localized to cytoplasmic microtubules.
Collier et al. Alternative myosin hinge regions are utilized in a tissue-specific fashion that correlates with muscle contraction speed.
TRYSELIUS et al. CecC, a cecropin gene expressed during metamorphosis in Drosophila pupae
Akimaru et al. Drosophila CBP is required for dorsal–dependent twist gene expression
Horabin et al. Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on controlling the use of the male exon 5'splice site.
Moessler et al. The SM 22 promoter directs tissue-specific expression in arterial but not in venous or visceral smooth muscle cells in transgenic mice
Zhao et al. The mouse Hox-1.3 gene is functionally equivalent to the Drosophila Sex combs reduced gene.
US5695995A (en) Neurogenic differentiation (neurod) genes
Duggan et al. Regulation of touch receptor differentiation by the Caenorhabditis elegans mec-3 and unc-86 genes
US6172200B1 (en) Patched antibodies
US5545808A (en) Transgenic salmonid fish expressing exogenous salmonid growth hormone
Bryan et al. Fascin, an echinoid actin-bundling protein, is a homolog of the Drosophila singed gene product
Klahre et al. Villin-like actin-binding proteins are expressed ubiquitously in Arabidopsis
US6380458B1 (en) Cell-lineage specific expression in transgenic zebrafish
US7303895B1 (en) Choline transport like (CTL) membrane proteins involved in choline transport

Legal Events

Date Code Title Description
FZDE Dead