Connect public, paid and private patent data with Google Patents Public Datasets

Bone morphogenetic protein-16 (bmp-16) compositions


Publication number
CA2265508C CA 2265508 CA2265508A CA2265508C CA 2265508 C CA2265508 C CA 2265508C CA 2265508 CA2265508 CA 2265508 CA 2265508 A CA2265508 A CA 2265508A CA 2265508 C CA2265508 C CA 2265508C
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CA 2265508
Other languages
French (fr)
Other versions
CA2265508A1 (en )
Anthony J. Celeste
Beth L. Murray
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genetics Institute LLC
Original Assignee
Genetics Institute LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date



    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/495Transforming growth factor [TGF]
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/51Bone morphogenetic factor; Osteogenins; Osteogenic factor; Bone-inducing factor
    • A61K38/00Medicinal preparations containing peptides
    • C07K2319/00Fusion polypeptide


Purified BMP-16 proteins and processes for producing them are disclosed. DNA
molecules encoding the BMP-16 proteins are also disclosed. The proteins may be used in the treatment of bone, cartilage, other connective tissue defects and disorders, including tendon, ligament and meniscus, in wound healing and related tissue repair, as well as for treatment of disorders and defects to tissues which include epidermis, nerve, muscle, including cardiac muscle, and other tissues and wounds, and organs such as liver, lung, cardiac, pancreas and kidney tissue. The proteins may also be useful for the induction of growth and/or differentiation of undifferentiated embryonic and stem cells.


The present invention relates to a novel family of purified proteins designated as Bone Motphogenetic Protein-16 (BMP-16) and BIvIP-16-related proteins, DNA encoding them, and processes for obtaining them. These proteins may be used to induce bone and/or cartilage or other connective tissue formation, and in won~nd healing and tissue repair.
These proteins may also be used for augmenting the activity of other bone morphogenetic proteins.
The search for the molecule or molecules responsible for the bone-, cartilage-, and other connective tissue-inductive activity present in bone and other tissue extracts has led to the discovery of a novel set of molecules called the Bone Morphogenetic Proteins (BMPs).
The structures of several proteins, designated BMP-1 through BMP-1 S have previously been elucidated. The unique inductive activities of these proteins, along with their presence in bone, suggests that they are important regulators of bone repair processes, and may be involved in the normal maintenance of bone tissue. There is a need to identify whether additional proteins, particularly human proteins, exist which play a role in these processes. The present invention relates to the identification of such a novel hu~,man protein, which the inventors have designated human BMP-16.
Human BMP-16 is the human homolog of a marine protein called Nodal. The nucleotide and amino acid sequences of Noda! are described in Zhou et al., Nature, 361:5=13-547 ( 1993). The marine Nodal gene has been described as being expressed in the mouse node during gastrulation. A retrovirally inducecL insertional mutation of the marine Nodal gene results in the absence of mesodetmal cell tyF~es normally associated with the primitive streak, and is embryonic lethal. Conlon et al., Development 120:1919-1928 (1994);
Conlon et al., Development 111:969-981 ( 1991 ).

- As used herein, the term BMP-16 protein refers to the human BMP-16 protein, having the amino acid sequence specified in SEQUENCE ID N0:2, as well as DNA
sequences encoding the BMP-16 protein. such as the native human sequence shown in SEQUENCE ID
NO:I. Also included are naturally occurring allelic sequences of SEQUENCE ID
NO:1 and 2, and equivalent degenerative codon sequences of the above.
The BMP-16 DNA sequence (SEQ ID NO: 1 ) and amino acid sequence (SEQ ID NO:
2) are set forth in the Sequence Listings. BMP-16 proteins may be capable of inducing the formation of cartilage, bone, or other connective tissue, or combinations thereof. The cartilage and/or bone and/or other connective tissue formation activity in the rat bone formation assay described below. BMP-16 proteins may be further characterized by the ability to demonstrate effects upon the growth and/or differentiation of embryonic cells and/or stem cells. Thus, the proteins or compositions of the present invention may also be useful for treating cell populations, such as embryonic cells or stem cell populations, to enhance or enrich the growth andlor differentiation of the cells.
Human BMP-16 protein may be produced by culturing a cell transformed with a DNA
sequence comprising nucleotide a DNA sequence encoding the mature BMP-16 polypeptide, comprising nucleotide #51 1 to nucleotide #840 as shown in SEQ ID NO: 1, and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acids #1 to #1 10 as shown in SEQ ID N0:2 substantially free from other proteinaceous materials with which it is co-produced. For production in mammalian cells, the DNA sequence further comprises a DNA sequence encoding a suitable propeptide 5' to and linked in frame to the nucleotide sequence encoding the mature BMP-16-related polypeptide.
The propeptide may be the native BMP-16-related propeptide, or may be a propeptide from another protein of the TGF-(3 superfamily. Where the native BMP-16 propeptide is used.
human BMP-16 may be produced by culturing a cell transformed with a DNA
sequence comprising a DNA sequence encoding the full BMP-16 polypeptide, comprising nucleotide #1 to #840 as shown in SEQ ID NO: 1, producing a protein characterized by the amino acid sequence comprising amino acids #-170 to #1 10 as shown in SEQ ID N0:2, of which amino acids -170 to -1 comprise the native propeptide of human BMP-16, and recovering and purifying from the culture medium a protein characterized by the amino acid sequence comprising amino acids #1 to #110 as shown in SEQ ID N0:2, substantially free from other proteinaceous materials with which it is co-produced.
It is expected that other species, particularly human, have DNA sequences homologous to human BMP-16 protein. The invention, therefore, includes methods for obtaining the DNA

~ sequences encoding human BMP-16 protein, the DNA sequences obtained by those methods, and the human protein encoded by those D:~VA sequences. This method entails utilizing the human BMP-16 protein nucleotide sequence or portions thereof to design probes to screen libraries for the corresponding gene from other species or coding sequences or fragments thereof from using standard techniques. Thus, the present invention may include DNA
sequences from other species, which are homologous to human BMP-16 protein and can be obtained using the human BMP-16 sequence. The present invention may also include functional fragments of the human BMP-116 protein, and DNA sequences encoding such functional fragments, as well as functional fragments of other related proteins. The ability of such a fragment to function is determinable; by assay of the protein in the biological assays l~ described for the assay of the BMP-16 protein. A DNA sequence encoding the complete mature human BMP-16 protein (SEQ ID NO: I ) and the corresponding amino acid sequence (SEQ ID N0:2) are set forth herein. The B:MP-16 proteins of the present invention, such as human BMP-16, may be produced by culturing a cell transformed with the correlating DNA
sequence, such as the human BMP-16 DNA sequence, and recovering and purifying protein, such as BMP-16, from the culture medium. '1.'he purified expressed protein is substantially free from other proteinaceous materials with vrhich it is co-produced, as well as from other contaminants. The recovered purified protein is contemplated to exhibit cartilage and/or bone and/or connective tissue formation activity. ~Chus, the proteins of the invention may be further characterized by the ability to demonstrate cartilage and/or bone and/or other connective tissue formation activity in the rat bone formation assay described below. BMP-16 proteins may be further characterized by the ability to demonstrate effects upon the growth and/or differentiation of embryonic cells and/or stem cells. Thus, the proteins or compositions of the present invention may also be characterized by their ability to enhance or enrich the growth and/or differentiation of the cells.
Another aspect of the invention provides pharmaceutical compositions containing a therapeutically effective amount of human BMP-16 protein, in a pharmaceutically acceptable vehicle or carrier. These compositions of the invention may be used in the formation of bone.
These compositions may further be utilized for the formation of cartilage, or other connective tissue, including tendon, ligament, meniscus and other connective tissue, as well as combinations of the above, for example regeneration of the tendon-to-bone attachment apparatus. The compositions of the present invention, such as compositions of human BMP-16, may also be used for wound healing and tissue repair. Compositions of the invention may further include at least one other therapeutically useful agent such as the BMP proteins BMP-1, BMP-2, BMP-3, BMP-4, BMP-5, BMP-6 and BMP-7, disclosed for instance in United States

3 _ 5 Patents 5,108,922: 5,013,649: 5,116,738; 5.106.748; 5,187,076; and 5.141,905; BMP-8, - disclosed in PCT publication W091/18098; and BMP-9, disclosed in PCT
publication W093/00432, BMP-10, disclosed in PCT application W094/26893: BMP-1 I, disclosed in PCT application W094/26892, or BMP-12 or BMP-13, disclosed in PCT application WO
95/16035, or BMP-15, disclosed in US Patent 5,635,372, issued June 3, 1997.
Other compositions which may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFs], including those described in PCT
applications W094/15965; W094/15949; W095/01801; W095/OI 802; W094/21681; W094I15966;
V~95/10539: W096/01845; W096/02559 and others. Also useful in the present invention may be BIP, disclosed in W094/01557; HP00269, disclosed in JP Publication number:
7-250688; and MP52, disclosed in PCT application W093/16099.
The compositions of the invention may comprise, in addition to a BMP-16-related protein, other therapeutically useful agents including growth factors such as epidermal growth factor (EGF), fibroblast growth factor (FGF), transforming growth factor (TGF-a and TGF-p), activins, inhibins, and insulin-like growth factor (IGF). The compositions may also include an appropriate matrix for instance, for supporting the composition and providing a surface for bone and/or cartilage and/or other connective tissue growth. The matrix may provide slow release of the osteoinductive protein and/or the appropriate environment for presentation thereof.
The BMP-16 containing compositions~may be employed in methods for treating a number of bone and/or cartilage and/or other connective tissue defects, periodontal disease and healing of various types of tissues and wounds. The tissue and wounds which may be treated include epidermis, nerve, muscle, including cardiac muscle, and other tissues and wounds, and other organs such as liver, lung, cardiac, pancreas and kidney tissue. These methods, according to the invention, entail administering to a patient needing such bone and/or cartilage and/or other connective tissue formation, wound healing or tissue repair, an effective amount of a BMP-16 protein. The BMP-16-containing compositions may also be used to treat or prevent such conditions as osteoarthritis, osteoporosis, and other abnotinalities of bone, cartilage, muscle, tendon, ligament or other connective tissue, organs such as liver, lung, cardiac, pancreas and kidney tissue, and other tissues. These methods may also entail the administration of a protein of the invention in conjunction with at least one other BMP protein as described above. In addition, these methods may also include the administration of a BMP-16 protein with other growth factors including EGF, FGF, TGF-a, TGF-(3, activin, inhibin and IGF.

4 Still a further aspect of the invention are DNA sequences coding for expression of a BMP-16 protein. Such sequences include the sequence of nucleotides in a ~' to 3' direction illustrated in SEQ ID NO: 1, DNA sequences which, but for the degeneracy of the genetic code, are identical to the DNA sequence SI:Q ID NO: 1, and encode the protein of SEQ ID
NO: 2. Further included in the present invention are DNA sequences which hybridize under stringent conditions with the DNA sequence of SEQ ID NO: 1 and encode a protein having the ability to induce the formation of cartilage and/or bone and/or other connective tissue, or other organs such as liver, lung, cardiac, pancreas and kidney tissue.
Preferred DNA sequences include those which hybridize under stringent conditions [see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory (1982), pages 387 to 389].
It is generally preferred that such DNA sequences encode a polypeptide which is at least about 80% homologous, and more preferably at least about 90% homologous, to the mature human BMP-16 amino acid sequence shown in SEQ ID NO:?. Finally, allelic or other variations of the sequences of SEQ ID NO: 1, whether ~~uch nucleotide changes result in changes in the peptide sequence or not, but where the peptide sequence still has BMP-16 activity, are also included in the present invention. The present invention also includes fragments of the DNA
sequence of BMP-16 shown in SEQ ID NO: 1 which encode a polypeptide which retains the activity of BMP-16 protein.
The DNA sequences of the present invention are useful, for example, as probes for the detection of mRNA encoding BMP-16 in a given cell population. Thus, the present invention includes methods of detecting or diagnosing genetic disorders involving the BMP-16 gene, or disorders involving cellular, organ or tissue disorders in which BMP-16 is irregularly transcribed or expressed. The DNA sequences may also be useful for preparing vectors for gene therapy applications as described below.
A further aspect of the invention includes vectors comprising a DNA sequence as described above in operative association with an expression control sequence therefor. These vectors may be employed in a novel process for producing a BMP-16 protein of the invention in which a cell line transformed with a DNA sequence encoding a BMP-16 protein in operative association with an expression control seqiuence therefor, is cultured in a suitable culture medium and a BMP-16-related protein is recovered and purified therefrom. This process may employ a number of known cells both prokaryotic and eukaryotic as host cells for expression of the polypeptide. The vectors may be us~:d in gene therapy applications. In such use, the vectors may be transfected into the cells of a patient ex vivo, and the cells may be reintroduced into a patient. Alternatively, the vectors rnay be introduced into a patient in vivo through targeted transfection.

5 Still a further aspect of the invention are BMP-16 proteins or polypeptides.
Such polypeptides are characterized by having an amino acid sequence including the sequence illustrated in SEQ ID NO: 2, variants of the amino acid sequence of SEQ ID NO:
2, including naturally occurring allelic variants, and other variants in which the protein retains the ability to induce the formation of cartilage and/or bone and/or other connective tissue, or other organs such as liver, lung, cardiac, pancreas and kidney tissue, or other activity characteristic of BMP-16. Preferred polypeptides include a polypeptide which is at least about 80%
homologous, and more preferably at least about 90% homologous, to the mature human BMP-16 amino acid sequence shown in SEQ ID N0:2. Finally, allelic or other variations of the sequences of SEQ
)D NO: 2, whether such amino acid changes are induced by mutagenesis, chemical alteration, or by alteration of DNA sequence used to produce the polypeptide, where the peptide sequence still has BMP-16 activity, are also included in the present invention. The present invention also includes fragments of the amino acid sequence of BMP-16 shown in SEQ ID
NO: 2 which retain the activity of BMP-16 protein.
The purified proteins of the present inventions may be used to generate antibodies, either monoclonal or polyclonal, to human BMP-16 and/or other BMP-16-related proteins, using methods that are known in the art of antibody production. Thus, the present invention also includes antibodies to human BMP-16 and/or other related proteins. The antibodies may be useful for purification of BMP-16 and/or other BMP-16 related proteins, or for inhibiting or preventing the effects of BMP-16 related proteins. The BMP-16 protein and related proteins may be useful for inducing the growth and/or differentiation of embryonic cells and/or stem cells. Thus, the proteins or compositions of the present invention may also be useful for treating relatively undifferentiated cell populations. such as embryonic cells or stem cell populations, to enhance or enrich the growth and/or differentiation of the cells. The treated cell populations may be useful for implantation and for gene therapy applications.

6 Descn~tion of the Sequences - SEQ 117 NO:1 is a nucleotide sequence containing nucleotide sequence encoding the entire mature human BMP-16 polypeptide.
SEQ ID N0:2 is the amino acid sequence containing the mature human BMP-16 polypeptide sequence.
SEQ ID N0:3 is the nucleotide sequence of the second exon of the genomic DNA
for the human BMP-16 polypeptide.
SEQ ID N0:4 is the nucleotide sequence of the third exon of the genomic DNA
for the human BMP-16 polypeptide.
Detailed Description of the Invention The human BMP-16 sequence of the: present invention is obtained using the whole or fragments of the murine BMP-16-related DNA sequence, or a partial human BMP-16 sequence, as a probe. Thus, the human BMP-16 DNA sequence comprise the DNA
sequence of nucleotides #1 to #840 of SEQ ID NO: 1. This sequence of the human BMP-16 DNA
sequence corresponds well to nucleotides #526 to #1393 of the murine Nodal DNA
sequence described in GenBank accession # X7051~I. The human BMP-16 protein comprises the sequence of amino acids #-170 to #1 10 of SEQ ID NO: 2. The mature human BMP-16 protein is encoded by nucleotides #51 I to #840 of SEQ ID NO:1, and comprises the sequence of amino acids #1 to #110 of SEQ ID N0:2.
It is expected that human BMP-16 protein, as expressed by mammalian cells such as CHO cells, exists as a heterogeneous population of active species of BMP-i 6 protein with varying N-tennini. It is expected that active species will comprise an amino acid sequence beginning with the cysteine residue at amino acid #10 of SEQ ID N0:2, or will comprise additional amino acid sequence further in the N-terminal direction. Thus, it is expected that DNA sequences encoding active BMP-16 proteins will comprise a nucleotide sequence comprising nucleotides #1, #51 1 or #538 to #837 or #840 of SEQ ID NO: 1.
Accordingly, active species of human BMP-16 are expected to include those comprising amino acids #-170, #1 or #10 to #109 or #1 10 of SEQ ID N0:2.
A host cell may be transformed with a coding sequence encoding a propeptide suitable for the secretion of proteins by the host cell is linked in proper reading frame to the coding sequence for the mature BMP-16 protein. For example, see United States Patent 5,168,050, in which a DNA encoding a precursor portion of a mammalian protein other than BMP-2 is fused to the DNA encoding a mature B1VIP-2 protein. See also the specification of W095/16035, in which the propeptide of F3MP-2 is fused to the DNA encoding a mature

7 BMP-12 protein.
- Thus, the present invention includes chimeric DNA molecules comprising a DNA
sequence encoding a propeptide from a member of the TGF-~i superfamily of proteins, other than BMP-16, is linked in correct reading frame to a DNA sequence encoding human BMP-16 protein, or a related protein. The term "chimeric" is used to signify that the propeptide originates from a different polypeptide than the BMP-I6 protein.
The N-terminus of one active species of human BMP-16 is expected to be experimentally determined by expression in E. coli to be as follows:
Thus, it appears that the N-terminus of this species of BMP-16 is at amino acid #1 of SEQ ID
NO: 1, and a DNA sequence encoding said species of BMP-16 would comprise nucleotides #51 I to #840 of SEQ ID NO: 1. The apparent molecular weight of human BMP-16 monomer is expected to be experimentally determined by SDS-PAGE to be approximately I
3 kd on a Novex 16% tricine gel. The human BMP-I6 protein is expected to exist as a clear, colorless solution in 0. I % trifluoroacetic acid.
It is expected that other BMP-16 proteins, as expressed by mammalian cells such as CHO cells, also exist as a heterogeneous population of active species of BMP-16-related protein with varying N-termini. For example, it is expected that active species of human BMP-16 protein will comprise an amino acid sequence beginning with the cysteine residue at amino acid #10 of SEQ )D N0:2, or will comprise additional amino acid sequence further in the N-terminal direction. Thus, it is expected that DNA sequences encoding active BMP-16 proteins include those which comprise a nucleotide sequence comprising nucleotides #511 or #538 to #837 or#840 of SEQ ID NO: 1. Accordingly, active human BMP-16 proteins include those comprising amino acids #I or #10 to #109 or #110 of SEQ ID NO: 2.
The BMP-16 proteins of the present invention, include polypeptides having a molecular weight of about 13 kd in monomeric form, said polypeptide comprising the amino acid sequence of SEQ ID NO: 2 and having the ability to induce the formation of cartilage and/or bone and/or other connective tissue in the Rosen-Modified Sarnpath-Reddi ectopic implant assay, described in the examples.
The BMP-16 proteins recovered from the culture medium are purified by isolating them from other proteinaceous materials from which they are co-produced and from other contaminants present. BMP-16 proteins may be characterized by the ability to induce the formation of cartilage and/or bone and/or other connective tissue and other tissue repair and differentiation, for example, in the rat bone formation assay described below.
In addition, BMP-16 proteins may be further characterized by their effects upon the growth andlor

8 differentiation of embryonic cells and/or stem cells. Thus, the proteins or compositions of the - present invention may be characterized by the embryonic stem cell assay described below.
The BMP-16 proteins provided herein also include factors encoded by the sequences similar to those of SEQ ID NO: 1, but into which modifications or deletions are naturally provided (e.g. allelic variations in the nucleotide sequence which may result in amino acid changes in the polypeptide) or deliberately engineered. For example, synthetic polypeptides may wholly or partially duplicate continuous sequences of the amino acid residues of SEQ ID
N0:2. These sequences, by virtue of sharing primary, secondary, or tertiary structural and conformational characteristics with bone growth factor polypeptides of SEQ ID
NO: 2 may possess biological properties in common tlherewith. It is know, far example that numerous conservative amino acid substitutions are possible without significantly modifying the structure and conformation of a protein, thus maintaining the biological properties as well. For example, it is recognized that conservative amino acid substitutions may be made among amino acids with basic side chains, such as lysine (Lys or K), arginine (Arg or R) and histidine (His or H);
amino acids with acidic side chains, such as aspartic acid (Asp or D) and glutamic acid (Glu or E); amino acids with uncharged polar side chains, such as asparagine (Asn or N), glutamine (Gln or Q), serine (Ser or S), threonine (Thr or T), and tyrosine (Tyr or Y);
and amino acids with nonpolar side chains, such as alanine (Ala or A), glycine (Gly or G), vaiine (Val or V), leucine (Leu or L), isoleucine (Ile or I).. proline (Pro or P), phenylalanine (Phe or F), methionine (Met or M), tryptophan (Trp or W) and cysteine (Cys or C). Thus, these modifications and deletions of the native BMP-16 may be employed as biologically active substitutes for naturally-occurring BMP-lfi and other polypeptides in therapeutic processes.
It can be readily determined whether a given variant of BMP-16 maintains the biological activity of BMP-16 by subjecting both B:MP-16 and the variant of BMP-16 to the assays described in the examples.
Other specific mutations of the sequences of BMP-16 proteins described herein involve modifications of glycosylation sites. These modifications may involve O-linked or N-linked glycosylation sites. For instance:, the absence of glycosylation or only partial glycosylation results from amino acid substitution or deletion at asparagine-linked glycosylation recognition sites. The asparagine-linked glycosylation recognition sites comprise tripeptide sequences which are specifically recognized by appropriate cellular glycosyiation enzymes. These tripeptide sequences are either asparagine-X-threonine or asparagrne-X-serine, where X is usually any amino acid. A variety of amino acid substitutions or deletions at one or both of the first or third amino acid positions of a glycosytation recognition site (and/or amino acid deletion at the second positron) results in non-glycosylation at the modified

9 _ ~ tripeptide sequence. Additionally, bacterial expression of BMP-16-related protein will also - result in production of a non-glycosylated protein, even if the glycosylation sites are left unmodified.
The present invention also encompasses the novel DNA sequences, free of association with DNA sequences encoding other proteinaceous materials, and coding for expression of BMP-16 proteins. These DNA sequences include those depicted in SEQ ID NO: l in a ~' to 3' direction and those sequences which hybridize thereto under stringent hybridization washing conditions [for example, O.1X SSC, 0.1% SDS at 65°C; see, T. Maniatis et al, Molecular Cloning (A Laboratory Manual ), Cold Spring Harbor Laboratory ( 1982}, pages 387 to 389] and encode a protein having cartilage and/or bone and/or other connective tissue inducing activity.
I S These DNA sequences also include those which comprise the DNA sequence of SEQ ID NO:
1 and those which hybridize thereto under stringent hybridization conditions and encode a protein which maintain the other activities disclosed for BMP-16.
Similarly, DNA sequences which code for BMP-16 proteins coded for by the sequences of SEQ ID NO: 3 , or BMP-16 proteins which comprise the amino acid sequence of SEQ ID NO: 2, but which differ in codon sequence due to the degeneracies of the genetic code or allelic variations (naturally-occurring base changes in the species population which may or may not result in an amino acid change) also encode the novel factors described herein.
Variations in the DNA sequences of SEQ ID NO: 1 which are caused by point mutations or by induced modifications (including insertion, deletion, and substitution) to enhance the activity, half-life or production of the polypeptides encoded are also encompassed in the mvenuon.
Another aspect of the present invention provides a novel method for producing BMP-16 proteins. The method of the present invention involves culturing a suitable cell line, which has been transformed with a DNA sequence encoding a BMP-16 protein of the invention, under the control of known regulatory sequences. The transformed host cells are cultured and the BMP-16 proteins recovered and purified from the culture medium. The purified proteins are substantially free from other proteins with which they are co-produced as well as from other contaminants.
Suitable cells or cell lines may be mammalian cells, such as Chinese hamster ovary 3S cells (CHO). The selection of suitable mammalian host cells and methods for transformation, culture, amplification, screening, product production and purification are known in the art.
See, e.g., Gething and Sambrook, Nature, 293:620-625 (1981), or alternatively, Kaufman et al, Mol. Cell. Biol., 5(7):1750-1759 ( 1985) or Howley et al, U.S. Patent 4,419,446. Another suitable mammalian cell line, which is described in the accompanying examples, is the monkey - COS-1 cell line. The mammalian cell CV-1 may also be suitable.
Bacterial cells may also be suitable hosts. For example, the various strains of E. colt (e.g., HB101, MC1061 ) are well-known as host cells in the field of biotechnology. Various strains of B. subtilis. Pseudomonas, other bacilli and the like may also be employed in this method. For expression of the protein in bacterial cells. DNA encoding the propeptide of BMP-16 is generally not necessary.
Many strains of yeast cells known u~ those skilled in the art may also be available as host cells for expression of the polypeptides of the present invention.
Additionally, where desired, insect cells may be utilized as host cells in the method of the present invention. See, e.g. Miller et al, Genetic En~ineerinQ, 8:277-298 (Plenum Press 1986) and references cited therein.
Another aspect of the present invention provides vectors for use in the method of expression of these novel BMP-16 polypeptides. Preferably the vectors contain the full novel DNA sequences described above which encode the novel factors of the invention.
Additionally, the vectors contain appropriate expression control sequences permitting expression of the BMP-16 protein sequences. Alternatively, vectors incorporating modified sequences as described above are also embodiments of the present invention.
Additionally, the sequence of SEQ ID NO:1 or other seduences encoding BMP-16 proteins could be manipulated to express a mature BMP-16 protein by deleting BMP-16 propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins or members of the TGF-(3 superfamily. Thus, the present invention includes chimeric DNA
molecules encoding a propeptide from a member of the TGF-~i superfamily linked in correct reading frame to a DNA sequence encoding a BMP-16 polypeptide.
The vectors may be employed in the method of transforming cell lines and contain selected regulatory sequences in operative association with the DNA coding sequences of the invention which are capable of directing the replication and expression thereof in selected host cells. Regulatory sequences for such vectors are known to those skilled in the arc and may be selected depending upon the host cells. Such selection is routine and does not form part of the present invention.
A protein of the present invention, which induces cartilage and/or bone and/or other connective tissue formation in circumstances where such tissue is not normally formed, has ' application in the healing of hone fractures and cartilage or other connective tissue defects in humans and other animals. Such a preparation employing a BMP-16 protein may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints. De novo bone formation induced by an osteogenic agent contributes to the repair of congenital, trauma induced, or oncologic resection induced craniofacial defects, and also is useful in cosmetic plastic surgery. A BMP-16-related protein may be used in the treatment of periodontal disease, and in other tooth repair processes. Such agents may provide an environment to attract bone-forming cells, stimulate growth of bone-forming cells or induce differentiation of progenitors of bone-forming cells, and may also support the regeneration of the periodontal ligament and attachment apparatus, which connects bone and teeth. BMP-16 polypeptides of the invention may also be useful in the treatment of osteoporosis. A variety of osteogenic. cartilage-inducing and bone inducing factors have been described. See, e.g., European patent applications 148,155 and 169.016 for discussions thereof.
I S The proteins of the invention may also be used in wound healing and related tissue repair. The types of wounds include, but are not limited to burns, incisions and ulcers. (See, e.g. PCT Publication W084/O1 106 for discussion of wound healing and related tissue repair.
Ii is further contemplated that proteins of the invention may increase neuronal, astrocytic and glial cell survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival and repair. The proteins of the invention may further be useful for the treatment of conditions related to other types of tissue, such as nerve, epidermis, muscle, and other organs such as liver, lung, cardiac, pancreas and kidney tissue.
The proteins of the present invention may futther be useful for the treatment of relatively undifferentiated cell populations, such as embryonic cells, or stem cells, to enhance growth and/or differentiation of the cells. The proteins of the present invention may also have value as a dietary supplement, or as a component of cell culture media. For this use, the proteins may be used in intact form, or may be predigested to provide a more readily absorbed supplement.
The proteins of the invention may also have other useful properties characteristic of the TGF-~i superfamily of proteins. Such properties include angiogenic, chemotactic and/or chemoattractant properties, and effects on cells including induction of collagen synthesis, fibrosis, differentiation responses, cell proliferative responses and responses involving cell adhesion, migration and extracellular matrices. These properties make the proteins of the invention potential agents for wound healing, reduction of fibrosis and reduction of scar tissue formation.
When dimerized as a homodimer or as a heterodimer with other BMPs, with other members of the TGF-(3 superfamily of proteins, or with inhibin-a proteins or inhibin-[3 proteins, the BMP-16 heterodimer is expected to demonstrate effects on the production of follicle stimulating hormone (FSH), as described further herein. It is recognized that FSH
stimulates the development of ova in mammalian ovaries (Ross et al., in Textbook of Endocrinology, ed. Williams, p. 355 (1981 ) and that excessive stimulation of the ovaries with FSH will lead to multiple ovulations. FSH is also important in testicular function. Thus, BMP-16 may be useful as a contraceptive baked on the ability of inhibins to decrease fertility in female mammals and decrease spermatogenesis in male mammals. Administration of sufficient amounts of other inhibins can induce infertility in mammals. BMP-16 may also be useful as a fertility inducing therapeutic, based upon the ability of activin molecules in stimulating FSH release from cells of the anterior pituitary. See, for example, United States Patent 4,798,885. BMP-16 may also be useful for advancement of the onset of fertility in sexually immature mammals, so as to increase the lifetime reproductive performance of domestic animals such as cows, sheep and pigs. It is further contemplated that BMP-16 may be useful in modulating hematopoiesis by inducing the differentiation of erythroid cells [see, e.g., Broxmeyer et al, Proc. Natl. Acad. Sci. LISA, 85:9052-9056 ( 1988) or Eto et al, Biochem.
Biophvs. Res. Comm.. 142:1095-1103 (198'1)], for suppressing the development of gonadal tumors [see, e.g., Matzuk et al.. Nature, 360:313-319 ( 1992)] or for augmenting the activity of bone morphogenetic proteins [see, e.g., tJgawa et al., J. Biol. Chem., 267:14233-14237 ( 1992)].
BMP-16 proteins may be further characterized by their ability to modulate the release of follicle stimulating hormone (FSH) in established in vitro bioassays using rat anterior pituitary cells as described (see, e.g., Vale e~: al, Endocrinology, 91:562-572 ( 1972); Ling et al.. Nature, 321:779-782 (1986) or Vale et al., Nature, 321:776-779 (1986)].
It is contemplated that the BMP-16 protein of the invention, when composed as a heterodimer with inhibin a or inhibin (3 chains, will exhibit regulatory effects, either stimulatory or inhibitory, on the release of follicle stimulating hormone (FSH), from anterior pituitary cells as described [Ling et al.. Naterre, 321:779-782 (1986) or'daie et al., Nature, 321:776-779 (1986); Vale et al, Endocrinology, 91:562-572 ( 1972). Therefore, depending on the particular composition.
it is expected that the BMP-16 protein of the invention may have contrasting and opposite effects on the release of follicle stimulating hormone (FSH) from the anterior pituitary.
Activin A (the homodimeric composition of inhibin (3A) has been shown to have erythropoietic-stimulating activity [see e.g. Eto et al., Biochem. Biophys.
Res. Commun., 142:1095-1103 ( 1987) and Murata et al., Prac. Natl. Acad. Sci. U.S.A., 85:2434-2438 ( 1988) and Yu et al., Nature, 330:765-767 (1987)]. It is contemplated that the BMP-16 protein of the invention may have a similar erythropoietic-stimulating activity. This activity of the BMP-16 protein may be further characterized by thc; ability of the BMP-16 protein to demonstrate erythropoietin activity in the biological assay performed using the human K-562 cell line as described by [Lozzio et al.. Blood, 45:321-334 (1975) and U.S. Pat. No.

A further aspect of the invention is a therapeutic method and composition for repairing - fractures and other conditions related to cartilage and/or bone andlor other connective tissue defects or periodontal diseases. The invention further comprises therapeutic methods and compositions for wound heaEing and tissue repair. Such compositions comprise a therapeutically effective amount of at least one of the BMP-16-related proteins of the invention in admixture with a pharmaceutically acceptable vehicle, carrier or matrix. It is further contemplated that compositions of the invention may increase neuronal survival and therefore be useful in transplantation and treatment of conditions exhibiting a decrease in neuronal survival. Compositions of the invention may further include at least one other therapeutically useful agent, such as members of the TGF-(3 superfamily of proteins, which includes the BMP
proteins BMP-I, BMP-3, BMP-3, BMP-4, BMP-5. BMP-6 and BMP-7, disclosed forinstance in United States Patents 5,108,922; 5,013,649; 5,116,738; 5,106,748;
5,187,076; and 5,141,905; BMP-8, disclosed in PCT publication W091/18098; BMP-9, disclosed in PCT
publication W093/00432; BMP-10, disclosed in PCT application W094126893; BMP-I
1, disclosed in PCT application W094/26892, BMP-12 or BMP-13, disclosed in PCT
application 30 WO 95/16035, or BMP-15, disclosed in US Patent 5,635,372, issued June 3, 1997.
Other compositions which may also be useful include Vgr-2, and any of the growth and differentiation factors [GDFsJ, including those described in PCT applications W094/15965; W094/15949; W095/01801: W095/01802: W094/21681: W094/15966;
W095/10539: W096/01845: W096/02559 and others. Also useful in the present invention 35 may be BIP, disclosed in W094/01557; HP00269, disclosed in 3P Publication number:
7-?50688; and MP52, disclosed in PCT application W093/16099.
It is expected that human BMP-16 protein may exist in nature as homodimers or heterodimers. To promote the formation of dimers of BMP-16 and useful proteins with 30 increased stability, one can genetically engineer the DNA sequence of SEQUENCE ID NO: I
to provide one or more additional cysteine trsidues to increase potential dimer formation. The resulting DNA sequence would be capable of producing a "cysteine added variant" of BMP-16.
In a preferred embodiment, one would engineer the DNA sequence of SEQUENCE ID
1 so that one or more codons may be altered to a nucleotide triplet encoding a cysteine residue, 35 such as TGT or TGC. Alternatively, one can produce "cysteine added variants" of BMP-16 protein by altering the sequence of the protein at the amino acid level by altering one or more amino acid residues of SEQUENCE ID N0:2 to Cys. Production of "cysteine added variants"
of proteins is described in United States Patent 5,166,322 .

It is expected that the proteins of the invention may act in concert with or perhaps - synergistically with other related proteins and growth factors. Further therapeutic methods and compositions of the invention therefore comprise a therapeutic amount of at least one BMP-16 protein of the invention with a therapeutic amount of at least one other member of the TGF-(i superfamily of proteins, such as the BMP proteins disclosed in the applications described above. Such combinations may comprise separate molecules of the BMP proteins or heteromolecules comprised of different BMP moieties. For example, a method and composition of the invention may comprise a disulfide linked dimer comprising a BMP-16 protein subunit and a subunit from one of the "BMP" proteins described above.
Thus, the present invention includes a purified BMP-16-related polypeptide which is a heterodimer wherein one subunit comprises the amino acid sequence from amino acid #1 to amino acid #110 of SEQ ID N0:2, and one subunit comprises an amino acid sequence for a bone motphogenetic protein selected from the group consisting of BMP-1, BMP-?, BMP-3. BMP-4, BMP-5, BMP-6. BMP-7, BMP-8. BMP-9, BMP-10, BMP-11, BMP-12 or BMP-13, disclosed in PCT application WO 95/16035, or BMP-15. disclosed in US Patent 5,635,372, issued June 3, 1997. A further embodiment may comprise a heterodimer of BMP-16-related moieties, for example of human BMP-16 and the murine Nodal protein, which is the homologue of human BMP-16. Further, BMP-16 protein may be combined with other agents beneficial to the treatment of the bone and/or cartilage andlor other connective tissue defect, wound, or tissue in question. These agents include various growth ?5 factors such as epidermal growth factor (EGF), f broblast growth factor (FGF), platelet derived growth factor (PDGF), transforming growth factors (TGF-a and TGF-(3), activins, inhibins, and k-fibroblast growth factor (kFGF), parathyroid hormone (PTH), parathyroid hormone related peptide (PTHrP), leukemia inhibitory factor (LIB/HILA/DA), insulin-like growth factors (IGF-I and IGF-II). Portions of these agents may also be used in compositions of the present invention. The preparation and formulation of such physiologically acceptable protein compositions, having due regard to pH, isotonicity, stability and the like, is within the skill of the art. The therapeutic compositions are also presently valuable for veterinary applications due to the lack of species specificity in $MP proteins. Particularly domestic animals and thoroughbred horses in addition to humans are desired patients for such treatment with the BMP-16 proteins of the present invention.
The therapeutic method includes administering the composition topically, systemically, or locally as an implant or device. When administered, the therapeutic composition for use in this invention is, of course, in a pyrogen-free, physiologically acceptable form. Further, the composition may desirably be encapsulated or injected in a viscous form for delivery to the site of bone, cartilage or other connective tissue or other tissue damage. Topical administration may be suitable for wound healing and tissue repair. Therapeutically useful agents other than the BMP-16 proteins which may also optionally be included in the composition as described above, may alternatively or additionally, be administered simultaneously or sequentially with the BMP composition in the methods of the invention.
Preferably for bone and/or cartilage and/or other connective tissue formation, the composition includes a matrix capable of delivering BMP-16-related or other BMP proteins to the site of bone and/or cartilage and/or other connective tissue damage, providing a structure for the developing bone and cartilage and other connective tissue and optimally capable of being resorbed into the body. The matrix may provide slow release of BMP-16 protein and/or other bone inductive protein, as well as proper presentation and appropriate environment for cellular infiltration. Such matrices may be formed of materials presently in use for other implanted medical applications.
The choice of matrix material is based on biocompatibility, biodegradability, mechanical properties, cosmetic appearance and interface properties. The particular application of the BMP-16 compositions will define the appropriate formulation. Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate.
tricalcium phosphate, hydroxyapatite, polylactic acid and polyanhydtides.
Other potential materials are biodegradable and biologically well defined, such as bone or dermal collagen.
Further matrices are comprised of pure proteins or extraceiiular matrix components. Other ?5 potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics. Matrices may be comprised of combinations of any of the above mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tricalcium phosphate. The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradability.
The dosage regimen will be determined by the attending physician considering various factors which modify the action of the BMP-16 protein, e.g. amount of bone or other tissue weight desired to be formed, the site of bone or tissue damage, the condition of the damaged bone tissue, the size of a wound, type of damaged tissue, the patient's age, sex, and diet, the sever7ty of any infection, time of administration and other clinical factors.
The dosage may vary with the type of matrix used in the reconstitution and the types of BMP
proteins in the composition. Generally, systemic or injectable administration will be initiated at a dose which is minimally effective, and the dose will be increased over a preselected time course until a positive effect is observed. Subsequently, incremental increases in dosage will be made limiting such incremental increases to such levels that produce a corresponding increase in - effect, while taking into account any adverse affects that may appear. The addition of other known growth factors, such as IGF I (insulin like growth factor I), to the final composition, may also effect the dosage.
Progress can be monitored by periodic assessment of bone or tissue growth and/or repair. The progress can be monitored, for e:Kample, x-rays, histomorphometric determinations and tetracycline labeling.
The following examples illustrate practice of the present invention in recovering and characterizing human BMP-16 and other BMP-16-related proteins, obtaining the human proteins and expressing the proteins via recombinant techniques.

Isolation of DNA
DNA sequences encoding human BIvIP-16 and human BMP-16-related proteins may be isolated by various techniques known to those skilled in the art.
Based on the knowledge of BMP proteins and other proteins within the TGF-f3 family, it is predicted that the carboxyl-terminal portion of these molecules (mature peptide) would exhibit greater sequence conservation than the more amino-terminal portions (propeptide region). This sequence relationship between BMP proteins and other proteins within the TGF-f3 family enables those skilled in the art to design DNA probes from the carboxyl-terminal encoding portion (mature peptide encoding region) of these molecules which can be utilized to identify related BMP proteins and other proteins within the TGF-f3 family.
As described below, the mature peptide encoding region of the marine nodal gene can be utilized to identify BMP-16 and BMP-16-related proteins.
A DNA probe corresponding to nucleotides #1060 through #1390 of the marine nodal gene (GenBank accession # X70514) can be nadioactively labelled with'-'P and used to screen a human genomic library, under reduced stringency hybridization/washing conditions, to identify recombinant clones containing sequences of the human BMP-16 gene or sequences of other BMP-16 related genes.
Human BMP-16 One million recombinants of a human genomic library constructed in the vector 1.
DASH II (Stratagene catalog #945203) arc: plated at a density of approximately 20,000 recombinants per plate on 50 plates. Duplicate nitrocellulose replicas of the recombinant bactetiophage plaques are hybridized to the '=P labelled 331 by marine nodal DNA probe WO 98112322 PCT/US9~/11954 _ ~ (described above) in standard hybridization buffer (5X SSC, 0.19c SDS, SX
Denhardt's, 100~g/ml salmon sperm DNA ) under reduced stringency conditions (60°C
for approximately 2 days). On the second day of the hybridization, the radioactively labelled murine nodal DNA
fragment containing hybridization solution is removed and the filters are washed under reduced stringency conditions (2X SSC, 0.1 % SDS at 60°C). The filters are wrapped in saran wrap and exposed to X-ray film for overnight to three days at -80°C, with the aid of an intensifying screen. The autoradio~raphs are developed and multiple positively hybridizing recombinants of various signal intensities are identified. These low stringency hybridization positive clones are plaque purified. Bacteriophage plate stocks of the plaque purified recombinants are made and bacteriophage DNA is isolated.
Individual positively hybridizing recombinant bacteriophage clones are examined for the presence of previously disclosed BMP sequences, or DNA sequences corresponding to other members of the TGF-Q family, by hybridization to an array of oligonucieotides representative of these previously disclosed DNA sequences. The oligonucleotides which are used to define the previously disclosed BMP sequences and DNA sequences of other members of the TGF-f3 family have been immobilized to the surface of a glass chip. The template used for hybridization analysis to the immobilized oligonucleotide array is produced in the following manner:
Recombinant bacteriophage DNA derived from positively hybridizing human genomic clones identified through the use of the murine nodal probe (experiment described above) are subjected to specific DNA amplification. Oligonucleotide primers corresponding to DNA
sequences of the of the bacteriophage cloning vector ~. DASH II are utilized to specifically amplify the human genomic DNA inserts of positively hybridizing recombinant clones. The following oligonucleotide primers are designed on the basis of the sequence of the Lambda DASH II° genomic cloning vector (Stratagene Cloning Systems. Inc.; La lolla, CA) and synthesized on an automated DNA synthesizer:
Oligonucleotides #1 and #2 are utilized as primers to allow the specific amplification of the human genomic DNA inserts of the recombinants identified by low stringency hybridization to the murine nodal probe or any recombinant DNA insert contained in the bacteriophage cloning vector ~, DASH II. The amplification reaction is performed as follows:
Approximately ~ 500 ng of purified recombinant bacteriophage DNA or an undetermined amount of recombinant bacteriophage DNA derived directly from an aqueous eluate of a purified bacteriophage plaque is added to a reaction mixture of 1 X Perkin-Elmer Cetus GeneAmp~ XL
Buffer (catalog #N808-0180-comprised Tricine, Potassium Acetate, Glycerol and DMSO) with the supplementation of 250 IrM each deoxynucleotide triphosphate (dATP, dGTP
and dTTP), 90 pM DCTP, 30 pM Fluorescein-dCTP. 1.3 mM Mg(OAc),, 40 units/ml Perltin-Elmer Cetus rTth DNA polymerise (catalog #N808-0180), 400 nM oligonucleotide primer #1 and 400 nM
oligonucleotide primer #3. The reaction mixture is subjected to thermal cycling in the following manner: 1 minute at 93°C for one cycle, 40 seconds at 93°C and 12 minutes at 68°C
for 30 cycles, followed by 10 minutes at 65°C for one cycle.
Approximately 1 pg of the DNA
which is specifically amplified by this reaction is digested with 18 milliunits of RQ1 RNase-Free DNase (Promega Corp., Madison, WI/Catalog #M6101 in 50 mM Tris-HCl pH
7.5, 10 mM MgSOa, 50mg bovine serum albumin (BSA)/ml, and O.t mM DTT at 37° for 90 minutes.
The reaction is stopped with the addition of 0.1 volumes of 0.5 M Na,EDTA. The fragmentation of the specifically amplified DNA under the conditions described above yields DNA fragments in the range of approximately 1500 to 50 base pairs. The 1500 to 50 by specifically amplified DNA fragments are heat denatured at 95°C for IO
minutes. The fragmented, denatured DNA solution is adjusted to a final concentration of 6X
SSPE, 0.05%
Triton X-100 and then hybridized to the BMP/TGF-a family representative oligonucleotide array which has been immobilized on a glass surface for a period of 4 hours to overnight at 37°C. The hybridized BMPlTGF-Q family representative oligonucleotide array which has been immobilized on a glass surface is washed with O.SX SSPE. 0.005% Triton X-100 and analyzed by a GeneChip ~0 Scanner (Affymettix).
One of the recombinant bacteriophage clones which hybridizes to the 329 by murine nodal probe is designated ~.HG-NR35-1. Analysis of this clone utilizing the BMP/TGF-(3 family oligonucleotide array resulted in a positive hybridization pattern to a small subset of the oligonucleotides on the glass chip array. One of the oligonucleotides defined by a positive hybridization signal was utilized to determine the DNA sequence of the region of the human genomic insert which was responsible for the original hybridization signal to the murine nodal probe. The sequence of this oligonucleotide is set forth below:
Oligonucleotide #3: CTGTGAGGGCGAGTGTCC

WO 98/12322 PCT/US9'7/11954 This oligonucleotide which corresponds to nucleotides #1173-#1190 of the murine nodal sequence (Genbank Accession #X70514) was utilized to perform DNA sequence analysis of the ~.HG-NR35-1 genomic clone resulting in the identification of a portion of the human BMP-16 sequence disclosed in this application. The bacteriophage ~,HG-NR35-1 has been deposited with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, MD
ATCC under the accession #97623 on June 25. 1996. This deposit meets the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. The hybridizing region of this recombinant, ?~HG-NR35-1, is localized to two BamHI fragments of approximately 2.1 kilobases (kb) and 4.3 kb in length. Each of these fragments are individually subcloned into the plasmid vector pGEM-3. The plasmid subclones containing the 2.1 kb and 4.3kb BamHI
fragments are designated DHSa/pGEM#-NR35-I#B2 and DHSa/pGEM#-NR35-1#B18, respectively. The plasmid subclone containing the 2.1 kb BamHI hybridizing fragment (DHSa/pGEM#-NR35-1#B2) has been deposited with the ATCC under the accession #98085 on June 25, 1996. The plasmid subclone containing the 4.3kb BamHI hybridizing fragment (DHSa/pGEM#-NR35-1#B 18) has been deposited with the ATCC under the accession #98084 on June 25, 1996. These deposits meet the requirements of the Budapest Treaty of the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and Regulations thereunder. The DNA sequence of a portion of the 2.
I kb insert of the plasmid subclone, DHSa/pGEM#-NR35-1#B2, is set forth in SEQ ID N0:3. A
portion of this sequence (nucleotides #383 to #1080) represents exon 2 of the human BMP-16 gene as defined by comparison to exon ? of the murine nodal gene (nucleotides #524 through #1240 of GenBank Accession No. X70514. The DNA sequence of a portion of the 4.3kb insert of the plasmid subclone. DHSa/pGEM#-NR35-I#B18, is set forth in SEQ ID N0:4. A
portion of this sequence (nucleotides #434 to #583) represents the coding region of exon 3 of the human BMP-16 gene as defined by comparison to the protein coding sequence of exon 3 of the murine nodal gene (nucleotides #1241 through #1390 of GenBank Accession No. X70514.
Based on the knowledge of the murine nodal gene structure, the specific protein coding nucleotide sequences contained therein, and the comparisons of those sequences to sequences contained within exon 2 (SEQ ID N0:3) and exon 3 (SEQ ID N0:4) of the human gene which have been detailed above; one can compile a partial coding sequence for the human BMP-16 protein of the invention. This partial human BMP-16 coding sequence (from which intervening sequences/introns and other non-BMP-16 protein encoding sequences of SEQ ID
NOs: 3 and 4 have been removed) is set forth in SEQ ID NO:1. The compiled sequence predicted from the fusion of the coding sequences from exons ? and 3 of the human BMP-16 - 5 gene defines an open reading frame of 840 nucleotides (nucleotides #1 through #840 of SEQ
ID NO:1 ) which encodes 280 amino acids oc the human BMP-16 protein of the invention. The encoded 280 amino acid BMP-16 protein set forth in SEQ ID N0:2 includes the full mature human BMP-16 peptide (amino acids #1-#110 of SEQ ID N0:2), as well as the C-terminal portion of the BMP-16 propeptide (amino acids #-170 through #-1 of SEQ ID N0:2 Based on the knowledge of other BMP proteins and other proteins within the TGF-f3 family, it is predicted that the human BMP-16 precursor polypeptide would be cleaved at the multibasic sequence Arg-His-Arg-Arg in agreement with a proposed consensus proteolytic processing sequence of Arg-X-X-Arg. Cleavage of the human BMP-16 precursor polypeptide is expected to generate a 1 10 amino acid mature peptide beginning with the amino acid His at position #1 of SEQ ID N0:2. The proce~~sine of human BMP-16 into the mature form is expected to involve dimerization and removal of the N-terminal region in a manner analogous to the processing of the related protein TC~F-l3 [Gentry et al.. Molec & Cell.
Biol., 8:4162 ( 1988): Derynck et al. Nature, 316:701 ( 1985)].
It is contemplated therefore that the mature active species of human BMP-16 comprises a homodimer of two polypeptide subunits, each subunit comprising amino acids #1 to #I 10 of SEQ )D N0:2 with a predicted molecular weight of approximately 13,000 daltons.
Further active species are contemplated comprising at least amino acids #l0 to #1 10 of SEQ
)D N0:2, thereby including the first conserved cysteine residue. As with other members of the TGF-f3BMP family of proteins, the carboxyl-terminal portion of the human BMP-16 protein exhibits greater sequence conservation than the more amino-terminal portion.
The percent amino acid identity of the human BMP-16 protein in the cysteine-rich C-terminal domain (amino acids #10 - #110 of SEQ ID N0:2) to the corresponding region of human BMP
proteins and other proteins within the TGF-f. Family is as follows: BMP-~, 42%; BMP-3, 41 %;
BMP-4. 40%; BMP-5, 42%; BMP-6, 45'7c; BMP-7, 43%; BMP-8, 45%; BMP-9, 44%;
BMP-10, 43%; BMP-I1, 35%; BMP-12. ~l5%; BMP-13, 46%; BMP-15, 36%; Vgl, 44%;
GDF-I. 38%; TGF-f31, 29%; TGF-f32, 32%; TGF-f33, 29%; inhibin !3B, 38%;
inhibin 13A, 43%.
The human BMP-16 DNA sequence (SEQ ID NO:1 ), or a portion thereof, can be used as a probe to identify a human cell line or tissue which synthesizes human BMP-16 or a human BMP-16-related mRNA. Briefly described, RNA is extracted from a selected cell or tissue source and either electrophoresed on a formaldehyde agarose gel and transferred to nitrocellulose, or reacted with formaldehyde and spotted on nitrocellulose directly. The nitrocellulose is then hybridized to a probe derived from the coding sequence of human BMP-16.

_ ~ Alternatively, the human BMP-16 sequence is used to design oligonucleotide primers - which will specifically amplify a portion of the human BMP-16 or human BMP-I6-related encoding sequence. It is contemplated that these human BMP-16 derived primers would allow one to specifically amplify corresponding human BMP-16 or BMP-16-related encoding sequences from mRNA, cDNA or genomic DNA templates. Once a positive source has been identified by one of the above described methods, mRNA is selected by oligo (dT) cellulose chromatography and cDNA is synthesized and cloned in AgtlO or other 1.
bacteriophage vectors known to those skilled in the art, for example, ?ZAP by established techniques (Toole et al., supra). It is also possible to perform the oligonucleotide primer directed amplification reaction, described above, directly on a preestablished human cDNA or genomic library which 1 ~ has been cloned into a ?~ bacteriophage vector. In such cases, a library which yields a specifically amplified DNA product encoding a portion of the human BMP-16 or related protein could be screened directly, utilizing the fragment of amplified human BMP-16 or BMP-16-related encoding DNA as a probe.
Additional methods known to those skilled in the art may be used to isolate other full-length cDNAs encoding human BMP-16-related proteins, or full length cDNA
clones encoding BMP-16-related proteins of the invention from species other than humans, particularly other mammalian species.

A. Description of W-20 cells Use of the W-20 bone marrow stromal cells as an indicator cell line is based upon the conversion of these cells to osteoblast-like cells after treatment with a BMP
protein [Thies et al. Journal of Bone and Mineral Research, 5:305 (1990); and Thies et al.
Endocrinology, 130:1318 ( 199?)]. Specifically, W-20 cells are a clonal bone marrow stromal cell line derived from adult mice by researchers in the laboratory of Dr. D. Nathan, Children's Hospital, Boston, MA. Treatment of W-20 cells with certain BMP proteins results in ( 1 ) increased alkaline phosphatase production, (2) induction of PTH stimulated cAMP, and (3) induction of osteocalcin synthesis by the cells. While ( 1 ) and (2) represent characteristics associated with the osteoblast phenotype, the ability to synthesize osteocalcin is a phenotypic property only displayed by mature osteoblasts. Furthermore, to date we have observed conversion of W-20 stromal cells to osteoblast-like cells only upon treatment with BMPs. In this manner, the in vitro activities displayed by BMP treated W-?0 cells correlate with the in vivo bone forming activity known for BMPs.

Below two in vitro assays useful in comparison of BMP activities of novel osteoinductive molecules are described.
B. W-20 Alkaline Phosphatase Assav Protocol W-20 cells are plated into 96 well tissue culture plates at a density of

10,000 cells per well in 200 pi of media (DME with 10% heat inactivated fetal calf serum, 2 mM
glutamine and 100 Units/ml penicillin + 100 ~tg/ml streptomycin. The cells are allowed to attach overnight in a 95% air, 5% CO, incubator at 37°C. The 200 Itl of media is removed from each well with a multichannel pipettor and replaced with ;zn equal volume of test sample delivered in DME
with 10% heat inactivated fetal calf serum, 2 mM glutamine and 1 % penicillin-streptomycin.
Test substances are assayed in triplicate. The test samples and standards are allowed a 24 hour incubation period with the W-20 indicator cells. After the 24 hours, plates are removed from the 37°C incubator and the test media are removed from the cells. The W-20 cell layers are washed 3 times with 200 p1 per well of calcium/magnesium free phosphate buffered saline and these washes are discarded. 50 pl of glass distilled water is added to each well and the assay plates are then placed on a dry ice/ethanol bath for quick freezing. Once frozen, the assay plates are removed from the dry ice/ethanol bath and thawed at 37°C.
This step is repeated 2 more times for a total of 3 freeze-thaw procedures. Once complete, the membrane bound alkaline phosphatase is available for measurement. 50 p1 of assay mix (50 mM
glycine, 0.05%
Triton X-100, 4 mM MgCI" 5 mM p-nitrophenol phosphate, pH = 10.3) is added to each assay well and the assay plates are then incubated for 30 minutes at 37°C in a shaking waterbath at 60 oscillations per minute. At the end of the 3Q minute incubation, the reaction is stopped by adding 100 p1 of 0.2 N NaOH to each well and placing the assay plates on ice.
The spectrophotometric absorbance for each well is read at a wavelength of 405 nanometers. These values are then compared to known standards to give an estimate of the alkaline phosphatase activity in each sample. For example, using known amounts of p-nitrophenol phosphate, absorbance values are generated. This is shown in Table I.

Table I
Absorbance Values for Known Standards of P-Nitrophenol Phosphate ~P-nitrophenol~hosohate umoles Mean absorbance (405 nm) o.oo0 0 0.006 0.261 +/- .024 0.012 0.521 +/- .03 l 0.018 0.797 +/- .063 0.024 1.074 +/- .061 0.030 I .305 +/- .083 Absorbance values for known amounts of BMPs can be determined and convened to pmoles of p-nitrophenol phosphate cleaved per unit time as shown in Table II.

- 5 Table II
Alkaline Phosphatase Values for W-20 Cells Treating with BMP-2 BMP-2 concentration Absorbance Reading umoles substrate ng/ml 405 nmeters per hour 0 0.645 0.024 1.56 0.696 0.026 3.12 0.765 0.029 6.25 0.923 0.036 12.50 1.121 0.044 25.0 1.457 0.058 50.0 1.662 0.067 100.0 1.977 0.080 These values are then used to compt~re the activities of known amounts of BMP-16 to BMP-2.
C. Osteocalcin RIA Protocol W-20 cells are plated at 106 cells per well in 24 well multiwell tissue culture dishes in 2 mls of DME containing 10% heat inactivated fetal calf serum. 2 mM glutamine.
The cells are allowed to attach overnight in an atmosphere of 95% air 5% CU= at 37°C. The next day the medium is changed to DME containing 1:0% fetal calf serum. 2 mM glutamine and the test substance in a total volume of 2 ml. Each test substance is administered to triplicate wells.
The test substances are incubated with the W-20 cells for a total of 96 hours with replacement at 48 hours by the same test medias. At the f;nd of 96 hours, 50 p1 of the test media is removed from each well and assayed for osteocalcin production using a radioimmunoassay for mouse osteocalcin. The details of the assay are described in the kit manufactured by Biomedical Technologies Inc., 378 Page Street. Stoughton, MA 02072. Reagents for the assay are found as product numbers BT-431 (mouse osteocalcin standard), BT-432 (Goat anti-mouse Osteocalcin), BT-4318 (iodinated mouse osteocalcin), BT-415 (normal goat serum) and BT-414 (donkey anti goat IgG). The RIA for osteocalcin synthesized by W-20 cells in response to BMP treatment is carried out as described in the protocol provided by the manufacturer.

The values obtained for the test samples are compared to values for known standards of mouse osteocalcin and to the amount of osteocaicin produced by W-20 cells in response to challenge with known amounts of BMP-2. The values for BMP-2 induced osteocalcin synthesis by W-20 cells is shown in Table III.
Table III
Osteocalcin Synthesis by W-20 Cells ration n~g/mlOsteocalcin Synthesis ne/well 0 0.8 2 0.9 4 0.8 8 2.2 16 2.7 31 3.2 62 5.1 I 25 6.5 250 8.2 500 9.4 1000 10.0 ROSEN MODIFIED SAMPATH-REDDI ASSAY
A modified version of the rat bone formation assay described in Sampath and Reddi.
Proc. Natl. Acad. Sci. USA. 80:6591-6595 (1983) is used to evaluate bone and/or cartilage andlor other connective tissue activity of BMP proteins. This modified assay is herein called the Rosen-modified Sampath-Reddi assay. The ethanol precipitation step of the Sampath-Reddi procedure is replaced by dialyzing (if the composition is a solution) or diafiltering (if the composition is a suspension) the fraction to be assayed against water. The solution or suspension is then equilibrated to 0.1 % TFA. The resulting solution is added to 20 mg of rat matrix. A mock rat matrix sample not treated with the protein serves as a control. This material is frozen and lyophilized and the resulting powder enclosed in #5 gelatin capsules.
The capsules are implanted subcutaneously in the abdominal thoracic area of 2I-49 day old male Long Evans rats. The implants are removed after 7-14 days. Half of each implant is used for alkaline phosphatase analysis [see, Reddi et al, Proc. Natl. Acad. Sci., 69:1601 ( 1972)].

_ 5 The other half of each implant is fixed and processed for histological analysis. 1 pm glycolmethacrylate sections are stained with Von Kossa and acid fuschin to score the amount of induced bone and cartilage and other connective tissue formation present in each implant.
The terms +1 through +~ represent the area of each histoloaical section of an implant occupied by new bone and/or cartilage cells and matrix. A score of +5 indicates that greater than S0%
of the implant is new bone and/or cartilage produced as a direct result of protein in the implant.
A score of +4, +3, +2, and +I would indicate that greater than 40%, 30%, 20%
and 10%
respectively of the implant contains new cartilage and/or bone.
Alternatively, the implants are inspected for the appearance of tissue resembling embryonic tendon, which is easily recognized by the presence of dense bundles of fibroblasts 1 ~ oriented in the same plane and packed tightly together. [Tendon/ligament-like tissue is described, for example, in Ham and Cormack. Histoloey (1B Lippincott Co. ( 1979), pp. 367-369). These findings may be reproduced in additional assays in which tendon/ligament-like tissues are observed in the BMP-16-related protein containing implants. The BMP-16-related proteins of this invention may be assessed for activity on this assay.

Expression of BMP-16 In order to produce murine, human or other mammalian BMP-16-related proteins, the DNA encoding it is transfened into an appropriate expression vector and introduced into mammalian cells or other preferred eukaryotic or prokaryotic hosts by conventional genetic engineering techniques. The preferred expression system for biologically active recombinant human BMP-16 is contemplated to be stably transformed mammalian cells.
One skilled in the art can construct mammalian expression vectors by employing the sequence of SEQ ID NO: 1 or SEQ ID NO: 3, or other DNA sequences encoding BMP-related proteins or other modified sequences and known vectors, such as pCD
[Okayama et al., Mol. Cell Biol., 2:161-170 (1982)], pJL3, plL4 [cough et al., EMBO 1., 4:645-653 (1985)]
and pMT2 CXM.
The mammalian expression vector pMT2 CXM is a derivative of p91023(b) (Wong et al.. Science 228:810-815, 1985) differing from the latter in that it contains the ampicillin resistance gene in place of the tetracycline resistance gene and further contains a XhoI site for itisertion of cDNA clones. The functional elements of pMT2 CXM have been described (Kaufman, R.J., 1985, Proc. Natl. Acad. Sci. USA 82:689-693) and include the adenovirus VA
genes. the SV40 origin of replication including the 72 by enhancer, the adenovirus major late promoter including a ~' splice site and the majority of the adenovirus tripartite leader sequence - present on adenovirus late mRNAs, a 3' splice acceptor site, a DHFR insert, the SV40 early polyadenylation site (SV40), and pBR322 sequences needed for propagation in E.
Piasmid pMT? CXM is obtained by EcoRI digestion of pMT2-VWF, which has been deposited with the American Type Culture Collection (ATCC), Rockville, MD
(USAj under accession number ATCC 6712?. EcoRI digestion excises the eDNA insert present in pMT2-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. toll HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods. pMT2 CXM is then constructed using loopout/in mutagenesis [Morinaga, et al., Biotechnolo~v 84: 636 (1984). This removes bases 1075 to I 145 relative to the Hind III site near the SV40 origin of replication and enhancer sequences of pMT2. In addition it inserts the following sequence:
5' PO-CATGGGCAGCTCGAG-3' at nucleotide 1 1.~~. This sequence contains the recognition site for the restriction endonuclease Xho I. A derivative of pMT2CXM, termed pMT23, contains recognition sites for the ?0 restriction endonucleases PstI, Eco RI, SaII and XhoI. Plasmid pMT2 CXM and pMT23 DNA
may be prepared by conventional methods.
pEMC2(31 derived from pMT21 may also be suitable in practice of the invention.
pMT21 is derived from pMT2 which is derived from pMT2-VWF. As described above EcoRI
digestion excises the cDNA insert present in pMT-VWF, yielding pMT2 in linear form which can be ligated and used to transform E. Coli HB 101 or DH-5 to ampicillin resistance. Plasmid pMT2 DNA can be prepared by conventional methods.
pMT21 is derived from pMT2 through the following two modifications. First, 76 by of the ~' untranslated region of the DHFR cDNA including a stretch of 19 G
residues from G/C
tailing for cDNA cloning is deleted. In this process, a XhoI site is inserted to obtain the following sequence immediately upstream from DHFR: 5' -CTGCAGGCGAGCCTGAATTCCTCGAGCCATCATG-3' PstI Eco RI XhoI
Second, a unique CIaI site is introduced by digestion with EcoRV and XbaI, treatment with Klenow fragment of DNA polymerase I, and ligation to a CIaI linker (CATCGATG).
This deletes a 250 by segment from the adenovirus associated RNA (VAI) region but does not interfere with VAI RNA gene expression or function. pMT21 is digested with EcoRI and Xhol, and used to derive the vector pEMC2B 1.

_ 5 A portion of the EMCV leader is obtained from pMT2-ECAT1 [S.K. Jung, et al. 1.
- Virol 63:1651-1660 (1989)] by digestion with Eco RI and PstI, resulting in a 2752 by fragment. This fragment is digested with -CaqI yielding an Eco RI-TaqI
fragment of 508 by which is purified by electrophoresis on low melting agarose gel. A 68 by adapter and its complementary strand are synthesized with ii 5' TaqI protruding end and a 3' XhoI protruding end which has the following sequence:
Taql I S GAAAAACACG_ATTG_C,3' Xhol This sequence matches the EMC virus leader sequence from nucleotide 763 to 827. It also changes the ATG at position 10 within the EMC virus leader to an ATT and is followed by a XhoI site. A three way ligation of the pMT:? 1 Eco RI-l6hoI fragment, the EMC
virus EcoRI-TaqI fragment, and the 68 by oligonucleotide adapter TaqI-l6hoI adapter resulting in the vector pEMC2(31.
This vector contains the SV40 origin of replication and enhancer, the adenovirus major late promoter, a cDNA copy of the majority of the adenovirus tripartite leader sequence, a small hybrid intervening sequence, an SV40 polyadenylation signal and the adenovirus VA I
gene, DHFR and (3-lactamase markers and an EMC sequence, in appropriate relationships to direct the high level expression of the desired cDNA in mammalian cells.
The construction of vectors may involve modification of the BMP-16-related DNA
sequences. For instance, BMP-16 cDN~~ can be modified by removing the non-coding nucleotides on the 5' and 3' ends of the coding region. The deleted non-coding nucleotides may or may not be replaced by other sequences known to be beneficial for expression. These vectors are transformed into appropriate host cells for expression of BMP-16-related proteins.
Additionally, the sequence of SEQ ID NO:1 or other sequences encoding BMP-16-related proteins can be manipulated to express a mature BMP-16-related protein by deleting BMP-16 encoding propeptide sequences and replacing them with sequences encoding the complete propeptides of other BMP proteins.
One skilled in the art can manipulate the sequences of SEQ ID NO: 1 by eliminating or replacing the mammalian regulatory sequences flanking the coding sequence with bacterial sequences to create bacterial vectors for intracellular or extracellular expression by bacterial cells. For example, the coding sequences could be further manipulated (e.g.
ligated to other known linkers or modified by deleting non-.coding sequences therefrom or altering nucleotides _ 5 therein by other known techniques). The modified BMP-16-related coding sequence could - then be inserted into a known bacterial vector using procedures such as described in T.
Taniguchi et al., Proc. Natl Acad. Sci. USA. 77:5230-5233 ( 1980). This exemplary bacterial vector could then be transformed into bacterial host cells and a BMP-16-related protein expressed thereby. For a strategy for producing extracellular expression of BMP-16-related proteins in bacterial cells, see, e.g. European patent application EPA
Similar manipulations can be performed for the construction of an insect vector [See, e.g. procedures described in published European patent application 155.476]
for expression in insect cells. A yeast vector could also be constructed employing yeast regulatory sequences for intracellular or extracellular expression of the factors of the present invention by yeast cells.
[See, e.g., procedures described in published PCT application W086/00639 and European patent application EPA 123,289].
A method for producing high levels of a BMP-16-related protein of the invention in mammalian cells may involve the construction of cells containing multiple copies of the heterologous BMP-16-related gene. The heterologous gene is linked to an amplifiable marker, e.g. the dihydrofolate reductase (DHFR) gene for which cells containing increased gene copies can be selected for propagation in increasing concentrations of methotrexate (MTX) according to the procedures of Kaufman and Sharp, J. Mol. Biol.. 159:601-629 (1982).
This approach can be employed with a number of different cell types.
For example, a plasmid containing a DNA sequence for a BMP-16-related protein of the invention in operative association with other plasmid sequences enabling expression thereof and the DHFR expression plasmid pAdA26SV(A)3 [Kaufman and Sharp, Mol. Cell.
Biol., 2:1304 (1982)] can be co-introduced into DHFR-deficient CHO cells, DUKX-BII, by various methods including calcium phosphate coprecipitation and transfection, electroporation or protoplast fusion. DHFR expressing transformants are selected for growth in alpha media with dialyzed fetal calf serum, and subsequently selected for amplification by growth in increasing concentrations of MTX (e.g. sequential steps in 0.02, 0.2, 1.0 and 5uM MTX) as described in Kaufman et al., Mol Cell Biol., 5:1750 (1983). Transformants are cloned, and biologically active BMP-16 expression is monitored by the Rosen-modified Sampath-Reddi rat bone formation assay described above in Example 3. BMP-16 protein expression should increase with increasing levels of MTX resistance. BMP-16 poiypeptides are characterized using standard techniques known in the art such as pulse labeling with [35S]
methionine or cysteine and polyacrylamide gel electrophoresis. Similar procedures can be followed to produce other related BMP-16-related proteins.

- Biological Activity of Expressed BMP-16 To measure the biological activity of the expressed BMP-16-related proteins obtained in Example 4 above, the proteins are recovered from the cell culture and purified by isolating the BMP-16-related proteins from other proteinaceous materials with which they are co-produced as well as from other contaminants. The purified protein may be assayed in accordance with the rat bone formation assay described in Example 3.
Purification is carried out using standard techniques known to those skilled in the art.
Protein analysis is conducted usung standard techniques such as SDS-PAGE
acrylamide [Laemmli, Nature ??7:680 (1970)] stained with silver [Oakley, et al. Anal.
IS Biochem. 105:361 (1980)] and by immunoblot [Towbin, et al. Proc. Natl.
Acad. Sci. USA
76:4350 ( I 979)]

Using Northern analysis, BMP-16 and BMP-16-related proteins can be tested for their effects on various cell lines. Suitable cell liners include cell lines derived from E13 mouse limb buds. After 10 days of treatment with BMP-16 or BMP-16-related protein, the cell phenotype is examined histologically for indications of tissue differentiation. In addition, Northern analysis of mRNA from BMP-i6 or BMP-16-related protein treated cells can be performed for various markers including one or more of the following markers for bone, cartilage and/or tendon/ligament, as described in Table IV:
Table IV
Marker Bone Cartiia~e Tendon/Lieament Osteocalcin + - -Alkaline Phosphatase + -Proteoglycan Core Protein +/-' + +' Collagen Type I + + +
Collagen Type II +/-' + +=
Decorin + + +
Elastin +/-' ? +
1- Marker seen early, marker not seen as mature: bone tissue forms 2- Marker depends upon site of tendon: strongest at bone interface 3- Marker seen at low levels Embryonic Stem Cell Assay In order to assay the effects of the BMP-16 proteins of the present invention, it is - possible to assay the growth and differentiation effects in vitro on a number of available embryonic stem cell lines. One such cell line is ES-E14TG2, which is available from the American Type Culture Collection in Rockville, Md.
In order to conduct the assay, cells may be propagated in the presence of 100 units of LIF to keep them in an undifferentiated state. Assays are setup by first removing the LIF and aggregating the cells in suspension, in what is known as embryoid bodies.
After 3 days the embryoid bodies are plated on gelatin coated plates ( 12 well plates for PCR
analysis, 24 well plates for immunocytochemistry) and treated with the proteins to be assayed.
Cells are supplied with nutrients and treated with the protein factor every 2-3 days.
Cells may be adapted so that assays may be conducted in media supplemented with l5~lo Fetal Bovine Serum (FBS) or with CDM defined media containing much lower amounts of FBS.
At the end of the treatment period (ranging from 7-21 days) RNA is harvested from the cells and analyzed by quantitative multiplex PCR for the following markers: Brachvurv, a mesodermal marker, AP-2, an ectodermal marker, and HNF-3a an endodermal marker.
Through immunocytochemistry, it is also possible to detect the differentiation of neuronal cells (glia and neurons), muscle cells (cardiomyocytes, skeletal and smooth muscle), and various other phenotype markers such as proteoglycan core protein (cartilage), and cytokeratins (epidermis). Since these cells have a tendency to differentiate autonomously when LIF is removed, the results are always quantitated by comparison to an untreated control.
The foregoing descriptions detail presently preferred embodiments of the present invention. Numerous modifications and variations in practice thereof are expected to occur to those skilled in the art upon consideration of these descriptions. Those modifications and variations are believed to be encompassed within the claims appended hereto.

(A) ADDRESSEE: Gowling, Strathy & Henderson (B) STREET: 160 Elgin Street, Suite 2600 (C) CITY: Ottawa (D) STATE: Ontario (E) COUNTRY: CA
(D) SOFTWARE:.PatentIn~Release #1:0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) NAME: Gowling, Strathy & Henderson (B) REGISTRATION NUMBER:
(A) TELEPHONE: (613) 233-1781 (B) TELEFAX: (613) 563-9869 (2) INFORMATION FOR SEQ ID NO:1:
(A) LENGTH: 843 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(A) NAME/KEY: sig-peptide (B) LOCATION: 1..510 Trademark*

~- . CA 02265508 1999-07-14 ... , o .
(A) NAME/K$Y: mat~eptide (B) LOCATION: 511..840 (ix) FEATURE:


Gin GlnGluAspLeuAlaTrpAlaGluLeuArgLeu GlnLeuSerSer ?ro ValAspLeuProThrGluGlySerLeuAlaIle GluIlePheHis G1n ProLysProAspThrGluGlnAlaSerAspSer CysLeuGluArg ?he GlnMetAspLeuPheThrValThrLeuSerGln ValThrPheSer Leu GlySerMetValLeuGluValThrArgProLeu SerLysTrpLeu AAG CGCCCTGGGGCCC:GGAGAAGCAGATGTCCAGG GTAGCTGGAGAG 336 ~ys ArgProGlyAlaLeuGluLysGlnMetSerArg ValAlaGlyGlu '.GC TGGCCGCGGCCCCCCACACCGCCTGCCACCAAT GTGCTCCTTATG 384 =ys TrpProArgProProThrProProAlaThrAsn ValLeuLeuMet ~eu TyrSerAsnLeuSerGlnGluGlnArgGlnLeu GlyGlySerThr '_"TG CTGTGGGAAGCCGAGAGCTCCTGGCGGGCCCAG GAGGGACAGCTG 480 Leu LeuTrpGluAlaGluSerSerTrpArgAlaGln GluGlyGlnLeu Ser TrpGluTrpGlyLysArgHisArgArgHisHis LeuProAspArg Ser GlnLeuCysArgLysValLysPheGlnValAsp PheAsnLeuIle ~GA TGGGGCTCCTGGATCATCTACCCCAAGCAGTAC AACGCCTATCGC 624 ~iy TrpGlySerTrpIleIleTyrProLysGlnTyr AsnAlaTyrArg Cys GluGlyGluCysProAsnProValGlyGluGlu PheHisProThr :zAC CATGCATACATCCAGAGTCTGCTGAAACGTTAC CAGCCCCACCGA 720 :,sn HisAlaTyrIleGlnSerLeuLeuLysArgTyr GlnProHisArg '7a1 ProSerThrCysCysAlaProValLysThrLys ProLeuSerMet ~eu TyrValAspAsnGlyArgValLeuLeuAspHis HisLysAspMet :,TC GTGGAAGAATGTGGGTGCCTCTGA 843 ._1e ValGluGluCysGlyCysLeu !2) INFORMATION FOR SEQ ID N0:2:
(A) LENGTH: 280 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID N0:2:
Val Asp Gly Gln Asn Trp Thr Phe Ala Phe Asp Phe Ser Phe Leu Ser Gln Gln Glu Asp Leu Ala Trp Ala Glu Leu Arg heu Gln Leu Ser Ser Pro Val Asp Leu Pro Thr Glu Gly Ser Leu Ala :ile Glu Ile Phe His Gln Pro Lys Pro Asp Thr Glu Gln Ala Ser Asp Ser Cys Leu Glu Arg Phe Gln Met Asp Leu Phe Thr Val Thr Leu Ser (~ln Val Thr Phe Ser ~eu Gly Ser Met Val Leu Glu Val Thr Arg Pro heu Ser Lys Trp Leu Lys Arg Pro Gly Ala Leu Glu Lys Gln Met Ser ~~rg Val Ala Gly Glu Cys Trp Pro Arg Pro Pro Thr Pro Pro Ala Thr Val Leu Leu Met Leu Tyr Ser Asn Leu Ser Gln Glu Gln Arg Gln heu Gly Gly Ser Thr Leu Leu Trp Glu Ala Glu Ser Ser Trp Arg Ala (zln Glu Gly Gln Leu Ser Trp Glu Trp Gly Lys Arg His Arg Arg His 1-lis Leu Pro Asp Arg Ser Gln Leu Cys Arg Lys Val Lys Phe Gln Val asp Phe Asn Leu Ile Gly Trp Gly Ser Trp Ile Ile Tyr Pro Lys Gln 'Pyr Asn Ala Tyr Arg Cys Glu Gly Glu Cys Pro Asn Pro Val Gly Glu Glu Phe His Pro Thr Asn His Ala Tyr Ile Gln Ser Leu Leu Lys Arg 'Pyr Gln Pro His Arg Val Pro Ser Thr Cys Cys Ala~Pro Val Lys Thr :Lys Pro Leu Ser Met 75 ao e5 Leu Tyr Val Asp Asn Gly Arg Val Leu Leu Asp :3is His Lys Asp Met Ile Val Glu Glu Cys Gly Cys Leu (2) INFORMATIODI FOR SEQ ID N0:3:
(A) LENGTH: 2003 base pairs (B) TYPE:
nucleic acid (C) STRANDEDNESS: le sing (D) TOPOLOGY:
linear (ii) MOLECULE
(genomic) (xi) SEQUENCE
SEQ ID N0:3:



(A) LENGTH: 1184 base p airs (B) TYPE: nucleic acid (C) STRANDEDNESS: singl e (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (geno mic) (xi) SEQUENCE DESCRIPTION: Q ID
SE N0:4:

Claims (16)

What is claimed is:
1. An isolated DNA molecule compnsing a DNA sequence selected from the group consisting of:
(a) nucleotides #1, 511 or 538 to #837 or 840 of SEQ ID NO:1;
(b) nucleotides encoding amino acids #-170, 1 or 10 to #109 or 110 of SEQ ID
NO:2; and (c) naturally occurring human allelic: sequences and equivalent degenerative codon sequences of (a) or (b).
2. A host cell transformed with the DNA sequence of claim 1.
3. A vector compnsing a DNA molecule of claim 1 in operative association with an expression control sequence therefor.
4. A host cell transformed with the vector of claim 3.
5. An isolated DNA molecule comprising a DNA sequence consisting of nucleotides # 511 to #840 of SEQ ID NO: 1.
6. A vector comprising a DNA molecule of claim 5 in operative association with an expression control sequence therefor.
7. A host cell transformed with the vector of claim 6.
8. A method for producing a purified human bone morphogenetic protein 16 (BMP-16) protein, said method comprising the steps of:
(a) culturing a host cell transformed with a DNA molecule according to claim 1;
and (b) recovenng and purifying said human BMP-16 protein from the culture medium.
9. The method of claim 8, wherein said host cell is transformed with a DNA
molecule comprising a DNA coding sequence consisting of nucleotide # 511 to #840 of SEQ ID NO: 1.
10. The method of claim 9, wherein said host cell is a mammalian cell and the DNA molecule further compnses a DNA sequence encoding a propeptide from a memberof the TGF-.beta. superfamily of proteins said DNA sequence encoding a propeptide being linked in proper reading frame to the DNA coding sequence.
11. A purifed bone morphogenetic protein-16 (BMP-16) polypeptide comprising the amino acid sequence from amino acid # 1 to # 110 as set forth in SEQ ID NO: 2.
12. A purifed BMP-16 polypeptide of claim 11 wherein said polypeptide is a dimer and wherein at least one subunit comprises the amino acid sequence from amino acid # 1 to # 110 of SEQ ID NO: 2.
13. A purified bone morphogeneuic protein-16 (BMP-16) polypeptide produced by the steps of (a) culturing a cell transformed with a DNA molecule according to claim 5: and (b) recovering and purifying from said culture medium a polypeptide comprising the amino acid sequence from amino acid # 1 to amino acid # 110 of SEQ ID NO: 2.14. A purified bone morphogenetic protein-16 (BMP-16) polypeptide according to claim 12, wherein said polypeptide is a dimer comprising two subunits, wherein one subunit comprises the amino acid sequence from amino acid #1 to amino acid #110 of SEQ
ID NO: 7, and one subunit comprises an amino acid sequence for a bone morphogenetic protein selected from the group consisting of BMP-1, BMP-2, BMP-3, BMP-4, BMP-5,BMP-6. BMP-7, BMP-8, BMP-9 BMP-10, BMP-11, BMP-12, BMP-13, and BMP-15.
15. A chimeric DNA molecule comprising a DNA sequence encoding a propeptide from a member of the TGF-.beta. superfamily of proteins linked in frame to a DNA sequence encoding a bone morphogenetic protein-16 (BMP-16) polypeptide, said BMP-16 polypeptide comprising amino acid # 1 to # 110 of SEQ ID NO: 2.
16. Antibodies to a purified BMP 16 protein according to claim 12.
CA 2265508 1996-09-18 1997-07-09 Bone morphogenetic protein-16 (bmp-16) compositions Expired - Fee Related CA2265508C (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US08715202 US5965403A (en) 1996-09-18 1996-09-18 Nucleic acids encoding bone morphogenic protein-16 (BMP-16)
US08/715,202 1996-09-18
PCT/US1997/011954 WO1998012322A1 (en) 1996-09-18 1997-07-09 Bone morphogenetic protein-16 (bmp-16) compositions

Publications (2)

Publication Number Publication Date
CA2265508A1 true CA2265508A1 (en) 1998-03-26
CA2265508C true CA2265508C (en) 2003-11-18



Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2265508 Expired - Fee Related CA2265508C (en) 1996-09-18 1997-07-09 Bone morphogenetic protein-16 (bmp-16) compositions

Country Status (7)

Country Link
US (3) US5965403A (en)
JP (1) JP2001500737A (en)
KR (1) KR20000036012A (en)
CA (1) CA2265508C (en)
EP (1) EP0941323A1 (en)
FI (1) FI990596A (en)
WO (1) WO1998012322A1 (en)

Families Citing this family (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3504263B2 (en) 1991-11-04 2004-03-08 ジェネティックス・インスチチュート・リミテッド・ライアビリティ・カンパニー Recombinant bone morphogenic protein heterodimer, compositions and use
US8106001B2 (en) * 1996-08-27 2012-01-31 University Of South Florida Diagnostic markers of human female infertility
US5965403A (en) * 1996-09-18 1999-10-12 Genetics Institute, Inc. Nucleic acids encoding bone morphogenic protein-16 (BMP-16)
KR20000070879A (en) * 1997-02-06 2000-11-25 브루스 엠. 에이센, 토마스 제이 데스로저 Human sdf-5 protein and compositions
JP2001512003A (en) * 1997-08-04 2001-08-21 ミレニアム ファーマシューティカルズ インク. Tango-78, Tango-79 and Tango-81 polypeptide, Tango-78, Tango-79 and nucleic acid molecules encoding Tango-81 and their use
US6211157B1 (en) 1998-05-01 2001-04-03 Sulzer Biologics, Inc. Protein mixtures to induce therapeutic angiogenesis
US6992066B2 (en) * 1998-10-16 2006-01-31 Zimmer Orthobiologics, Inc. Povidone-containing carriers for polypeptide growth factors
US7087577B2 (en) 1998-10-16 2006-08-08 Zimmer Orthobiologies, Inc. Method of promoting natural bypass
EP1181041A2 (en) * 1999-04-30 2002-02-27 Curis, Inc. Morphogen-induced enhancement of fertility
EP1202755A1 (en) * 1999-07-28 2002-05-08 Regeneration Technologies, Inc. Cartilage or bone matrix as a nucleic acid delivery vehicle
CN1331248A (en) * 2000-06-30 2002-01-16 上海博德基因开发有限公司 Polypeptide-human chondral connexin 10.67 and polynucleotide for coding it
US6482936B1 (en) * 2001-04-17 2002-11-19 Pe Corporation (Ny) Isolated human secreted proteins, nucleic acid molecules encoding human secreted proteins, and uses thereof
DK1399023T3 (en) * 2001-06-01 2008-08-18 Wyeth Corp Compositions for systemic administration of sequences encoding bone morphogenesis proteins
US7413753B2 (en) 2001-06-08 2008-08-19 Wyeth Calcium phosphate delivery vehicles for osteoinductive proteins
US7232802B2 (en) * 2001-12-21 2007-06-19 Zimmer Orthobiologics, Inc. Compositions and methods for promoting myocardial and peripheral angiogenesis
US20040265230A1 (en) * 2003-01-06 2004-12-30 Martinez Robert Vincent Compositions and methods for diagnosing and treating colon cancers
WO2004070062A3 (en) * 2003-02-04 2004-11-18 Eugene Brown Compositions and methods for diagnosing and treating cancers
US20050119210A1 (en) * 2003-05-20 2005-06-02 Xiaobing Be Compositions and methods for diagnosing and treating cancers
CN1878565B (en) 2003-09-12 2011-01-12 惠氏公司;埃特克斯公司 Injectable calcium phosphate solid rods and pastes for delivery of osteogenic proteins
DE10361075A1 (en) * 2003-12-22 2005-07-28 Pac Tech - Packaging Technologies Gmbh Method and Vorichtung for drying circuit substrates
EP1571159A1 (en) * 2004-03-04 2005-09-07 Bayerische Julius-Maximilians-Universität Würzburg Mutein of a bone morphogenetic protein and use thereof
WO2005116052A3 (en) * 2004-04-27 2006-06-08 Senyon Choe ANTAGONISM OF TGF-β SUPERFAMILY RECEPTOR SIGNALING
WO2005113585A3 (en) * 2004-05-20 2006-06-08 Acceleron Pharma Inc Modified tgf-beta superfamily polypeptides
WO2005118636A3 (en) * 2004-05-27 2006-06-22 Acceleron Pharma Inc Tgf derepressors and uses related thereto
US9161967B2 (en) 2006-06-30 2015-10-20 Biomimetic Therapeutics, Llc Compositions and methods for treating the vertebral column
US7473678B2 (en) 2004-10-14 2009-01-06 Biomimetic Therapeutics, Inc. Platelet-derived growth factor compositions and methods of use thereof
US20060166251A1 (en) * 2005-01-26 2006-07-27 Archambault Joanne M Use of sFRPs as markers of BMP activity
JP2008534607A (en) * 2005-03-30 2008-08-28 ワイスWyeth Method for stimulating hair growth by administering Bmp
US20060247790A1 (en) * 2005-04-30 2006-11-02 Mckay William F Shaped osteochondral grafts and methods of using same
JP5368102B2 (en) 2005-11-17 2013-12-18 バイオミメティック セラピューティクス, インコーポレイテッド Maxillofacial bone augmentation using rhPDGF-BB and a biocompatible matrix
US8147860B2 (en) 2005-12-06 2012-04-03 Etex Corporation Porous calcium phosphate bone material
US7659999B2 (en) * 2005-12-23 2010-02-09 Xerox Corporation UIdesign: N-up calculator user interface
ES2443581T3 (en) 2006-02-09 2014-02-19 Biomimetic Therapeutics, Llc Compositions and methods for treating bone
JP5484047B2 (en) 2006-06-30 2014-05-07 バイオミメティック セラピューティクス, エルエルシー pdgf- biological matrix composition for treating rotator cuff injury and methods
US8524265B2 (en) 2006-08-17 2013-09-03 Warsaw Orthopedic, Inc. Medical implant sheets useful for tissue regeneration
EP2086598B1 (en) 2006-11-03 2015-05-27 BioMimetic Therapeutics, LLC Compositions and methods for arthrodetic procedures
US20080195476A1 (en) * 2007-02-09 2008-08-14 Marchese Michael A Abandonment remarketing system
EP2259807B1 (en) 2008-02-07 2013-04-24 Biomimetic Therapeutics, Inc. Compositions for distraction osteogenesis
EP2300610A1 (en) * 2008-06-09 2011-03-30 Wyeth LLC Novel bmp-12-related proteins and methods of their manufacture
WO2010030714A8 (en) 2008-09-09 2011-03-10 Biomimetic Therapeutics, Inc. Platelet-derived growth factor compositions and methods for the treatment of tendon and ligament injuries
US8609127B2 (en) 2009-04-03 2013-12-17 Warsaw Orthopedic, Inc. Medical implant with bioactive material and method of making the medical implant
US20110002897A1 (en) 2009-06-11 2011-01-06 Burnham Institute For Medical Research Directed differentiation of stem cells
JP6144049B2 (en) 2010-02-22 2017-06-07 バイオミメティック セラピューティクス,リミテッド ライアビリティ カンパニー Platelet-derived growth factor compositions and methods for treating tendinopathy
US9688735B2 (en) 2010-08-20 2017-06-27 Wyeth Llc Designer osteogenic proteins
CN105198981A (en) 2010-08-20 2015-12-30 惠氏有限责任公司 Designer osteogenic proteins

Family Cites Families (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5106748A (en) * 1986-07-01 1992-04-21 Genetics Institute, Inc. Dna sequences encoding 5 proteins
US5108922A (en) * 1986-07-01 1992-04-28 Genetics Institute, Inc. DNA sequences encoding BMP-1 products
US5187076A (en) * 1986-07-01 1993-02-16 Genetics Institute, Inc. DNA sequences encoding BMP-6 proteins
US5013649A (en) * 1986-07-01 1991-05-07 Genetics Institute, Inc. DNA sequences encoding osteoinductive products
US5141905A (en) * 1986-07-01 1992-08-25 Rosen Vicki A Dna sequences encoding bmp-7 proteins
DK0536186T3 (en) * 1990-05-16 2002-05-21 Genetics Inst Bone and cartilage formation-inducing proteins
US5168050A (en) * 1990-05-24 1992-12-01 Genentech, Inc. Mammalian expression of the bone morphogenetic protein-2b using bmp2a/bmp2b fusion
DE69228118D1 (en) * 1991-06-25 1999-02-18 Genetics Inst BMP 9 compositions
EP0625989B1 (en) * 1992-02-12 2000-01-19 BIOPHARM GESELLSCHAFT ZUR BIOTECHNOLOGISCHEN ENTWICKLUNG VON PHARMAKA mbH Dna sequences encoding novel growth/differentiation factors
WO1994001557A1 (en) * 1992-07-13 1994-01-20 Sumitomo Metal Industries., Ltd. Bone formation-inducing protein
CA2153654A1 (en) * 1993-01-12 1994-07-21 Se-Jin Lee Growth differentiation factor-5
JPH08505771A (en) * 1993-01-12 1996-06-25 ジョーンズ ホプキンス ユニバーシティー スクール オブ メディシン Growth and differentiation factor -3
DE69432815T2 (en) * 1993-03-19 2003-12-11 Univ Johns Hopkins Med Growth factor-8
CA2161807A1 (en) * 1993-05-12 1994-11-24 Anthony J. Celeste Bmp-10 compositions
ES2213745T3 (en) * 1993-05-12 2004-09-01 Genetics Institute, Llc BMP11 compositions.
CA2124422A1 (en) * 1993-05-27 1994-11-28 Yukio Fujisawa Heterodimers of tgf-.beta. superfamily
CA2165776A1 (en) * 1993-07-09 1995-01-19 Se-Jin Lee Growth differentiation factor-6
WO1995001802A1 (en) * 1993-07-09 1995-01-19 The Johns Hopkins University School Of Medicine Growth differentiation factor-7
WO1995010539A1 (en) * 1993-10-08 1995-04-20 The Johns Hopkins University School Of Medicine Growth differentiation factor-10
DE69434651T2 (en) * 1993-12-07 2007-03-08 Genetics Institute, Inc., Cambridge BMP-12, BMP-13 and tendon-inducing compositions containing them
US5439904A (en) * 1993-12-07 1995-08-08 Synphar Laboratories, Inc. 2-spiro(2'-spirocycloalkyl)cyclopropyl cephalosporin sulfones as antiinflammatory and antigenerative agents
US5914234A (en) * 1994-07-08 1999-06-22 The Johns Hopkins University School Of Medicine Methods of detecting growth differentiation factor-11
DK0770089T3 (en) * 1994-07-13 2000-10-23 Univ Johns Hopkins Med Growth differentiation factor-12
US5693779A (en) * 1994-11-08 1997-12-02 The United States Of America As Represented By The Department Of Health And Human Services Production and use of anti-dorsalizing morphogenetic protein
US5965403A (en) * 1996-09-18 1999-10-12 Genetics Institute, Inc. Nucleic acids encoding bone morphogenic protein-16 (BMP-16)

Also Published As

Publication number Publication date Type
US6623934B2 (en) 2003-09-23 grant
FI990596D0 (en) grant
EP0941323A1 (en) 1999-09-15 application
CA2265508A1 (en) 1998-03-26 application
US20030158379A1 (en) 2003-08-21 application
WO1998012322A1 (en) 1998-03-26 application
US6331612B1 (en) 2001-12-18 grant
US5965403A (en) 1999-10-12 grant
KR20000036012A (en) 2000-06-26 application
FI990596A0 (en) 1999-03-17 application
FI990596A (en) 1999-05-03 application
JP2001500737A (en) 2001-01-23 application

Similar Documents

Publication Publication Date Title
Khan et al. Bone growth factors
Ignotz et al. Regulation of fibronectin and type I collagen mRNA levels by transforming growth factor-beta.
Gitelman et al. Recombinant Vgr-1/BMP-6-expressing tumors induce fibrosis and endochondral bone formation in vivo.
Miller et al. Complementary DNA cloning of the murine transforming growth factor-β3 (TGFβ3) precursor and the comparative expression of TGFβ3 and TGFβ1 messenger RNA in murine embryos and adult tissues
Wozney The bone morphogenetic protein family and osteogenesis
Wozney The potential role of bone morphogenetic proteins in periodontal reconstruction
US5221620A (en) Cloning and expression of transforming growth factor β2
US5354557A (en) Osteogenic devices
Ozkaynak et al. OP‐1 cDNA encodes an osteogenic protein in the TGF‐beta family.
US6322786B1 (en) Method of producing bone-inducing agent
US5863758A (en) Nucleic acids encoding osteogenic proteins
US5861278A (en) HNF3δ compositions
McPherron et al. GDF-3 and GDF-9: two new members of the transforming growth factor-beta superfamily containing a novel pattern of cysteines.
US4877864A (en) Osteoinductive factors
Wang Bone morphogenetic proteins (BMPs): therapeutic potential in healing bony defects
US5916870A (en) Compositions and therapeutic methods using morphogenic proteins and stimulatory factors
Sakou Bone morphogenetic proteins: from basic studies to clinical approaches
US6719968B2 (en) Tendon-inducing compositions
US6027919A (en) BMP-12 and BMP-13 proteins and DNA encoding them
US5344654A (en) Prosthetic devices having enhanced osteogenic properties
US5208219A (en) Method for inducing bone growth
Lyons et al. Vgr-1, a mammalian gene related to Xenopus Vg-1, is a member of the transforming growth factor beta gene superfamily
US5013649A (en) DNA sequences encoding osteoinductive products
US5393739A (en) Use of bone morphogenetic protein in synergistic combination with TGF-β for bone repair
US6190880B1 (en) Recombinant bone morphogenetic protein heterodimers, compositions and methods of use

Legal Events

Date Code Title Description
EEER Examination request
MKLA Lapsed