Connect public, paid and private patent data with Google Patents Public Datasets

Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions


Publication number
CA2255774C CA 2255774 CA2255774A CA2255774C CA 2255774 C CA2255774 C CA 2255774C CA 2255774 CA2255774 CA 2255774 CA 2255774 A CA2255774 A CA 2255774A CA 2255774 C CA2255774 C CA 2255774C
Grant status
Patent type
Prior art keywords
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA 2255774
Other languages
French (fr)
Other versions
CA2255774A1 (en )
Francis Barany
Matthew Lubin
Phillip Belgrader
George Barany
Robert P. Hammer
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Cornell Research Foundation Inc
Louisiana State University and Agricultural and Mechanical College
University of Minnesota
Original Assignee
Cornell Research Foundation Inc
Louisiana State University and Agricultural and Mechanical College
University of Minnesota
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Grant date
Family has litigation



    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for mutation or polymorphism detection
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for mutation or polymorphism detection
    • C12Q1/683Hybridisation assays for mutation or polymorphism detection involving restriction enzymes, e.g. RFLP
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6846Common amplification features
    • C12Q1/6851Quantitative amplification
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6846Common amplification features
    • C12Q1/6853Common amplification features using modified primers or templates
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6846Common amplification features
    • C12Q1/6858Allele specific amplification
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/686Polymerase Chain Reaction [PCR]
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6862Ligase Chain Reaction [LCR]
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Hybridisation probes
    • C12Q1/6881Hybridisation probes for tissue and cell typing, e.g. HLA probes
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays


The present invention relates to the detection of nucleic acid sequence differences using coupled ligase detection reaction and polymerase chain reaction. One aspect of the present invention involves use of a ligase detection reaction coupled to a polymerase chain reaction. Another aspect of the present invention relates to the use of a primary polymerase chain reaction coupled to a secondary polymerase chain reaction coupled to a ligase detection reaction. A third aspect of the present invention involves a primary polymerase chain reaction coupled to a secondary polymerase chain reaction. Such coupling of the ligase detection reaction and the polymerase chain reaction permits multiplex detection of nucleic acid sequence differences.



This invention was developed with government funding under National Institutes of Health Grant No. GM41337-06. The U.S. Government may retain certain rights.


The present invention relates to the detection of nucleic acid sequence differences using coupled ligase detection reaction ("LDR") and polymerase chain reaction ("PCR"). One aspect of the present invention involves use of a ligase detection reaction coupled to a polymerase chain reaction.
Another aspect of the present invention relates to the use of a primary polymerase chain reaction coupled to a secondary polymerase chain reaction coupled to a ligase detection reaction. A third aspect of the present invention involves a primary polymerase chain reaction coupled to a. secondary polymerase chain reaction.

Multiplex Detection Large-scale multiplex analysis of highly polymorphic loci is needed for practical identification of individuals, e.g., for paternity testing and in forensic science (Reynolds et al., Anal.. Chem., 63:2-15 (1991)), for organ-transplant donor-recipient matching (Buyse et al., Tissue Antigens, 41:1-14 (1993) and Gyllensten et al., PCR Meth. App1, 1:91-98 (1991)), for genetic disease diagnosis, prognosis, and pre-natal counseling (Chamberlain et al., Nucleic Acids Res., 16:11141-11156 (1988) and L. C. Tsui, Human Mutat., 1:197-203 (1992)), and the study of oncogenic mutations (Hollstein et al., Science, 253:49-53 (1991)). In addition, the cost-effectiveness of infectious disease diagnosis by nucleic acid analysis varies directly with the multiplex scale in panel testing. Many of these applications depend on the discrimination of single-base differences at a multiplicity of sometimes closely spaced loci.
A variety of DNA hybridization techniques are available for detecting the presence of one or more selected polynucleotide sequences in a sample containing a large number of sequence regions. In a simple method, which relies on fragment capture and labeling, a fragment containing a selected sequence is captured by hybridization to an immobilized probe. The captured fragment can be labeled by hybridization to a second probe which contains a detectable reporter moiety.
Another widely used method is Southern blotting. In this method, a mixture of DNA fragments in a sample is fractionated by gel electrophoresis, then fixed on a nitrocellulose filter. By reacting the filter with one or more labeled probes under hybridization conditions, the presence of bands containing the probe sequences can be identified. The method is especially useful for identifying fragments in a restriction-enzyme DNA digest which contains a given probe sequence and for analyzing restriction-fragment length polymorphisms ("RFLPs").
Another approach to detecting the presence of a given sequence or sequences in a polynucleotide sample involves selective amplification of the sequence(s) by polymerase chain reaction. U.S. Patent No. 4,683,202 to Mullis, et al. and R.K. Saiki, et al., Science 230:1350 (1985). In this method, primers complementary to opposite end portions of the selected sequence(s) are used to promote, in conjunction with thermal cycling, successive rounds of primer-initiated replication. The amplified sequence(s) may be readily identified by a variety of techniques. This approach is particularly useful for detecting the presence of low-copy sequences in a polynucleotide-containing sample, e.g., for detecting pathogen sequences in a body-fluid sample.

More recently, methods of identifying known target sequences by probe ligation methods have been reported. U.S. Patent No. 4,883,750 to N.M.
Whiteley, et al., D.Y. Wu, et al., Genomics 4:560 (1989), U. Landegren, et al., Science 241:1077 (1988), and E. Winn-Deen, et al., Clin. Chem. 37:1522 (1991).
In one approach, known as oligonucleotide ligation assay ("OLA"), two probes or probe elements which span a target region of interest are hybridized to the target region. Where the probe elements basepair with adjacent target bases, the confronting ends of the probe elements can be joined by ligation, e.g., by treatment with ligase. The ligated probe element is then assayed, evidencing the presence of the target sequence.
In a modification of this approach, the ligated probe elements act as a template for a pair of complementary probe elements. With continued cycles of denaturation, hybridization, and ligation in the presence of pairs of probe elements, the target sequence is amplified linearly, allowing very small amounts of target sequence to be detected and/or amplified. This approach is referred to as ligase detection reaction. When two complementary pairs of probe elements are utilized, the process is referred to as the ligase chain reaction which achieves exponential amplification of target sequences. F. Barany, "Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase," Proc.
Nat'l Acad. Sci. USA, 88:189-93 (1991) and F. Barany, "The Ligase Chain Reaction (LCR) in a PCR World," PCR Methods and Applications, 1:5-16 (1991).
Another scheme for multiplex detection of nucleic acid sequence differences is disclosed in U.S. Patent No. 5,470,705 to Grossman et. al.
where sequence-specific probes, having a detectable label and a distinctive ratio of charge/translational frictional drag, can be hybridized to a target and ligated together. This technique was used in Grossman, et. al.,"High-density Multiplex Detection of Nucleic Acid Sequences: Oligonucleotide Ligation Assay and Sequence-coded Separation," Nucl. Acids Res. 22(21):4527-34 (1994) for the large scale multiplex analysis of the cystic fibrosis transmembrane regulator gene.
Jou, et. al.,"Deletion Detection in Dystrophia Gene by Multiplex Gap Ligase Chain Reaction and Immunochromatographic Strip Technology,"
Human Mutation 5:86-93 (1995) relates to the use of a so called "gap ligase chain reaction" process to amplify simultaneously selected regions of multiple exons with the amplified products being read on an immunochromatographic strip having antibodies specific to the different haptens on the probes for each exon.
There is a growing need (e.g., in the field of genetic screening) for methods useful in detecting the presence or absence of each of a large number of sequences in a target polynucleotide. For example, as many as 400 different mutations have been associated with cystic fibrosis. In screening for genetic predisposition to this disease, it is optimal to test all of the possible different gene sequence mutations in the subject's genomic DNA, in order to make a positive identification of "cystic fibrosis". It would be ideal to test for the presence or absence of all of the possible mutation sites in a single assay. However, the prior-art methods described above are not readily adaptable for use in detecting multiple selected sequences in a convenient, automated single-assay format.
Solid-phase hybridization assays require multiple liquid-handling steps, and some incubation and wash temperatures must be carefiilly controlled to keep the stringency needed for single-nucleotide mismatch discrimination.
Multiplexing of this approach has proven difficult as optimal hybridization conditions vary greatly among probe sequences.
Developing a multiplex PCR process that yields equivalent amounts of each PCR product can be difficult and laborious. This is due to variations in the annealing rates of the primers in the reaction as well as varying polymerase extension rates for each sequence at a given Mg2+ concentration. Typically, primer, Mg2+, and salt concentrations, along with annealing temperatures are adjusted in an effort to balance primer annealing rates and polymerase extension rates in the reaction. Unfortunately, as each new primer set is added to the reaction, the number of potential amplicons and primer dimers which could form increase exponentially. Thus, with each added primer set, it becomes increasingly more difficult and time consuming to work out conditions that yield relatively equal amounts of each of the correct products.
Allele-specific PCR products generally have the same size, and an assay result is scored by the presence or absence of the product band(s) in the gel lane associated with each reaction tube. Gibbs et al., Nucleic Acids Res., 17:2437-2448 (1989). This approach requires splitting the test sample among multiple reaction tubes with different primer combinations, multiplying assay cost.
PCR has also discriminated alleles by attaching different fluorescent dyes to competing allelic primers in a single reaction tube (F.F. Chehab, et al., Proc.
Natl. Acad. Sci. USA, 86:9178-9182 (1989)), but this route to multiplex analysis is limited in scale by the relatively few dyes which can be spectrally resolved in an economical manner with existing instrumentation and dye chemistry. The incorporation of bases modified with bulky side chains can be used to differentiate allelic PCR products by their electrophoretic mobility, but this method is limited by the successful incorporation of these modified bases by polymerase, and by the ability of electrophoresis to resolve relatively large PCR products which differ in size by only one of these groups. Livak et al., Nucleic Acids Res., 20:4831-(1989). Each PCR product is used to look for only a single mutation, making multiplexing difficult.
Ligation of allele-specific probes generally has used solid-phase capture (U. Landegren et al., Science, 241:1077-1080 (1988); Nickerson et al., Proc. Natl. Acad. Sci. USA, 87:8923-8927 (1990)) or size-dependent separation (D.Y. Wu, et al., Genomics, 4:560-569 (1989) and F. Barany, Proc. Natl. Acad.
Sci., 88:189-193 (1991)) to resolve the allelic signals, the latter method being limited in multiplex scale by the narrow size range of ligation probes.
Further, in a multiplex format, the ligase detection reaction alone cannot make enough.
product to detect and quantify small amounts of target sequences. The gap ligase chain reaction process requires an additional step -- polymerase extension. The use of probes with distinctive ratios of charge/translational frictional drag for a more complex multiplex will either require longer electrophoresis times or the use of an alternate form of detection.
The need thus remains for a rapid single assay format to detect the presence or absence of multiple selected sequences in a polynucleotide sample.
Microsatellite Analysis Tandem repeat DNA sequences known as microsatellites represent a very common and highly polymorphic class of genetic elements within the human genome. These microsatellite markers containing small repeat sequences have been used for primary gene mapping and linkage analysis. Weber, J.L. et al., Am. J. Hum. Genet. 44: 388-396 (1989); Weissenbach, J. et al., Nature (London) 359: 794-800 (1992). PCR amplification of these repeats allows rapid assessment for loss of heterozygosity and can greatly simplify procedures for mapping tumor suppressor genes. Ruppert, J.M., et al., Cancer Res. 53: 5093-94 (1993); van der Riet, et al., Cancer Res. 54: 1156-58 (1994); Nawroz, H., et al., Cancer Res.
1152-55 (1994); Cairns, P., et al., Cancer Res. 54: 1422-24 (1994). More recently, they have been used to identify specific mutations in certain inherited disorders including Huntington disease, fragile X syndrome, myotonic dystrophy, spinocerebellar ataxia type I, spinobulbar muscular atrophy, and hereditary dentatorubral-pallidoluysian atrophy. The Huntington's Disease Collaborative Research Group Cell 72: 971-83 (1993); Kremer, E.J., et al., Science 252: 1711-14 (1991); Imbert, G., et al., Nat. Genet. 4: 72-76 (1993); Orr, H.T., et al., Nat.
Genet. 4: 221-226 (1993); Biancalana, V., et al., Hum. Mol. Genet. 1: 255-258 (1992); Chung, M.-Y., et al., Nat. Genet. 5: 254-258 (1993); Koide, R., et al., Nat. Genet. 6: 9-13 (1994). These inherited disorders appear to arise from the expansion of trinucleotide repeat units within susceptible genes. A more widespread microsatellite instability, demonstrated by expansion or deletion of repeat elements in neoplastic tissues, was first reported in colorectal tumors.
Peinado, M.A., et al. Proc. Natl. Acad. Sci. USA 89: 10065-69 (1992); Ionov, Y., Nature (London) 363: 558-61 (1993); Thibodeau, S.N., et al., Science 260:
816-819 (1993) and later in several other tumor types (Risinger, J.I., Cancer Res.
53: 5100-03 (1993); Han, H.-J., et al., Cancer Res. 53: 5087-89 (1993);
Peltomaki, P., Cancer Res. 53: 5853-55 (1993); GonzaIez-Zulueta, M., et al., Cancer Res. 53: 5620-23 (1993); Merlo, A., et al., Cancer Res. 54: 2098-2101 (1994)). In hereditary nonpolyposis colorectal carcinoma patients, this genetic instability is apparently due to inherited and somatic mutations in mismatch repair genes. Leach, F., et al., Cell 75: 1215-1225 (1993); Fishel, R., et al., Cell 75:
1027-38 (1993); Papadopoulos, N., et al., Science 263: 1625-29 (1994);
Bronner, C.E., et al., Nature (London) 368: 258-61 (1994).
PCR is commonly used for microsatellite analysis in identifying both the appearance of new polymorphisms and the loss of heterozygosity in cancer detection. L. Mao, et. al., "Microsatellite Alterations as Clonal Markers for the Detection of Human Cancer," Proc. Nat'l Acad. Sci USA 91(21): 9871-75 (1994); L. Mao, et. al., "Molecular Detection of Primary Bladder Cancer by Microsatellite Analysis," Science 271:659-62 (1996); D. Radford, et. al., "Allelotyping of Ductal Carcinoma in situ of the Breast: Detection of Loci on 8p, 13q, 161, 17p and 17q," Cancer Res. 55(15): 3399-05 (1995). In using PCR for such purposes, each PCR reaction is run individually and separated on a sequencing gel.
Although these references demonstrate that PCR has application to diagnosis and prognosis of certain cancers, this type of analysis is deficient, because it does not permit a high throughput and requires size separation. In addition, there are problems with PCR slippage, causing researchers to shift to tri-tetra-, and higher nucleotide repeat units, making cancer detection more difficult.

Microsatellite markers have also been used for colon cancer detection (L. Cawkwell, et. al., "Frequency of Allele Loss of DCC, p53, RB1, WT1, NF1, NM23, and APC/MCC in Colorectal Cancer Assayed by Fluorescent Multiplex Polymerase Chain Reaction," Br. J. Cancer 70(5): 813-18 (1994)) and for genome mapping (P. Reed, et. al.,"Chromosome-specific Microsatellite Sets for Fluorescent-Based, Semi-Automated Genome Mapping," Nat. Genet. 7(3): 390-95 (1994)). However, the key to such multiplex processes is the ability to perform them in a single reaction tube. Conventional multiplex microsatellite marker approaches require careful attention to primer concentrations and amplification conditions. Although PCR products can be pooled in sets, this requires a prerun on agarose gels to insure that the mixture has about equal amounts of DNA in each band.

Human Identification PCR has also been used for human identification, such as paternity testing, criminal investigations, and military personnel identification. A.
Syvanen et. al.,"Identification of Individuals by Analysis of Biallelic DNA Markers, Using PCR and Solid-Phase Mini-Sequencing" Am. J. Hum. Genet. 52(1): 46-59 (1993) describes a mini-sequencing approach to human identification. The technique requires PCR amplification of individual markers with at most 4 PCR reactions being carried out at a time in a single PCR tube. Mini-sequencing is carried out to determine individual polymorphisms.

Coupled Processes G. Deng, et. al.,"An Improved Method of Competitive PCR for Quantitation of Gene Copy Number," Nucl. Acids Res. 21: 4848-49 (1993) describes a competitive PCR process. Here, two PCR steps are utilized with different sets of primers being used for each gene and its equivalent standard.
T. Msuih, et. al., "Novel, Ligation-Dependent PCR Assay for Detection of Hepatitis C. Virus in Serum," J. Clin Microbio. 34: 501-07 (1996) and Y. Park, et. al., "Detection of HCV RNA Using Ligation-Dependent Polymerase Chain Reaction in Formalin-Fixed Paraffin-Embedded Liver Tissue"
(submitted) describe the use of a LDR/PCR process in work with RNA.
The present invention is directed to the detection of nucleic acid sequence differences using coupled LDR and PCR processes. The present invention can be carried out in one of the following 3 embodiments: (1) LDR
coupled to PCR; (2) primary PCR coupled to secondary PCR coupled to LDR;
and (3) primary PCR coupled to secondary PCR. Each of these embodiments have particular applicability in detecting certain characteristics. However, each requires the use of coupled reactions for multiplex detection of nucleic acid sequence differences where oligonucleotides from an early phase of each process contain sequences which may be used by oligonucleotides from a later phase of the process.

1. Primary PCR/Secondary PCR/LDR Process One aspect of the present invention relates to a method for identifying two or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in a plurality of target nucleotide sequences. This method involves a first polymerase chain reaction phase, a second polymerase chain reaction phase, and a ligase detection reaction phase. This process involves analyzing a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences.
In the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided. Each group comprises one or more primary oligonucleotide primer sets with each set having a first nucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence in the sample. The polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products in the same group or groups. The primary oligonucleotide primers, the sample, and the polymerase are blended to form a primary polymerase chain reaction mixture.
The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as substantially described above. During hybridization, target-specific portions of the primary oligonucleotide primers hybridize to the target nucleotide sequences. The extension treatment causes hybridized primary oligonucleotide primers to be extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primers are hybridized.

Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second cycle have the secondary primer-specific portions on their 5' ends and the complement of primer-specific portion on their 3' ends.
Next, there is a second polymerase chain reaction phase. This phase involves providing one or a plurality of secondary oligonucleotide primer sets. Each set has a first secondary oligonucleotide primer containing the same sequence as the 5' upstream portion of the first primary oligonucleotide primer, and a second secondary oligonucleotide primer containing the same sequence as the 5' upstream portion of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide complementary to the first secondary primer. A set of secondary oligonucleotide primers may be used to amplify all of the primary extension products in a given group. The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles having a denaturation treatment, a hybridization treatment, and an extension treatment, as substantially set forth above. During the hybridization treatment, the secondary oligonucleotide primers hybridize to the complementary sequences present on the primary extension products but not to the original target sequence. The extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products.
The last phase of this aspect of the present invention involves a ligase detection reaction process. Here, a plurality of oligonucleotide probe sets are provided where each set has a first oligonucleotide probe, having a secondary extension product-specific portion and a detectable reporter label, and a second oligonucleotide probe, having a secondary extension product-specific portion.
The oligonucleotide probes in a particular set are suitable for ligation together when hybridized adjacent to one another on a complementary secondary extension product-specific portion. However, there is a mismatch which interferes with such ligation when the oligonucleotide probes are hybridized to any other nucleotide sequence present in the sample. The ligation product of oligonucleotide probes in a particular set may be distinguished from either probe or other ligation products.
The plurality of oligonucleotide probe sets, the secondary extension products, and a ligase are blended to form a ligase detection reaction mixture.
The ligase detection reaction mixture is subjected to one or more ligase detection reaction cycles having a denaturation treatment and hybridization treatment substantially as described above. In the hybridization treatment, the oligonucleotide probe sets hybridize at adjacent positions in a base-specific manner to the respective secondary extension products if present. As a result, adjacent probes ligate to one another to form a ligation product sequence containing the detectable reporter label and the secondary extension product-specific portions connected together. The oligonucleotide probe sets may hybridize to nucleotide sequences other than their respective complementary secondary extension products but do not ligate together due to the presence of one or more mismatches and individually separate during the denaturation treatment. Following the ligase detection reaction cycles, the reporter labels of the ligation product sequences are detected which indicates the presence of one or more target nucleotide sequences in the sample.
The primary PCR/secondary PCR/LDR process of the present invention provides significant advantages over the use of PCR alone in the multiplex detection of single nucleotide and tandem repeat polymorphisms.
As noted above, the use of PCR alone requires heavy optimization of operating conditions in order to conduct multiplex detection procedures.

Moreover, the quantity of oligonucleotide primers must be increased to detect greater numbers of target nucleotide sequences. However, as this occurs, the probability of target independent reactions (e.g., the primer-dimer effect) increases. In addition, the mutations must be known, false positives may be generated by polymerase extension off of normal template, closely-clustered sites due to interference of overlapping primers cannot undergo multiplex detection, single base or small insertions and deletions in small repeat sequences cannot be detected, and quantification of mutant DNA in high background of normal DNA is difficult. As a result, the number of target nucleotide sequences detected in a single multiplex PCR process is limited.
Direct sequencing requires enrichment of mutant samples in order to correct sequences, requires multiple reactions for large genes containing many exons, requires electrophoretic separation of products, is time consuming, and cannot be used to detect mutant DNA in less than 5% of background of normal DNA. When mini-sequencing, the mutation must be known, closely-clustered sites due to interference of overlapping primers cannot undergo multiplex detection, single base or small insertions and deletions in small repeat sequences cannot be detected, and four separate reactions are required. For allele-specific oligonucleotide hybridization ("ASO"), the mutation must be known, hybridization and washing conditions must be known, cross-reactivity is difficult to prevent, closely-clustered sites due to interference of overlapping primers cannot undergo multiplex detection, and mutant DNA cannot be detected in less than 5% of background of normal DNA. Primer-mediated RFLP requires electrophoretic separation to distinguish mutant from normal DNA, is of limited applicability to sites that may be converted into a restriction site, requires additional analysis to determine the nature of the mutation, and is difficult to use where the mutant DNA is in a high background of normal DNA. Single strand conformational polymorphism analysis ("SSCP") requires electrophoretic separation to distinguish mutant conformer from normal conformer, misses 30% of possible mutations, requires additional analysis to determine the nature of the mutation, and cannot distinguish mutations from silent polymorphisms. With dideoxynucleotide finger printing ("ddF"), it is difficult to detect mutations in a high background of normal DNA, electrophoretic separation is required to distinguish mutant conformer from normal conformer, additional analysis must be used to determine the nature of the mutation, and mutations cannot be distinguished from silent polymorphisms.
Denaturing gradient gel electrophoresis ("DGGE") must electrophoretically separate mutant conformer from normal conformer, misses 30% of possible mutations, requires additional analysis to determine the nature of the mutation, cannot distinguish mutations from silent polymorphisms, and imposes technical challenges to reproducing previously achieved results. RNase mismatch cleavage requires additional analysis to determine the nature of the mutation, requires analysis of both strands to exclude RNase-resistant mismatches, and imposes difficulty in detecting mutations in a high background of normal DNA. Chemical mismatch cleavage cannot detect mutant DNA in less than 5% of background of normal DNA, and requires an analysis of both strands to detect all mutations.
For T4 Endo VII mismatch cleavage, additional analysis is needed to determine the nature of the mutation, mutations cannot be distinguished from silent polymorphisms, endonuclease cleaves control DNA which necessitates careful interpretation of results, and it is difficult to detect mutations in a high background of normal DNA.
These problems are avoided in the primary PCR/secondary PCR/LDR process of the present invention which combines the sensitivity of PCR
with the specificity of LDR. The primary PCR phase produces primary extension products with a secondary primer-specific portion. This initial phase is carried out under conditions effective to maximize production of primary extension products without obtaining the adverse effects sometimes achieved in a PCR-only process.
In particular, the primary PCR phase of the present invention is carried out with 15 to 20 PCR cycles and utilizes less primer than would be utilized in a PCR-only process. The primary PCR phase of the present invention produces extension products in a varied and unpredictable way, because some target nucleotide sequences will be amplified well, while others will not. However, in the secondary PCR phase, all of the primary extension products are amplified approximately equally, because they all have the same secondary primer-specific portions. Target nucleotide sequences originally present in the sample will not be amplified by the secondary PCR phase, because such sequences do not contain a secondary primer-specific portion. As a result, the primary PCR/secondary PCR/LDR process of the present invention is able to achieve multiplex detection of hundreds of nucleotide sequence differences in a single tube without undue customization of operating conditions for each particular sample being analyzed.
Since the selection of mutant sequences is mediated by LDR rather than PCR, the primary PCR/secondary PCR/LDR process is less susceptible to false-positive signal generation. In addition, the primary PCR/secondary PCR/LDR process allows detection of closely-clustered mutations, detection of single base or small insertions and deletions in small repeat sequences, quantitative detection of less than 1 % mutations in high background of normal DNA, and detection of ligation product sequences using addressable arrays. The only significant requirements are that the mutations be known and that a multitude of oligonucleotides be synthesized.
The ability to detect single nucleotide and tandem repeat polymorphisms is particularly important for forensic DNA identification and diagnosis of genetic diseases.

II. LDR/PCR Process A second aspect of the present invention relates to a method for identifying one or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in a plurality of target nucleotide sequences. This method has a ligase detection reaction phase followed by a polymerase chain reaction phase. This method involves providing a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences.
In the ligase detection reaction phase, one or more oligonucleotide probe sets are provided. Each set has a first oligonucleotide probe, having a target-specific portion and a 5' upstream primer-specific portion, and a second oligonucleotide probe, having a target-specific portion and a 3' downstream primer-specific portion. The oligonucleotide probes in a particular set are suitable for ligation together when hybridized adjacent to one another on a corresponding target nucleotide sequence. However, there is a mismatch which interferes with such ligation when they are hybridized to any other nucleotide sequence present in the sample. The sample, the plurality of oligonucleotide probe sets, and a ligase are blended together to form a ligase detection reaction mixture.
The ligase detection reaction mixture is subjected to one or more ligase detection reaction cycles. These cycles include a denaturation treatment and a hybridization treatment. In the denaturation treatment, any hybridized oligonucleotides are separated from the target nucleotide sequences. The hybridization treatment causes the oligonucleotide probe sets to hybridize at adjacent positions in a base-specific manner to their respective target nucleotide sequences if present in the sample. Once hybridized, the oligonucleotide probe sets ligate to one another to form a ligation product sequence. This product contains the 5' upstream primer-specific portion, the target-specific portions connected together, and the 3' downstream primer-specific portion. The ligation product sequence for each set is distinguishable from other nucleic acids in the ligase detection reaction mixture. The oligonucleotide probe sets hybridized to nucleotide sequences in the sample other than their respective target nucleotide sequences but do not ligate together due to a presence of one or more mismatches and individually separate during the subsequent denaturation treatment.

In the polymerase chain reaction, one or a plurality of oligonucleotide primer sets are provided. Each set has an upstream primer containing the same sequence as the 5' upstream primer-specific portion of the ligation product sequence and a downstream primer complementary to the 3' downstream primer-specific portion of the ligation product sequence, where one primer has a detectable reporter label. The ligase detection reaction mixture is blended with the one or a plurality of oligonucleotide primer sets and the polymerase to form a polymerase chain reaction mixture.
The polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles which include a denaturation treatment, a hybridization treatment, and an extension treatment. During the denaturation treatment, hybridized nucleic acid sequences are separated. The hybridization treatment causes primers to hybridize to their complementary primer-specific portions of the ligation product sequence. During the extension treatment, hybridized primers are extended to form extension products complementary to the sequences to which the primers are hybridized. In a first cycle of the polymerase chain reaction phase, the downstream primer hybridizes to the 3' downstream primer-specific portion of the ligation product sequence and is extended to form an extension product complementary to the ligation product sequence. In subsequent cycles the upstream primer hybridizes to the 5' upstream primer-specific portion of the extension product complementary to the ligation product sequence and the downstream primer hybridizes to the 3' downstream portion of the ligation product sequence.
Following the polymerase chain reaction phase of this process, the reporter labels are detected and the extension products are distinguished to indicate the presence of one or more target nucleotide sequences in the sample.
One embodiment of the LDR/PCR process of the present invention achieves improved results over the use of LDR alone in measuring the number of gene copies in a cell (i.e. gene dosage). When LDR alone is utilized, it is difficult to produce sufficient target copies which are needed ultimately to quantify a plurality of genes.
In another embodiment of the LDR/PCR process of the present invention, the LDR phase ligation product sequences are produced in a ratio proportional to the ratio of the genes from which they were derived within the sample. By incorporation of the same primer-specific portions in the oligonucleotide probes for the LDR phase, the PCR phase amplifies ligation product sequences to the same degree so that their proportionality is maintained.
Target sequences originally found in the sample being analyzed are not amplified by the PCR phase, because such target sequences do not contain PCR primer-specific portions. In addition, since only the oligonucleotide primers for the PCR
phase have reporter labels, only extension products with those labels will be detected.
Determination of variation in gene dosage is important in a number of biomedical applications.
Males differ in gene dosage from females for those genes located on the X chromosome, women having two copies while men have one copy. Women may be carriers of deletions along the X chromosome. If the deleted region of the X chromosome included one or more genes, then the woman has only one copy of these genes in the corresponding, non-deleted area of the other X chromosome.
The result (having one copy of an X-linked gene) is similar to the situation in male cells and is usually tolerated without manifestations of an inherited disorder.
However, if the woman's son inherits her deleted X chromosome, he will have no copies of the genes in the deletion region and suffer from the X-linked disorder related to the absence of the gene. The detection of chromosomal deletions, therefore, is one application of the LDR/PCR process of the present invention.
Congenital chromosomal disorders occur when a fertilized egg has an abnormal compliment of chromosomes. The most common congenital chromosomal disorder is Down Syndrome, which occurs when there is an additional chromosome 21 in each cell, designated 47,XX+21 or 47,XY+21. The LDR/PCR process of the present invention can be designed to identify congenital chromosomal disorders.
The LDR/PCR process of the present invention is also useful for distinguishing polymorphisms in mono-nucleotide and di-nucleotide repeat sequences. It will also be useful in distinguishing minor populations of cells containing unique polymorphisms for detection of clonality.
The LDR/PCR process can be used with both gel and non-gel (i.e.
DNA array) technologies. It allows multiplex analysis of many gene amplifications and deletions simultaneously, allows quantitative analysis, and does not require an external standard. The only relatively minor challenge presented by the LDR/PCR process is that it is difficult to use in determining the boundaries of large deletions in chromosomes.
By contrast, microsatellite marker analysis cannot be used to detect small regions that are deleted or amplified, is not compatible with simultaneous detection of amplified regions, and depends on the availability of informative markers. Competitive PCR (i.e. differential PCR) cannot be used in a multiplex format to detect several deletions and amplifications simultaneously, and is not particularly accurate. Southern hybridization is time consuming, labor intensive, is not amenable to multiplexing due to the need for multiple steps for each probe tested, and requires large quantities of DNA. Fluorescent in situ hybridization ("FISH") requires specialized expertise, is time consuming, and requires large probes to analyze for suspected deleted or amplified regions. Thus, the LDR/PCR
process of the present invention constitutes a significant advance over prior processes.

III. Primary PCR/Secondary PCR Process A third aspect of the present invention also involves a method for identifying two or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in one or more target nucleotide sequences. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
For the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided where each group comprises two or more primary oligonucleotide primer sets. Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. The polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups. The primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.
The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
During the hybridization treatment, the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences. In the extension treatment, the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized.
Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second and subsequent cycles have the secondary primer-specific portions on their 5' ends and the complement of primer-specific portion on their 3' ends.
In the second polymerase chain reaction phase of this aspect of the present invention, one or a plurality of secondary oligonucleotide primer sets are provided. Each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide complementary to the first secondary primer. A set of secondary oligonucleotide primers amplify the primary extension products in a given group.
The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. In the liybridization treatment, the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products. After subjecting the secondary polymerase chain reaction mixture to the two or more polymerase chain reaction cycles, the labelled secondary extension products are detected. This indicates the presence of one or more target nucleotide sequences in the sample.
The primary PCR/secondary PCR process of the present invention provides significant advantages over Southern hybridization, competitive PCR, and microsatellite marker analysis in detecting nucleotide deletions which cause a loss of heterozygosity. Although Southern hybridization is more accurate than competitive PCR, it is quite labor intensive, requires large amounts of DNA, and neither technique can be multiplexed. Current multiplex microsatellite marker approaches require carefuI attention to primer concentrations and amplification conditions.
The primary PCR/secondary PCR process of the present invention overcomes these difficulties encountered in the prior art. In the primary PCR
phase, the primary oligonucleotide primers flank dinucleotide or other repeat sequences and include a secondary primer-specific portion. The primary PCR
phase is carried out at low concentrations of these primers to allow several loci to undergo amplification at the same time. The secondary PCR phase causes amplification to continue at the same rate with target-specific secondary primers being selected to space one set of microsatellite markers from the adjacent set.
The primary PCR/secondary PCR process can be used to carry out multiplex detection in a single PCR tube and with single gel lane analysis.
This aspect of the present invention is useful in carrying out a microsatellite marker analysis to identify nucleotide deletions in a gene.
Such multiplex detection can be carried out in a single reaction tube. However, the primary PCR/secondary PCR process cannot distinguish amplifications from deletions, so, when making such distinctions, this process must be used in conjunction with the above-described LDR/PCR process or a differential PCR


Figure 1 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of germline mutations, such as point mutations, by electrophoresis or capture on an addressable array. Note that the term "zip-code" which appears in Figure 1 and other drawings refers to a sequence specific to a subsequently used primer or probe but not to either the target sequence or other genome sequences.
Figure 2 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of biallelic polymorphisms by electrophoresis or capture on an addressable array.
Figure 3 is a flow diagram depicting a primary PCR/secondary PCR/LDR process for detection of cancer-associated mutations by electrophoresis or capture on an addressable array.
Figure 4 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of biallelic polymorphisms.
Figure 5 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of allelic differences using LDR oligonucleotide probes which distinguish all possible bases at a given site.
Figure 6 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of the presence of any possible base at two nearby sites using LDR oligonucleotide probes whicli distinguish all possible bases at a given site.
Figure 7 is a schematic diagram depicting a primary PCR/secondary PCR/LDR process for detection of cancer-associated mutations at adjacent alleles.

Figure 8 is a flow diagram depicting an LDR/PCR process with and without restriction endonuclease digestion using electrophoresis detection.
Figure 9 is a flow diagram depicting an LDR/PCR process using detection on an addressable array using gene-specific addresses.
Figure 10 is a schematic diagram depicting an LDR/PCR process for multiplex detection of gene amplifications and deletions.
Figure 11 is a schematic diagram depicting an allele specific problem for an LDR/PCR process.
Figure 12 is a schematic diagram depicting a solution for the allele specific problem for an LDR/PCR process which is shown in Figure 11.
Figure 13 is a flow diagram depicting an LDR/PCR process with an intermediate exonuclease digestion phase for detection of biallelic polymorphisms by electrophoresis or capture on an addressable array.
Figure 14 is a flow diagram depicting an LDR/PCR process with an intermediate exonuclease digestion phase for detection of cancer-associated mutations by electrophoresis or capture on an addressable array.
Figure 15 is a schematic diagram depicting an LDR/PCR process with an intermediate exonuclease digestion phase for detection of allele specific mutations and polymorphisms.
Figure 16 is a schematic diagram depicting an LDR/PCR process with an intermediate exonuclease digestion phase for detection of mononucleotide repeat polymorphisms.
Figure 17 is a schematic diagram depicting an LDR/PCR process with an intermediate exonuclease digestion phase for detection of mononucleotide repeat polymorphisms which are in low abundance.
Figure 18 is a flow diagram depicting the detection of polymorphisms using an LDR/PCR process with an intermediate sequenase extension phase and a uracil N-glycosylase digestion phase after the LDR phase and before the PCR phase and with detection by electrophoresis or an addressable array.
Figure 19 is a flow diagram depicting the detection of cancer using an LDR/PCR process with an intermediate sequenase extension phase and a uracil N-glycosylase digestion phase after the LDR phase and before the PCR phase and with detection by electrophoresis or an addressable array.
Figure 20 is a schematic diagram depicting detection of mononucleotide repeats using an LDR/PCR process with an intermediate sequenase amplification phase and a uracil N-glycosylase digestion phase after the LDR phase and before the PCR phase.
Figure 21 is a schematic diagram depicting detection of mononucleotide repeat polymorphisms which are in low abundance using an LDR/PCR process with an intermediate sequenase amplification phase and a uracil N-glycosylase digestion phase after the LDR phase and before the PCR phase.
Figure 22 is a flow diagram depicting a primary PCR/secondary PCR process for detection of microsatellite repeats.
Figure 23 is a schematic diagram depicting a primary PCR/secondary PCR process for multiplex detection of insertions and deletions in microsatellite repeats.
Figure 24 shows the design of LDR oligonucleotide probes for quantification of gene amplifications and deletions in an LDR/PCR process.
Figures 25A-D show electropherogram results for an LDR/PCR
Figures 26A-C show electropherogram results for an LDR/PCR
process of ErbB, G6PD, Int2, p53, and SOD gene segments from normal human female DNA and from DNA of the breast cancer cell line ZR-75-30 and the gastric carcinoma cell line SKGT-2. The ErbB gene is known to be amplified in the cancer cell lines. Target-specific ligation product sequences of 104 bp are generated in 10 cycles (94 C for 30 sec, 65 C for 4 min) of LDR using 500 femtomoles of each ligation primer, 50 ng of genomic DNA, 124 units of Thermus thermophillus ("Tth ") ligase, 2 l of lOX buffer (0.2 M Tris, pH 8.5 and 0.1 M
MgCl2), 2 l of 10 mM NAD, and 1 l of 200 mM DTT in a volume of 20 l.
The ligation products are proportionally amplified in 26 cycles (94 C for 15 sec, 60 C for 50 sec) of PCR by the addition of 30 l of a solution containing 5 l lOX Stoffel buffer (Perkin Elmer), 25 picomoles of each oligonucleotide primer, 2.5 units of Taq polymerase Stoffel fragment, and 8 l of a solution 5 mM in each dNTP. After amplification, the products are digested with HaeIII and HinP1I to generate FAM-labeled products of 58 bp (ErbB (i.e. HER-2/neu/erbB oncogene)), 61 bp (G6PD), 67 bp (Int2 (i.e. int-2 oncogene)), 70 bp (p53) and 76 bp (SOD).
These products are separated and analyzed on a 373A DNA sequencer using the Genescan 672 software package (Applied Biosystems, Inc., Foster City, Calif.).
Results are displayed as electropherograms such that peak heights and areas reflect the amounts of the PCR products. In Figure 26A, the gene dosage determination for the five loci in normal human female DNA is shown. The peak heights and areas for G6PD, Int2, p53, and SOD are very similar. The peak height and area for ErbB is consistently small in normal genomic DNA. In Figure 26B, the peak height and area for ErbB are elevated when gene dosage is investigated in ZR-30, a cell line with known ErbB amplification. In Figure 26C, the gastric cell line, SKGT-2 shows dramatic amplification of the ErbB gene and a modest amplification of Int2. The G6PD gene peak may be embedded in the large ErbB
Figures 27A-C show electropherogram results for an LDR/PCR
process to determine whether amplification of ErbB affected the relative peak heights of the other LDR oligonucleotide probes and PCR oligonucleotide primers for G6PD, Int2, p53, and SOD. In Figure 27A, the gene dosage determination foi-the four loci in normal human female DNA is shown. Peak heights and areas for G6PD, Int2, p53, and SOD are similar, as they were in the experiment using all five LDR primers. In Figure 27B, G6PD, Int2, and SOD analyzed in the ZR-75-30 breast cancer cell line show similar relative peak heights, comparable to their appearance in normal female DNA. The peak height for p53 is reduced, suggesting the deletion of this gene in a portion of the cells in this cell line. In Figure 27C, in the gastric carcinoma cell line, SKGT-2, G6PD, and p53 show comparable peak heights. The Int2 peak height remains relatively high, as it was in the experiment using all five LDR oligonucleotide probes. Thus, the LDR and PCR amplification of each product appears to be independent of the other products during the course of the experiment.
Figures 28A-C show electropherogram results for the PCR phase of a primary PCR/secondary PCR/LDR process. Multiplex PCR amplification of 12 loci using primary PCR oligonucleotide primers produces approximately equal amounts of product. Over 80 gene regions with single-base polymorphisms were identified from the Human Genome Database. Twelve of these (see Table 10 and Figures 29A-H) were amplified in a primary PCR phase as follows: Long primary PCR oligonucleotide primers were designed to have gene-specific 3' ends and 5' ends complementary to one of two sets of secondary PCR oligonucleotide primers.
The upstream primary PCR oligonucleotide primers were synthesized with either FAM (i.e. 6-carboxyfluorescein; fluorescent dye used in sequencing and mutation detection) or TET (i.e. tetrachlorinated-6-carboxyfluorescein; fluorescent dye used in sequencing/mutation detection) fluorescent labels. All 24 base long primary PCR oligonucleotide primers were used at low concentration (2 picomole of each primer in 20 l) in a 15 cycle primary PCR phase. After this, the two sets of secondary PCR oligonucleotide primers were added at higher concentrations (25 picomoles of each) and the secondary PCR phase was conducted for an additional 25 cycles. The products were separated on a 373 DNA Sequencer (Applied Biosystems). Panel A shows the electropherogram results for the FAM- and TET-labelled products combined. Panel B shows the FAM-labelled products alone.
Panel C shows the TET-labelled products alone. The process produces similar amounts of multiplexed products without the need to adjust carefully primer concentrations or PCR conditions.
Figures 29A-H show electropherogram results for the LDR phase of a primary PCR/secondary PCR/LDR process in detecting 12 biallelic genes for forensic identification. The primary and secondary PCR phases for the 12 polymorphic genes were performed as described in Fig. 28A-C. However, the secondary PCR oligonucleotide primers were not fluorescently labelled. The secondary PCR process extension products were diluted into a ligase buffer containing 36 LDR oligonucleotide probes (one common and two discriminating primers for each locus). LDR oligonucleotide probe sets were designed in two ways: (i) allele-specific oligonucleotide probes were of the same length but contained either the FAM or TET label; or (ii) the allele-specific oligonucleotide probes were both labelled with HEX (i.e. hexachlorinated-6-carboxyfluorescein;
fluorescent dye used in sequencing and mutation detection) but differed in length by two basepairs. After 20 cycles of the LDR phase, the ligation product sequences were resolved using a 10% polyacrylamide sequencing gel on a 373 DNA Sequencer (Applied Biosystems). Panel A and E show the 12 loci PCR/LDR profiles of two individuals. Panels B, C, and D show, respectively, the FAM, TET, and HEX data for the individual in panel A. Panels F, G, and H
show, respectively, the FAM, TET, and HEX data for the individual in panel E.
The individual in panel A is homozygous only at locus 6 (ALDOB (i.e.
aldolase B)) and locus 8 (IGF (i.e. insulin growth factor)). The individual in panel E is heterozygous only at loci 3 (C6 (i.e. complement component C6)), 5 (NF1 (i.e. neurofibromatosis)), 6 (ALDOB), and 8 (IGF). This demonstrates that the primary PCR/primary PCR/LDR process can simultaneously distinguish both homozygous and heterozygous genotypes at multiple positions.


1. Primary PCR/Secondary PCR/LDR Process One aspect of the present invention relates to a method for identifying two or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in a plurality of target nucleotide sequences. This method involves a first polymerase chain reaction phase, a second polymerase chain reaction phase, and a ligase detection reaction phase. This process involves analyzing a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences.
In the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided. Each group comprises one or more primary oligonucleotide primer sets with each set having a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. The polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products in the same group or groups. The primary oligonucleotide primers, the sample, and the polymerase are blended to form a primary polymerase chain reaction mixture.
The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as substantially described above. During hybridization, target-specific portions of the primary oligonucleotide primers hybridize to the target nucleotide sequences. The extension treatment causes hybridized primary oligonucleotide primers to be extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primers are hybridized.
Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second cycle have the secondary primer-specific portions on their 5' ends and the complement of the primer-specific portion on their 3' ends.
Next, there is a second polymerase chain reaction phase. This phase involves providing one or a plurality of secondary oligonucleotide primer sets. Each set has a first secondary oligonucleotide primer containing the same sequence as the 5' upstream portion of the first primary oligonucleotide primer, and a second secondary oligonucleotide primer containing the same sequence as the 5' upstream portion of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide complementary to the first secondary primer. A set of secondary oligonucleotide primers may be used to amplify all of the primary extension products in a given group. The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.

The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles having a denaturation treatment, a hybridization treatment, and an extension treatment, as substantially set forth above. During the hybridization treatment, the secondary oligonucleotide primers hybridize to complementary sequences present on the primary extension products but not to the original target sequence. The extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products.
The last phase of this aspect of the present invention involves a ligase detection reaction process. Here, a plurality of oligonucleotide probe sets are provided where each set has a first oligonucleotide probe, having a secondary extension product-specific portion and a detectable reporter label, and a second oligonucleotide probe, having a secondary extension product-specific portion.
The oligonucleotide probes in a particular set are suitable for ligation together when hybridized adjacent to one another on a complementary secondary extension product-specific portion. However, there is a mismatch which interferes with such ligation when the oligonucleotide probes are hybridized to any other nucleotide sequence present in the sample. The ligation product of oligonucleotide probes in a particular set may be distinguished from either individual probes or other ligation products. The plurality of oligonucleotide probe sets, the secondary extension products, and a ligase are blended to form a ligase detection reaction mixture.
The ligase detection reaction mixture is subjected to one or more ligase detection reaction cycles having a denaturation treatment and hybridization treatment substantially as described above. In the hybridization treatment, the oligonucleotide probe sets hybridize at adjacent positions in a base-specific manner to the respective secondary extension products if present. As a result, adjacent probes ligate to one another to form a ligation product sequence containing the detectable reporter label and the secondary extension product-specific portions connected together. The oligonucleotide probe sets may hybridize to nucleotide sequences other than the respective complementary secondary extension products but do not ligate together due a presence of one or more mismatches and individually separate during the denaturation treatment. Following the ligation detection reaction cycles, the reporter labels of the ligation product sequences are detected which indicates the presence of one or more target nucleotide sequences in the sample.
Figures 1, 2, and 3 show flow diagrams of the primary PCR/secondary PCR/LDR process of the present invention utilizing either of two detection procedures. One alternative involves use of capillary electrophoresis or gel electrophoresis and a fluorescent quantification procedure. Alternatively, detection can be carried out by capture on an array of capture oligonucleotide addresses and fluorescent quantification. Figure 1 relates to detection of germline mutations (e.g., a point mutation), while Figure 2 detects biallelic polymorphisms, and Figure 3 shows the detection of cancer-associated mutations.
Figure 1 depicts the detection of a germline point mutation. In step 1, after DNA sample preparation, multiple exons are subjected to primary PCR amplification using Taq (i.e. Thermus aquaticus) polymerase under hot start conditions with oligonucleotide primers having a target-specific portion and a secondary primer-specific portion. At the end of the primary PCR phase, Taq polymerase may be inactivated by heating at 100 C for 10 min or by a freeze/thaw step. The products of the primary PCR amplification phase are then subjected in step 2 to secondary PCR amplification using Taq polymerase under hot start conditions with the secondary oligonucleotide primers. At the end of the secondary PCR phase, Taq polymerase may be inactivated by heating at 100 C
for 10 min or by a freeze/thaw step. In step 3, products of the secondary PCR
phase are then diluted 20-fold into fresh LDR buffer containing LDR
oligonucleotide probes containing allele-specific portions and common portions.
Step 4 involves the LDR phase of the process which is initiated by addition of Taq ligase under hot start conditions. During LDR, oligonucleotide probes ligate to their adjacent oligonucleotide probes only in the presence of target sequence which gives perfect complementarity at the junction site.
The products may be detected in two different formats. In the first format 5a, fluorescently-labeled LDR probes contain different length poly A or hexaethylene oxide tails. Thus, each ligation product sequence (resulting from ligation of two probes hybridized on normal DNA) will have a slightly different length and mobility such that several ligation product sequences yield a ladder of peaks. Thus, each ligation product (resulting from ligation of two probes hybridized on normal DNA) will have a slightly different length and mobility such that several ligation product sequences yield a ladder of peaks. A germline mutation would generate a new peak on the electropherogram. Alternatively, the LDR probes may be designed such that the germline mutation ligation product sequence migrates with the same mobility as a normal DNA ligation product sequence, but it is distinguished by a different fluorescent reporter. The size of the new peak will approximate the amount of the mutation present in the original sample; 0% for homozygous normal, 50% for heterozygous carrier, or 100% for homozygous mutant. In the second format 5b, each allele-specific probe contains e.g., 24 additional nucleotide bases on their 5' ends. These sequences are unique addressable sequences which will specifically hybridize to their complementary address sequences on an addressable array. In the LDR reaction, each allele-specific probe can ligate to its adjacent fluorescently labeled common probe in the presence of the corresponding target sequence. Ligation product sequences corresponding to wild type and mutant alleles are captured on adjacent addresses on the array. Unreacted probes are washed away. The black dots indicate 100%
signal for the wild type allele. The white dots indicate 0% signal for the mutant alleles. The shaded dots indicate the one position of germline mutation, 50%
signal for each allele.

Figure 2 depicts the detection of biallelic polymorphisms. In step 1, after DNA sample preparation, multiple exons are subjected to primary PCR
amplification using Taq polymerase under hot start conditions with oligonucleotide primers having a target-specific portion and a secondary primer-specific portion.
The products of the primary PCR amplification phase are then subjected in step to secondary PCR amplification using Taq polymerase under hot start conditions with the secondary oligonucleotide primers. At the end of the secondary PCR
phase, Taq polymerase may be inactivated by heating at 100 C for 10 min or by a freeze/thaw step. In step 3, products of the secondary PCR phase are then diluted 20-fold into fresh LDR buffer containing LDR oligonucleotide probes containing allele-specific portions and common portions. Step 4 involves the LDR
phase of the process which is initiated by addition of Taq ligase under hot start conditions. During LDR, oligonucleotide probes ligate to their adjacent oligonucleotide probes only in the presence of target sequence which gives perfect complementarity at the junction site. In the first format 5a, fluorescently-labeled LDR probes contain different length poly A or hexaethylene oxide tails. Each ligation product sequence will have a slightly different length and mobility, such that several LDR products yield a ladder of peaks. Alternatively, the LDR
probes may be designed such that the ligation products for polymorphic alleles migrate at the same position but are distinguished by different fluorescent reporter groups.
The size of the peaks will approximate the amount of each allele. In the second format 5b, each oligonucleotide probe contains unique addressable sequences with e.g., 24 additional nucleotide bases on their 5' ends. These sequences will specifically hybridize to their complementary address sequences on an array of capture oligonucleotides. In the LDR phase, each allele-specific probe can ligate to its adjacent fluorescently labeled common probe in the presence of corresponding target sequence. Ligation product sequences corresponding to each allele are captured on the array, while unligated oligonucleotide probes are washed away. The black dots indicate that both chromosomes have a given allele, the white dots show that neither chromosome has that allele, and the shaded dots indicate that one chromosome has a given allele.
Figure 3 depicts the detection of cancer-associated mutation. In step 1, after DNA sample preparation, multiple exons are subjected to primary PCR
amplification using Taq polymerase under hot start conditions with oligonucleotide primers having a target-specific portion and a secondary primer-specific portion.
The products of the primary PCR amplification phase are then subjected in step to secondary PCR amplification using Taq polymerase under hot start conditions with the secondary oligonucleotide primers. At the end of the secondary PCR
phase, Taq polymerase may be inactivated by heating at 100 C for 10 min or by a freeze/thaw step. Fluorescent quantification of PCR products can be achieved using capillary or gel electrophoresis in step 3. In step 4, the products are spiked with a 1/100 dilution of marker DNA (for each of the fragments). This DNA is homologous to wild type DNA, except it contains a mutation which is not observed in cancer cells, but which may be readily detected with the appropriate LDR probes. In step 5, the mixed DNA products in products of the secondary PCR phase are then diluted 20-fold into fresh LDR buffer containing LDR
oligonucleotide probes containing allele-specific portions and common portions.
Step 6 involves the LDR phase of the process which is initiated by addition of Taq ligase under hot start conditions. During LDR, oligonucleotide probes ligate to their adjacent oligonucleotide probes only in the presence of target sequence which gives perfect complementarity at the junction site.
The products may be detected in the same two formats discussed above. In the format of step 7a, products are separated by capillary or gel electrophoresis, and fluorescent signals are quantified. Ratios of mutant peaks to marker peaks give the approximate amount of cancer mutations present in the original sample divided by 100. In the format of step 7b, products are detected by specific hybridization to complementary sequences on an addressable array.
Ratios of fluorescent signals in mutant dots to marker dots give the approximate amount of cancer mutations present in the original sample divided by 100.
As shown in Figure 4, two DNA fragments of interest are treated with the primary PCR/secondary PCR/LDR process of the present invention.
Initially, the double stranded DNA molecules are denatured to separate the strands. This is achieved by heating to a temperature of 80-105 C. Low concentrations of primary PCR oligonucleotide primers, containing a 3' target-specific portion (shaded area) and 5' secondary primer-specific portion (black area), are then added and allowed to hybridize to the strands, typically at a temperature of 50-85 C. A thermostable polymerase (e.g., Taq aquaticus polymerase) is also added, and the temperature is then adjusted to 50-85 C
to extend the primer along the length of the nucleic acid to which the primer is hybridized. After the extension phase of the polymerase chain reaction, the resulting double stranded molecule is heated to a temperature of 80-105 C to denature the molecule and to separate the strands. These hybridization, extension, and denaturation steps may be repeated a number of times to amplify the target to an appropriate level.

In the secondary PCR phase, the products of the primary PCR phase are blended with secondary PCR oligonucleotide primers and allowed to hybridize to one another, typically at a temperature of 50-85 C. The secondary oligonucleotide primers are usually used in higher concentrations than are the primary oligonucleotide primers. Taq polymerase is also added, and the temperature is then adjusted to 50-85 C to extend the primer along the length of the primary PCR extension products to which the secondary oligonucleotide primer is hybridized. After the extension phase of the polymerase chain reaction, the resulting double stranded molecule is heated to a teinperature of 80-105 C to denature the molecule and to separate the strands. These hybridization, extension, and denaturation steps may be repeated a number of times to amplify the target to an appropriate level.

Once the secondary PCR phase of the process is completed, the ligation detection reaction phase begins, as shown in Figure 4. After denaturation of the target nucleic acid, if present as a double stranded DNA molecule, at a temperature of 80-105 C, preferably 94 C, ligation detection reaction oligonucleotide probes for one strand of the target nucleotide sequence are added along with a ligase (for example, as shown in Figure 4, a thermostable ligase like Thermus aquaticus ligase). The oligonucleotide probes are then allowed to hybridize to the target nucleic acid molecule and ligate together, typically, at a temperature of 45-85 C, preferably, 65 C. When there is perfect complementarity at the ligation junction, the oligonucleotides can be ligated together. Where the variable nucleotide is T or A, the presence of T in the target nucleotide sequence will cause the oligonucleotide probe with the Fl reporter label to ligate to the common oligonucleotide probe with the 5' poly A tail A,,, and the presence of A in the target nucleotide sequence will cause the oligonucleotide probe with the F2 reporter label to ligate to the common oligonucleotide probe with A. Similarly, where the variable nucleotide is A or G, the presence of T
in the target nucleotide sequence will cause the oligonucleotide probe with F3AA
reporter label (i.e. the F3 reporter label coupled to 2 additional bases forming a 5' poly A spacer) to ligate to the common oligonucleotide probe with the 5' poly A
tail An+4, and the presence of C in the target nucleotide sequence will cause the oligonucleotide probe with the F3 reporter label to ligate to the common oligonucleotide probe with the 5' poly A tail An+4. Following ligation, the material is again subjected to denaturation to separate the hybridized strands. The hybridization/ligation and denaturation steps can be carried out through one or more cycles (e.g., 1 to 50 cycles) to amplify target signals. Equimolar ligation of both F3-labeled oligonucleotides indicates the individual is heterozygous for that locus, whereas ligation of only the F2 labeled oligonucleotides indicates the individual is homozygous for the other locus.

In Figure 4, the poly A,, and poly Ai+4 tails are used where quantification is to be carried out by capillary or gel electrophoresis. The tails of differing length cause the corresponding different ligation product sequences to form bands at different locations in the gel or capillary. The presence of these bands at different locations permit the corresponding nucleotide differences in the DNA being analyzed to be identified. Although ligation product sequences can be distinguished based on the use of different reporter labels, the combination of different reporter labels and different length tails permits greater numbers of nucleotide differences to be distinguished. This is important for multiplex detection processes.

As noted above with respect to Figures 1 to 3, detection can be carried out on an addressable array instead of with gel or capillary electrophoresis.
The use of such addressable arrays require that the poly A tails on the LDR
oligonucleotide probe not containing a reporter label (i.e. tails A. and Ai+4) be replaced with different addressable array-specific oligonucleotide portions.
As explained more fully infra, a solid support is provided with an array of capture oligonucleotides, some of which are complementary to the different addressable array-specific oligonucleotide portions. Hybridization of these portions to their complementary capture oligonucleotide probes indicates the presence of a corresponding nucleotide difference.

Figure 5 is a schematic diagram of a primary PCR/secondary PCR/LDR process, in accordance with the present invention, where any possible base in 2 DNA molecules of interest are distinguished. The primary and secondary PCR processes are carried out in substantially the same way as described for Figure 4. Appearance of fluorescent reporter labels Fl, F2, F3, and F4 in conjunction with the left hand DNA molecule indicates the presence of the A, G, C, and T alleles in the DNA molecule, respectively. As shown in Figure 5, equal amounts of the Fl and F3 reporter labels indicates that the individual in question is heterozygous for the A and C alleles. With respect to analysis of the right hand DNA molecule in Figure 5, the same reporter label is used to indicate the presence of the different alleles; however, on each oligonucleotide probe with the distinguishing bases, there are different 5' poly A tails. More particularly, a 2 unit poly A tail, a 4 unit poly A tail, a 6 unit poly A tail, and an 8 unit poly A tail correspond to the T, C, G, and A alleles in the DNA molecule, respectively. As shown in Figure 5, equal amounts of the Fl reporter label with the A6 and A4 tails indicates that the individual in question is heterozygous for the G and C
Figure 6 is a schematic diagram of a primary PCR/secondary PCR/LDR process, in accordance with the present invention, for detecting the presence of any possible base at two nearby sites in DNA molecules of interest.
The primary and secondary PCR phases are carried out in substantially the same way as described for Figure 4. Here, the LDR probes are able to overlap, yet are still capable of ligating provided there is perfect complementarity at the junction.
This distinguishes LDR from other approaches, such as allele-specific PCR
where overlapping primers would interfere with one another. In Figure 6, the discriminating oligonucleotide probes contain the reporter label with the discriminating base on the 3' end of these probes. The poly A tails are on the 3' end of common oligonucleotide probes. In the left hand DNA molecule, the presence of equal amounts of ligation product sequences with reporter labels Fl and F3 shows that the individual in question is heterozygous for the A and C
alleles in the first position. Similarly, in the second position for the left hand DNA molecule, the presence of ligation product sequences with reporter labels F2, F3, and F4 shows that the individual in question is heterozygous for the G, C, and T alleles. Turning to the right hand DNA molecule, the presence of equal amounts of ligation product sequences with reporter label Fl having the A6 and tails indicates that at the first position, the individual in question is heterozygous for the G and C alleles. In the second position for the right hand DNA
molecule, the presence of the equal amounts of ligation product sequences with reporter label F1 having the Ag and A2 tails indicates that the individual in question is heterozygous for the A and T alleles.
Figure 7 is a schematic diagram depicting the use of the primary PCR/secondary PCR/LDR process of the present invention to detect a low abundance mutation in the presence of an excess of normal sequence. Here, in the left hand DNA molecule is codon 12 of the K-ras gene, sequence GGT, which codes for glycine ("Gly"). A small percentage of the cells contain the G to A
mutation in GAT, which codes for aspartic acid ("Asp"). The LDR probes for wild-type (i.e. normal) sequences are missing from the reaction. If the normal LDR probes (with the discriminating base being G) were included, they would ligate to the common probes and overwhelm any signal coming from the mutant target. Instead, as shown in Figure 7, the existence of a ligation product sequence with fluorescent label Fl and the An+Z tail indicates the presence of the aspartic acid encoding mutant. In the right hand DNA molecule, Figure 7 shows codon 61 of the K-ras gene sequence CAG which codes for glutamine ("Gln"). A small percentage of the cells contain the C to G mutation in GAG, which codes for glutamic acid ("Glu"). Again, the LDR oligonucleotide probes do not include the C and A bases found in the wild type form to avoid overwhelming the mutant signal. For this DNA molecule, the existence of a ligation product sequence with fluorescent label F2 and the Ai+4 tail indicates the presence of the glutamic acid encoding mutant.

U. LDR/PCR Process A second aspect of the present invention relates to a method for identifying one or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in a plurality of target nucleotide sequences. This method has a ligase detection reaction phase followed by a polymerase chain reaction phase. This method involves providing a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences.
In the ligase detection reaction phase, one or more of oligonucleotide probe sets are provided. Each set has a first oligonucleotide probe, having a target-specific portion and a 5' upstream primer-specific portion, and a second oligonucleotide probe, having a target-specific portion and a 3' downstream primer-specific portion. The oligonucleotide probes in a particular set are suitable for ligation together when hybridized adjacent to one another on a corresponding target nucleotide sequence. However, there is a mismatch which interferes with such ligation when they are hybridized to any other nucleotide sequence present in the sample. The sample, the plurality of oligonucleotide probe sets, and a ligase are blended together to form a ligase detection reaction mixture.
The ligase detection reaction mixture is subjected to one or more ligase detection reaction cycles. These cycles include a denaturation treatment and a hybridization treatment. In the denaturation treatment, any hybridized oligonucleotides are separated from the target nucleotide sequences. The hybridization treatment causes the oligonucleotide probe sets to hybridize at adjacent positions in a base-specific manner to their respective target nucleotide sequences if present in the sample. Once hybridized, the oligonucleotide probe sets ligate to one another to form a ligation product sequence. This product contains the 5' upstream primer-specific portion, the target-specific portions connected together, and the 3' downstream primer-specific portion. The ligation product sequence for each set is distinguishable from other nucleic acids in the ligase detection reaction mixture. The oligonucleotide probe sets hybridized to nucleotide sequences in the sample other than their respective target nucleotide sequences but do not ligate together due to a presence of one or more mismatches and individually separate during the denaturation treatment.
In the polymerase chain reaction, one or a plurality of oligonucleotide primer sets are provided. Each set has an upstream primer containing the same sequence as the 5' upstream primer-specific portion of the ligation product sequence and a downstream primer complementary to the 3' downstream primer-specific portion of the ligation product sequence, where one primer has a detectable reporter label. The ligase detection reaction mixture is blended with the one or a plurality of oligonucleotide primer sets and the polymerase to form a polymerase chain reaction mixture.
The polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles whicli include a denaturation treatment, a hybridization treatment, and an extension treatment. During the denaturation treatment, hybridized nucleic acid sequences are separated. The hybridization treatment causes primers to hybridize to their complementary primer-specific portions of the ligation product sequence. During the extension treatment, hybridized primers are extended to form extension products complementary to the sequences to which the primers are hybridized. In a first cycle of the polymerase chain reaction phase, the downstream primer hybridizes to the 3' downstream primer-specific portion of the ligation product sequence and is extended to form an extension product complementary to the ligation product sequence. In subsequent cycles, the upstream primer hybridizes to the 5' upstream primer-specific portion of the extension product complementary to the ligation product sequence and the 3' downstream primer hybridizes to the 3' downstream portion of the ligation product sequence.
Following the polymerase chain reaction phase of this process, the reporter labels are detected and the extension products are distinguished to indicate the presence of one or more target nucleotide sequences in the sample.
Figure 8 is a flow diagram depicting the LDR/PCR process of the present invention with or without restriction endonuclease digestion and using capillary electrophoresis detection. In step 1, a DNA sample is mixed with Taq ligase and oligonucleotide probes containing a target-specific portion and a primer-specific portion. The mixture is subjected to an LDR process to produce ligation product sequences containing the ligated target-specific portions and the primer-specific portions. Step 2 involves mixing the ligation product sequences with Taq polymerase and primers and subjecting the mixture to a PCR process. The next step is determined as a function of whether the ligation product sequences are the same or different sizes. Where the ligation product sequences are different sizes, step 3a is selected which involves subjecting the extension products from PCR
to capillary electrophoresis or gel electrophoresis, either of which is followed by fluorescent quantification. Step 3b is utilized where the ligation product sequences are the same size and involves subjecting the extension products from the PCR
phase to restriction endonuclease digestion. This generates digestion fragments of unique size which can be subjected to capillary electrophoresis or gel electrophoresis, followed by fluorescent quantification, according to step 4b.
When step 3a is selected, the curve generated as a result of electrophoresis shows three ligation product sequences migrating at lengths of 104, 107, and 110, with the peak areas representing amplification of the Her-2 gene, loss of heterozygosity of the p53 gene, and the control SOD gene, respectively. The electrophoresis curve where steps 3b and 4b are used involves three ligation product sequence restriction fragments at lengths of 58, 70, and 76, with the peak areas representing amplification of the Her-2 gene, loss of heterozygosity of the p53 gene, and the control SOD gene, respectively.
As an alternative to Figure 8, Figure 9 shows the LDR/PCR process of the present invention where, in step 3, the extension products are captured on an array of capture oligonucleotide addresses. The capture oligonucleotide probes can be complementary to a nucleotide sequence across the ligation junction.
The number of gene copies captured on the array of capture oligonucleotides is then determined by fluorescent quantification as compared with known controls. In Figure 8, such analysis of the array indicates ligation product sequences hybridizing to gene-specific addresses, where the fluorescent intensity represents amplification of the Her-2 gene, loss of heterozygosity of the p53 gene, and the control SOD gene, respectively.

Figure 10 is a schematic diagram depicting an LDR/PCR process for multiplex detection of gene amplifications and deletions. Here, the ratio of the Her-2/neu gene from Chromosome 17q, the p53 gene from Chromosome 17p, and the SOD gene from Chromosome 21q is detected. Following denaturation of DNA at 94 C, pairs of oligonucleotide probes, having a target-specific portion and a primer-specific portion, are allowed to anneal adjacent to each other on target nucleic acids and ligate to one another (in the absence of mismatches).
This ligase detection reaction is carried out with Tth ligase at a hybridization/ligation temperature of 65 C which is well below the T,r, values of 75 C for the oligonucleotide probes. Next, the ligation product sequences are simultaneously amplified by PCR using Taq polymerase and two common primers complementary to the primer-specific portion, one of which is fluorescently labeled. This maintains the proportionality of the target sequences initially present in the sample.
The extension products are then digested with HaeIII and Hinp11 which releases fluorescently labeled fragments of unique sizes for each target sequence present in the sample. The digestion products are separated and analyzed on an Applied Biosystems, Inc. (Foster City, Calif.) 373A DNA Sequencer. The peak heights and areas are related to the relative copies of genes present in the initial target sample.

Figure 11 is a schematic diagram, depicting a problem which can be encountered with the allele-specific LDR/PCR process. While a PCR/LDR
process is very powerful, there may be circumstances where a multiplexed allele-specific LDR/PCR process of the present invention would be preferred. The concept is to have one or more sets of LDR oligonucleotide probes, each set characterized by (a) a first oligonucleotide probe, having a target-specific portion and a 5' upstream primer-specific portion, and (b) a second oligonucleotide probe, having a target-specific portion and a 3' downstream primer-specific portion.
As shown in step 1 of Figure 11, the LDR oligonucleotide probes anneal adjacent to each other on the target sequence. An LDR reaction using thermostable ligase (black dot) would form a ligation product sequence provided there is perfect complementarity at the ligation junction. In step 2, the ligation product sequences are PCR amplified with primer sets, each set characterized by (a) an upstream primer containing the same sequence as the 5' upstream primer-specific portion of a ligation product sequence and (b) a downstream primer complementary to the 3' downstream primer-specific portion of that ligation product sequence. The primers are shown as black lines in step 2. If one primer is fluorescently labeled, it will generate a fluorescent product which may be detected in a variety of detection schemes. For the LDR/PCR process to be specific, a PCR extension product should not be formed in the absence of a ligation event.
Unfortunately, the possibility exists for polymerase to extend the first LDR oligonucleotide probe (off normal target), forming a product containing the length of the target sequence, and a primer-specific portion on the 5' end. Meanwhile, polymerase can make several complementary copies of the downstream LDR probe using the downstream primer. In a second amplification cycle, this downstream LDR probe extension product can anneal to the upstream LDR probe extension product off the target sequence, and generate a sequence containing the target region flanked by the two primer-specific sequences. This product will amplify as the LDR
product, and thus yield a false positive signal.
Figure 12 is a schematic drawing showing a solution to the allele specific LDR/PCR problem, utilizing an intermediate exonuclease digestion step.
Allele-specific LDR/PCR can be achieved while significantly reducing background ligation independent (incorrect) target amplification. To do so, it is necessary to eliminate one or more of the components required for ligation independent PCR
amplification, without removing the information content of the ligation product sequence. One solution is to use exonuclease in step 2 to digest unreacted LDR
oligonucleotide probes from step 1. By blocking the end which is not ligated, for example the 3' end of the downstream oligonucleotide probe, one probe can be made substantially resistant to digestion, while the other is sensitive. Only the presence of full length ligation product sequence will prevent digestion of the upstream primer. Blocking groups include use of a thiophosphate group and/or use of 2-0-methyl ribose sugar groups in the backbone. Exonucleases include Exo I(3'-5'), Exo III (3'-5'), and Exo IV (both 5'-3' and 3'-5'), the later requiring blocking on both sides. One convenient way to block both probes is by using one long "padlock" probe (see M. Nilsson et. al., "Padlock Probes: Circularizing Oligonucleotides for Localized DNA Detection," Science 265: 2085-88 (1994), which is hereby incorporated by reference), although this is by no means required.
An advantage of using exonucleases, for example a combination of Exo I (single strand specific) and Exo III (double strand specific), is the ability to destroy both target and one LDR probe, while leaving the ligation product sequences substantially undigested. By using an exonuclease treatment prior to PCR, in accordance with steps 3 and 4, either one or both oligonucleotide probes in each set are substantially reduced, and thus hybridization of the remaining oligonucleotide probes to the original target DNA (which is also substantially reduced by exonuclease treatment) and formation of a ligation product sequence which is a suitable substrate for PCR amplification by the oligonucleotide primer set is substantially reduced. In other words, formation of ligation independent labeled extension products is substantially reduced or eliminated.
Figure 13 is a flow diagram showing an allele-specific LDR/PCR
process using exonuclease digestion with either size based- or DNA array based-detection. The flow diagram shows the three reactions required for the multiplexed allele-specific LDR/PCR process. In step 1, sets of LDR
oligonucleotide probes (wherein the downstream probes are blocked on their 3' ends) are ligated in the presence of the correct allele target using Taq DNA
Unreacted upstream probes are digested with exonuclease in step 2, coincidentally, target is also digested. Finally, in step 3, primer sets are used to amplify the ligation product sequence by hybridizing to the primer specific portions of ligation product sequences. In step 4a, the LDR oligonucleotide probes in a given particular set generate a unique length product, and thus may be distinguished from either oligonucleotide probes or other ligation products. After the PCR
reaction, the products are separated by size or electrophoretic mobility.
Labels on the PCR primers are detected, and the products are distinguished by size. In step 4b, the LDR oligonucleotide probes in a particular set use may be distinguished from either oligonucleotide probes or other ligation product sequences by differences in the sequences of the PCR primers. By using a plurality of oligonucleotide primer sets, each set characterized by (a) an upstream primer containing the same sequence as the 5' upstream primer-specific portion of a ligation product sequence, and (b) a downstream primer complementary to the 3' downstream primer-specific portion of that ligation product sequence, wherein one primer has a detectable reporter label and the other primer contains an addressable nucleotide sequence linked to the 5' end of that primer such that the addressable nucleotide sequence remains single stranded after a PCR reaction, all the products can be distinguished. The latter may be achieved by using a non-natural base within a PCR primer which polymerase cannot extend througli, thus generating PCR products which have single stranded tails. See C. Newton, et. al., "The Production of PCR Products with 5' Single-stranded Tails Using Primers that Incorporate Novel Phosphoramidite Intermediates," Nucl. Acids Res. 21(3): 1155-62 (1993), which is hereby incorporated by reference. By providing a DNA array with different capture oligonucleotides immobilized at different particular sites, where the capture oligonucleotides have nucleotide sequences complementary to the addressable nucleotide sequences on the primers, the PCR extension products can hybridize to the DNA array. Finally, the labels of extension product sequences captured using the addressable array-specific portions immobilized to the DNA array at particular sites can be detected. This indicates the presence of one or more target nucleotide sequences in the sample.

Figure 14 is a flow diagram showing a quantitative allele-specific LDR/PCR process using exonuclease digestion in step 3 with either size based-or DNA array based-detection. The flow diagram shows how one can quantify the amounts of different targets (especially low abundance cancer mutations) by adding marker sequence(s) (step 1) at the start of the LDR reaction (step 2). In this embodiment, the biochemical reactions (i.e. PCR (step 4)) are followed, as described in Figure 13, and the relative amount of mutant product to marker product are quantified using capillary or gel electrophoresis (step 5a) or capture on an addressable array (step 5b). The amount of mutant target present in the original sample can then be determined.
Figure 15 is a schematic drawing showing an allele-specific LDR/PCR process with exonuclease digestion (step 2) for detection of mutations or polymorphisms. Mutations and polymorphisms may be distinguished as described in Figure 12. In this example, in step 1, the upstream LDR
oligonucleotide probes, which have the discriminating allele-specific base at the 3' end of the target-specific portion, have different 5' upstream primer-specific portions. Thus, different primers (in the PCR amplification step (i.e. step 3)) may be labeled with different fluorescent groups (Fam and Tet) to allow for distinction of products (step 4). An array based detection scheme may also be used, where the upstream (allele-specific) probes have different 5' upstream primer-specific portions, and the different PCR primers contain different addressable nucleotide sequences which remain single stranded after a PCR reaction.
Figure 16 is a schematic drawing showing an aliele-specific LDR
(step 1)/PCR (step 3) process using exonuclease digestion (step 2) for detection of mononucleotide or dinucleotide repeat polymorphisms. One of the most powerful uses of LDR/PCR is for detecting nucleotide repeat polymorphisms, a task which cannot be achieved by allele-specific PCR (because the 3' nucleotide is always the same), nor easily achieved by observing PCR product size variation (due to Taq polymerase slippage during amplification). In Figure 16, the LDR
oligonucleotide probes distinguish between an A9 and A,o mononucleotide repeat sequence by virtue of the specificity of thermostable DNA ligase. LDR products are only formed on the correct length target sequence, and thus the presence of that target is distinguished (step 4).
Figure 17 is schematic drawing showing an allele-specific LDR/PCR process using exonuclease digestion (step 2) for detection of low abundance mononucleotide or dinucleotide repeat mutations. Mononucleotide repeat length mutations may be distinguished as described in Figure 12. In Figure 17, the LDR oligonucleotide probes (step 1) distinguish between an A8 , (mutants), and A,o (normal) mononucleotide repeat sequences by virtue of the specificity of thermostable DNA ligase. The two upstream LDR oligonucleotide probes differ in the length of the mononucleotide sequence at their 3' ends of their target specific portion and have different 5' upstream primer-specific portions.
Thus, different primers (in the PCR amplification step (step 3)) may be labeled with different fluorescent groups (Fam and Tet) to allow for distinction of products (step 4). This has the distinct advantage of allowing mononucleotide repeat polymorphisms to be distinguished based on fluorescent label instead of size, the latter being susceptible to false positives due to polymerase slippage. An array based detection scheme may also be used, where the upstream (allele-specific) probes have different 5' upstream primer-specific portions, and the different PCR
primers contain different addressable nucleotide sequences which remain single stranded after a PCR reaction.
Figure 18 is a flow diagram, showing an allele-specific LDR/PCR
process using uracil N-glycosylase selection with either size based- or DNA
array based-detection. The flow diagram shows the four reactions required for multiplexed allele-specific LDR/PCR. Sets of LDR oligonucleotide probes (wherein one or both probes contain deoxy-uracil in place of deoxythimidine) are ligated in the presence of the correct allele target using Taq DNA ligase in step 1.
A complementary copy of the ligation product sequence is made with sequenase in step 2. Sequenase is a modified T7 polymerase, with any easily inactivated polymerase (i.e. mesophilic polymerases such as, E. coli polymerase) being useful. Both ligation product sequences and unreacted probes are destroyed with uracil N-glycosylase in step 3. The advantage of using uracil N-glycosylase is its proven ability in carry-over prevention for PCR. Finally PCR primer sets are used to amplify the sequenase extension products in step 4. In step 5a, the LDR
oligonucleotide probes in a particular set generate a unique length product, and thus may be distinguished from either probes or other ligation products. After the PCR reaction, the products are separated by size or electrophoretic mobility.
Labels on the PCR primers are detected, and products are distinguished by size.
In step 5b, the LDR oligonucleotide probes in a particular set may be distinguished from either probes or other ligation product sequences by differences in the sequences of the primer-specific portions. By using a plurality of oligonucleotide primer sets, each set characterized by (a) an upstream primer containing the same sequence as the 5' upstream primer-specific portion of a ligation product sequence, and (b) a downstream primer complementary to the 3' downstream primer-specific portion of that ligation product sequence. One primer has a detectable reporter label, and the other primer contains an addressable array-specific portion linked to the 5' end of that primer such that the addressable array-specific portion remains single stranded after a PCR reaction, one can distinguish all the products. By providing a DNA array with different capture oligonucleotides immobilized at different particular sites, wherein the capture oligonucleotides have nucleotide sequences complementary to the addressable array-specific portions on the primers, the PCR extension products can be hybridized to the DNA array.
Finally, the labels of extension product sequences captured using the addressable nucleotide sequence portions and immobilized to the DNA array at particular sites can be detected to indicate the presence of one or more target nucleotide sequences in the sample.

Figure 19 is a flow diagram showing a quantitative allele-specific LDR/PCR process using uracil N-glycosylase selection with either size based-or DNA array based-detection. The flow diagram shows how one can quantify the amounts of different targets (especially low abundance cancer mutations) by adding marker sequence(s) in step 1 at the start of the LDR phase in step 2. As described in Figure 18, the biochemical reactions (i.e. sequenase treatment (step 3), uracil N-glycosylase selection (step 4), and PCR (step 5)) are preceded with, and the relative amount of mutant product to marker product is quantified using capillary or gel electrophoresis (step 6a) or capture on an addressable array (step 6b).
From this information, the amount of mutant target present in the original sample can be determined.
Figure 20 is a schematic drawing showing an allele-specific LDR/PCR process using uracil N-glycosylase selection (step 3) (after sequenase treatment (step 2)) for detection of mononucleotide or dinucleotide repeat polymorphisms. One of the most powerful uses of the LDR/PCR process is for detecting nucleotide repeat polymorphisms, a task which cannot be achieved by allele-specific PCR (since the 3' nucleotide is always the same), nor easily achieved by observing PCR product size variation (due to Taq polymerase slippage during amplification), as in step 4. In Figure 20, the LDR (step 1) oligonucleotide probes distinguish between an A9 and A,o mononucleotide repeat sequence by virtue of the specificity of thermostable DNA ligase. Ligation product sequences are only formed on the correct length target sequence, and, thus, the presence of that target is distinguished in step 5.
Figure 21 is a schematic drawing showing an allele-specific LDR/PCR process using uracil N-glycosylase selection for detection of low abundance mononucleotide or dinucleotide repeat mutations. Mononucleotide repeat length mutations may be distinguished as described in Figure 18. In Figure 21, the LDR oligonucleotide probes distinguish between an A8 , A9 (mutants), and A,o (normal) mononucleotide repeat sequences by virtue of the specificity of thermostable DNA ligase (step 1). Sequenase treatment (step 2) and uracil N-glycosylase selection (step 3) are then carried out. The two upstream LDR oligonucleotide probes differ in the length of the mononucleotide sequence at the 3' ends of their target-specific portion, and have different 5' upstream primer-specific portions. Thus, different primers (in the PCR amplification step (steps 4-5)) may be labeled with different fluorescent groups (Fam and Tet) to allow for distinction of products. This has the distinct advantage of allowing one to distinguish mononucleotide repeat polymorphisms based on fluorescent label instead of size, the latter being susceptible to false positives due to polymerase slippage. An array based detection scheme may also be used, where the upstream (allele-specific) probes have different 5' upstream primer-specific portions, and the different PCR primers contain different addressable array-specific portions which remain single stranded after a PCR reaction.
The LDR/exonuclease/PCR process described with reference to Figures 11 to 17 and the LDR/sequenase/uracil N-glycosylase/PCR process set forth in Figures 18-21 provide the ability to multiplex detect and then PCR
amplify many different target sequences and to distinguish multiple single-base or sequence variations, all in a single reaction tube. This is achieved by combining the sensitivity of PCR with the selectivity of LDR. Since the selection of mutant sequences is mediated by LDR rather than PCR, the primary PCR/secondary PCR/LDR process is less susceptible to false-positive signal generation. In addition, the primary PCR/secondary PCR/LDR process allows detection of closely-clustered mutations, detection of single base or small insertions and deletions in small repeat sequences, quantitative detection of less than 1 %
mutations in high background of normal DNA, and detection of ligation product sequences using addressable arrays. Detection of single base or small insertions and deletions in small and medium repeat sequences may cause "stutter" when the primary amplification is PCR. No other currently-available technique can adequately solve this problem, especially when the target sequence containing the mononucleotide repeat polymorphism is present in a lower abundance than normal DNA. In fact, analysis of genomic mutations which involve repeat sequence changes is severely hampered by the PCR "stutter" problem. By using the LDR/PCR process of the present invention, it is possible to detect down to 1 %
mutations in a high background of normal DNA. The only relatively minor challenges presented by this process are that the mutations must be known and that 3 different enzymes/reaction conditions must be utilized.

III. Primary PCR/Secondary PCR Process A third aspect of the present invention also involves a method for identifying two or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in one or more target nucleotide sequences. This method involves subjecting a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences to two successive polymerase chain reaction phases.
For the first polymerase chain reaction phase, one or more primary oligonucleotide primer groups are provided where each group comprises one or more primary oligonucleotide primer sets. Each set has a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primary-specific portion, and a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion. The first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion. The oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product. However, there is a mismatch which interferes with formation of such a polymerase chain reaction product when the primary oligonucleotide primers hybridize to any other nucleotide sequence present in the sample. The polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products with the same group or other groups. The primary oligonucleotide primers are blended with the sample and the polymerase to form a primary polymerase chain reaction mixture.

The primary polymerase chain reaction mixture is subjected to two or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above.
During the hybridization treatment, the target-specific portion of a primary oligonucleotide primer is hybridized to the target nucleotide sequences. In the extension treatment, the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized.
Although the upstream secondary primer-specific portions of a primary oligonucleotide primer set are not present on the target DNA, their sequences are copied by the second and subsequent cycles of the primary polymerase chain reaction phase. As a result, the primary extension products produced after the second cycle have the secondary primer-specific portions on their 5' ends and the complement of primer-specific portion on their 3' ends.
In the second polymerase chain reaction phase of this aspect of the present invention, one or a plurality of secondary oligonucleotide primer sets are provided. Each set has a first secondary primer having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and a second secondary primer containing the same sequence as the 5' upstream primer of the second primary oligonucleotide primer from the same primary oligonucleotide primer set as the first primary oligonucleotide complementary to the first secondary primer. A set of secondary oligonucleotide primers amplify the primary extension products in a given group.

The secondary oligonucleotide primers are blended with the primary extension products and the polymerase to form a secondary polymerase chain reaction mixture.
The secondary polymerase chain reaction mixture is subjected to one or more polymerase chain reaction cycles involving a denaturation treatment, a hybridization treatment, and an extension treatment, as described above. In the hybridization treatment, the secondary oligonucleotide primers are hybridized to the primary extension products, while the extension treatment causes the hybridized secondary oligonucleotide primers to be extended to form secondary extension products complementary to the primary extension products. After subjecting the secondary polymerase chain reaction mixture to the two or more polymerase chain reaction cycles, the labelled secondary extension products are detected. This indicates the presence of one or more target nucleotide sequences in the sample.
Figure 22 is a flow diagram depicting a primary PCR/secondary PCR process, in accordance with the present invention, for detection of microsatellite repeats. In step 1(i.e. the primary PCR phase), after DNA
sample preparation, multiple exons are amplified using Taq polymerase under hot start conditions with oligonucleotide primers having a target-specific portion and a secondary primer-specific portion. Step 2 involves a secondary PCR phase where Taq polymerase is used to amplify the primary PCR extension products with oligonucleotide primers containing the same sequence as the secondary primer-specific portion of the primary PCR primers. The extension products resulting from the secondary PCR phase are subjected in step 3 to capillary electrophoresis or gel electrophoresis, followed by fluorescent quantification. The electrophoresis results in Figure 22 indicate the presence of both alleles (i.e., chromosomes) containing RB1 and NM23 and loss of heterozygosity (i.e., loss of allele on one chromosome) for p53.

Figure 23 is a schematic diagram depicting a primary PCR/secondary PCR process, according to the present invention, for detection of the loss of heterozygosity due to insertions and deletions in microsatellite repeats.
The primary PCR phase in step 1 is initiated by denaturing the sample DNA at 940 C. Long PCR oligonucleotide primers, having 3' ends complementary to unique DNA surrounding microsatellite repeat sequences and 5' ends containing the same sequence as one of two primers utilized in the secondary PCR phase, are then caused to anneal to target DNA at 65 C. The primary PCR phase is carried out for 10-15 cycles. The long primers utilized in the primary PCR phase can be multiplexed as long as they do not amplify alleles with overlapping length ranges.
These reactions must be carried out on tumor and corresponding normal DNA to identify informative (i.e heterozygous) Ioci. In step 2 (i.e secondary PCR
amplification), primers complementary to the 5' ends of the primary PCR
primers (one fluorescently labeled) are then used to amplify the primary PCR extension products at nearly equal efficiency. The secondary PCR extension products are then separated and analyzed by gel electrophoresis and an Applied Biosystems Inc.
373A DNA Sequencer using the Genescan 672 software package. Areas of loss of heterozygosity at informative loci are identified. The analysis in Figure 23 shows the presence of both alleles (i.e., chromosomes) containing RB1 and NM23 and loss of heterozygosity (i.e., loss of allele on one chromosome) for p53.
IV. General Process Information The ligase detection reaction is described generally in WO 90/17239 to Barany et al., F. Barany et al., "Cloning, Overexpression and Nucleotide Sequence of a Thermostable DNA Ligase-encoding Gene," Gene, 109:1-11 (1991), and F. Barany, "Genetic Disease Detection and DNA Amplification Using Cloned Thermostable Ligase," Proc. Natl. Acad. Sci. USA, 88:189-193 (1991), the disclosures of which are hereby incorporated by reference. In accordance with the present invention, the ligase detection reaction can use 2 sets of complementary oligonucleotides. This is known as the ligase chain reaction which is described in the 3 immediately preceding references, which are hereby incorporated by reference. Alternatively, the ligase detection reaction can involve a single cycle which is known as the oligonucleotide ligation assay. See Landegren, et al., "A
Ligase-Mediated Gene Detection Technique," Science 241:1077-80 (1988);
Landegren, et al.,"DNA Diagnostics -- Molecular Techniques and Automation,"
Science 242:229-37 (1988); and U.S. Patent No. 4,988,617 to Landegren, et al., which are hereby incorporated by reference During ligase detection reaction phases, the denaturation treatment is carried out at a temperature of 80-105 C, while hybridization takes place at 50-85 C. Each cycle comprises a denaturation treatment and a thermal hybridization treatment which in total is from about one to five minutes long. Typically, the ligation detection reaction involves repeatedly denaturing and hybridizing for 2 to 50 cycles. The total time for the ligase detection reaction phase is 1 to 250 minutes.
The oligonucleotide probe sets or primers can be in the form of ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and mixtures thereof.
In one variation, the oligonucleotides of the oligonucleotide probe sets each have a hybridization or melting temperature (i.e. Tof 66-70 C.
These oligonucleotides are 20-28 nucleotides long.
The oligonucleotide probe sets or primers, as noted above, have a reporter label suitable for detection. Useful labels include chromophores, fluorescent moieties, enzymes, antigens, heavy metals, magnetic probes, dyes, phosphorescent groups, radioactive materials, chemiluminescent moieties, and electrochemical detecting moieties.

The polymerase chain reaction process is fully described in H.
Erlich, et. al.,"Recent Advances in the Polymerase Chain Reaction," Science 252:
1643-50 (1991); M. Innis, et. al., PCR Protocols: A Guide to Methods and Applications, Academic Press: New York (1990); and R. Saiki, et. al., "Primer-directed Enzymatic Amplification of DNA with a Thermostable DNA
Polymerase," Science 239: 487-91 (1988), which are hereby incorporated by reference.

A particularly important aspect of the present invention is its capability to quantify the amount of target nucleotide sequence in a sample.
This can be achieved in a number of ways by establishing standards which can be internal (i.e. where the standard establishing material is amplified and detected with the sample) or external (i.e. where the standard establishing material is not amplified, and is detected with the sample).

In accordance with one quantification method, the signal generated by the reporter label, resulting from capture of ligation product sequences produced from the sample being analyzed,. are detected. The strength of this signal is compared to a calibration curve produced from signals generated by capture of ligation product sequences in samples with known amounts of target nucleotide sequence. As a result, the amount of target nucleotide sequence in the sample being analyzed can be determined. This techniques involves use of an external standard.
Another quantification method, in accordance with the present invention, relates to an internal standard. Here, a known amount of one or more marker target nucleotide sequences is added to the sample. In addition, a plurality of marker-specific oligonucleotide probe sets are added along with the ligase, the previously-discussed oligonucleotide probe sets, and the sample to a mixture.
The marker-specific oligonucleotide probe sets have (1) a first oligonucleotide probe with a target-specific portion complementary to the marker target nucleotide sequence, and (2) a second oligonucleotide probe with a target-specific portion complementary to the marker target nucleotide sequence and a detectable reporter label. The oligonucleotide probes in a particular marker-specific oligonucleotide set are suitable for ligation together when hybridized adjacent to one another on a corresponding marker target nucleotide sequence. However, there is a mismatch which interferes with such ligation when hybridized to any other nucleotide sequence present in the sample or added marker sequences. The presence of ligation product sequences is identified by detection of reporter labels.
The amount of target nucleotide sequences in the sample is then determined by comparing the amount of ligation product sequence generated from known amounts of marker target nucleotide sequences with the amount of other ligation product sequences.
Another quantification method, in accordance with the present invention involves, analysis of a sample containing two or more of a plurality of target nucleotide sequences with a plurality of sequence differences. Here, ligation product sequences corresponding to the target nucleotide sequences are detected and distinguished by any of the previously-discussed techniques. The relative amounts of the target nucleotide sequences in the sample are then quantified by comparing the relative amounts of captured ligation product sequences generated. This provides a quantitative measure of the relative level of the target nucleotide sequences in the sample.
The preferred thermostable ligase is that derived from Thermus aquaticus. This enzyme can be isolated from that organism. M. Takahashi, et al., "Thermophillic DNA Ligase," J. Biol. Chem. 259:10041-47 (1984), which is hereby incorporated by reference. Alternatively, it can be prepared recombinantly. Procedures for such isolation as well as the recombinant production of Thermus aquaticus ligase (as well as Thermus themophilus ligase) are disclosed in WO 90/17239 to Barany, et. al., and F. Barany, et al., "Cloning, Overexpression and Nucleotide Sequence of a Thermostable DNA-Ligase Encoding Gene," Gene 109:1-11 (1991), which are hereby incorporated by reference. These references contain complete sequence information for this ligase as well as the encoding DNA. Other suitable ligases include E. coli ligase, T4 ligase, and Pyococcus ligase.
The ligation detection reaction mixture may include a carrier DNA, such as salmon sperm DNA.
The hybridization step in the ligase detection reaction, which is preferably a thermal hybridization treatment discriminates between nucleotide sequences based on a distinguishing nucleotide at the ligation junctions. The difference between the target nucleotide sequences can be, for example, a single nucleic acid base difference, a nucleic acid deletion, a nucleic acid insertion, or rearrangement. Such sequence differences involving more than one base can also be detected. Preferably, the oligonucleotide probe sets have substantially the same length so that they hybridize to target nucleotide sequences at substantially similar hybridization conditions. As a result, the process of the present invention is able to detect infectious diseases, genetic diseases, and cancer. It is also useful in environmental monitoring, forensics, and food science.
A wide variety of infectious diseases can be detected by the process of the present invention. Typically, these are caused by bacterial, viral, parasite, and fungal infectious agents. The resistance of various infectious agents to drugs can also be determined using the present invention.
Bacterial infectious agents which can be detected by the present invention include Escherichia coli, Salmonella, Shigella, Klebsiella, Pseudomonas, Listeria monocytogenes, Mycobacterium tuberculosis, Mycobacterium avium-intracellulare, Yersinia, Francisella, Pasteurella, Brucella, Clostridia, Bordetella pertussis, Bacteroides, Staphylococcus aureus, Streptococcus pneumonia, B-Hemolytic strep., Corynebacteria, Legionella, Mycoplasma, Ureaplasma, Chlamydia, Neisseria gonorrhea, Neisseria meningitides, Hemophilus influenza, Enterococcus faecalis, Proteus vulgaris, Proteus mirabilis, Helicobacter pylori, Treponema palladium, Borrelia burgdorferi, Borrelia recurrentis, Rickettsial pathogens, Nocardia, and Acitnomycetes.
Fungal infectious agents which can be detected by the present invention include Cryptococcus neoformans, Blastomyces dermatitidis, Histoplasma capsulatum, Coccidioides immitis, Paracoccidioides brasiliensis, Candida albicans, Aspergillus fumigautus, Phycomycetes (Rhizopus), Sporothrix schenckii, Chromomycosis, and Maduromycosis.
Viral infectious agents which can be detected by the present invention include human immunodeficiency virus, human T-cell lymphocytotrophic virus, hepatitis viruses (e.g., Hepatitis B Virus and Hepatitis C Virus), Epstein-Barr Virus, cytomegalovirus, human papillomaviruses, orthomyxo viruses, paramyxo viruses, adenoviruses, corona viruses, rhabdo viruses, polio viruses, toga viruses, bunya viruses, arena viruses, rubella viruses, and reo viruses.
Parasitic agents which can be detected by the present invention include Plasmodium falciparum, Plasmodium malaria, Plasmodium vivax, Plasmodium ovale, Onchoverva volvulus, Leishmania, Trypanosoma spp., Schistosoma spp., Entamoeba histolytica, Cryptosporidum, Giardia spp., Trichimonas spp., Balatidium coli, Wuchereria bancrofti, Toxoplasma spp., Enterobius vermicularis, Ascaris lumbricoides, Trichui-is trichiura, Dracunculus medinesis, trematodes, Diphyllobothrium latum, Taenia spp., Pneumocystis carinii, and Necator americanis.
The present invention is also useful for detection of drug resistance by infectious agents. For example, vancomycin-resistant Enterococcus faecium, methicillin-resistant Staphylococcus aureus, penicillin-resistant Streptococcus pneumoniae, multi-drug resistant Mycobacterium tuberculosis, and AZT-resistant human immunodeficiency virus can all be identified with the present invention.
Genetic diseases can also be detected by the process of the present invention. This can be carried out by prenatal or post-natal screening for chromosomal and genetic aberrations or for genetic diseases. Examples of detectable genetic diseases include: 21 hydroxylase deficiency, cystic fibrosis, Fragile X Syndrome, Turner Syndrome, Duchenne Muscular Dystrophy, Down Syndrome or other trisomies, heart disease, single gene diseases, HLA typing, phenylketonuria, sickle cell anemia, Tay-Sachs Disease, thalassemia, Klinefelter Syndrome, Huntington Disease, autoimmune diseases, lipidosis, obesity defects, hemophilia, inborn errors of metabolism, and diabetes.
Cancers which can be detected by the process of the present invention generally involve oncogenes, tumor suppressor genes, or genes involved in DNA amplification, replication, recombination, or repair. Examples of these include: BRCA1 gene, p53 gene, APC gene, Her2/Neu amplification, Bcr/Abl, K-ras gene, and human papillomavirus Types 16 and 18. Various aspects of the present invention can be used to identify amplifications, large deletions as well as point mutations and small deletions/insertions of the above genes in the following common human cancers: leukemia, colon cancer, breast cancer, lung cancer, prostate cancer, brain tumors, central nervous system tumors, bladder tumors, melanomas, liver cancer, osteosarcoma and other bone cancers, testicular and ovarian carcinomas, head and neck tumors, and cervical neoplasms.
In the area of environmental monitoring, the present invention can be used for detection, identification, and monitoring of pathogenic and indigenous microorganisms in natural and engineered ecosystems and microcosms such as in municipal waste water purification systems and water reservoirs or in polluted areas undergoing bioremediation. It is also possible to detect plasmids containing genes that can metabolize xenobiotics, to monitor specific target microorganisms in population dynamic studies, or either to detect, identify, or monitor genetically modified microorganisms in the environment and in industrial plants.
The present invention can also be used in a variety of forensic areas, including for human identification for military personnel and criminal investigation, paternity testing and family relation analysis, HLA
compatibility typing, and screening blood, sperm, or transplantation organs for contamination.

In the food and feed industry, the present invention has a wide variety of applications. For example, it can be used for identification and characterization of production organisms such as yeast for production of beer, wine, cheese, yogurt, bread, etc. Another area of use is with regard to quality control and certification of products and processes (e.g., livestock, pasteurization, and meat processing) for contaminants. Other uses include the characterization of plants, bulbs, and seeds for breeding purposes, identification of the presence of plant-specific pathogens, and detection and identification of veterinary infections.
Desirably, the oligonucleotide probes are suitable for ligation together at a ligation junction when hybridized adjacent to one another on a corresponding target nucleotide sequence due to perfect complementarity at the ligation junction. However, when the oligonucleotide probes in the set are hybridized to any other nucleotide sequence present in the sample, there is a mismatch at a base at the ligation junction which interferes with ligation.
Most preferably, the mismatch is at the base adjacent the 3' base at the ligation junction.
Alternatively, the mismatch can be at the bases adjacent to bases at the ligation junction.
As noted supra, detection and quantification can be carried out using capillary or gel electrophoresis or on a solid support with an array capture oligonucleotides.
The use of capillary and gel electrophoresis for such purposes is well known. See e. g. , Grossman, et. al.,"High-density Multiplex Detection of Nucleic Acid Sequences: Oligonucleotide Ligation Assay and Sequence-coded Separation," Nucl. Acids Res. 22(21): 4527-34 (1994), which is hereby incorporated by reference.
The use of a solid support with an array of capture oligonucleotides is fully disclosed in pending provisional U.S. Patent Application Serial No.
60/011,359, which is hereby incorporated by reference. When using such arrays, the oligonucleotide primers or probes used in the above-described coupled PCR

and LDR phases, respectively, have an addressable array-specific portion.
After the LDR or PCR phases are completed, the addressable array-specific portions for the products of such processes remain single stranded and are caused to hybridize to the capture oligonucleotides during a capture phase. C. Newton, et al., "The Production of PCR Products With 5' Single-Stranded Tails Using Primers That Incorporate Novel Phosphoramidite Intermediates," Nucl. Acids Res. 21(5):1155-62 (1993), which is hereby incorporated by reference.

During the capture phase of the process, the mixture is contacted with the solid support at a temperature of 45-90 C and for a time period of up to 60 minutes. Hybridizations may be accelerated by adding cations, volume exclusion or chaotropic agents. When an array consists of dozens to hundreds of addresses, it is important that the correct ligation product sequences have an opportunity to hybridize to the appropriate address. This may be achieved by the thermal motion of oligonucleotides at the high temperatures used, by mechanical movement of the fluid in contact with the array surface, or by moving the oligonucleotides across the array by electric fields. After hybridization, the array is washed sequentially with a low stringency wash buffer and then a high stringency wash buffer.

It is important to select capture oligonucleotides and addressable nucleotide sequences which will hybridize in a stable fashion. This requires that the oligonucleotide sets and the capture oligonucleotides be configured so that the oligonucleotide sets hybridize to the target nucleotide sequences at a temperature less than that which the capture oligonucleotides hybridize to the addressable array-specific portions. Unless the oligonucleotides are designed in this fashion, false positive signals may result due to capture of adjacent unreacted oligonucleotides from the same oligonucleotide set which are hybridized to the target.
The capture oligonucleotides can be in the form of ribonucleotides, deoxyribonucleotides, modified ribonucleotides, modified deoxyribonucleotides, peptide nucleotide analogues, modified peptide nucleotide analogues, modified phosphate-sugar backbone oligonucleotides, nucleotide analogues, and mixtures thereof.
Where an array is utilized, the detection phase of the process involves scanning and identifying if LDR or PCR products have been produced and correlating the presence of such products to a presence or absence of the target nucleotide sequence in the test sample. Scanning can be carried out by scanning electron microscopy, confocal microscopy, charge-coupled device, scanning tunneling electron microscopy, infrared microscopy, atomic force microscopy, electrical conductance, and fluorescent or phosphor imaging.
Correlating is carried out with a computer.

LDR/PCR Process Example 1- Genomic DNA Preparation Genomic DNA was prepared from the blood of two normal human volunteers, one male and one female, according to standard techniques.
Briefly, approximately 12 ml of blood was obtained in EDTA-containing blood collection tubes. Red blood cells were lysed by mixing the blood samples with 4 volumes of lysis buffer (10 mM Tris pH 8.0, 10 mM EDTA). After 10 min on ice with occasional agitation, the suspensions were centrifuged and the supernatants were decanted. The white blood cell pellets were resuspended in 20 ml of lysis buffer, and the above process was repeated. Each cell pellet was then suspended in 15 ml of digestion buffer (50 mM Tris pH 8.0, 5 mM EDTA, 100 mM NaCI, 1 %
SDS) and 3 mg (0.2 mg/ml) of proteinase K was added. The cells were digested at 37 C for 5 hours. The digests were extracted twice with equal volumes of phenol, then once with equal volumes of a 1:1 phenol: chloroform mixture and finally once with equal volumes of chloroform, each time centrifuging the mixture and removing the aqueous phase for the next extraction. After the final extraction and removing the aqueous phases, one tenth volume of 3 M sodium acetate, pH
6.5, was added. Two volumes of ice cold 100% EtOH were then added to each solution to precipitate the genomic DNAs, which were spooled out of solution on glass pipettes. The DNA precipitates were washed twice in 0.75 ml volumes of 70% EtOH, briefly centrifuging each time to allow removal of the supernatants.
After removing the supernatants for the second time, the remaining EtOH was allowed to evaporate and the DNA was suspended in 0.5 ml of TE (10mM Tri-HC1 pH 8.0 containing 1mM EDTA) solution. A fifth dilution of each DNA
solution was also prepared in TE.

To determine the concentrations of the one fifth DNA solutions, 1, 2, and 4 l aliquots of each were loaded on a 1 % agarose gel with a known amount of HindIII digested lambda DNA as a control. The gel was run at 150 Volts for 2 hours with ethidium bromide in the electrophoresis buffer. After photographing the gel and comparing the intensities of the DNA bands, the one fifth dilutions were judged to have concentrations of approximately 100 ng/ml.
DNA solutions extracted from various tumor cell lines were the generous gifts of other laboratories. The concentrations of these solutions were checked in a similar fashion and solutions of 100 ng/ml in TE were prepared.
To digest the genomic DNAs with Taq I, 25 l of the 100 ng/ l solutions was mixed with 5 l of lOX medium salt buffer (0.5 M NaCI, 0.1 M
MgCl2, 0.1 M Tris, pH 8.0), 20 l of water-ME (i.e. water containing 6mM ME
(i.e., mercaptoethanol)), and 400 U of Taq I restriction endonuclease. The digests were covered with mineral oil and incubated at 65 C for 1 hour. The reactions were stopped by adding 1.2 l of 500 mM EDTA and heating the specimens to 85 C for 10 min. Complete digestion of the DNAs was checked by electrophoresing aliquots on a 1% agarose gel.

Example 2 - Oligonucleotide Preparation for LDR Probes and PCR Primers All oligonucleotides were synthesized on a 394A DNA Synthesizer (Applied Biosystems Division of Perkin-Elmer Corp., Foster City, CA.).
Oligonucleotides labeled with 6-FAM were synthesized using the manufacturer's suggested modifications to the synthesis cycle (Applied Biosystems Inc., 1994) and were subsequently deprotected at 55 C for 4 hr. LDR oligonucleotides were purified by ethanol precipitation after overnight deprotection at 55 C. The primer-specific portions of the oligonucleotides used for PCR amplification were purified by polyacrylamide gel electrophoresis on 10% acrylamide/7M urea gels.
Oligonucleotides were visualized after electrophoresis by UV shadowing against a lightening screen and excised from the gel (Applied Biosystems Inc., 1992).
They were then eluted overnight at 64 C in TNE (i.e. Tris-sodium EDTA) buffer (100 mM Tris/HCl pH 8.0 containing 500 mM NaCI and 5 mM EDTA) and recovered from the eluate using Sep Pak cartridges (Millipore Corp, Milford, MA.) following the manufacture's instructions.

Oligonucleotides were resuspended in 100 1 TE (i.e. 10 mM Tri-HCl pH 8.0 containing ImM EDTA). Typical concentrations of these original LDR probe solutions are about 1 g/ l or approximately 74 pm/ l as determined by the following formula:

[concentration ( g/ l) X 106] / [length (nt) X 325 ] = pm/ l The concentrations of the LDR probes are given in Table 1. The concentrations of oligonucleotides complementary to the oligonucleotide probes of the ligase detection reaction were higher. ZipALg1F was 3.75 g/ l and ZipBLg2R was 2.01 g/ l or 524 pm/ l and 281 pm/ l, respectively, as determined by the formula above.

Table 1 Primer Length g/ 1 Pm/ l Vo1=100nm 1=200pm G6PDEx6-3L 48 nt 0.86 55.1 1.81 l 3.63 1 G6PDEx6-4R 48 0.65 41.7 2.4 4.8 ErbBExl-5L 48 0.95 60.9 1.64 3.28 ErbBExl-5R 48 1.4025 89.9 1.11 2.22 Int2Ex3-7L 50 1.6005 98.5 1.02 2.03 Int2Ex3-8R 46 1.306 87.4 1.14 2.29 p53Ex8-9L 2 1.036 61.3 1.63 3.26 p53Ex8-1OR 44 1.164 81.4 1.23 2.46 SODEx3-11L 49 1.287 80.8 1.24 2.48 SODEx3-12R 47 1.2045 78.9 1.27 2.53 As a prerequisite for the LDR phase, the downstream LDR
oligonucleotides probes were phosphorylated with T4 polynucleotide kinase.
Aliquots of the 5 downstream oligonucleotides equivalent to 200 pm (see Table 1) were combined with 10 l of lOX kinase buffer (500 mM Tris/HCI pH 8.0, 100 mM MgC12), 10 l of 10 mM ATP, 20 U T4 kinase, and sufficient water-ME to give a final volume of 100 l. Phosphorylation was carried out at 37 C for min followed by incubation for 10 min at 85 C to inactivate the T4 enzyme.
The resulting concentration of the kinased LDR probe solution was 2 pm/ l or 2000 fm/ l in each probe.

The kinase reaction is sununarized as follows:

4.8 l G6PDEx6-4R
2.2 Itl ErbBExl-5R
2.3 i Int2Ex3-8R
2.5 l p53Ex8-10R
2.5 l SODEx3-12R
l 10 x Kinase Buffer 10 l 10 mMATP
10 65.7 ul HOH + ME
100 l Total + 2 l = 20 units T4 Kinase 37 C for 30 min.
Heat kill kinase, 85 C, 10 min.
Final concentration = 2 pm/ l = 2000 fm/ l The solutions of the LDR and PCR oligonucleotides were adjusted to convenient concentrations. The kinased LDR probe solution was diluted fourfold in water to yield a concentration of 500fm/ l. A solution of the upstream LDR probes was made by combining volumes of the probes equivalent to 200 pm (see Table 1) with sufficient water to give a final volume of 400 l. This created a solution 500 fnl/ l in each of the upstream LDR probes. Aliquots (20 l) of the kinased and unkinased LDR probes were frozen for subsequent use. Standard solutions of the PCR primers (10 pm/ l) were prepared from their original solutions by combining 9.5 l of ZipALg1F and 17.8 l of ZipBLg2R with sufficient water to achieve a total volume of 500 l. These solutions were frozen for use in the LDR/PCR process.

Unkinased probes were prepared according to the following:

200 pm ea Primer 3.62 I G6PDEx6-3L
3.28 l ErbBEx1-5L
2.04 g1 Int2Ex3-7L
3.26 l p53Ex8-9L
2.48 1 SODEx3-11L
385.32 ul HOH
400 l Total Vol Final concentration = 0.5 pm/ 1= 500 fm/ 1 Table 2 - Sequences Probe (length in nt) Gene Location Upstream Downstream Ligation Position erb 17q12-q21 erbBExl-5L (48) erbBExl-6R (48) exon " 1 " P40 G6PD Xq28 G6PDEx6-3L (48) G6PDEx6-4R (48) exon 6 W1145 Int2 11q13 Int2Ex3-7L (50) Int2Ex3-8R (46) exon 3 W135 p53 17p13.1 p53Ex8-9L (52) p53Ex8-tOR (44) exon 8 P51 SOD 21q22.1 SODEx3-11L (49) SODEx3-12R (47) exon 3 P355 Figure 24 shows the design of LDR oligonucleotide probes for quantification of gene amplifications and deletions in the LDR/PCR process.
These oligonucleotide probes were designed to recognize exon 8 in the p53 tumor suppressor gene (on chromosome 17p), exon 3 of int-2 (on chromosome 11q), an internal exon in HER-2/neu (i.e. HER-2/neu/erbB oncogene) (on chromosome 17q), exon 3 in SOD (i.e. super oxide dimutase) (on chromosome 21q), and exon 6 in G6PD (i.e. glucose 6-phosphate dehydrogenase) (on chromosome Xq). Each pair of LDR oligonucleotide probes has the following features: (i) The left oligonucleotide probe contains from 5' to 3' an 18 base sequence identical to the fluorescently labeled secondary oligonucleotide primer (black bar), an "adjustment sequence" (white bar), and a target-specific sequence of from 22 to 28 bases with a T,,, of 75 C (patterned bar); (ii) The right oligonucleotide probe contains from 5' to 3' a target-specific sequence of 20-25 bases with a T,,, of 75 C
(patterned bar), a single HaeIII or HinP1I restriction site at slightly different positions within the target-specific sequence, and an "adjustment sequence" (white bars). The two oligonucleotide probes are designed such that their combined length is exactly bases, with 50 G+C bases and 46 A+T bases. The position of each unique restriction site generates a product which differs by at least 2 bases from the other products. Each oligonucleotide probe set has an exon-specific region chosen to ligate the junction sequence of (A, T)C y C(A, T). This junction sequence corresponds to either a proline residue (codon CCN) or the complementary sequence of a tryptophan residue (TGG). These sequences were chosen to minimize differences in ligation rates and the chance of a polymorphism at the ligation junction.
3' PCR Primers:
ZipALgIF 5' Fam-GGA GCA CGC TAT CCC GTT AGA C 3' (Tm = 71'C) ZipBLg2R 5' CGC TGC CAA CTA CCG CAC TAT G 3' (Tm = 72' C) (Underlined sequences are common between LDR probes and ZipALg1F or the complement of ZipBLg2R.) Example 3 - Buffers and Reagents A. LDR Buffers/Reagents - the following LDR buffers and reagents were selected:
lOX ST ligase buffer (0.2 M Tris pH 8.5, 0.1 M MgCI2) [This was also tested with Tris at pH 7.6.]
x TT ligase buffer (0.2 M Tris pH 7.6, 0.5 M KCI, 0.1 M MgClz, 5mM
EDTA) 10 NAD (10 mM) DTT (200 mM) LDR primer solution containing one tenth concentration of each of the LDR
primer mixtures (50 fm of each LDR primer per tt1) Tth DNA Ligase (625 U/ l) B. PCR Buffers/Reagents - the following PCR buffers and reagents were selected:

10X Stoffel buffer (0.1 M KCI, 0.1M Tris-HCl pH 8.3 Perkin Elmer) dNTP solution (100mM total, 25mM of each dNTP Perkin Elmer), diluted 5 fold in dHOH to a final concentration of 5mM of each dNTP
ZipALg 1 F (10 pm/ l) ZipBLg2R (10 pm/ l) Example 4 - LDR/PCR Process Four LDR/PCR processes were performed for each DNA to be tested with reaction tubes PCR amplified to 22, 24, 26, and 30 cycles to assure that one reaction would be halted in the exponential phase. Each LDR reaction (20 l) was thermal cycled and then a PCR mix (30 l) containing primers with a portion complementary to the primer-specific portion of the LDR probes was added to each specimen to allow exponential amplification. To minimize differences between reaction tubes, master mixes of LDR and PCR reagents were made.

A master mix of LDR reagents was constructed with a volume sufficient for all reaction tubes. Proportions and volumes for a single reaction were as follows:

Reagent Volume 10X ST Ligase Buffer 2 l NAD (10 mM) 2 l DTT (200 mM) 1 l dHOH 5 ul Total 10 l Tth DNA Ligase 0.2 l (= 125 U) Mixes of target DNA and LDR probes for each reaction tube were constructed with the following proportions:

Reagent Volume DNA (Taql digested) 1 l (=50 ng) LDR Probe Mix 4 1 (200 fm each primer) dHOH 5 ul Total 10 l For each reaction, 10 l was placed in a thin-walled PCR tube, rapidly mixed with 10 1 of LDR reagent mix (including ligase), overlayed with mineral oil, and placed in a Perkin Elmer 9600 thermal cycler.
LDR was initiated by holding at 96 C for 2 minutes to denature the DNA followed by 10 cycles of 94 C for 30 seconds and 65 C for 4 minutes.

PCR reagent mixes for each reaction tube were constructed with the following proportions:

Rea ent Volume lOX Stoffel buffer 5 l dNTP solution 8 l (= 0.8 mM each dNTP in final reaction) ZipALg1F (10 pm/ l) 2.5 l (= 25 pm per reaction) ZipBLg2R (10 pm/ l) 2.5 l (= 25 pm per reaction) dHOH 12 ul Total 30 l Stoffel Fragment 0.25 l (= 2.5 U) At the completion of the LDR reaction, the tubes were held at 94 C, while 30 ml of PCR reagent mix (including Stoffel fragment) were added to each tube. PCR amplification was accomplished by thermal cycling at 94 C for 15 seconds followed by 60 C for 50 seconds. At 22, 24, 26, and 30 cycles, respectively, one of four identical reaction tubes of each DNA specimen was removed and quenched in a slurry of dry ice and ETOH.
Example 5 - Agarose Gel Evaluation Ten microliter aliquots of the 26 and 30 cycle reaction specimens were evaluated on a 2% agarose gel. Ethidium bromide staining revealed bands of the expected size (104 bp).

Example 6 - Digestion of Products, Preparation of Dilutions, and Loading on GeneScanner To separate the gene-specific LDR/PCR products, 10 l aliquots of the 22, 24, and 26 cycle reactions were digested by adding 10 l of a solution containing 5 U each of HaeIII and HinP1I restriction enzymes (both from New England BioLabs), 2 l of lOX restriction enzyme buffer number 2 (New England BioLabs), and 8 l of dHOH (i.e. distilled water). The digests were incubated at 37 C for one hour and then stopped by the addition of 1 l of 0.5 M EDTA, pH
8Ø The restriction digests were a one half dilution of the original LDR/PCR
products. A 10 fold dilution of each sample was also prepared by adding 5 l of each restriction digest to 20 41 of TE buffer.

Before loading samples on the ABI 373A DNA Sequencer (Applied Biosystems) a 1:5 mixture of 50 mM EDTA pH 8.0 containing 2% blue dextran and de-ionized formamide was made. To 5 l of the EDTA-Blue Dextran solution, 5 l of digested LDR/PCR product dilution and 1jil of GENESCAN 1000 ROX
marker (Applied Biosystems) were added. These solutions were heated to 85 C
for 10 minutes and snap chilled on ice, before 5.5 l were loaded on the denaturing gel.

Samples were analyzed in an Applied Biosystems 373A DNA
sequencer on a 0.4 mm thick, 10% polyacrylamide/7M urea gel with a well-to-read distance of 12 cm. The gel matrix was buffered with 1.2x TBE (106 mM
Tris-borate and 2.4 mM EDTA pH 8.3) and the electrophoresis chamber buffer contained 0.6x TBE (53.4 mM Tris-borate and 1.2 mM EDTA pH 8.3). The gel was pre-run prior to sample loading at 1600 V for 30 minutes with the electrode polarity reversed (anode in the chamber with sample wells at the top of the gel).
After loading, the gene-specific LDR/PCR products were electrophoresed at 1200 V and the primary data was captured using the ABI 672 Data Collection Software V 1.1 (Applied Biosystems) Using the ABI 672 GeneScan Analysis Software V1.2.2 (Applied Biosystems), the resulting data were displayed as electropherograms, with peak heights and peak areas calculated.
In the normal female, the ErbB2 peak is lower, and the p53 peak is slightly lower than the remaining 3 peaks. See Figures 25A-D. In different experiments, it was observed that the ErbB2 peak is always lower, the G6PD, Int-2, p53, and SOD peak areas would vary somewhat, but all 5 peaks would retain the same relative profile from one sample to the next for a given experiment. When comparing male with female DNA, the G6PD peak was about half the area of other peaks, consistent with a single X-chromosome in males, while the other peaks were essentially the same. The ErB2 peak for the NM10 Breast Cancer cell line is slightly elevated, while that in cell line SKBR3 is several fold greater than the normal female control, reflecting the known ErbB-2 gene amplification in these two cell lines. In addition, cell line NM10 appears to have undergone LOH (i.e. a loss of heterozygosity) of p53, while cell line SKBR3 appears to have undergone LOH of G6PD and p53. Some of the cells in cell line SKBR3 may have lost both copies of the p53 gene. Repeating these amplifications in the absence of the ErbB-2 primers was used to confirm the presence of these additional gene deletions (see below).
These results can be quantified by comparing the ratio of peak areas in each peak to a standard (the SOD peak area) for that experiment. The raw data and ratio of peak areas are given below:
Table 3 - Raw Peak Area Data Genes ErB G6PD Int2 p53 SOD

Male 9954 21525 45688 36346 62506 Female 8340 39309 39344 30270 54665 Table 4 - Ratio of Peak Areas to SOD Peak Area ErbB/SOD G6PD/SOD Int2/SOD p53/SOD
Male 0.16 0.34 0.73 0.58 Female 0.15 0.72 0.72 0.55 NM 10 0.24 0.66 0.80 0.21 SKBR3 2.22 0.40 1.04 0.06 Although the ratios differ for each gene, (due to different efficiencies of LDR/PCR for each gene,) the ratios are generally consistent between the male and female sample, except for the G6PD/SOD ratio. The G6PD
for the female is about twice the value as the male, accurately reflecting the presence of two and one X chromosome, respectively. One can quantify the amount of ErbB2 amplification by comparing the ratio of peak area ratios between normal DNA and cancer cell lines.

Table 5 - Ratio of Peak Areas Ratios ErbB/2 G6PD Int2 p53 Female/Male 0.96 2.09 0.98 0.95 NM10/Male 1.50 1.91 1.09 0.35 SKBR3/Male 13.92 1.15 1.42 0.10 From these ratios, it can be determined that the normal male and female have the same number of genes on chromosomes 17q (ErbB), 17p (p53), and llq (Int 2), but that the female has twice as many G6PD genes, or X

chromosomes. Likewise, cell line NM10 showed slight amplification of the ErbB-2 gene, and LOH at p53, while cell line SKBR3 shows significant amplification of the ErbB-2 gene, LOH at G6PD and p53. To confirm additional gene amplifications and deletions, primer pairs causing massive amplifications may be removed from the LDR/PCR reaction (see below).
In the normal female, the ErbB2 peak is lower than the remaining 4 peaks. In different experiments, it was observed that the G6PD, Int-2, p53, and SOD peak areas would vary somewhat, but would retain the same relative profile from one sample to the next. See Figures 26A-C. The ErbB2 peak was consistently lower, and slight shoulders were observed on the G6PD and SOD
peaks, for unknown reasons. The ErbB-2 peak in both cell line samples is several fold greater than the normal female control, reflecting the known ErbB-2 gene amplification in these two cell lines. In addition, the ZR-75-30 line appears to show LOH of p53, while the SKGT-2 cell line appears to have a slight amplification of the Int-2 region. By repeating these LDR/PCR experiments in the absence of the ErbB-2 primers, it was demonstrated that these results are not artifacts of the massive levels of ErbB-2 amplification. See Figures 27A-C.
Both gene amplifications and deletions for multiple genes using the LDR/PCR format have been demonstrated. See Figures 26A-C and 27A-C.
Again, these results can be quantified by comparing the ratio of peak areas in each peak to a standard (the SOD peak area) for that experiment.
The raw data and ratio of peak areas are given below:

Table 6 - Raw Peak Area Data Genes ErbB G6PD Int2 p53 SOD

Female; 4 Primer Sets NA 9577 8581 9139 8128 ZR7530; 4 Primer NA 8452 7904 4168 7996 Sets SKGT2; 4 Primer Sets NA 15915 28614 13116 12478 Female; 5 Primer Sets 3955 9436 8066 9304 8848 ZR7530; 5 Primer 66748 11105 8812 4163 9303 Sets SKGT2; 5 Primer Sets 263254 21877 31887 13630 13480 Table 7 - Ratio of Peak Areas to SOD Peak Area ErbB/SOD G6PD/SOD Int2/SOD p53/SOD
Female; 4 Primer Sets NA 1.18 1.06 1.12 ZR7530; 4 Primer Sets NA 1.06 0.99 0.52 SKGT2; 4 Primer Sets NA 1.28 2.29 1.05 Female; 5 Primer Sets 0.45 1.97 0.91 1.05 ZR7530; 5 Primer Sets 7.17 1.19 0.95 0.45 SKGT2; 5 Primer Sets 19.53 1.62 2.37 1.01 The ratios are remarkably consistent between the four primer set and the five primer set experiments. The only exception is the G6PD peak for the SKGT2 cell line, where the huge peak for ErbB-2 may have added to the G6PD
One can quantify the amount of ErbB2 and Int-2 amplification as well as p53 deletion by comparing the ratio of peak area ratios between normal DNA and cancer cell lines, as shown in Table 8. In addition, the ratios from using 4 sets of primers can be compared with 5 sets of primers to ascertain the internal consistency of this technique.
Table 8 - Ratio of Peak Area Ratios ErbB G6PD Int2 p53 Female; 4/5 NA 1.10 1.16 1.07 ZR7530; 4/5 NA 0.89 1.04 1.16 SKGT2; 4/5 NA 0.79 0.97 1.04 ZR7530/Female; 4/4 NA 0.90 0.94 0.46 ZR7530; Female; 5/5 16.05 1.12 1.04 0.43 SKGT2/Female; 4/4 NA 1.08 2.17 0.93 SKGT2; Female; 5/5 43.69 1.52 2.59 0.96 The values for the top half of Table 8 should all be close to 1.0 if the LDR/PCR technique is internally consistent, when using 4 or 5 primers. All values are very close to 1Ø Again, the value for G6PD for SKGT2 is a bit low for the reasons mentioned.
The values on the bottom half of Table 8 show the extent of ErbB-2 amplification. The numbers are quite consistent for the 4 primer and 5 primer amplifications (with the exception of SKGT2-G6PD noted above). The ZR7530 cell line demonstrates a clear LOH for p53, while the SKGT2 cell line shows amplification of the Int-2 region, and both p53 genes present.

Primary PCR/Secondary PCR/LDR Process Example 7 - Oligonucleotide Synthesis Oligonucleotides were assembled by standard phosphoramidite chemistry on an Expedite DNA synthesizer (Perseptive Biosystems, Framingham, MA). Oligonucleotides 5'-end labeled with 6-FAM, TET, and HEX were synthesized using the appropriate dye phosphoramidites (Perkin Elmer-Applied Biosystems) and purified with Oligonucleotide Purification Cartridges (Perkin Elmer-Applied Biosystems) following the manufacturer's protocol (Applied Biosystems Division-Perkin Elmer Corp., "Synthesis and Purification of Fluorescently Labeled Oligonucleotides Using Dye Phosphoramidites," User Bulletin, number 78, Applied Biosystems Division, Foster City, CA, (1994)), which is hereby incorporated by reference. All oligonucleotides were checked for purity on an Applied Biosystems 270-HT capillary electrophoresis instrument using a mPAGE-3 column (J&W Scientific, Folsom, CA). Only oligonucleotides that were greater than 95 % pure were used for the experiments. Oligonucleotides were resuspended in 250 ml TE (10 mM Tris/HC1 and 5 mM EDTA pH 8.0).
Typical concentrations were 300-500 mM for crude stock solutions and 100-200 mM for OPC (i.e. Oligonucleotide Purification Columns available from Applied Biosystems) purified stock solutions. For PCR and LDR, oligonucleotides were diluted to working solutions of 10 mM (10 pmoles/ml) or 5 mM (5 pmoles/ml).

Example 8 - Phosphorylation of LDR Oligonucleotides The 12 LDR common oligonucleotides were phosphorylated at the 5' end to permit ligation to the fluorescent labeled oligonucleotides. The oligonucleotides are shown below in Table 9.

Table 9 - LDR Oligonucleotide Sequences Locus Allele-Specific Oligonucleotide Common Oligonucleotide (5'--> 3') (5'--> 3') TET-AGCTTCAATGATGAGAACCTGT









The allele-specific oligonucleotides are 5' end labeled with either FAM, TET, or HEX. All the comnion oligonucleotides are phospliorylated at the 5' end. Underline denotes tails that are not complementary to the target sequence. LDR primer sets were designed in two ways: (i) allele-specific primers were of the same length but contained either FAM or TET label;
or (ii) the allele-specific primers were both labeled with HEX but differed in lengtli by two bases.

-$5-This was accomplished either during the synthesis with Phosphate-ON (Clontech Laboratories, Palo Alto, CA) according to the manufacturer's instructions or post-synthesis, using T4 polynucleotide kinase (Boehringer Mannheim, Indianapolis, IN) . In the latter, a common oligomer was diluted into 50 l of kinase buffer (50 mM Tris/HC1, 10 mM MgC12, and 1 mM ATP) to a final concentration of 1 mM (500 pmol in 50 l ). Ten units of T4 kinase was added, and the reaction was incubated at 37 C for 30 min. The T4 kinase was inactivated by heating at 95 C for 10 min.

The kinase reaction was carried out as follows:
10 l 50 mM common oligo 5 l lOx kinase buffer 5 1 10 mM ATP
30 l H20 50 l Total + 1 l T4 Kinase (10 units) 37 C for 30 min.
95 C for 10 min.
Final concentration = 10 mM
Example 9 - Multiplex PCR Amplification Twelve gene regions (2-13) were chosen for simultaneous PCR
amplification based on information available in the Human Genome Database, as shown below in Table 10.

Table 10 - List of Polymorphic Sites Analyzed Site Locus Locus Name Chr. Nucleotide Variation Het. Ref.
Number Symbol Location Position 1 CYP2D6 cytochrome P450 IID622q13.1 4469 (M33388) C,T .38 2 2 AT3 antithrombin III 1q23-q25.1 7987 (X68793) C,T .46 3 3 C6 complement 5pl4-pl2 185 (X72179) A,C .47 4 component C6 4 IL1A interleukin 1 alpha 2q13 6282 (X03833) T,G .34 5 5 NF1 neurofibromatosis 17q11.2 63683 (L05367) A,G .47 6 6 ALDOB aldolase B 9q22.3-q31 1087 (M15656) A,G .50 7 7 A2M alpha 2 12p13.3- 153 (X68731) G,A .42 8 macroglobulin p12.3 8 IGF2 insulin growth factor 11p15.5 820 (X07868) G,A .46 9 9 PROSI protein S alpha 3p11-cen 183 (M36564) A,G .50 10 10 LIPC triglyceride lipase 15q21-q23 113 (M29189) T,G .49 11 11 CD18 integrin B-2 subunit 21q22.3 109 (X64081) C,T .50 12 12 LDLR low density lipoproteinl9pl3.2 70 (L00344) G,A .50 13 receptor The site numbers are specific single point variations located within tiie respective genes. All variations indicated are defined on the sense strand. Genbank accessiou numbers are indicated in parentlieses.
Clir., chromosonte; Het., heterozygosity.
References in Table 10 2 M. Armstrong, et al., "A Polymorphic Cfo I Site In Exon 6 of the Human Cytoclironie P450 CYPD6 Gene Detected by the Polynierase Cliain Reaction," Human Genetics 91:616-17 (1993), which is liereby incorporated by reference.
3 S.C. Bock, et al., "Antithrombin III Utah: Proline-407 to Leucine Mutation in a Highly Conserved Region Near the Inhibitor Reactive Site," Bioctiemistry 28:3628 (1991), wliich is hereby iueorporated by reference.

4 G. Dewald, et al., "Polymorphisni of Human Coinplement Component C6: An Amino Acid Substitution (glu/ala) Within [he Second Thronibospondin Repeat Differentiates Between the Two Comnion Allotypes C6 A and C6 B,"
Biocheni, Bionhys. Res. Commun. 194:458-64 (1993), which is hereby incorporated by reference.

5 P.A. Velden, et al., "Amino Acid Dimorphism in ILIA is Detectable by PCR
Amplification," Huni. Mol. Genet.
2:1753 (1993), which is hereby incorporated by reference.

6 R.M. Cawthon, et al., "Identification and Cliaracterization of Transcripts From Theneurofibromatosis I Region: The Sequence and Genomic Structure of EV12 and Mapping of Other Transcripts,"
Genoniics 7:555-65 (1990), which is hereby incorporated by reference.

7 C.C. Brooks, et al., "Association of the Widespread A149P Hereditary Fructose Intolerance Mutation With Newly Identified Sequence Polymorphisnis in the Aldolase B Gene," Am. J. Human Genetics 52:835-40 (1993), whiclt is hereby incorporated by reference.

8 W. Poller, et al., "Sequence Polymorphism in the Human Alpha-2-Macroglobulin (A2M) Gene," Nucleic Acids Res.
19:198 (1991), which is hereby incorporated by reference.

9 T. Gloudemans, "An Ava II Restriction Fragment Length Polymorphism in the Insulin-Like Growth Factor Il Gene and the Occurrence of Sniooth Muscle Tumors," Cancer Res. 53:5754-58 (1993), which is hereby incorporated by reference.
10 C.M. Diepstraten, et al., "A CCA/CCG Neutral Dimorphism in the Codon for Pro 626 of tlte Human Protein S Gene PSa (PROSI)," Nucleic Acids Res. 19:5091 (1991), which is hereby incorporated by reference.

11 M. Reina, et al., "SSCP Polymorphism in the Hunian Hepatic Triglyceride Lipase (LIPC) Gene," Hum. Mol. Genet.
1:453 (1992), which is hereby incorporated by reference.

12 S. Mastuura, et al., "Investigation of the Polymorphic AvaIl Site by a PCR-based Assay at the Human CD18 Gene Locus," Hutnan Genetics 93:721 (1994), whicli is hereby incorporated by ref'erence.

13 L. Warnich, et al., "Detection of a Frequent Polytnorphism in Exon 10 of the Low-Density Lipoprotein Receptor Gene," Human Genetics 89:362 (1992), which is Itereby incorporated by reference.

Each region was well characterized and harbored a single-base variation with only two known alleles. PCR amplifications were performed using genomic DNA isolated from whole blood using the Purgene DNA Isolation Kit (Gentra Systems, Inc., Minneapolis, MI) according to the manufacturer's instructions.
A volume of 25 l of PCR buffer (10 mM Tris/HCI pH 8.3, 10 mM KCI, 4 mM MgCI7, 0.4 mM each dNTP), 10-100 ng of genomic target DNA, PCR hybrid primer pairs 1-12 (2 pmol of each primer), and 1.3 units of AmpliTaq DNA polymerase Stoffel fragment (Applied Biosystems) was placed in a thin-walled MicroAmp reaction tube (Applied Biosystems). Each hybrid primer consisted of a gene-specific 3' region (16-29 bases) and a 5' region (22 bases) corresponding to one of two sets of universal (i.e. the portions which are primer-specific) primers (See Figure 4, where F1=Tet, F2=Fam, and F3=Het). These primers are shown in Table 11.

TABLE 11 - Primary PCR Primer Sequences Number Primer or (5'--> 3') Name I F GGAGCACGCTATCCCGTTAGACAGCCAAGGGGAACCCTGAGAG













So i underline denotes e ZipALgi an ZipBLg2 sequences. Dotted un er ine denotes the ZipCLgl and tp g sequences. Linker sequences are indicated in bold. F=forward, R=reverse.
Forward and reverse hybrid primers for loci 1,3,5,7,10, and 12 contained 5' end regions identical to universal primers ALg1 and BLg2 respectively. Forward and reverse primers to loci 2,4,6,8,9, and 11 contained 5' end regions identical to universal primers CLg3 and DLg4, respectively. The rationale for using a low concentration of the hybrid primers in the PCR phase was to deplete the hybrid primers during the reaction. This would theoretically allow products with low amplification efficiencies to "catch up with" those that had high amplification efficiencies. Amplification was attained by thermal cycling for 1 cycle of 96 C for sec to denature, then 15 cycles of 94 C for 15 sec to denature and 65 C for 60 15 sec to anneal and extend.
An equal volume of PCR buffer containing a high concentration of the two pairs of universal primers (25 pmol of each primer; Table 2) and 1.3 units of Amplitaq DNA polymerase Stoffel fragment was added to the Microamp reaction tube, and thermal cycling was performed for another 25 cycles with the annealing temperature lowered to 55 C. The upstream universal primers ALgl and CLg3 were fluorescently labeled with 6-FAM and TET, respectively. All thermal cycling was achieved with a GeneAmp PCR System 9600 thermal cycler (Applied Biosystems).

The primary PCR process was carried out under the following conditions:

5.9 l H2O
l primer pairs 1-12 (2 pmol each primer) 5 2.5 l lOX Stoffel fragment 4 1 25 mM MgC12 5 l 2 mM dNTP stock (each) 2.5 l genomic DNA (10 ng) 0.13 l Stoffel Frag. (1.3 units) 25 l Total The primary PCR cycling conditions were as follows:
96 C 15"
94 C15",65 C1'x15 65 C Hold The secondary PCR process was carried out under the following conditions:
13.37 l H20 5 l zip primer pairs (25 pmol each primer) 2.5 l lOX Stoffel fragment 4 l 25 mM MgClz 0.13 1 Stoffel Frag. (1.3 units) 25 l Total The secondary PCR cycling conditions were as follows:
94 C15",55 C1'x25 4 C Hold The PCR products were separated on an Applied Biosystems 373 DNA sequencer. A 3 ml aliquot of PCR sample was mixed with 3 ml of formamide containing fluorescently labeled Genescan-2500 [TAMRA] size standard (Applied Biosystems). The formamide/standard solution was prepared by adding 50 ml Genescan-2500 size standard [TAMRA] to 450 ml of formamide.
The sample was heated at 95 C for 2 min, quick cooled in ice, and electrophoresed through a denaturing 8% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer running Genescan version 1.2 software. The sizes of the fluorescently labeled products were automatically computed by the Genescan analysis software using the local Southern method. The electropherograms clearly showed 12 distinct products (Figure 28). The uniform amount of each product was attributed to the similar size of each amplicon and the use of the primary primers with portions complementary to the secondary primers, which annealed with identical affinities to the 12 amplicons without the need to carefully adjust reaction conditions. The computed sizes of the products, which ranged from 135 to 175 bp, matched exactly to their actual sizes (see Table 12).

Table 12 - List of PCR and LDR Products Site PCR Products LDR Product Num6er Label Size (bp) Label Size (bp) Variation Allele TET T B








The dual labeling approacll (Table 12) made it much easier to distinguish the products on the electropherograms (Figure 28, compare panel A with panels B
and C).

Example 10 - Multiplex Ligase Detection Reaction To avoid any possibility of labeled PCR product interfering with the detection of ligation product sequences, PCR product amplified using unlabeled PCR universal primers served as the target for the LDR. The polymerase in the PCR was inactivated by either freeze-thawing or adding EDTA/proteinase K to a final concentration of 5 mM and 100 mg/ml, respectively, and heating to 37 C
for 30 min and 95 C for 10 min.

Proteinase K digestion was carried out under the following conditions:
l PCR product + 2.5 al 500 mg/ml proteinase K
l Total 60 C for 60 min.
95 C for 10 min to heat kill proteinase K.

Four microliters of PCR product was diluted in 20 l of LDR mix containing 50 mM Tris/HCl pH 8.5, 50 mM KCI, 10 mM MgC121 1 mM NAD+, 10 mM DTT, LDR oligonucleotide sets 1-12 (200 fmol of each oligonucleotide), and 10 units of Thermus aquaticus DNA ligase (Barany, F. and Gelfand, D., "Cloning, Overexpression, and Nucleotide Sequence of a Thermostable DNA
Ligase-Encoding Gene," Gene, 109:1-11 (1991), which is hereby incorporated by reference). Each LDR oligonucleotide probe set consisted of two allele-specific oligonucleotides and a common oligonucleotide. Each pair of discriminating allele-specific oligonucleotide probes in the LDR oligonucleotide probe sets 1,2,3,4,6,7,8, and 9 were the same size, with one oligonucleotide labeled with FAM and the other labeled with TET. For LDR oligonucleotide probe sets 5, 10, 11, and 12, each pair of allele-specific oligonucleotides differed by 2 bases (the larger oligonucleotide had a 5' tail that was not complementary to the target sequence), and both oligonucleotides were labeled with HEX. Thermal cycling was performed for 1 cycle of 95 C for 2 min to denature, then 20 cycles of 95 C
for 30 sec to denature, and 65 C for 4 min to ligate.

The LDR process was carried out as follows:
4 l PCR product 2 l LDR oligo sets 1-12 (200 fmol each oligo) 2 l lOX T. ligase buffer 2 1 10 mM NAD +
1 141 200 mM DTT
9 l H O Total + 1 l Taq Ligase (10 units) 15 Stock of Ligase: 0.5 l of 625 u/ml + 3.2 l lOX buffer + 27.5 l H,'0 LDR cycling conditions were as follows:

94 C 2' 20 94 C 30", 65 C 4' x 20 4 C Hold A 3 l aliquot of LDR sample was mixed with 3 l of formamide containing fluorescently labeled Genescan-2500 [TAMRA] size standard (Applied Biosystems). The sample was heated at 95 C for 2 min, quick cooled in ice, and electrophoresed through a denaturing 10% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer running Genescan version 1.2 software. The sizes of the fluorescently labeled products were automatically computed by the Genescan analysis software using the local Southern method. LDR profiles of two individuals are shown in Figure 29. When each fluorescent dye was analyzed independently (Figure 29, panels B-D and F-H), it was very easy to determine the alleles present for each locus. A simple "A" or "B" code was assigned to each LDR product (Table 12) and used to score the genotypes. See Table 13 as follows:

Table 13 - Genotypes Determined by PCR-LDR for 5 Individuals Individual Site Number AA AA AA AB AB AB AB AB AA AB AB BB
The first individual (Figure 29A-D; Table 13, individual 1) was heterozygous at polymorphic sites 1-7, and 10-12. Heterozygosity at sites 1-4 and 6-7 was indicated by the detection of both 6-FAM and TET labeled products (Figure 29, panels B and C) at the respective positions on the electropherograms.
5 Heterozygosity at sites 5 and 11-12 was indicated by the presence of two HEX
labeled products, differing in size by 2 bases, for each of these loci (Figure 29, panel D). In contrast, the one product detected at sites 8 and 9 (Figure 29, panels B and C) established that each of these loci was homozygous. The second individual (Figure 29E-F and G-H; Table 13, individual 2) was heterozygous only at sites 3,5,6, and 9 and homozygous at sites 1,2,4,7,8, 10-12. There was a total of 8 differences in the genotypes at these positions between the two persons.
Three additional individuals were typed, and all 5 persons had distinct genotypes based on the 12 loci (Table 13).
Although the invention has been described in detail for the purpose of illustration, it is understood that such details are solely for that purpose. The variations can be made therein by those skilled in the art without departing from the spirit of the scope of the invention which is defined by the following claims.

Claims (4)

1. A method for identifying two or more of a plurality of sequences differing by one or more single-base changes, insertions, deletions, or translocations in a plurality of target nucleotide sequences comprising:

providing a sample potentially containing one or more target nucleotide sequences with a plurality of sequence differences;

providing one or more primary oligonucleotide primer groups, each group comprised of one or more primary oligonucleotide primer sets, each set characterized by (a) a first oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, and (b) a second oligonucleotide primer, having a target-specific portion and a 5' upstream secondary primer-specific portion, wherein the first oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion and the second oligonucleotide primers of each set in the same group contain the same 5' upstream secondary primer-specific portion, wherein the oligonucleotide primers in a particular set are suitable for hybridization on complementary strands of a corresponding target nucleotide sequence to permit formation of a polymerase chain reaction product, but have a mismatch which interferes with formation of such a polymerase chain reaction product when hybridized to any other nucleotide sequence present in the sample, and wherein the polymerase chain reaction products in a particular set may be distinguished from other polymerase chain reaction products in the same group or other groups;

providing a polymerase;

blending the sample, the primary oligonucleotide primers, and the polymerase to form a primary polymerase chain reaction mixture;

subjecting the primary polymerase chain reaction mixture to two or more polymerase chain reaction cycles comprising a denaturation treatment, wherein hybridized nucleic acid sequences are separated, a hybridization treatment, wherein the target-specific portion of the primary oligonucleotide primers hybridize to the target nucleotide sequences, and an extension treatment, wherein the hybridized primary oligonucleotide primers are extended to form primary extension products complementary to the target nucleotide sequence to which the primary oligonucleotide primer is hybridized;

providing one or a plurality of secondary oligonucleotide primer sets, each set characterized by (a) a first secondary primer, having a detectable reporter label and containing the same sequence as the 5' upstream portion of a first primary oligonucleotide primer, and (b) a second secondary primer containing the same sequence as the 5' upstream portion of a second primary oligonucleotide primer which is from the same primary oligonucleotide primer set as the first primary oligonucleotide, wherein a set of secondary oligonucleotide primers amplify the primary extension products in a given group;

blending the primary extension products, the secondary oligonucleotide primers, and the polymerase to form a secondary polymerase chain reaction mixture;

subjecting the secondary polymerase chain reaction mixture to two or more polymerase chain reaction cycles comprising a denaturation treatment, wherein hybridized nucleic sequences are separated, a hybridization treatment, wherein the secondary oligonucleotide primers hybridize to the primary extension products, an extension treatment, wherein the hybridized secondary oligonucleotide primers are extended to form secondary extension products complementary to the primary extension product; and detecting the labeled secondary extension products, thereby indicating the presence of one or more target nucleotide sequences in the sample.
2. A method according to claim 1, wherein the polymerase chain reaction secondary oligonucleotide primers in a particular set produce secondary extension products of unique length so that they may be distinguished from other nucleic acids in the secondary polymerase chain reaction mixture, said method further comprising:
separating the extension products by size or electrophoretic mobility and distinguishing the secondary extension products which differ in size.
3. A method according to claim 1, wherein the secondary extension products contain unique sequences so that they may be distinguished from other secondary extension products, said method further comprising:
providing a solid support with different capture oligonucleotides immobilized at different particular sites, wherein the capture oligonucleotides have nucleotide sequences complementary to the unique nucleotide sequences within the secondary extension products;
contacting the secondary polymerase chain reaction mixture, after said subjecting it to one or more polymerase chain reaction cycles, with the solid support under conditions effective to hybridize the secondary extension products to the capture oligonucleotides in a base-specific manner, thereby capturing the secondary extension products to the solid support at the site with complementary capture oligonucleotides, wherein said detecting indicates the presence of secondary extension products captured using the unique nucleotide sequence portions within the secondary extension products and immobilized to the solid support at particular sites, thereby indicating the presence of one or more target nucleotide sequences in the sample.
4. A method according to claim 1, wherein the primary oligonucleotide primer sets in the same group contain either the same 5' upstream primer-specific portion on the first oligonucleotide primers or the same 5' upstream primer-specific portion on the second oligonucleotide primers and, the secondary oligonucleotide primer sets form one or a plurality of oligonucleotide primer groups, each group comprised of one or more oligonucleotide primer sets, wherein one secondary oligonucleotide primer has a detectable reporter label and the other secondary oligonucleotide primer contains an addressable array-specific portion linked to the 5' end of that primer which remains single stranded after said subjecting the secondary polymerase chain reaction mixture to one or more polymerase chain reaction cycles, the oligonucleotide primer sets in the same group contain either the same first secondary oligonucleotide primer or the same second secondary oligonucleotide primer, wherein a group of secondary oligonucleotide primers may be used to amplify all the primary extension products in a given groups, said method further comprising:
providing a solid support with different capture oligonucleotides immobilized at different particular sites, wherein the capture oligonucleotides have nucleotide sequences complementary to the addressable array-specific portions;
contacting the secondary polymerase chain reaction mixture, after said subjecting it to one or more polymerase chain reaction cycles, with the solid support under conditions effective to hybridize the secondary extension products to the capture oligonucleotides in a base-specific manner, thereby capturing the addressable array-specific portions to the solid support at the site with the complementary capture oligonucleotide, wherein said detecting indicates the presence of extension products captured using the addressable array-specific portions and immobilized to the solid support at particular sites, thereby indicating the presence of one or more target nucleotide sequences in the sample.
CA 2255774 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions Expired - Lifetime CA2255774C (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US1853296 true 1996-05-29 1996-05-29
US60/018,532 1996-05-29
PCT/US1997/009012 WO1997045559A1 (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions

Publications (2)

Publication Number Publication Date
CA2255774A1 true CA2255774A1 (en) 1997-12-04
CA2255774C true CA2255774C (en) 2008-03-18



Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2255774 Expired - Lifetime CA2255774C (en) 1996-05-29 1997-05-27 Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions

Country Status (5)

Country Link
US (18) US6027889A (en)
JP (3) JP4468488B2 (en)
CA (1) CA2255774C (en)
EP (3) EP0912761A4 (en)
WO (1) WO1997045559A1 (en)

Families Citing this family (460)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6652808B1 (en) * 1991-11-07 2003-11-25 Nanotronics, Inc. Methods for the electronic assembly and fabrication of devices
WO1993017126A1 (en) * 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
US5710000A (en) * 1994-09-16 1998-01-20 Affymetrix, Inc. Capturing sequences adjacent to Type-IIs restriction sites for genomic library mapping
USRE43097E1 (en) 1994-10-13 2012-01-10 Illumina, Inc. Massively parallel signature sequencing by ligation of encoded adaptors
US6852487B1 (en) * 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US20020150921A1 (en) * 1996-02-09 2002-10-17 Francis Barany Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6458530B1 (en) 1996-04-04 2002-10-01 Affymetrix Inc. Selecting tag nucleic acids
CA2255599C (en) 1996-04-25 2006-09-05 Bioarray Solutions, Llc Light-controlled electrokinetic assembly of particles near surfaces
WO1997045559A1 (en) 1996-05-29 1997-12-04 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6312892B1 (en) 1996-07-19 2001-11-06 Cornell Research Foundation, Inc. High fidelity detection of nucleic acid differences by ligase detection reaction
JP3142879B2 (en) * 1996-09-13 2001-03-07 株式会社分子バイオホトニクス研究所 Target nucleic acid detection solid phase, a method of manufacturing the same, and the target nucleic acid detection method
GB9624165D0 (en) * 1996-11-19 1997-01-08 Amdex A S Use of nucleic acids bound to carrier macromolecules
US6083763A (en) 1996-12-31 2000-07-04 Genometrix Inc. Multiplexed molecular analysis apparatus and method
US7622294B2 (en) 1997-03-14 2009-11-24 Trustees Of Tufts College Methods for detecting target analytes and enzymatic reactions
US6327410B1 (en) 1997-03-14 2001-12-04 The Trustees Of Tufts College Target analyte sensors utilizing Microspheres
EP1591541B1 (en) 1997-04-01 2012-02-15 Illumina Cambridge Limited Method of nucleic acid sequencing
US6143496A (en) * 1997-04-17 2000-11-07 Cytonix Corporation Method of sampling, amplifying and quantifying segment of nucleic acid, polymerase chain reaction assembly having nanoliter-sized sample chambers, and method of filling assembly
WO1998053300A3 (en) * 1997-05-23 1999-02-25 Lynx Therapeutics Inc System and apparaus for sequential processing of analytes
US7115884B1 (en) 1997-10-06 2006-10-03 Trustees Of Tufts College Self-encoding fiber optic sensor
US6607878B2 (en) 1997-10-06 2003-08-19 Stratagene Collections of uniquely tagged molecules
US7348181B2 (en) 1997-10-06 2008-03-25 Trustees Of Tufts College Self-encoding sensor with microspheres
US7153656B2 (en) * 2001-09-11 2006-12-26 Los Alamos National Security, Llc Nucleic acid sequence detection using multiplexed oligonucleotide PCR
GB9725197D0 (en) * 1997-11-29 1998-01-28 Secr Defence Detection system
US20030096232A1 (en) * 1997-12-19 2003-05-22 Kris Richard M. High throughput assay system
US20030039967A1 (en) * 1997-12-19 2003-02-27 Kris Richard M. High throughput assay system using mass spectrometry
US20100105572A1 (en) * 1997-12-19 2010-04-29 Kris Richard M High throughput assay system
US20020177144A1 (en) * 1997-12-30 2002-11-28 Jose Remacle Detection and/or quantification method of a target molecule by a binding with a capture molecule fixed on the surface of a disc
US20050053962A1 (en) * 1998-01-27 2005-03-10 Gary Blackburn Amplification of nucleic acids with electronic detection
US6881571B1 (en) * 1998-03-11 2005-04-19 Exonhit Therapeutics S.A. Qualitative differential screening
US6759192B1 (en) * 1998-06-05 2004-07-06 Genset S.A. Polymorphic markers of prostate carcinoma tumor antigen-1(PCTA-1)
JP3662850B2 (en) 1998-06-24 2005-06-22 イルミナ インコーポレイテッド Decoding array sensor having a microsphere
US20040203078A1 (en) * 1998-07-22 2004-10-14 National Institute Of Advanced Industrial Science And Technology Labeled complex, process for producing same and process for utilizing same
US6703228B1 (en) 1998-09-25 2004-03-09 Massachusetts Institute Of Technology Methods and products related to genotyping and DNA analysis
EP1001037A3 (en) * 1998-09-28 2003-10-01 Whitehead Institute For Biomedical Research Pre-selection and isolation of single nucleotide polymorphisms
US6949370B1 (en) 1998-10-30 2005-09-27 Cornell Research Foundation, Inc. High fidelity thermostable ligase and uses thereof
DE69911641T2 (en) * 1998-11-27 2004-08-05 Synaptics (Uk) Ltd., Harston position sensor
US6395486B1 (en) 1999-03-15 2002-05-28 Applera Corporation Probe/mobility modifier complexes for multiplexnucleic acid detection
JP4601830B2 (en) * 1999-03-19 2010-12-22 コーネル リサーチ ファンデーション インク. Couples polymerase chain reaction - restriction endonuclease digestion - ligase detection reaction method
US6506594B1 (en) * 1999-03-19 2003-01-14 Cornell Res Foundation Inc Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US7014994B1 (en) 1999-03-19 2006-03-21 Cornell Research Foundation,Inc. Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process
US6355431B1 (en) 1999-04-20 2002-03-12 Illumina, Inc. Detection of nucleic acid amplification reactions using bead arrays
US20060275782A1 (en) 1999-04-20 2006-12-07 Illumina, Inc. Detection of nucleic acid reactions on bead arrays
US20030207295A1 (en) * 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US7056661B2 (en) * 1999-05-19 2006-06-06 Cornell Research Foundation, Inc. Method for sequencing nucleic acid molecules
US20030096321A1 (en) * 1999-05-19 2003-05-22 Jose Remacle Method for the identification and/or the quantification of a target compound obtained from a biological sample upon chips
US6544732B1 (en) * 1999-05-20 2003-04-08 Illumina, Inc. Encoding and decoding of array sensors utilizing nanocrystals
WO2000075373A3 (en) 1999-05-20 2002-01-24 Illumina Inc Combinatorial decoding of random nucleic acid arrays
US8481268B2 (en) 1999-05-21 2013-07-09 Illumina, Inc. Use of microfluidic systems in the detection of target analytes using microsphere arrays
US8080380B2 (en) * 1999-05-21 2011-12-20 Illumina, Inc. Use of microfluidic systems in the detection of target analytes using microsphere arrays
JP3911909B2 (en) * 1999-06-09 2007-05-09 株式会社日立製作所 Dna Sample preparation and dna sample preparation device
US20020119448A1 (en) 1999-06-23 2002-08-29 Joseph A. Sorge Methods of enriching for and identifying polymorphisms
US6964847B1 (en) 1999-07-14 2005-11-15 Packard Biosciences Company Derivative nucleic acids and uses thereof
WO2001006012A1 (en) * 1999-07-14 2001-01-25 Packard Bioscience Company Derivative nucleic acids and uses thereof
US6692915B1 (en) 1999-07-22 2004-02-17 Girish N. Nallur Sequencing a polynucleotide on a generic chip
EP1218545B1 (en) 1999-08-18 2012-01-25 Illumina, Inc. Methods for preparing oligonucleotide solutions
DE60038495T2 (en) * 1999-09-10 2009-04-09 Geron Corp., Menlo Park Oligonucleotide N3 'p5' thiophosphoramidates: their synthesis and use
US6692918B2 (en) * 1999-09-13 2004-02-17 Nugen Technologies, Inc. Methods and compositions for linear isothermal amplification of polynucleotide sequences
CN1373812B (en) 1999-09-13 2012-04-11 纽亘技术公司 Methods and compositions for linear isothermal amplification of polynucleotide sequences
FR2798673B1 (en) * 1999-09-16 2004-05-28 Exonhit Therapeutics Sa Methods and compositions for the detection of pathological events
WO2001025481A1 (en) 1999-10-04 2001-04-12 Olympus Optical Co., Ltd. Method of detecting nucleic acid
JP3668075B2 (en) * 1999-10-12 2005-07-06 プレシジョン・システム・サイエンス株式会社 Genetic material sequence determination suspension system, genetic material sequence determination method and SNPs fast scoring method using the suspension system with its suspension system
CA2398107C (en) * 2000-01-28 2013-11-19 Althea Technologies, Inc. Methods for analysis of gene expression
US7611869B2 (en) * 2000-02-07 2009-11-03 Illumina, Inc. Multiplexed methylation detection methods
US20050214825A1 (en) * 2000-02-07 2005-09-29 John Stuelpnagel Multiplex sample analysis on universal arrays
WO2001057268A3 (en) * 2000-02-07 2002-07-18 Illumina Inc Nucleic acid detection methods using universal priming
US8076063B2 (en) * 2000-02-07 2011-12-13 Illumina, Inc. Multiplexed methylation detection methods
EP2246438A1 (en) * 2001-07-12 2010-11-03 Illumina, Inc. Multiplex nucleic acid reactions
US7955794B2 (en) 2000-09-21 2011-06-07 Illumina, Inc. Multiplex nucleic acid reactions
US20020006617A1 (en) 2000-02-07 2002-01-17 Jian-Bing Fan Nucleic acid detection methods using universal priming
US7361488B2 (en) 2000-02-07 2008-04-22 Illumina, Inc. Nucleic acid detection methods using universal priming
EP1395805A4 (en) * 2001-06-11 2005-03-09 Illumina Inc Multiplexed detection methods
US6770441B2 (en) 2000-02-10 2004-08-03 Illumina, Inc. Array compositions and methods of making same
JP4954415B2 (en) * 2000-02-10 2012-06-13 イルミナ インコーポレイテッド Array and its manufacturing method of the individual arrays as a substrate for the simultaneous processing of the beads samples were based
EP1130113A1 (en) * 2000-02-15 2001-09-05 Johannes Petrus Schouten Multiplex ligation dependent amplification assay
US7285384B2 (en) * 2000-02-16 2007-10-23 Illuminia, Inc. Parallel genotyping of multiple patient samples
DE10010281B4 (en) * 2000-02-25 2005-03-10 Epigenomics Ag Ligase / polymerase method for detection of cytosine methylation in DNA samples
US7482443B2 (en) * 2000-03-09 2009-01-27 Genetag Technology, Inc. Systems and methods to quantify and amplify both signaling probes for cDNA chips and genes expression microarrays
US6368801B1 (en) 2000-04-12 2002-04-09 Molecular Staging, Inc. Detection and amplification of RNA using target-mediated ligation of DNA by RNA ligase
JP5508654B2 (en) 2000-04-14 2014-06-04 コーネル・リサーチ・ファンデーション・インコーポレイテッドCornell Research Foundation, Incorporated Design method for localization possible array for the detection of differences in nucleic acid sequences using ligase detection reaction
WO2001085987A1 (en) * 2000-05-09 2001-11-15 Diatech Pty. Ltd. Methods for identifying polynucleotide repeat regions of defined length
EP1313880A2 (en) * 2000-05-30 2003-05-28 PE Corporation (NY) Methods for detecting target nucleic acids using coupled ligation and amplification
US7087414B2 (en) 2000-06-06 2006-08-08 Applera Corporation Methods and devices for multiplexing amplification reactions
US9709559B2 (en) 2000-06-21 2017-07-18 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US7892854B2 (en) * 2000-06-21 2011-02-22 Bioarray Solutions, Ltd. Multianalyte molecular analysis using application-specific random particle arrays
US7846733B2 (en) * 2000-06-26 2010-12-07 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
CA2412721A1 (en) * 2000-06-26 2002-01-03 Nugen Technologies, Inc. Methods and compositions for transcription-based nucleic acid amplification
WO2002002810A3 (en) * 2000-07-01 2002-09-19 Clondiag Chip Tech Gmbh Method for qualitative and/or quantitative detecting of molecular interactions on probe arrays
DE60125243T2 (en) * 2000-07-03 2007-05-31 Applera Corp., Foster City Polynucleotide sequence assay
JP4310599B2 (en) * 2000-07-05 2009-08-12 東洋紡績株式会社 Method for detecting a nucleotide polymorphism
US20040072239A1 (en) * 2000-07-06 2004-04-15 Patricia Renaud Method for controlling the microbiological quality of an aqueous medium and kit therefor
US20050260574A1 (en) * 2000-07-27 2005-11-24 Gibbs Mark J Combinatorial probes and uses therefor
WO2002016645A3 (en) * 2000-08-21 2003-04-03 Lynx Therapeutics Inc Polymorphic dna fragments and uses thereof
US20050239125A1 (en) * 2000-09-06 2005-10-27 Hodge Timothy A Methods for genotype screening
US20060014186A1 (en) * 2001-09-04 2006-01-19 Hodge Timothy A Methods for genotype screening of a strain disposed on an adsorbent carrier
US20050272085A1 (en) * 2000-09-06 2005-12-08 Hodge Timothy A Methods for forensic and congenic screening
US7011943B2 (en) * 2000-09-06 2006-03-14 Transnetyx, Inc. Method for detecting a designated genetic sequence in murine genomic DNA
US20030207289A1 (en) * 2001-09-04 2003-11-06 Hodge Timothy A. Detection of genetic sequences using a bipartite probe
US20040185464A1 (en) * 2000-09-15 2004-09-23 Kris Richard M. High throughput assay system
DE10048944A1 (en) * 2000-10-03 2002-04-18 Andreas Kage A method of selecting high affinity binding to a target nucleic acid by two-dimensional separation
JP4287652B2 (en) * 2000-10-24 2009-07-01 ザ・ボード・オブ・トラスティーズ・オブ・ザ・レランド・スタンフォード・ジュニア・ユニバーシティThe Board Of Trustees Of The Leland Stanford Junior University Behavior analysis by direct multiprocessing genomic dna
US20040018491A1 (en) * 2000-10-26 2004-01-29 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
US20020142326A1 (en) * 2000-11-30 2002-10-03 Coull James M. Methods and compositions for sorting and/or determining organisms
DE60142709D1 (en) 2000-12-13 2010-09-09 Nugen Technologies Inc Methods and compositions for generation a variety of copies of nucleic acid sequences and methods for detection thereof
US6312929B1 (en) * 2000-12-22 2001-11-06 Cepheid Compositions and methods enabling a totally internally controlled amplification reaction
CA2433674A1 (en) * 2001-01-05 2002-07-11 Invitrogen Corporation Method for relative quantification of attached nucleic acids
FI115139B (en) * 2001-01-10 2005-03-15 Valtion Teknillinen The method and test kit occurring in the cell or in the number of tissue samples for the quantitative variations of the polynucleotides and / or to evaluate the comparative
EP1229128A1 (en) * 2001-01-31 2002-08-07 Boehringer Mannheim Gmbh New method for genotype determination
WO2002064743A3 (en) * 2001-02-12 2002-10-31 Matthew Biery Confirming the exon content of rna transcripts by pcr using primers complementary to each respective exon
WO2003012147A1 (en) * 2001-02-20 2003-02-13 Datascope Investment Corp. Method for reusing standard blots and microarrays utilizing dna dendrimer technology
DE60220025D1 (en) 2001-03-09 2007-06-21 Nugen Technologies Inc Methods and compositions for amplification of RNA sequences
CA2439074A1 (en) * 2001-03-09 2002-09-19 Nugen Technologies, Inc. Methods and compositions for amplification of rna sequences
EP1247815A3 (en) * 2001-03-25 2003-01-29 Exiqon A/S Modified oligonucleotides and uses thereof
US7029919B2 (en) * 2001-05-04 2006-04-18 Agilent Technologies, Inc. Electro-optical device and methods for hybridization and detection
WO2002090561A1 (en) * 2001-05-07 2002-11-14 Curagen Corporation Methods and composition for nucleic acid amplification
WO2004059289A3 (en) * 2001-05-22 2006-03-02 Epict Technologies Target-dependent transcription using deletion mutants of n4 rna polymerase
GB0112868D0 (en) * 2001-05-25 2001-07-18 Secr Defence Detection system
DE10126630A1 (en) * 2001-05-31 2003-01-09 Peter Und Traudl Engelhorn Sti A method for cell sorting
US7262063B2 (en) 2001-06-21 2007-08-28 Bio Array Solutions, Ltd. Directed assembly of functional heterostructures
CA2451498A1 (en) * 2001-06-22 2003-01-03 Marshfield Clinic Methods and oligonucleotides for the detection of salmonella sp., e. coli o157:h7, and listeria monocytogenes
US20030170695A1 (en) * 2001-06-29 2003-09-11 Liang Shi Enzymatic ligation-based identification of nucleotide sequences
US20030082584A1 (en) * 2001-06-29 2003-05-01 Liang Shi Enzymatic ligation-based identification of transcript expression
US7473767B2 (en) * 2001-07-03 2009-01-06 The Institute For Systems Biology Methods for detection and quantification of analytes in complex mixtures
US7582420B2 (en) * 2001-07-12 2009-09-01 Illumina, Inc. Multiplex nucleic acid reactions
WO2003062783A3 (en) * 2001-07-20 2003-11-20 Daniel L Feldheim Light addressable electrochemical detection of duplex structures
US6913884B2 (en) * 2001-08-16 2005-07-05 Illumina, Inc. Compositions and methods for repetitive use of genomic DNA
US20030096277A1 (en) * 2001-08-30 2003-05-22 Xiangning Chen Allele specific PCR for genotyping
WO2003025540A3 (en) * 2001-09-18 2003-10-16 Us Genomics Inc Differential tagging of polymers for high resolution linear analysis
EP1438416A4 (en) * 2001-09-26 2007-09-05 Epigenx Pharmaceutical Inc Assays for dna methylation changes
JP4377689B2 (en) * 2001-10-15 2009-12-02 バイオアレイ ソリューションズ リミテッド Composite analysis of polymorphic loci by simultaneous interrogation and enzyme mediated detection
US20080138800A1 (en) * 2001-10-15 2008-06-12 Alice Xiang Li Multiplexed analysis of polymorphic loci by concurrent interrogation and enzyme-mediated detection
JP3829690B2 (en) * 2001-10-30 2006-10-04 株式会社日立製作所 Inspection method of nucleic acid sequence
CN1697882A (en) 2001-11-19 2005-11-16 帕拉里勒生物科学公司 Multiplex PCR
EP1319718A1 (en) * 2001-12-14 2003-06-18 Keygene N.V. High throughput analysis and detection of multiple target sequences
EP1456418A4 (en) * 2001-12-20 2006-07-26 Merck & Co Inc Identification of novel polymorphic sites in the human mglur8 gene and uses thereof
WO2003060163A8 (en) * 2001-12-28 2004-08-05 Keygene Nv Discrimination and detection of target nucleotide sequences using mass spectrometry
EP1327682B1 (en) * 2002-01-11 2009-05-13 BioSpring Gesellschaft für Biotechnologie mbH Method for producing DNA
DE10201463B4 (en) 2002-01-16 2005-07-21 Clondiag Chip Technologies Gmbh Reaction vessel for carrying out array method
US20050208491A1 (en) * 2002-02-08 2005-09-22 Rudolf Zirwes Specific multiplex analysis of nucleic acids
US7499806B2 (en) 2002-02-14 2009-03-03 Illumina, Inc. Image processing in microsphere arrays
US7282355B2 (en) * 2002-03-13 2007-10-16 Syngenta Participations Ag Nucleic acid detection method
US7081339B2 (en) * 2002-04-12 2006-07-25 Primera Biosystems, Inc. Methods for variation detection
DE10220935B3 (en) * 2002-05-10 2004-02-05 Siemens Ag A method for the biochemical analysis of DNA and associated arrangement
WO2003100099A1 (en) * 2002-05-24 2003-12-04 Cygene, Inc. Parallel stranded duplexes of deoxyribonucleic acid and methods of use
EP1546380A4 (en) * 2002-05-28 2007-02-14 Us Genomics Inc Methods and apparati using single polymer analysis
CA2489022C (en) * 2002-06-12 2012-10-16 Genencor International, Inc. Methods for improving a binding characteristic of a molecule
FI20021325A0 (en) * 2002-07-05 2002-07-05 Valtion Teknillinen Method and kit for determining the amount of each individual polynucleotides
JP2005538735A (en) * 2002-09-17 2005-12-22 パーキネルマー ラス インコーポレイテッド Real-time detection method of nucleic acid reaction
US20040214196A1 (en) * 2002-09-19 2004-10-28 Applera Corporation Methods and compositions for detecting targets
CA2499360A1 (en) * 2002-09-19 2004-04-01 Applera Corporation Methods and compositions for detecting targets
US20040259105A1 (en) * 2002-10-03 2004-12-23 Jian-Bing Fan Multiplex nucleic acid analysis using archived or fixed samples
GB0223563D0 (en) * 2002-10-10 2002-11-20 Secr Defence Detection system
EP1558756A4 (en) * 2002-10-23 2006-09-27 Applera Corp Methods and composition for detecting targets
US20040235005A1 (en) * 2002-10-23 2004-11-25 Ernest Friedlander Methods and composition for detecting targets
US7526114B2 (en) 2002-11-15 2009-04-28 Bioarray Solutions Ltd. Analysis, secure access to, and transmission of array images
EP1572974A2 (en) * 2002-11-19 2005-09-14 Applera Corporation Polynucleotide sequence detection assays and analysis
WO2004046344A3 (en) * 2002-11-19 2006-12-07 Applera Corp Polynucleotide sequence detection assays
GB0227274D0 (en) * 2002-11-22 2002-12-31 Dynal Biotech Ltd Probes
EP2031070B1 (en) 2002-12-04 2013-07-17 Life Technologies Corporation Multiplex amplification of polynucleotides
JP2006517786A (en) * 2002-12-12 2006-08-03 ナノスフェアー インコーポレイテッドNanosphere Inc. Direct snp detection using unamplified dna
US8206904B2 (en) 2002-12-18 2012-06-26 Third Wave Technologies, Inc. Detection of nucleic acids
US7851150B2 (en) * 2002-12-18 2010-12-14 Third Wave Technologies, Inc. Detection of small nucleic acids
US9487823B2 (en) * 2002-12-20 2016-11-08 Qiagen Gmbh Nucleic acid amplification
US7682565B2 (en) 2002-12-20 2010-03-23 Biotrove, Inc. Assay apparatus and method using microfluidic arrays
US20060094108A1 (en) * 2002-12-20 2006-05-04 Karl Yoder Thermal cycler for microfluidic array assays
EP2500440B1 (en) 2002-12-20 2015-12-16 Celera Corporation Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof
US7192700B2 (en) * 2002-12-20 2007-03-20 Orchid Cellmark Inc. Methods and compositions for conducting primer extension and polymorphism detection reactions
US20040180369A1 (en) * 2003-01-16 2004-09-16 North Carolina State University Photothermal detection of nucleic acid hybridization
WO2004065000A1 (en) 2003-01-21 2004-08-05 Illumina Inc. Chemical reaction monitor
US8043834B2 (en) * 2003-03-31 2011-10-25 Qiagen Gmbh Universal reagents for rolling circle amplification and methods of use
DE10315074A1 (en) 2003-04-02 2004-10-14 Clondiag Chip Technologies Gmbh Apparatus for reproduction and for detecting nucleic acids
WO2004092418A3 (en) 2003-04-14 2004-12-02 Nugen Technologies Inc Global amplification using a randomly primed composite primer
US20050009052A1 (en) * 2003-04-22 2005-01-13 Irm Llc, A Delaware Limited Liability Company Differential tag length analysis of cell proliferation
US8168777B2 (en) 2004-04-29 2012-05-01 Human Genetic Signatures Pty. Ltd. Bisulphite reagent treatment of nucleic acid
US20040229269A1 (en) * 2003-05-15 2004-11-18 Ghazala Hashmi Hybridization-mediated analysis of polymorphisms
DE10323685A1 (en) * 2003-05-22 2004-12-09 Klapproth, Holger, Dr. A method for the covalent immobilization of probe biomolecules to organic surfaces
JP2006526399A (en) * 2003-06-02 2006-11-24 チェック−ポインツ ホールディング ベー.フェー. A method for detecting microorganisms in food sample at high speed
US20050239089A1 (en) * 2003-06-06 2005-10-27 Johnson Martin D Mobility cassettes
DE602004028478D1 (en) 2003-06-17 2010-09-16 Human Genetic Signatures Pty A process for genomamplifikation
US20070111204A1 (en) * 2003-06-27 2007-05-17 Kathleen Delgrosso Methods for detecting nucleic acid variations
US20100291637A1 (en) * 2003-06-30 2010-11-18 Panasonic Corporation Method for modifying nucleotide chain
CA2517167C (en) * 2003-06-30 2010-08-03 Matsushita Electric Industrial Co., Ltd. Method for modifying nucleotide chain
CN1580283A (en) * 2003-08-13 2005-02-16 清华大学 Method for detecting nucleic acid molecule
GB0319949D0 (en) * 2003-08-26 2003-09-24 Univ Strathclyde Nucleic acid sequence identification
US8808991B2 (en) 2003-09-02 2014-08-19 Keygene N.V. Ola-based methods for the detection of target nucleic avid sequences
DE602004018801D1 (en) 2003-09-04 2009-02-12 Human Genetic Signatures Pty Nucleic acid detection test
US20050266417A1 (en) * 2003-09-12 2005-12-01 Francis Barany Methods for identifying target nucleic acid molecules
US7927796B2 (en) * 2003-09-18 2011-04-19 Bioarray Solutions, Ltd. Number coding for identification of subtypes of coded types of solid phase carriers
EP1664722B1 (en) 2003-09-22 2011-11-02 Bioarray Solutions Ltd Surface immobilized polyelectrolyte with multiple functional groups capable of covalently bonding to biomolecules
WO2005045059A3 (en) * 2003-10-28 2005-09-09 Bioarray Solutions Ltd Allele assignment and probe selection in multiplexed assays of polymorphic targets
CA2899287A1 (en) 2003-10-28 2005-05-12 Bioarray Solutions Ltd. Optimization of gene expression analysis using immobilized capture probes
ES2533876T3 (en) 2003-10-29 2015-04-15 Bioarray Solutions Ltd Multiplexed analysis of nucleic acids by fragmentation dsDNA
WO2005042785A1 (en) * 2003-10-30 2005-05-12 North Carolina State University Electrochemical detection of nucleic acid hybridization
US20050191651A1 (en) * 2003-10-30 2005-09-01 North Carolina State University Temperature-jump enhanced electrochemical detection of nucleic acid hybridization
US20050272054A1 (en) 2003-11-26 2005-12-08 Applera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
US20050130213A1 (en) * 2003-12-10 2005-06-16 Tom Morrison Selective ligation and amplification assay
US7582430B2 (en) * 2004-01-20 2009-09-01 United States Of America As Represented By The Secretary Of The Army Immunoliposome-nucleic acid amplification (ILNAA) assay
DE102004003860A1 (en) 2004-01-26 2005-08-18 Clondiag Chip Technologies Gmbh A process for the genotype and pathotyping of Pseudomonas aeruginosa
EP1561823A1 (en) * 2004-02-04 2005-08-10 Biotez Berlin-Buch GmbH Method for the detection of single nucleotid polymorphisms (SNP) of genes of drug metabolism and test system for performing such a method
CA2555704A1 (en) * 2004-02-10 2005-08-25 Cornell Research Foundation, Inc. Method for detection of promoter methylation status
WO2005079986A1 (en) * 2004-02-18 2005-09-01 Applera Corporation Multi-step bioassays on modular microfluidic application platforms
EP1753873A4 (en) * 2004-03-05 2008-11-05 Ohio Med College Methods and compositions for assessing nucleic acids and alleles
US8679788B2 (en) 2004-03-22 2014-03-25 The Johns Hopkins University Methods for the detection of nucleic acid differences
US7601821B2 (en) * 2004-03-24 2009-10-13 Applied Biosystems, Llc Encoding and decoding reactions for determining target molecules
WO2005106036A3 (en) * 2004-04-12 2006-02-16 Ohio Med College Methods and compositions for assaying analytes
US20050282195A1 (en) * 2004-04-30 2005-12-22 Applera Corporation Compositions, methods, and kits for (MIS)ligating oligonucleotides
WO2005108618A3 (en) * 2004-04-30 2006-03-30 Mark Andersen Methods and kits for methylation detection
DE102004022263A1 (en) 2004-05-06 2005-12-15 Clondiag Chip Technologies Gmbh Device and method for the detection of molecular interactions
EP2412827B1 (en) 2004-05-07 2014-01-22 Celera Corporation Genetic polymorphism associated with liver fibrosis methods of detection and uses thereof
US7622281B2 (en) * 2004-05-20 2009-11-24 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for clonal amplification of nucleic acid
US7575863B2 (en) 2004-05-28 2009-08-18 Applied Biosystems, Llc Methods, compositions, and kits comprising linker probes for quantifying polynucleotides
US20080138801A1 (en) * 2004-05-28 2008-06-12 Arizona Board Of Regents, A Body Corporate Acting On Behalf Of Arizona State University Surface Plasmon Resonance Sensor for Detecting Changes in Polynucleotide Mass
US7785843B2 (en) * 2004-06-23 2010-08-31 Sequenom, Inc. Target-specific compomers and methods of use
WO2006005055A3 (en) * 2004-06-30 2006-03-16 Mark Andersen Methods reaction mixtures and kits for ligating polynucleotides
US7363170B2 (en) * 2004-07-09 2008-04-22 Bio Array Solutions Ltd. Transfusion registry network providing real-time interaction between users and providers of genetically characterized blood products
CN101087890A (en) * 2004-07-26 2007-12-12 帕拉列勒生物科学公司 Simultaneous analysis of multiple genomes
WO2006013052A1 (en) * 2004-07-30 2006-02-09 Universität Bremen Method for analysing samples by means of hybridisation
DE102004037081A1 (en) * 2004-07-30 2006-03-23 Universität Bremen Hybridization assay of nucleic acid, useful particularly for identifying nitrogen-fixing microorganisms, where the complex formed includes a lable in, or close to, the hybrid region
US7848889B2 (en) 2004-08-02 2010-12-07 Bioarray Solutions, Ltd. Automated analysis of multiplexed probe-target interaction patterns: pattern matching and allele identification
EP1623996A1 (en) * 2004-08-06 2006-02-08 Deutsches Krebsforschungszentrum Stiftung des öffentlichen Rechts Improved method of selecting a desired protein from a library
US20060040258A1 (en) * 2004-08-23 2006-02-23 Huiyan Guo Water-soluble conjugates and methods of preparation
DK1794173T3 (en) 2004-09-10 2010-10-25 Human Genetic Signatures Pty Amplification blocker comprising intercalating nucleic acids (INA) containing intercalating pseudonucleotides (IPN)
EP1791982B1 (en) 2004-09-21 2011-01-05 Life Technologies Corporation TWO-COLOR REAL-TIME/END-POINT QUANTITATION OF MICRORNAS (MIRNAs)
ES2301268B1 (en) * 2004-10-25 2009-05-01 Centro De Investigacion Biomolecular Aplicada Salamanca, S.L. Use of the Slug gene or its products of replication, transcription or expression in the identification, diagnosis, prevention or treatment of cancer spread and / or development of metastasis.
JPWO2006059769A1 (en) * 2004-12-03 2008-06-05 愛知県 Methods of diagnosis and prognosis of malignant lymphoma
ES2399054T3 (en) 2004-12-03 2013-03-25 Human Genetic Signatures Pty Ltd Methods for simplifying microbial nucleic acids by chemical modification of cytosine
US20060134650A1 (en) * 2004-12-21 2006-06-22 Illumina, Inc. Methylation-sensitive restriction enzyme endonuclease method of whole genome methylation analysis
EP1831401B1 (en) 2004-12-29 2010-02-10 Applied Biosystems, LLC Methods, compositions, and kits for forming self-complementary polynucleotides
US20060211024A1 (en) * 2005-03-10 2006-09-21 Gwc Technologies Incorporated Methods for analysis of a nucleic acid sample
WO2006099365A9 (en) 2005-03-11 2009-05-14 Applera Corp Genetic polymorphisms associated with coronary heart disease, methods of detection and uses thereof
US20060205090A1 (en) * 2005-03-14 2006-09-14 Newton Michael W Water-soluble conjugates for electrochemical detection
US20070026423A1 (en) * 2005-03-16 2007-02-01 Thomas Koehler Method and test kit for the detection of target nucleic acids
US8309303B2 (en) * 2005-04-01 2012-11-13 Qiagen Gmbh Reverse transcription and amplification of RNA with simultaneous degradation of DNA
US20060240442A1 (en) * 2005-04-20 2006-10-26 Vevea Dirk N Methods and oligonucleotides for the detection of Salmonella SP., E coli 0157:H7, and Listeria monocytogenes
US20060246463A1 (en) * 2005-04-20 2006-11-02 Vevea Dirk N Methods and oligonucleotides for the detection of Salmonella SP., E coli 0157:H7, and Listeria monocytogenes
US20070009925A1 (en) * 2005-05-05 2007-01-11 Applera Corporation Genomic dna sequencing methods and kits
WO2006125267A1 (en) 2005-05-26 2006-11-30 Human Genetic Signatures Pty Ltd Isothermal strand displacement amplification using primers containing a non-regular base
WO2007117256A1 (en) * 2005-05-31 2007-10-18 Applera Corporation Multiplexed amplification of short nucleic acids
US8486629B2 (en) 2005-06-01 2013-07-16 Bioarray Solutions, Ltd. Creation of functionalized microparticle libraries by oligonucleotide ligation or elongation
US20060276220A1 (en) * 2005-06-03 2006-12-07 Judith Schure Cell phone case with magnifier and method
US20070065844A1 (en) * 2005-06-08 2007-03-22 Massachusetts Institute Of Technology Solution-based methods for RNA expression profiling
US20070087360A1 (en) * 2005-06-20 2007-04-19 Boyd Victoria L Methods and compositions for detecting nucleotides
JP5058160B2 (en) * 2005-06-30 2012-10-24 ジーイー・ヘルスケア・バイオサイエンス・コーポレイション Detection methods of gene expression
US7977108B2 (en) * 2005-07-25 2011-07-12 Roche Molecular Systems, Inc. Method for detecting a mutation in a repetitive nucleic acid sequence
US20070065847A1 (en) * 2005-08-11 2007-03-22 Affymetrix, Inc. Degeneratively Labeled Probes
WO2007025281A3 (en) * 2005-08-24 2007-11-01 Applera Corp A method to quantify sirnas, mirnas and polymorphic mirnas
EP1929046B1 (en) * 2005-09-07 2012-07-11 Nugen Technologies, Inc. Improved nucleic acid amplification procedure
EP1762627A1 (en) 2005-09-09 2007-03-14 Qiagen GmbH Method for the activation of a nucleic acid for performing a polymerase reaction
EP1762628B1 (en) * 2005-09-13 2008-03-12 Eppendorf Array Technologies SA Detection method of homologous sequences differing by one base on a microarray
WO2007030882A1 (en) 2005-09-14 2007-03-22 Human Genetic Signatures Pty Ltd Assay for a health state
US7799530B2 (en) 2005-09-23 2010-09-21 Celera Corporation Genetic polymorphisms associated with cardiovascular disorders and drug response, methods of detection and uses thereof
DE102005052713A1 (en) 2005-11-04 2007-05-16 Clondiag Chip Tech Gmbh Device and method for the detection of molecular interactions
EP1957667A1 (en) * 2005-11-15 2008-08-20 Solexa Ltd. Method of target enrichment
US7960105B2 (en) * 2005-11-29 2011-06-14 National Institutes Of Health Method of DNA analysis using micro/nanochannel
ES2374788T3 (en) * 2005-12-23 2012-02-22 Institute For Systems Biology Nanoreporters and methods for their production and use.
US20100009373A1 (en) * 2005-12-23 2010-01-14 Perkinelmer Health Sciences, Inc. Methods and compositions relating to multiplex genomic gain and loss assays
CA2634447A1 (en) * 2005-12-23 2007-07-05 Perkinelmer Las, Inc. Comparative genomic hybridization on encoded multiplex particles
US20090104613A1 (en) * 2005-12-23 2009-04-23 Perkinelmer Las, Inc. Methods and compositions relating to multiplexed genomic gain and loss assays
EP1975254A4 (en) 2006-01-20 2009-12-02 Olympus Corp Method of detecting nucleotide sequence with an intramolecular probe
EP1991700B1 (en) 2006-02-13 2012-01-11 The Government of the United States of America as Represented by the Secretary of the Department of Health and Human Services Primers and probes for detection and discrimination of types and subtypes of influenza viruses
US20070196849A1 (en) * 2006-02-22 2007-08-23 Applera Corporation Double-ligation Method for Haplotype and Large-scale Polymorphism Detection
US20070196832A1 (en) * 2006-02-22 2007-08-23 Efcavitch J William Methods for mutation detection
DK1991698T3 (en) * 2006-03-01 2014-03-10 Keygene Nv "High-throughput" -sekvensbaseret detection of SNPs using ligeringsassays
US8673567B2 (en) * 2006-03-08 2014-03-18 Atila Biosystems, Inc. Method and kit for nucleic acid sequence detection
DE102006020885A1 (en) * 2006-05-05 2007-11-08 Qiagen Gmbh Inserting a tag sequence into a nucleic acid comprises using an anchor oligonucleotide comprising a hybridizing anchor sequence and a nonhybridizing tag-template sequence
US7833716B2 (en) * 2006-06-06 2010-11-16 Gen-Probe Incorporated Tagged oligonucleotides and their use in nucleic acid amplification methods
US20080044822A1 (en) * 2006-08-21 2008-02-21 Gafur Zainiev Nucleic acid array with releaseable nucleic acid probes
US20080044821A1 (en) * 2006-08-21 2008-02-21 Gafur Zainiev Nucleic acid array having fixed nucleic acid anti-probes and complementary free nucleic acid probes
US20100056388A1 (en) * 2006-08-21 2010-03-04 Cnvgenes, Inc. Nucleic acid array having fixed nucleic acid anti-probes and complementary free nucleic acid probes
US20090286694A1 (en) * 2006-08-21 2009-11-19 Gafur Zainiev Nucleic acid array with releaseable nucleic acid probes
US20080050724A1 (en) * 2006-08-24 2008-02-28 Microfluidic Systems, Inc. Method of detecting one or more limited copy targets
JP2008072950A (en) * 2006-09-21 2008-04-03 Sysmex Corp Method for confirming conversion treatment and nucleic acid molecule used therefor
US8568979B2 (en) 2006-10-10 2013-10-29 Illumina, Inc. Compositions and methods for representational selection of nucleic acids from complex mixtures using hybridization
US20080090238A1 (en) * 2006-10-12 2008-04-17 Dan-Hui Dorothy Yang Increased sensitivity of proximity ligation assays
EP2084297A4 (en) 2006-10-20 2010-10-20 Celera Corp Genetic polymorphisms associated with venous thrombosis, methods of detection and uses thereof
US20090074637A1 (en) * 2006-11-03 2009-03-19 Murphy Michael C Optimized Modular Microfluidic Devices
US7902345B2 (en) 2006-12-05 2011-03-08 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
US8133701B2 (en) * 2006-12-05 2012-03-13 Sequenom, Inc. Detection and quantification of biomolecules using mass spectrometry
JP2008148570A (en) * 2006-12-14 2008-07-03 Hitachi Ltd Microorganism detection system
EP2121956B1 (en) 2006-12-21 2016-08-17 Gen-Probe Incorporated Methods and compositions for nucleic acid amplification
CA2673870A1 (en) 2006-12-27 2008-07-10 Emory University Compositions and methods for the treatment of infections and tumors
US20080182235A1 (en) * 2007-01-30 2008-07-31 Celsis International Plc Detection of Analytes in Samples Using Liposome-Amplified Luminescence and Magnetic Separation
WO2008096375A3 (en) 2007-02-07 2008-12-18 Decode Genetics Ehf Genetic variants contributing to risk of prostate cancer
WO2008118839A1 (en) * 2007-03-23 2008-10-02 Dana-Farber Cancer Institute, Inc. Exon grouping analysis
WO2008118998A3 (en) * 2007-03-27 2008-11-27 Elizabeth Garcia Method for multiplex detection and quantitation of nucleic acids
US20080274458A1 (en) * 2007-05-01 2008-11-06 Latham Gary J Nucleic acid quantitation methods
KR101651678B1 (en) 2007-05-21 2016-08-26 제넨테크, 인크. Methods and compositions for identifying and treating lupus
US20090036325A1 (en) * 2007-05-25 2009-02-05 Applera Corporation Directed assembly of amplicons to enhance read pairing signature with massively parallel short read sequencers
WO2008146309A3 (en) 2007-05-25 2009-01-22 Decode Genetics Ehf Genetic variants on chr 5pl2 and 10q26 as markers for use in breast cancer risk assessment, diagnosis, prognosis and treatment
US7947446B2 (en) * 2007-05-29 2011-05-24 Ming-Sheng Lee High throughput mutation screening methods and kits using a universalized approach—differential sequence fill-in (DSF)-enabled sequential adapter ligation and amplification
CA2688225C (en) 2007-05-31 2017-09-26 Yale University A genetic lesion associated with cancer
EP2150628B1 (en) * 2007-06-01 2013-12-11 Monoquant PTY LTD A method for dna breakpoint analysis
CA2690043A1 (en) * 2007-06-06 2008-12-18 Bio-Rad Laboratories, Inc. Signal amplification using circular hairpin probes
JP5165933B2 (en) * 2007-06-12 2013-03-21 日本碍子株式会社 Detection methods and arrays of the specific subsequence of a target nucleic acid
US8008010B1 (en) * 2007-06-27 2011-08-30 Applied Biosystems, Llc Chimeric oligonucleotides for ligation-enhanced nucleic acid detection, methods and compositions therefor
US9512470B2 (en) * 2007-07-11 2016-12-06 Pathofinder Holding B.V. Method for the simultaneous detection of multiple nucleic acid sequences in a sample
EP2195452B1 (en) 2007-08-29 2012-03-14 Sequenom, Inc. Methods and compositions for universal size-specific polymerase chain reaction
CA2697640C (en) * 2007-09-21 2016-06-21 Katholieke Universiteit Leuven Tools and methods for genetic tests using next generation sequencing
JP2010539991A (en) * 2007-10-04 2010-12-24 ハルシオン モレキュラー Sequencing of nucleic acid polymers by using an electron microscope
EP2207894A2 (en) * 2007-10-12 2010-07-21 Decode Genetics EHF Sequence variants for inferring human pigmentation patterns
US9428746B2 (en) 2007-10-31 2016-08-30 Akonni Biosystems, Inc. Method and kit for purifying nucleic acids
US20090111193A1 (en) 2007-10-31 2009-04-30 Cooney Christopher G Sample preparation device
US7759112B2 (en) * 2007-10-31 2010-07-20 Akonni Biosystems, Inc. Apparatus, system, and method for purifying nucleic acids
US8039212B2 (en) 2007-11-05 2011-10-18 Celera Corporation Genetic polymorphisms associated with liver fibrosis, methods of detection and uses thereof
EP2215250B1 (en) 2007-11-27 2013-02-27 Human Genetic Signatures Pty Ltd Enzymes for amplification and copying bisulphite modified nucleic acids
US8093063B2 (en) * 2007-11-29 2012-01-10 Quest Diagnostics Investments Incorporated Assay for detecting genetic abnormalities in genomic nucleic acids
US8298768B2 (en) 2007-11-29 2012-10-30 Complete Genomics, Inc. Efficient shotgun sequencing methods
US8697360B2 (en) 2007-11-30 2014-04-15 Decode Genetics Ehf. Genetic variants on CHR 11Q and 6Q as markers for prostate and colorectal cancer predisposition
US7932037B2 (en) * 2007-12-05 2011-04-26 Perkinelmer Health Sciences, Inc. DNA assays using amplicon probes on encoded particles
US20090181390A1 (en) * 2008-01-11 2009-07-16 Signosis, Inc. A California Corporation High throughput detection of micrornas and use for disease diagnosis
WO2009091719A1 (en) 2008-01-14 2009-07-23 Applera Corporation Compositions, methods, and kits for detecting ribonucleic acid
US8034568B2 (en) * 2008-02-12 2011-10-11 Nugen Technologies, Inc. Isothermal nucleic acid amplification methods and compositions
WO2009101639A1 (en) * 2008-02-14 2009-08-20 Decode Genetics Ehf. Susceptibility variants for lung cancer
US20090221620A1 (en) 2008-02-20 2009-09-03 Celera Corporation Gentic polymorphisms associated with stroke, methods of detection and uses thereof
KR101419980B1 (en) * 2008-03-15 2014-07-15 홀로직, 인크. Compositions and methods for analysis of nucleic acid molecules during amplification reactions
GB2470672B (en) 2008-03-21 2012-09-12 Nugen Technologies Inc Methods of RNA amplification in the presence of DNA
JP5319148B2 (en) * 2008-03-27 2013-10-16 日本碍子株式会社 Detection methods and arrays of the mutation in the target nucleic acid
EP2274450A2 (en) 2008-04-01 2011-01-19 Decode Genetics EHF Susceptibility variants for peripheral arterial disease and abdominal aortic aneurysm
EP2271767B1 (en) * 2008-04-03 2016-06-29 CB Biotechnologies, Inc. Amplicon rescue multiplex polymerase chain reaction for amplificaton of multiple targets
WO2009129521A3 (en) * 2008-04-19 2010-02-18 New York University Immunodominant mycobacterium tuberculosis peptides from cell wall proteins for early diagnosis and immunization
JP2009268665A (en) * 2008-05-07 2009-11-19 Canon Inc Inhalation device
CN101586150B (en) * 2008-05-23 2016-09-28 陕西佰美基因股份有限公司 Detection probe, oligonucleotide microarrays and general nucleic acid detection method and use thereof
EP2313520B1 (en) * 2008-07-04 2014-08-27 Decode Genetics EHF Copy number variations predictive of risk of schizophrenia
EP2313525A2 (en) 2008-07-07 2011-04-27 Decode Genetics EHF Genetic variants for breast cancer risk assessment
EP2733222A1 (en) 2008-07-09 2014-05-21 Celera Corporation Genetic polymorphisms associated with cardiovascular diseases, methods of detection and uses thereof
US20100159506A1 (en) * 2008-07-25 2010-06-24 Cellscape Corporation Methods and systems for genetic analysis of fetal nucleated red blood cells
WO2010013771A1 (en) * 2008-07-30 2010-02-04 独立行政法人産業技術総合研究所 Universal nucleic acid probe set and method for utilization thereof
EP2334820A1 (en) * 2008-08-12 2011-06-22 Decode Genetics EHF Genetic variants useful for risk assessment of thyroid cancer
CA2734123A1 (en) * 2008-08-15 2010-02-18 Decode Genetics Ehf Genetic variants predictive of cancer risk
CN102203287B (en) * 2008-08-26 2017-09-19 弗卢迪格姆公司 Increase the sample / or target throughput method for measuring and
CA2743104A1 (en) 2008-11-07 2010-05-14 University Of Utah Research Foundation Preferential amplification and detection of minor allele
CA2744449A1 (en) 2008-11-28 2010-06-03 Emory University Methods for the treatment of infections and tumors
CN102301005A (en) * 2008-12-17 2011-12-28 生命技术公司 A method for detecting allelic variants, compositions, and kits
JP5805064B2 (en) 2009-03-27 2015-11-04 ライフ テクノロジーズ コーポレーション The method for detecting allelic variants, compositions, and kits
US8759002B2 (en) 2009-01-30 2014-06-24 Kantonsspital Aarau Ag Gene dosage analysis
US20120028254A1 (en) 2009-02-06 2012-02-02 Weidhaas Joanne B SNP Marker of Breast and Ovarian Cancer Risk
EP2399131B1 (en) 2009-02-20 2014-08-27 The U.S.A. As Represented By The Secretary, Department Of Health And Human Services Method for the diagnosis of age-associated vascular disorders
US20120021949A1 (en) * 2009-03-31 2012-01-26 Centre Hospitalier Universitaire Vaudois Methylation Ligation-Dependent Macroarray (MLM)
EP2765205B1 (en) * 2009-04-01 2016-05-18 DxTerity Diagnostics Incorporated Chemical ligation dependent probe amplification (CLPA)
EP2789694A1 (en) 2009-04-02 2014-10-15 Fluidigm Corporation Microfluidic device with reaction product recovery system
US8795963B2 (en) 2009-04-03 2014-08-05 Decode Genetics Ehf. Genetic markers for risk management of atrial fibrillation and stroke
EP2256215A1 (en) 2009-04-30 2010-12-01 Steffen Mergemeier Assay system using a nuclease activity of a nucleic acid polymerase
EP2451975A4 (en) * 2009-05-08 2013-08-14 Decode Genetics Ehf Genetic variants contributing to risk of prostate cancer
US20110003301A1 (en) * 2009-05-08 2011-01-06 Life Technologies Corporation Methods for detecting genetic variations in dna samples
US20100299773A1 (en) * 2009-05-20 2010-11-25 Monsanto Technology Llc Methods and compositions for selecting an improved plant
WO2010138908A1 (en) 2009-05-29 2010-12-02 Ventana Medical Systems, Inc. Igfir gene copy number as a prognostic marker in a non-small cell lung cancer
WO2010138912A1 (en) 2009-05-29 2010-12-02 Ventana Medical Systems, Inc. Methods of scoring gene copy number in a biological sample using in situ hybridization
US8835117B2 (en) 2009-05-29 2014-09-16 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention Nucleic acids for detection and discrimination of genotypes of Chlamydophila psittaci
JP2012531210A (en) 2009-06-25 2012-12-10 イェール ユニバ−シティ−Yale University Single nucleotide polymorphisms and cancer risk in Brca1
WO2011003020A1 (en) 2009-07-01 2011-01-06 Gen-Probe Incorporated Methods and compositions for nucleic acid amplification
WO2011004405A1 (en) 2009-07-10 2011-01-13 Decode Genetics Ehf Genetic markers associated with risk of diabetes mellitus
US9487839B2 (en) * 2009-09-29 2016-11-08 Case Western Reserve University Method for detecting single nucleotide polymorphisms
EP2486152B1 (en) 2009-10-07 2017-12-06 H. Hoffnabb-La Roche Ag Methods for diagnosing lupus
JP5663491B2 (en) * 2009-10-29 2015-02-04 日本碍子株式会社 The method for detecting a target nucleic acid
US20120202704A1 (en) * 2009-12-07 2012-08-09 Illumina, Inc. Multi-sample indexing for multiplex genotyping
WO2011091106A3 (en) * 2010-01-22 2011-11-24 The Regents Of The University Of California Compositions and methods for gene signature - based chemical screening
US8774488B2 (en) 2010-03-11 2014-07-08 Cellscape Corporation Method and device for identification of nucleated red blood cells from a maternal blood sample
EP2558596A2 (en) 2010-04-16 2013-02-20 The Government Of The United States Of America As Reresented By The Secretary Of The Department Of Health & Human Services Real time pcr assay for detection of bacterial respiratory pathogens
WO2011133474A3 (en) 2010-04-18 2014-04-03 Beth Israel Deaconess Medical Center Methods of predicting predisposition to or risk of kidney disease
US20110269735A1 (en) 2010-04-19 2011-11-03 Celera Corporation Genetic polymorphisms associated with statin response and cardiovascular diseases, methods of detection and uses thereof
WO2012006056A3 (en) 2010-06-29 2012-04-05 Oregon Health & Science University Ccr6 as a biomarker of alzheimer's disease
WO2012003330A3 (en) 2010-06-30 2012-12-06 Stratos Genomics, Inc Multiplexed identification of nucleic acid sequences
US20120034603A1 (en) 2010-08-06 2012-02-09 Tandem Diagnostics, Inc. Ligation-based detection of genetic variants
US20140342940A1 (en) 2011-01-25 2014-11-20 Ariosa Diagnostics, Inc. Detection of Target Nucleic Acids using Hybridization
EP2611924A2 (en) 2010-08-30 2013-07-10 Dow Agrosciences LLC Activation tagging platform for maize, and resultant tagged population and plants
EP2611925B1 (en) 2010-08-30 2017-11-29 Dow AgroSciences LLC Sugarcane bacilliform viral (scbv) enhancer and its use in plant functional genomics
WO2012054933A3 (en) * 2010-10-22 2012-06-28 Fluidigm Corporation Universal probe assay methods
US9228970B2 (en) * 2010-12-08 2016-01-05 Imec Heat-transfer resistance based analysis bioparticles
EP2663656B1 (en) 2011-01-13 2016-08-24 Decode Genetics EHF Genetic variants as markers for use in urinary bladder cancer risk assessment
DK2665833T3 (en) 2011-01-17 2017-07-24 Life Technologies Corp Working procedure for the detection of ligands using nucleic acids
US8756020B2 (en) 2011-01-25 2014-06-17 Ariosa Diagnostics, Inc. Enhanced risk probabilities using biomolecule estimations
US20120190020A1 (en) 2011-01-25 2012-07-26 Aria Diagnostics, Inc. Detection of genetic abnormalities
CN103403543B9 (en) 2011-01-25 2017-05-17 阿尔玛克诊断有限公司 Colon cancer gene expression signature and use
US8700338B2 (en) 2011-01-25 2014-04-15 Ariosa Diagnosis, Inc. Risk calculation for evaluation of fetal aneuploidy
US20140024590A1 (en) 2011-02-18 2014-01-23 Yale University KRAS-Variant And Endometriosis
WO2012118745A1 (en) 2011-02-28 2012-09-07 Arnold Oliphant Assay systems for detection of aneuploidy and sex determination
US8759036B2 (en) 2011-03-21 2014-06-24 Affymetrix, Inc. Methods for synthesizing pools of probes
US20140065615A1 (en) 2011-03-21 2014-03-06 Yale University The KRAS Variant and Tumor Biology
US20140115732A1 (en) 2011-04-29 2014-04-24 Monsanto Technology Llc Diagnostic Molecular Markers for Seed Lot Purity Traits in Soybeans
CN103649335B (en) 2011-05-04 2015-11-25 Htg分子诊断有限公司 Quantitative nuclease protection assay (qNPA) and sequencing (qnps) Improvement
CN103635594A (en) 2011-05-09 2014-03-12 富鲁达公司 Probe based nucleic acid detection
KR20140064735A (en) * 2011-05-17 2014-05-28 디엑스테리티 다이아그노스틱스 인코포레이티드 Methods and compositions for detecting target nucleic acids
CN103796987B (en) 2011-06-08 2016-09-21 生命技术公司 The new detergent for pcr system design and development
US9567628B2 (en) 2011-06-08 2017-02-14 Life Technologies Corporation Polymerization of nucleic acids using proteins having low isoelectric points
US9040244B2 (en) 2011-07-05 2015-05-26 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention HIV-1 genotyping assay for global surveillance of HIV-1 drug resistance
CA2840929A1 (en) * 2011-07-08 2013-01-17 Keygene N.V. Sequence based genotyping based on oligonucleotide ligation assays
WO2013010074A1 (en) 2011-07-13 2013-01-17 Primeradx, Inc. Multimodal methods for simultaneous detection and quantification of multiple nucleic acids in a sample
US9670540B2 (en) 2011-07-21 2017-06-06 Cornell University Methods and devices for DNA sequencing and molecular diagnostics
US8712697B2 (en) 2011-09-07 2014-04-29 Ariosa Diagnostics, Inc. Determination of copy number variations using binomial probability calculations
KR20140064918A (en) 2011-09-07 2014-05-28 휴먼 제네틱 시그너처스 피티와이 엘티디 Molecular detection assay
WO2013049535A3 (en) 2011-09-30 2013-07-11 The United States Of America, As Represented By The Secretary, Department Of Health & Human Services Influenza vaccine
WO2013059746A1 (en) 2011-10-19 2013-04-25 Nugen Technologies, Inc. Compositions and methods for directional nucleic acid amplification and sequencing
CN103930568A (en) 2011-11-10 2014-07-16 霍夫曼-拉罗奇有限公司 Methods for treating, diagnosing and monitoring Alzheimer 's disease
EP2780466A1 (en) 2011-11-15 2014-09-24 Université Libre de Bruxelles Streptococcus pneumoniae detection in blood
US20130195870A1 (en) 2011-11-30 2013-08-01 Genentech, Inc. ERBB3 Mutations In Cancer
EP2785874A4 (en) 2011-11-30 2015-08-19 Childrens Hosp Medical Center Personalized pain management and anesthesia: preemptive risk identification and therapeutic decision support
CN104114719A (en) 2011-12-14 2014-10-22 由卫生福利和体育大臣代表的荷兰王国 Identification of poliovirus strains
GB2533882B (en) 2012-01-26 2016-10-12 Nugen Tech Inc Method of enriching and sequencing nucleic acids of interest using massively parallel sequencing
WO2013122826A1 (en) * 2012-02-14 2013-08-22 Gnubio, Inc. Cascaded addition of target specific universal adapters to nucleic acids
EP2820155B1 (en) * 2012-02-28 2017-07-26 Population Genetics Technologies Ltd. Method for attaching a counter sequence to a nucleic acid sample
RU2639517C2 (en) 2012-02-29 2017-12-21 ДАУ АГРОСАЙЕНСИЗ ЭлЭлСи Enhancer of sugar cane baculovirus (scbv) and its application in functional genomics of plants
US9045803B2 (en) 2012-02-29 2015-06-02 Abbott Molecular Inc. Hepatitis B virus typing and resistance assay
WO2013148147A8 (en) 2012-03-26 2013-11-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Dna methylation analysis for the diagnosis, prognosis and treatment of adrenal neoplasms
WO2013165551A1 (en) 2012-05-03 2013-11-07 The Government Of The Usa As Represented By The Secretary Of The Department Of Health And Human Services Methods of detecting influenza virus
KR101184566B1 (en) * 2012-05-11 2012-09-20 케이맥(주) Method for integrated analysis of real-time pcr and dna chip
US9840732B2 (en) 2012-05-21 2017-12-12 Fluidigm Corporation Single-particle analysis of particle populations
US20160017430A1 (en) 2012-05-24 2016-01-21 Fundació Institut D'investigació Biomèdica De Bellvitge (Idibell) Method for the identification of the origin of a cancer of unknown primary origin by methylation analysis
US9394574B2 (en) 2012-06-12 2016-07-19 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Methods for detecting Legionella nucleic acids in a sample
EP2861757A1 (en) 2012-06-14 2015-04-22 Life Technologies Corporation Novel compositions, methods and kits for real time polymerase chain reaction (pcr)
WO2013192292A1 (en) 2012-06-21 2013-12-27 Justin Lamb Massively-parallel multiplex locus-specific nucleic acid sequence analysis
JP2015522293A (en) 2012-07-19 2015-08-06 アリオサ ダイアグノスティックス インコーポレイテッドAriosa Diagnostics,Inc. Detection of genetic variants based on multiplexing continuous ligation
EP2893034A4 (en) * 2012-09-10 2016-04-13 Genesky Diagnostics Suzhou Inc Method for multiplex nucleic acid analysis
EP2914743A1 (en) 2012-11-02 2015-09-09 Life Technologies Corporation Small rna capture, detection and quantification
WO2014074942A1 (en) 2012-11-08 2014-05-15 Illumina, Inc. Risk variants of alzheimer's disease
US20140157450A1 (en) 2012-12-04 2014-06-05 Seminis Vegetable Seeds, Inc. Methods and compositions for watermelon sex expression
WO2014089536A1 (en) * 2012-12-07 2014-06-12 Invitae Corporation Multiplex nucleic acid detection methods
WO2014110528A1 (en) * 2013-01-13 2014-07-17 Unitaq Bio Methods and compositions for pcr using blocked and universal primers
CN105247072A (en) 2013-02-25 2016-01-13 基因泰克公司 Methods and compositions for detecting and treating drug resistant akt mutant
US20140274774A1 (en) 2013-03-12 2014-09-18 Life Technologies Corporation Universal reporter-based genotyping methods and materials
GB201515589D0 (en) 2013-03-15 2015-10-21 Abvitro Inc Single cell bar-coding for antibody discovery
WO2014144092A1 (en) 2013-03-15 2014-09-18 Nugen Technologies, Inc. Sequential sequencing
WO2014176259A1 (en) 2013-04-22 2014-10-30 Icahn School Of Medicine At Mount Sinai Mutations in pdgfrb and notch3 as causes of autosomal dominant infantile myofibromatosis
WO2015026873A1 (en) * 2013-08-19 2015-02-26 Singular Bio, Inc. Assays for single molecule detection and use thereof
US20150113679A1 (en) 2013-09-25 2015-04-23 Board Of Regents Of The University Of Nebraska Methods and Compositions for Obtaining Useful Plant Traits
US20160251732A1 (en) 2013-10-22 2016-09-01 THE GOVERNMENT OF THE USA as represented by THE SE CRETARY OH THE DEPARTMENT OF HEALTH AND HUMAN SER Compositions and methods for detection and discrimination of influenza viruses
JP2017501969A (en) 2013-10-25 2017-01-19 ライフ テクノロジーズ コーポレーション Novel compounds and the use thereof for use in Pcr System
EP2891722A1 (en) 2013-11-12 2015-07-08 Population Diagnostics, Inc. Methods and compositions for diagnosing, prognosing, and treating endometriosis
EP3074537A4 (en) * 2013-11-26 2017-07-26 Bio-Rad Laboratories Inc Methods for detecting nucleic acid proximity
US20150150155A1 (en) 2013-11-27 2015-05-28 Seminis Vegetable Seeds, Inc. Disease resistance loci in onion
CN105452486A (en) * 2014-01-10 2016-03-30 生物辐射实验室股份有限公司 Intercalating dyes for differential detection
WO2015127201A8 (en) 2014-02-21 2016-09-22 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Hiv-2 nucleic acids and methods of detection
KR20160123385A (en) 2014-02-24 2016-10-25 칠드런즈 호스피탈 메디칼 센터 Methods and compositions for personalized pain management
US20150240256A1 (en) 2014-02-27 2015-08-27 Seminis Vegetable Seeds, Inc. Compositions and methods for peronospora resistance in spinach
US9745614B2 (en) 2014-02-28 2017-08-29 Nugen Technologies, Inc. Reduced representation bisulfite sequencing with diversity adaptors
US20170044631A1 (en) 2014-04-14 2017-02-16 The Unite States of America, as represented by the Secretary, Dept. of Health and Human Services Methods for rapid detection and identification of viral nucleic acids
US20150337298A1 (en) 2014-05-23 2015-11-26 Fluidigm Corporation Haploidome determination by digitized transposons
EP3149195A1 (en) * 2014-06-02 2017-04-05 Base4 Innovation Ltd Nucleotide polymorphism detection method
US20170204459A1 (en) * 2014-06-06 2017-07-20 Cornell University Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions
WO2015199976A8 (en) 2014-06-24 2016-02-25 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Target activated microdissection
US20160130670A1 (en) 2014-06-27 2016-05-12 Seminis Vegetable Seeds, Inc. Methods and assays for male sterile watermelon
EP3183368A1 (en) 2014-08-22 2017-06-28 Cepheid Methods of detecting influenza
CN107002076A (en) 2014-09-15 2017-08-01 阿布维特罗有限责任公司 High-throughput nucleotide library sequencing
EP3204520A2 (en) * 2014-10-08 2017-08-16 Cornell University Method for identification and quantification of nucleic acid expression, splice variant, translocation, copy number, or methylation changes
EP3005862A1 (en) 2014-10-10 2016-04-13 Seminis Vegetable Seeds, Inc. Melon plants with improved disease tolerance
EP3207156A1 (en) 2014-10-13 2017-08-23 Life Technologies Corporation Methods, kits & compositions for determining gene copy numbers
WO2016069853A3 (en) 2014-10-30 2016-06-23 Cepheid Methods of detecting ebola
EP3234188A1 (en) 2014-12-15 2017-10-25 Cepheid Exponential base-greater-than-2 nucleic acid amplification
KR101728023B1 (en) * 2015-01-02 2017-04-18 주식회사 랩 지노믹스 Detection of mutations in ATP7B gene using PCR-LDR
US9856521B2 (en) 2015-01-27 2018-01-02 BioSpyder Technologies, Inc. Ligation assays in liquid phase
JP2016140288A (en) * 2015-01-30 2016-08-08 倉敷紡績株式会社 Preparation method of single stranded dna product
US9434996B1 (en) 2015-03-13 2016-09-06 Tracy Ann Hayden All mini-STR multiplex with increased C.E. through-put by STR prolongation template fusion
US20160299129A1 (en) * 2015-04-07 2016-10-13 Xiaolei Qiu Ultra Sensitive and Specific Multiplex Biosensor System Based on Multiple Cooperative Interactions
US20160312276A1 (en) * 2015-04-23 2016-10-27 Cellular Research, Inc. Methods and compositions for whole transcriptome amplification
WO2016205233A3 (en) 2015-06-15 2017-02-02 Cepheid Integrated purification and measurement of dna methylation and co-measurement of mutations and/or mrna expression levels in an automated reaction cartridge
US20170064918A1 (en) 2015-09-03 2017-03-09 Seminis Vegetable Seeds, Inc. Downy mildew resistant lettuce plants
WO2017053903A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Single amplicon activated exclusion pcr
WO2017053905A1 (en) 2015-09-24 2017-03-30 Abvitro Llc Affinity-oligonucleotide conjugates and uses thereof
WO2017053902A1 (en) 2015-09-25 2017-03-30 Abvitro Llc High throughput process for t cell receptor target identification of natively-paired t cell receptor sequences
US20170298427A1 (en) 2015-11-16 2017-10-19 Progenity, Inc. Nucleic acids and methods for detecting methylation status
WO2017123696A1 (en) 2016-01-12 2017-07-20 Interleukin Genetics, Inc. Methods for predicting response to treatment
WO2017189906A1 (en) 2016-04-27 2017-11-02 Mira Dx, Inc. Immune-based treatment of kras-variant cancer patients

Family Cites Families (129)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5258506A (en) * 1984-10-16 1993-11-02 Chiron Corporation Photolabile reagents for incorporation into oligonucleotide chains
US4883750A (en) * 1984-12-13 1989-11-28 Applied Biosystems, Inc. Detection of specific sequences in nucleic acids
US4683202B1 (en) 1985-03-28 1990-11-27 Cetus Corp
US4925785A (en) 1986-03-07 1990-05-15 Biotechnica Diagnostics, Inc. Nucleic acid hybridization assays
US5525464A (en) 1987-04-01 1996-06-11 Hyseq, Inc. Method of sequencing by hybridization of oligonucleotide probes
US5202231A (en) * 1987-04-01 1993-04-13 Drmanac Radoje T Method of sequencing of genomes by hybridization of oligonucleotide probes
DE68908054D1 (en) 1988-01-21 1993-09-09 Genentech Inc Strengthening and detection of nucleic acid.
US4988617A (en) * 1988-03-25 1991-01-29 California Institute Of Technology Method of detecting a nucleotide change in nucleic acids
GB8810400D0 (en) * 1988-05-03 1988-06-08 Southern E Analysing polynucleotide sequences
US5700637A (en) 1988-05-03 1997-12-23 Isis Innovation Limited Apparatus and method for analyzing polynucleotide sequences and method of generating oligonucleotide arrays
US5185243A (en) 1988-08-25 1993-02-09 Syntex (U.S.A.) Inc. Method for detection of specific nucleic acid sequences
CA1336394C (en) 1988-08-30 1995-07-25 Thomas G. Laffler Detection and amplification of target nucleic acid sequences
DE69031318D1 (en) 1989-03-17 1997-10-02 Abbott Lab Method and apparatus for hybridization of nucleic acid with improved reaction kinetics
WO1990011372A1 (en) 1989-03-21 1990-10-04 Collaborative Research, Inc. Multiplex dna diagnostic test
US5035996A (en) * 1989-06-01 1991-07-30 Life Technologies, Inc. Process for controlling contamination of nucleic acid amplification reactions
US5527681A (en) 1989-06-07 1996-06-18 Affymax Technologies N.V. Immobilized molecular synthesis of systematically substituted compounds
US5744101A (en) 1989-06-07 1998-04-28 Affymax Technologies N.V. Photolabile nucleoside protecting groups
US5143854A (en) * 1989-06-07 1992-09-01 Affymax Technologies N.V. Large scale photolithographic solid phase synthesis of polypeptides and receptor binding screening thereof
US5424186A (en) * 1989-06-07 1995-06-13 Affymax Technologies N.V. Very large scale immobilized polymer synthesis
GB8920097D0 (en) * 1989-09-06 1989-10-18 Ici Plc Amplification processes
US5104792A (en) * 1989-12-21 1992-04-14 The United States Of America As Represented By The Department Of Health And Human Services Method for amplifying unknown nucleic acid sequences
US5516663A (en) 1990-01-26 1996-05-14 Abbott Laboratories Ligase chain reaction with endonuclease IV correction and contamination control
CA2040896C (en) 1990-04-20 2002-01-29 Edwin F. Ullman Double receptor polynucleotide assay method
US5494810A (en) * 1990-05-03 1996-02-27 Cornell Research Foundation, Inc. Thermostable ligase-mediated DNA amplifications system for the detection of genetic disease
ES2294777T3 (en) 1990-05-03 2008-04-01 California Institute Of Technology DNA amplification system mediated thermostable ligase for the detection of genetic diseases.
DE69130800D1 (en) * 1990-07-24 1999-03-04 Hoffmann La Roche Reducing non-specific amplification during a (in vitro) nucleic acid amplification using modified nucleic acid bases
US5484699A (en) 1990-09-28 1996-01-16 Abbott Laboratories Nucleotide sequences useful as type specific probes, PCR primers and LCR probes for the amplification and detection of human papilloma virus, and related kits and methods
CA2046713A1 (en) * 1990-10-16 1992-04-17 Richard M. Martinelli Amplification of midivariant dna templates
US5700636A (en) 1990-10-19 1997-12-23 Becton Dickinson And Company Methods for selectively detecting microorganisms associated with vaginal infections in complex biological samples
CA2055755A1 (en) 1990-11-22 1992-05-23 Toshihiko Kishimoto Method of immobilizing single-stranded dna on carrier at terminal
DE69132843D1 (en) * 1990-12-06 2002-01-10 Affymetrix Inc Identifying nucleic acids in samples
DE4039348A1 (en) 1990-12-10 1992-06-11 Henkel Kgaa Carpet cleaners
WO1992010566A1 (en) 1990-12-13 1992-06-25 Board Of Regents, The University Of Texas System In-situ hybridization probes for identification and banding of specific human chromosomes and regions
WO1992011390A1 (en) * 1990-12-17 1992-07-09 Idexx Laboratories, Inc. Nucleic acid sequence detection by triple helix formation
US5290925A (en) * 1990-12-20 1994-03-01 Abbott Laboratories Methods, kits, and reactive supports for 3' labeling of oligonucleotides
RU1794088C (en) * 1991-03-18 1993-02-07 Институт Молекулярной Биологии Ан@ Ссср Method of dna nucleotide sequence determination and a device for its realization
WO1992021079A1 (en) * 1991-05-24 1992-11-26 The President And Fellows Of Harvard College Parallel sequential reactor
US5278298A (en) * 1991-05-29 1994-01-11 Merck & Co., Inc. Eimeria brunetti 16s rDNA probes
GB9112251D0 (en) 1991-06-07 1991-07-24 Amersham Int Plc Quantitative detection of nucleic acid amplification products
DE69213112D1 (en) * 1991-06-20 1996-10-02 Hoffmann La Roche Improved methods for nucleic acid amplification
US5371241A (en) * 1991-07-19 1994-12-06 Pharmacia P-L Biochemicals Inc. Fluorescein labelled phosphoramidites
WO1993004199A3 (en) 1991-08-20 1993-04-15 Scient Generics Ltd Methods of detecting or quantitating nucleic acids and of producing labelled immobilised nucleic acids
DE69223980D1 (en) 1991-10-15 1998-02-12 Multilyte Ltd binding assay using a labeled reagent
DE69232753T2 (en) 1991-11-01 2003-05-15 Diatech Pty Ltd Enhancements proceed solid-phase
US5594121A (en) 1991-11-07 1997-01-14 Gilead Sciences, Inc. Enhanced triple-helix and double-helix formation with oligomers containing modified purines
US5324633A (en) * 1991-11-22 1994-06-28 Affymax Technologies N.V. Method and apparatus for measuring binding affinity
US5985548A (en) 1993-02-04 1999-11-16 E. I. Du Pont De Nemours And Company Amplification of assay reporters by nucleic acid replication
WO1993017126A1 (en) * 1992-02-19 1993-09-02 The Public Health Research Institute Of The City Of New York, Inc. Novel oligonucleotide arrays and their use for sorting, isolating, sequencing, and manipulating nucleic acids
EP1018649A3 (en) 1992-03-31 2000-11-29 Abbott Laboratories Immunochromatographic device and method for multiplex detection of multiple analytes
US5470705A (en) 1992-04-03 1995-11-28 Applied Biosystems, Inc. Probe composition containing a binding domain and polymer chain and methods of use
JP2775346B2 (en) 1992-04-03 1998-07-16 アプライド バイオシステムズ,インコーポレイテッド Probe constructs and methods
US5412087A (en) 1992-04-24 1995-05-02 Affymax Technologies N.V. Spatially-addressable immobilization of oligonucleotides and other biological polymers on surfaces
US5686272A (en) 1992-05-29 1997-11-11 Abbott Laboratories Amplification of RNA sequences using the ligase chain reaction
EP0607151B1 (en) 1992-06-17 2002-11-13 City Of Hope A method of detecting and discriminating between nucleic acid sequences
US5981176A (en) 1992-06-17 1999-11-09 City Of Hope Method of detecting and discriminating between nucleic acid sequences
WO1994001446A3 (en) 1992-07-09 1994-03-03 Beckman Instruments Inc Derivatized organic solid support for nucleic acid synthesis
GB9214873D0 (en) 1992-07-13 1992-08-26 Medical Res Council Process for categorising nucleotide sequence populations
JP3516953B2 (en) 1992-08-03 2004-04-05 アボツト・ラボラトリーズ Detection and amplification of target nucleic acid using the equi Sonu Cleo Li tic activity
US6180338B1 (en) 1992-08-04 2001-01-30 Beckman Coulter, Inc. Method, reagent and kit for the detection and amplification of nucleic acid sequences
WO1994006906A1 (en) 1992-09-18 1994-03-31 Merck & Co., Inc. DNA ENCODING MURINE PRECURSOR INTERLEUKIN 1β CONVERTING ENZYME
WO1994008047A1 (en) 1992-09-25 1994-04-14 Abbott Laboratories Ligase chain reaction method for detecting small mutations
WO1994009022A1 (en) * 1992-10-09 1994-04-28 Oncor, Inc. Methods for the detection of chromosome structural abnormalities by in situ hybridization to fixed tissue
US5795714A (en) * 1992-11-06 1998-08-18 Trustees Of Boston University Method for replicating an array of nucleic acid probes
JP2575270B2 (en) * 1992-11-10 1997-01-22 浜松ホトニクス株式会社 Sequencing methods of nucleic acid, single molecule detection method, a method of creating the device and the sample
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
WO1994016105A1 (en) 1993-01-15 1994-07-21 The Public Health Research Institute Of The City Of New York, Inc. Rna assays using rna binary probes and ribozyme ligase
WO1994016108A1 (en) 1993-01-15 1994-07-21 The Public Health Research Institute Of The City Of New York, Inc. Sensitive nucleic acid sandwich hybridization assays and kits
DE69434688D1 (en) 1993-01-15 2006-05-18 New York Health Res Inst Diagnostic detection of RNA and reagentiensätze samples using binary rna and an RNA-dependent RNA ligase
JPH08508636A (en) * 1993-01-27 1996-09-17 オンコール インコーポレーテッド Amplification of nucleic acid sequences
WO1994017206A1 (en) * 1993-01-27 1994-08-04 Oncor, Inc. Method for amplifying nucleic acid sequences
US5593840A (en) * 1993-01-27 1997-01-14 Oncor, Inc. Amplification of nucleic acid sequences
DE69413574T2 (en) * 1993-02-09 1999-05-12 Agfa Gevaert Nv A processing solution and method for making a lithographic offset printing plate according to the silver salt diffusion transfer process
US5593826A (en) 1993-03-22 1997-01-14 Perkin-Elmer Corporation, Applied Biosystems, Inc. Enzymatic ligation of 3'amino-substituted oligonucleotides
CA2122203C (en) * 1993-05-11 2001-12-18 Melinda S. Fraiser Decontamination of nucleic acid amplification reactions
US6709813B1 (en) 1993-05-14 2004-03-23 Ortho-Clinical Diagnostics, Inc. Diagnostic compositions, elements, methods and test kits for amplification and detection of human CMV DNA using primers having matched melting temperatures
US5652106A (en) 1993-06-04 1997-07-29 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Rapid amplification-based subtyping of mycobacterium tuberculosis
US5422252A (en) * 1993-06-04 1995-06-06 Becton, Dickinson And Company Simultaneous amplification of multiple targets
DK72493D0 (en) 1993-06-18 1993-06-18 Risoe Forskningscenter Solid supports for use in peptide synthesis and assays
US5837832A (en) 1993-06-25 1998-11-17 Affymetrix, Inc. Arrays of nucleic acid probes on biological chips
US5731171A (en) * 1993-07-23 1998-03-24 Arch Development Corp. Sequence independent amplification of DNA
US5601978A (en) 1993-09-03 1997-02-11 Abbott Laboratories Oligonucleotides and methods for the detection of chlamydia trachomatis
US5415839A (en) 1993-10-21 1995-05-16 Abbott Laboratories Apparatus and method for amplifying and detecting target nucleic acids
US6156501A (en) 1993-10-26 2000-12-05 Affymetrix, Inc. Arrays of modified nucleic acid probes and methods of use
US5429807A (en) 1993-10-28 1995-07-04 Beckman Instruments, Inc. Method and apparatus for creating biopolymer arrays on a solid support surface
US5352582A (en) * 1993-10-28 1994-10-04 Hewlett-Packard Company Holographic based bio-assay
US5415087A (en) * 1994-01-21 1995-05-16 Norfolk Southern Railway Co. Mobile tie banding apparatus
US5631130A (en) 1994-05-13 1997-05-20 Abbott Laboratories Materials and methods for the detection of Mycobacterium tuberculosis
WO1995031571A3 (en) 1994-05-13 1995-12-21 Abbott Lab Materials and methods for the detection of mycobacteria
US5508168A (en) 1994-05-16 1996-04-16 Hoffmann-La Roche Inc. Methods and reagents for the detection of herpes simplex virus, treponema pallidum, and haemophilus ducreyi
US7378236B1 (en) 1994-06-17 2008-05-27 The Board Of Trustees Of The Leland Stanford Junior University Method for analyzing gene expression patterns
WO1995035390A1 (en) * 1994-06-22 1995-12-28 Mount Sinai School Of Medicine Of The City University Of New York Ligation-dependent amplification for the detection of infectious pathogens and abnormal genes
US5942391A (en) * 1994-06-22 1999-08-24 Mount Sinai School Of Medicine Nucleic acid amplification method: ramification-extension amplification method (RAM)
US5876924A (en) * 1994-06-22 1999-03-02 Mount Sinai School Of Medicine Nucleic acid amplification method hybridization signal amplification method (HSAM)
US5834181A (en) 1994-07-28 1998-11-10 Genzyme Corporation High throughput screening method for sequences or genetic alterations in nucleic acids
WO1996006190A3 (en) * 1994-08-19 1996-05-09 Perkin Elmer Corp Coupled amplification and ligation method
US5648213A (en) 1994-08-30 1997-07-15 Beckman Instruments, Inc. Compositions and methods for use in detection of analytes
US5695934A (en) * 1994-10-13 1997-12-09 Lynx Therapeutics, Inc. Massively parallel sequencing of sorted polynucleotides
WO1996041011A1 (en) 1995-06-07 1996-12-19 Lynx Therapeutics, Inc. Oligonucleotide tags for sorting and identification
US5604097A (en) 1994-10-13 1997-02-18 Spectragen, Inc. Methods for sorting polynucleotides using oligonucleotide tags
US5512441A (en) * 1994-11-15 1996-04-30 American Health Foundation Quantative method for early detection of mutant alleles and diagnostic kits for carrying out the method
WO1996015271A1 (en) 1994-11-16 1996-05-23 Abbott Laboratories Multiplex ligations-dependent amplification
EP0837948B1 (en) 1995-06-05 2007-12-05 bioMérieux, Inc. Device and method for detecting microorganisms
US5728526A (en) 1995-06-07 1998-03-17 Oncor, Inc. Method for analyzing a nucleotide sequence
US5667974A (en) 1995-06-07 1997-09-16 Abbott Laboratories Method for detecting nucleic acid sequences using competitive amplification
US5759779A (en) 1995-08-29 1998-06-02 Dehlinger; Peter J. Polynucleotide-array assay and methods
US5723320A (en) 1995-08-29 1998-03-03 Dehlinger; Peter J. Position-addressable polynucleotide arrays
US5695937A (en) 1995-09-12 1997-12-09 The Johns Hopkins University School Of Medicine Method for serial analysis of gene expression
US6040138A (en) 1995-09-15 2000-03-21 Affymetrix, Inc. Expression monitoring by hybridization to high density oligonucleotide arrays
US5856096A (en) 1995-09-20 1999-01-05 Ctrc Research Foundation Rapid and sensitive assays for detecting and distinguishing between processive and non-processive telomerase activities
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
JP3974941B2 (en) 1995-11-21 2007-09-12 イェール ユニバーシティ Unimolecular segment amplification and detection
US5858659A (en) 1995-11-29 1999-01-12 Affymetrix, Inc. Polymorphism detection
EP0880598A4 (en) 1996-01-23 2005-02-23 Affymetrix Inc Nucleic acid analysis techniques
US6962263B2 (en) * 1996-01-24 2005-11-08 Sambrailo Packaging, Inc. Produce packaging system having produce containers with double-arched ventilation channels
EP2368897B1 (en) 1996-02-09 2016-10-19 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US20020150921A1 (en) 1996-02-09 2002-10-17 Francis Barany Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US6852487B1 (en) 1996-02-09 2005-02-08 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US5868136A (en) 1996-02-20 1999-02-09 Axelgaard Manufacturing Co. Ltd. Medical electrode
WO1997045559A1 (en) 1996-05-29 1997-12-04 Cornell Research Foundation, Inc. Detection of nucleic acid sequence differences using coupled ligase detection and polymerase chain reactions
US6312892B1 (en) 1996-07-19 2001-11-06 Cornell Research Foundation, Inc. High fidelity detection of nucleic acid differences by ligase detection reaction
WO1998036763A1 (en) 1997-02-25 1998-08-27 Eli Lilly And Company Treatment of infertility with leptin receptor ligands
US6313048B1 (en) * 1997-03-03 2001-11-06 Micron Technology, Inc. Dilute cleaning composition and method for using same
US5932711A (en) 1997-03-05 1999-08-03 Mosaic Technologies, Inc. Nucleic acid-containing polymerizable complex
US6899889B1 (en) * 1998-11-06 2005-05-31 Neomend, Inc. Biocompatible material composition adaptable to diverse therapeutic indications
US6506594B1 (en) 1999-03-19 2003-01-14 Cornell Res Foundation Inc Detection of nucleic acid sequence differences using the ligase detection reaction with addressable arrays
US7014994B1 (en) 1999-03-19 2006-03-21 Cornell Research Foundation,Inc. Coupled polymerase chain reaction-restriction-endonuclease digestion-ligase detection reaction process
JP2002539849A (en) 1999-03-26 2002-11-26 アフィメトリックス インコーポレイテッド Universal array
US20030207295A1 (en) 1999-04-20 2003-11-06 Kevin Gunderson Detection of nucleic acid reactions on bead arrays
JP4287652B2 (en) 2000-10-24 2009-07-01 ザ・ボード・オブ・トラスティーズ・オブ・ザ・レランド・スタンフォード・ジュニア・ユニバーシティThe Board Of Trustees Of The Leland Stanford Junior University Behavior analysis by direct multiprocessing genomic dna

Also Published As

Publication number Publication date Type
US20070054306A1 (en) 2007-03-08 application
EP1736554B1 (en) 2013-10-09 grant
US20080171330A1 (en) 2008-07-17 application
US6797470B2 (en) 2004-09-28 grant
US20070042419A1 (en) 2007-02-22 application
US20150018249A1 (en) 2015-01-15 application
US8597890B2 (en) 2013-12-03 grant
CA2255774A1 (en) 1997-12-04 application
US20030032016A1 (en) 2003-02-13 application
US20120252696A1 (en) 2012-10-04 application
US20140315757A1 (en) 2014-10-23 application
US8802373B2 (en) 2014-08-12 grant
US20040203061A1 (en) 2004-10-14 application
US8642269B2 (en) 2014-02-04 grant
WO1997045559A1 (en) 1997-12-04 application
US20040214224A1 (en) 2004-10-28 application
US7166434B2 (en) 2007-01-23 grant
US20120270220A1 (en) 2012-10-25 application
JP5634936B2 (en) 2014-12-03 grant
EP2369007A1 (en) 2011-09-28 application
EP0912761A4 (en) 2004-06-09 application
JP4781372B2 (en) 2011-09-28 grant
US8597891B2 (en) 2013-12-03 grant
US20070048783A1 (en) 2007-03-01 application
US6268148B1 (en) 2001-07-31 grant
US7312039B2 (en) 2007-12-25 grant
US20130224746A1 (en) 2013-08-29 application
US7364858B2 (en) 2008-04-29 grant
US7429453B2 (en) 2008-09-30 grant
US6027889A (en) 2000-02-22 grant
JP2011139718A (en) 2011-07-21 application
US20070054305A1 (en) 2007-03-08 application
US20120270272A1 (en) 2012-10-25 application
EP1736554A2 (en) 2006-12-27 application
EP1736554A3 (en) 2007-02-21 application
US7332285B2 (en) 2008-02-19 grant
US7097980B2 (en) 2006-08-29 grant
JP4468488B2 (en) 2010-05-26 grant
US7556924B2 (en) 2009-07-07 grant
US7320865B2 (en) 2008-01-22 grant
US8283121B2 (en) 2012-10-09 grant
JP2008092959A (en) 2008-04-24 application
US20060024731A1 (en) 2006-02-02 application
EP2369007B1 (en) 2015-07-29 grant
EP0912761A1 (en) 1999-05-06 application
JP2000511060A (en) 2000-08-29 application
US20100006437A1 (en) 2010-01-14 application

Similar Documents

Publication Publication Date Title
Gyllensten et al. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus
Abravaya et al. Detection of point mutations with a modified ligase chain reaction (Gap-LCR)
Lasken et al. Whole genome amplification: abundant supplies of DNA from precious samples or clinical specimens
US5888819A (en) Method for determining nucleotide identity through primer extension
US6576448B2 (en) Methods for selectively isolating DNA using rolling circle amplification
Pastinen et al. Multiplex, fluorescent, solid-phase minisequencing for efficient screening of DNA sequence variation.
Mhlanga et al. Using molecular beacons to detect single-nucleotide polymorphisms with real-time PCR
Grossman et al. High-density multiplex detection of nucleic acid sequences: oligonucleotide ligation assay and sequence-coded separation
US6130073A (en) Coupled amplification and ligation method
US5599666A (en) Allelic ladders for short tandem repeat loci
US7727720B2 (en) Methods for detection of genetic disorders
US5955276A (en) Compound microsatellite primers for the detection of genetic polymorphisms
Barany Genetic disease detection and DNA amplification using cloned thermostable ligase
Saiki et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase
US5369004A (en) Five highly informative microsatellite repeat polymorphic DNA markers
US6331393B1 (en) Process for high-throughput DNA methylation analysis
US20070178478A1 (en) Methods for detection of genetic disorders
US6858412B2 (en) Direct multiplex characterization of genomic DNA
US20050064428A1 (en) Method for detecting cytosine-methylation patterns by exponential ligation of hybridised probe oligo-nucleotides (mla)
US6221603B1 (en) Rolling circle amplification assay for nucleic acid analysis
Barany The ligase chain reaction in a PCR world
US20050069879A1 (en) Method for high sensitivity detection of cytosine-methylation
EP1130113A1 (en) Multiplex ligation dependent amplification assay
Gibbs et al. Detection of single DNA base differences by competitive oligonucleotide priming
EP0370719A2 (en) Extended nucleotide sequences

Legal Events

Date Code Title Description
EEER Examination request
MKEX Expiry

Effective date: 20170529