CA2219271A1 - 1-deoxy-d-xylulose 5-phosphate synthase, a process for identifying effectors of 1-deoxy-d-xylulose 5-phosphate synthase and effectors of 1-deoxy-d-xylulose 5-phosphate synthase - Google Patents

Abstract

1-Deoxy-D-xylulose 5-phosphate synthase, a process for identifying effectors of 1-deoxy-D-xylulose 5-phosphate synthase, and effectors of 1-deoxy-D-xylulose 5-phosphate synthase The present invention relates to 1-deoxy-D-xylulose 5-phosphate synthase (DXS), to a process for preparing DXS, to the use of DXS, to a process for identifying DXSeffectors and to DXS effectors.

Description

CA 022l927l l997-l2-23 Hoechst Schering AgrEvo GmbH AGR 97/M 225 Dr.GRU

1-Deoxy-D-xylulose 5-phosphate synthase, a process for identifying effectors of 1-deoxy-D-xylulose 5-phosphate synthase, and effectors of 1-deoxy-D-xylulose 5-phosphate synthase The present invention relates to 1-deoxy-D-xylulose 5-phosphate synthase (DXS), to a process for preparing DXS, to the use of DXS, to a process for identifying DXS
effectors and to DXS effectors.
Isoprenoids represent a very extensive class of natural substances and encompassa large number of essential compounds such as carotenoids, steroids, prenylquinone side chains or phytol residues in chlorophylls (Coolbear & Threlfall, (1989) in Biosynthesis of terpenoid lipids, ed. Ratledge & Wilkinson, (Academic 1 5 Press), pp. 115-254, Bach, T.J. (1995) Lipids 30, 191 -202).

It is postulated that the biosynthesis of isopentenyl diphosphate (IPP), the C5 parent substance of all isoprenoids, takes place by way of the acetate/mevalonate pathway (Banthorpe et al., (1972) Chem. Rev. 72, 115-155; Beyia & Porter, (1976) Annu.
Rev. Biochem. 45, 113-142).

Recently, the existence of a metabolic pathway for synthesizing IPP which represents an alternative to the acetate/mevalonate pathway was demonstrated by means of 13C labeling experiments carried out in bacteria, algae and plants (Rohmer et al., (1993) Biochem. J 295, 517-524; Rohmer et al., (1996) J. Am.
Chem. Soc. 118, 2564-2566). 1-Deoxy-D-xylulose 5-phosphate (DXP), which is synthesized from pyruvate and glyceraldehyde 3-phosphate (GA3P) in a thiamine diphosphate-dependent reaction, was postulated to be the first intermediate in this alternative pathway for biosynthesizing isoprenoids.
DXS catalyzes the first reaction step of the alternative, non-mevalonate-dependent isoprenoid biosynthesis pathway, i.e. the synthesis of 1-deoxy-D-xylulose 5-phosphate (DXP) from pyruvate and glyceraldehyde 3-phosphate (GA3P).

. CA 02219271 1997-12-23 DXP and 1-deoxy-D-xylulose (DOX) are also involved in the biosynthesis of thiamine (vitamin B1) and pyridoxol (vitamin B6) (Hill et al., (1996) J. Biol. Chem.
271, 30426-30435; Himmeldirk et al., (1996) Chem. Commun., 1187-1188).

In addition to this, there has been a report on the cloning and characterization of the E. coli dxs gene and the overexpression of the dxs gene product in E. coli (Lois et al., (1997) Abstracts 3rd Terpnet Meeting on Plant Isoprenoids, p. 16, Université de Poitiers, France). The formation of DXP was demonstrated using cell-free extracts.

1 O The E. coli DXS enzyme was postulated to have a thiamine diphosphate-binding site, as is known, for example, from other enzymes such as pyruvate decarboxylases, acetolactate synthases or transketolases.

Sequence comparisons carried out at the amino acid level demonstrated 1 5 homologies with gene products of previously unknown function, to the extent that DXS function can be attributed to the following open reading frames (ORFs):

E. coli (EMBL Acc. N o. U 82664, Bp 17765 to 19627), Haemophilus influenzae (SwissProt Acc. N o. P 45205), Bacillus subtilis (SwissProt Acc. N o. P 54523);
Rhodobacter capsulatus (SwissProt Acc. N o. P 26242), Synechocystis sp PCC6803 (GenBank Acc. No. D 90903), Mycobacterium leprae (Acc. No. P 46708), Mycobacterium tuberculosis (Acc. No. Z 96072), Helicobacter pylori (Acc. N o. AE000552), Methanococcus jannaschii (Acc. N o. G 64384) and the CLA 1 (or Def) gene from Arabidopsis thaliana (GenBank Acc. N o. U 27099; Mandel et al. (1996) The Plant Journal 9, 649-658).

Further searches in sequence data bases indicated that homologies exist between the DXS proteins and transketolase-like enzymes (e.g. EC 2.2.1.1) and the E1 proteins of the pyruvate dehydrogenase complex (PDH, EC 1.2.4.1) from a variety of organisms. However, the DXS proteins are usually smaller than bacterial transketolases.

.

The nucleic acid sequences or nucleic acid molecules which encode a protein having the function of a 1-deoxy-D-xylulose 5-phosphate synthase are termed "dxs", and the amino acid sequences or proteins having the function of a 1-deoxy-D-xylulose 5-phosphate synthase are termed "DXS".

It has now been found, surprisingly, that enzymes having the function of a DXS
constitute a novel, highly specific target for the development of pesticidal, inparticular herbicidal compounds or compounds having an antibiotic effect.

10 The invention relates, therefore, to an isolated protein having the function of a DXS, or an active fragment thereof, which is preferably selected from the group consisting of DXS from E. coli, Haemophilus influenzae, Bacillus subtilis, Rhodobacter capsulatus, Synechocystis sp. PCC6803, Mycobacterium leprae, Mycobacterium tuberculosis, Helicobacter pylori, Methanococcus jannaschii and Arabidopsis 1 5 thaliana.

The invention also relates to the abovementioned DXS for use as the site of action for herbicides or antibiotics.

20 The invention furthermore relates to a process for preparing a protein having the function of a DXS, or an active fragment thereof, in a recombinant host cell, which comprises inserting a nucleic acid molecule which encodes a protein having the function of a DXS, or an active fragment thereof, into an expression cassette which is suitable for a host cell; inserting the resulting expression cassette, in a suitable 25 manner, into a vector which is suitable for a host cell; transforming a suitable host cell with the resulting vector; culturing the host cell which has been transformed in this way in a suitable medium, and isolating the protein having the function of a DXS, or the active fragment thereof, which protein or fragment is produced by said host cell, from the culture medium and/or the host cell in a suitable manner.
In this respect, the present invention relates to the preparation of purified DXS by the recombinant route. For example, in order to prepare recombinant DXS in a host organism, DXS-encoding DNA sequences can be cloned into an expression cassette which is suitable for the heterologous expression of the structural gene in the selected host organism.

The following DXS-encoding DNA sequences are for example, suitable for this 5 purpose: microbial or plant dxs cDNA, plant dxs cDNA molecules whose sequenceshave been altered using current methods, and also synthetic DNA sequences which are derived from microbial or plant dxs cDNA, which enable an active DXS, or active fragments thereof, to be expressed, in particular the abovementioned DXS-encoding sequences from E. coli, Haemophilus influenzae, Bacillus subtilis, Rhodobacter 10 capsulatus, Synechocystis sp. PCC6803, Mycobacterium leprae, Mycobacterium tuberculosis, Helicobacter pylori, Methanococcus jannaschii and Arabidopsis thaliana.

DXS-encoding DNA sequences can also be used as selection markers, for example 15 as herbicide resistance markers.

It can also be desirable to introduce specific regulatory sequences, for examplepromoters, operator sequences, enhancers, terminators, signal sequences, 5'-untranslated and 3'-untranslated sequences, or sequences encoding suitable fusion 20 proteins, into the expression cassette. It is generally accepted technology to use such regulatory sequences, with it being possible for this technology to vary widely depending on the expression strategy.

The resulting dxs-expression cassette, provided with the necessary regulatory 25 elements in the appropriate reading frame of the dxs structural gene, can be inserted into an expression vector which can then be used to transform the selected host organism. Suitable expression strategies for preparing recombinant proteins, and corresponding expression vectors, are known generally in the case of host organisms such as E. coli, yeasts and insect cells. The recombinant organism which 30 is obtained by means of stable or transient transformation with the dxs-expression cassette can be used to obtain recombinant DXS in purified or partially purifiedform, or to obtain cell fractions which contain DXS. Where appropriate, the recombinant organism can also be a direct component, i.e. a cellular component, of an analytical test system.

In this respect, the term "recombinant organism" is to be understood as being the cell of an organism which is modified with in-vitro-altered or integrated DNA, for 5 example of recombinant yeast, bacterial, algal, insect or plant cells.

An example of a preferred expression system is that using E. coli as the host organism. All vectors which possess suitable expression signals, such as promoters, and suitable selection markers, such as resistance genes or genes which 10 complement an auxotrophy, can be used as vectors.

Various methods can be used to purify recombinantly prepared DXS. The suitability of a method depends in each case on the host organism employed, the expression strategy and other factors which are known to a skilled person who is experienced in 15 expressing and purifying recombinant proteins. For the purpose of its purification, the recombinant protein can also be fused with peptide sequences by means of appropriately altering its gene sequence in the expression cassette. Peptides orproteins which, as C-terminal or N-terminal fusions, confer on the recombinant DXS
an affinity for particular column materials are preferably to be used as fusion 20 partners. These fusions should not affect the function of the DXS or must be able to be eliminated, for example by the incorporation of suitable protease cleavage sites, with the function then being reconstituted. Examples of fusion partners which may be mentioned, without this use being restricted to the fusion partners, or theirfragments, which are given by way of example, are oligohistidine tails, the Strep-25 TagTM (Biometra GmbH, Gottingen, FRG), glutathione-S-Transferase (GST) or maltose-binding protein (MalE).

The recombinant preparation and purification of the DXS enables, for example, DXS
to be used in biochemical test systems for determining the enzyme function of the 30 DXS in the presence of test substances which are to be assayed, in particular by means of the automated assaying (e.g. high throughput screening) of test substances.

CA 022l927l l997-l2-23 The proteins according to the invention exhibit particular characteristics which are possessed in common by DXS proteins. These characteristics can include, for example, enzyme activity, molecular weight, immunological reactivity, chromatographic behavior, conformation, stability, pH optimum, temperature 5 optimum, etc., and also physical properties, such as electrophoretic mobility,charge, sedimentation coefficients, solubility, spectroscopic properties, etc.

An example of an important characteristic of a DXS is its ability to synthesize DXP
from pyruvate and GA3P. This activity can, for example, be determined as described 10 in Example No. 4.

The invention also relates, therefore, to a process for identifying DXS effectors, which comprises the enzymic activity of the DXS leading to a signal which can bemeasured directly or indirectly, qualitatively or quantitatively, preferably with a DXS
15 being incubated with suitable substrates and the enzymic activity of the DXS being determined and compared in the presence and absence of a test substance which isto be investigated.

The invention also relates, therefore, to a process for identifying DXS effectors, 20 which comprises determining the enzymic activity of the DXS in the absence of a test substance; determining the enzymic activity of the DXS in the presence of said test substance; and comparing the enzymic activities which have been ascertained.

The invention also relates, therefore, to the use of a process according to the 25 invention for identifying DXS effectors, preferably in an automated test system, for example by means of so-called high-throughput screening, for example using pipetting robots and/or computer-assisted control and analysis systems.

The process is suitable for identifying specific inhibitors or activators, i.e. effectors, 30 of DXS, such that, inter alia, substances which possess a potential herbicidal or growth-inhibiting effect, or else a growth-promoting effect, can be identified. In this context, the chemical compound to be investigated is preferably employed at concentrations of between 10-9 M and 10-3 M, and, particularly preferably, at concentrations of between 10-7 M and 10~ M.

A number of suitable methods, in which the DXS is incubated in a suitable reaction buffer, under reaction conditions which are suitable with regard to reaction 5 temperature and the pH of the reaction, in the presence of thiamine diphosphate together with suitable substrates such as pyruvate and GA3P, are available for determining the enzymic activity of the DXS.

Suitable reaction buffers having a pH of between pH 3 and pH 11, and reaction 10 temperatures of between 2~C and 60~C, may be mentioned as reaction conditions which are preferred for the DXS.

The enzyme inhibition or enzyme activation (i.e. the effect produced by the effector) can be quantified by means of a simple comparison of the catalytic activity of the 15 DXS in the absence and in the presence of the test substance to be investigated under otherwise identical test conditions. Various biochemical measurement methods can be employed to determine the activity of the DXS, with these methodseither being used to measure the formation of the reaction products of the DXS-catalyzed reaction, e.g. DXP, or else to measure the decrease in the concentration 20 of the enzyme substrates of the DXS, e.g. pyruvate or GA3P, for example by means of an end-point determination of the DXP after enzymic conversion of the substrates pyruvate and GA3P, which, where appropriate, were radioactively labeled or provided with other customary labels, or which can be detected by means of subsequent reactions, e.g. by means of coupled enzymic reactions.
Many standard methods for determining enzyme activities are available to the skilled person who is experienced in performing enzyme tests (see, for example, Bergmeyer, H.U., Methoden der enzymatischen Analyse [Methods of Enzymic Analysis], Volumes 1 and 2, Verlag Chemie, Weinheim (1974), Suelter, C.H., 30 Experimentelle Enzymologie: Grundlagen fur die Laborpraxis [Experimental Enzymology: Basic Principles for Laboratory Practice], Fischer Stuttgart (1990)).

' CA 022l927l l997-l2-23 The enzymic activity of the DXS can be determined, for example, by incubating the DXS with [2-14C]-pyruvate and GA3P and, after a suitable incubation time, qualitatively or quantitatively determining the quantity of [2-14C]-1-deoxy-D-xylulose 5-phosphate which has been formed after separating off as yet unreacted [2-14C]-5 pyruvate and GA3P. The 1-deoxy-D-xylulose 5-phosphate can, for example, be separated from the pyruvate and GA3P on a suitable stationary phase using a suitable mobile phase mixture, for example by means of thin layer chromatographyor by means of HPLC. In order to improve the separation of DXP, pyruvate and GA3P, the phosphoric esters which are present in the reaction mixture can be 10 converted into the corresponding alcohols, for example by treating them with acid or alkaline phosphatase, before carrying out the chromatographic separation. Other radioactively labeled substrates, such as [U-14C]-pyruvate, 14C-labeled GA3P, 3H-labeled pyruvate or 3H-labeled GA3P can also be used in place of [2-14C]-pyruvate and GA3P when the activity of a DXS is being determined.

It is furthermore conceivable to use purified DXS as the basis for preparing radioactively labeled DXP derivatives (e.g. ~3C-labeled, 14C-labeled or 32P-labeled derivatives, inter alia), with a view to then employing these derivatives in test systems. Radioactively labeled DXP can be employed as a specific metabolite for 20 investigating subsequent enzymes in the 1-deoxyxylulose-P pathway and therebyalso making it possible to investigate effectors once again. Thus, it might be possible, for example, to detect the formation of 14C-IPP or other 14C compounds;
any effector which then decreases the conversion of 14C-DXP into IPP in vivo or in vitro can then in turn be regarded as being a possible herbicide/antibiotic for the 25 whole pathway.

The activity of the DXS can also be determined by, for example, incubating the DXS
with [1-14C]-pyruvate and GA3P and, after a suitable incubation time, determining the quantity of ~4Co2 which has been released in the reaction.
The activity of the DXS can also be determined by, for example, incubating the DXS
with pyruvate and GA3P and, after a suitable incubation time, converting the quantity of pyruvate which has still not been converted in the reaction into lactate using the enzyme lactate dehydrogenase and determining, by means of a suitable method, for example photometrically, the decrease in the concentration of the reduced nicotinamide dinucleotide (NADH) which is required as a cosubstrate in the lactate dehydrogenase reaction.

The activity of the DXS can also be determined by, for example, incubating the DXS
with pyruvate and GA3P and, after a suitable incubation time, converting the quantity of GA3P which has still not been converted in the reaction into 1,3-biphosphoglycerate using the enzyme glyceraldehyde 3-phosphate dehydrogenase 10 and determining, by means of a suitable method, either directly, for example photometrically, or after coupling to the reduction of tetrazolium compounds, the increase in the concentration of the reduced form of the nicotinamide dinucleotide which is required as a cosubstrate in the glyceraldehyde 3-phosphate dehydrogenase reaction.

The activity of the DXS can also be determined by, for example, incubating the DXS
with pyruvate and GA3P and, either after a suitable incubation time or in a coupled enzymic test system, continuously converting the quantity of C02 which is released in the reaction into oxaloacetate using the enzyme phosphoenolpyruvate 20 carboxylase and converting the quantity of oxaloacetate which is formed in this way into malate using the enzyme malate dehydrogenase and determining1 by means of a suitable method, for example photometrically, the decrease in the concentration of the reduced nicotinamide dinucleotide (NADH) which is required as a cosubstrate in the malate dehydrogenase reaction.
The activity of the DXS can also be determined by, for example, incubating the DXS
with pyruvate and GA3P and coupling the partial reaction of the decarboxylation of pyruvate to the reduction of 2,6-dichlorophenolindophenol.

30 While the processes according to the invention for determining the effect of test substances as effectors can be carried out using purified DXS, they can also be carried out using the intact cells of a recombinant organism which expresses theDXS recombinantly, using DXS-containing extracts from this organism or using CA 022l927l l997-l2-23 enriched DXS-containing fractions from this organism. Preferred recombinant hostorganisms which may be mentioned are bacterial, insect and yeast cells.
Alternatively, use can also be made of a DXS which is isolated from plant tissue or plant cell cultures. It is known that DXP is converted into DMAPP/IPP by way of a 5 number of intermediate steps. The details of this pathway, that is the subsequent enzymes which occur, have still not been analyzed. However, it is known that theconversion takes place by way of kinases, oxidoreductases, isomerases and mutases. In this respect, it is to be expected that the subsequent enzymes will likewise constitute sites for the action of herbicides and antiobiotics and likewise 10 function as effectors.

It is an important prerequisite for various applications, such as the establishment of an abovementioned biochemical test system for determining a protein function, that the protein to be investigated can be isolated in a functional state and in as pure a 15 form as possible, i.e. free of interfering activities. As with all cell proteins, this can be achieved in the case of the DXS by using customary methods of protein purification to isolate the enzyme from the organisms or tissues. It is shown in the present invention that it is possible to isolate a functionally intact DXS whose sequence, in the case of E. coli by way of example, is given by SEQ ID No. 1 and corresponds to 20 the sequence designated Acc. No. U 82664 in the EMBL database.

The invention furthermore relates to the use of a protein having the function of a DXS, or an active fragment thereof, for identifying DXS effectors.

The use of the DXS is essentially based on its enzymic activity. The provision of 5 functionally intact DXS makes it possible to carry out biochemical reactions both in vitro (e.g. cell-free DXS test system) and in vivo, for example in single-cell or multicell recombinant organisms or cell cultures, in particular yeasts, bacteria, algae, insect cells or plants.

10 On the one hand, these reactions can be used to prepare 1-deoxy-D-xylulose 5-phosphate (DXP) or consequential products such as thiamine, pyridoxine and isoprenoids (including carotenoids, chlorophylls, phytols, lutein, sterols, ubiquinones/menaquinones/plastoquininones, dolichol, natural rubber, paclitaxel/docetaxel (trade names Taxol/Taxotere), and, on the other hand, these15 biochemical reactions can be used to determine the effect of chemical compounds or heterogeneous substance mixtures on the function of the DXS in a test system.
Furthermore, the recombinantly prepared DXS can, for example, also be used to elucidate the spatial structure of the enzyme. Generally known methods, such as the 20 X-ray structural analysis of protein crystals or NMR spectroscopy, can be used to elucidate the spatial structure. The information obtained about the structure of the DXS can be used, for example, for designing novel DXS inhibitors, and consequently potential herbicides, in a rational manner.
The invention also relates to DXS effectors which are identifiable by a process 25 according to the invention and to DXS effectors which are structural analogs of pyruvate, GA3P or DXP, in particular DXS effectors which have an antibiotic, pesticidal or herbicidal effect, and to their use as pesticides, herbicides or antibiotics.

30 The following materials and methods were used in the examples given below, which examples serve to clarify the invention and are in no way intended to signify any restriction:

Bacterial strains and plasmids:
Escherichia coli K 12, W3110 wild-type strain (obtainable from Yale University Genetic Stock Center, USA) was used as the starting material for isolating chromosomal DNA.

The plasmid pUCBM20 (Boehringer Mannheim, FRG) was used for cloning and expressing dxs in E. coli DH5a (supE44 ~lacUI69 (~801acZ ~M15) hsdRI7 recAI
endA1 gyrA96 thi-l relA1) (Hanahan (1983) J. Mol. Biol. 166, 557-580) and E. coli JM 109 (recAII supE44 endAII hsdR17 gyrA96 relA1 thi ~(lac-proAB) F' [traD36 10 proAB+ laclq lacZ~M15]) (Yanisch-Perron et al. (1985) Gene 33, 103-119).

Cloning techniques:

In general, the standard techniques described in the literature references were used 1 5 for cloning (Sambrook et al. (1989) Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Lab. Press. Cold Spring Harbor, NY), PCR amplification (Mullis and Faloona, (1987) Meth. Enzymol. 155, 335-350) and DNA transformation (Hanahan (1983) J. Mol. Biol. 166, 557-580).

20 It is to be expected that an alteration in the activity of the DXS, in particular an increase in the activity, would lead to an increased formation of DXP derivatives (e.g. thiamine or pyridoxine) and isoprenoid substances. The latter include carotenoids. While DXS is of interest as a site of action for inhibiting IPP synthesis (herbicides and antibiotics), the invention also relates to an increase in the activity of 25 the DXS and to the increased formation of DXP derivatives such as thiamine orpyridoxine (vitamins B1 and B6) and, in particular, of isoprenoid substances. In this respect, the following are, especially but not exclusively, to be claimed to thebroadest possible extent: carotenoids, chlorophylls, phytols, lutein, sterols, ubiquinones/menaquinones/plastoquinones, dolichol, natural rubber, 30 paclitaxel/docetaxel (trade names Taxol/Taxotère), among other commercially interesting compounds.

CA 022l927l l997-l2-23 Example 1: Isolation and cloning of the E. coli dxs gene The dxs gene was amplified from E. coli K12 wild-type strain W 31 10 by means ofthe polymerase chain reaction (PCR) using the known E. coli genome sequence 5 U 82664 and the following primers:

DXSEC05: 5'CCGMTTCACRGCCCCTGATGAGI I I IGAT3~(bp19636-19616) and DXSEC03: 5' TTGCATGCAGGAGTGGAGTAGGGATTATG 3' (bp 17747-17769).

The PCR primers DXSEC05 and DXSEC03 contain restriction cleavage sites for the enzymes EcoRI and Sphl, respectively.

1 5 For carrying out the PCR, 100 pmol of each of the primers were used together with 1.6 ng of chromosomal DNA from E. coli K-12 wild-type strain LJ 110 (W3110). After the double-stranded DNA had been denatured at 95~C for 30 seconds, there followed 30 cycles of in each case: annealing at 60~C, polymerization at 72~C and subsequent denaturation at 95~C (1 min).
The sequence of the PCR product (SEQ ID No. 2) was determined using an A.L.F.
System (Pharmacia, Freiburg, FRG):

251 ATGAG l l l I G ATATTGCCM ATACCCGACC CTGGCACTGG TCGACTCCAC

101 MCTGCGCCG CTA l l I ACTC GACAGCGTGA GCCGTTCCAG CGGGCACTTC

451 GGCGATGGCG CGATTACCGC AGGCATGGCG l l l GMGCGA TGMTCACGC

601 TCCGGTMGC l l l ACTCTTC ACTGCGCGM GGCGGGMM MGTTTTCTC

701 MGGCATGGT AGTGCCTGGC ACGTTGTTTG MGAGCTGGG CmMCTAC

851 MGGTCGTGG TTATGMCCG GCAGMAMG ACCCGATCAC l l ICCACGCC

951 l l I GCCGAGC TATTCMAM TC I l l GGCGA CTGGTTGTGC GMMCGGCAG

1 O 1051 GGCATGGTCG AG l l l l CACG TMMTTCCCG GATCGCTACT TCGACGTGGC
1101 MTTGCCGAG CMCACGCGG TGACCmGC TGCGGGTCTG GCGATTGGTG
1151 GGTACMMCC CATTGTCGCG ATTTACTCCA C l l l CCTGCA ACGCGCCTAT

1 5 1301 C I l l I GATCT CTCTTACCTG CGCTGCATAC CGGMMTGGT CATTATGACC

1501 CGTCGTGGCG AGMMCTGGC GATCCTTMC l l l GGTACGC TGATGCCAGA

Example 2: Expression of the dxs gene in E. coli JM 109 The resulting 1.9 kb PCR fragment, having a 7 bp upstream ribosome binding site (AGG), was isolated and subcloned into the plasmid pUCBM20 (Boehringer Mannheim, FRG) by way of the EcoRI and Sphl cleavage sites. After they had been transformed into E. coli JM109, the integrity of the plasmids was checked by means 35 of restriction analysis. Expression was effected by way of the lac promoter which was present on the plasmid.

Example 3: Purification of the DXS enzyme from recombinant E. coli JM 109 cells E. coli JM109 cells which harbored plasmid pUCBM20 containing the inserted dxs gene were cultured in LB medium (in all 9.6 liters) containing ampicillin (100 mg/l) up 5 to an optical density of 0.8 and were then induced for 4 h with isopropyl-beta-D-thiogalactoside (IPTG) (0.4 mM). The cells were harvested by centrifugation, washed with 50 mM Tris/HCI,1 mM dithiothreitol, 0.5 mM thiamine diphosphate, 5 mM MgCI2, pH 7.5 (buffer A), resuspended in buffer A (2.5 ml/g of cell wet weight) and disrupted by 3 passes in a French press. Following centrifugation, the cell 1 0 debris were discarded and (NH4)2SO4 was added, at the rate of 225 g/l and at 0~C, to the supernatant (173 ml) in order to precipitate the proteins. The precipitate was resuspended in buffer A and subjected to ultrafiltration.

The sample (63 ml) was then loaded onto a Q-Sepharose HP column (Pharmacia 1 5 Biotech, Sweden), washed with buffer A and then eluted, using an ascending salt gradient (0-1 M NaCI in buffer A), in the range between 0.2 and 0.3 M NaCI.

The test method described below was used to investigate the ability of the crudeextracts and (partially) purified enzyme to form DXP enzymically from pyruvate and 20 GAP3P. An approx. 17-fold enrichment was achieved in relation to the recombinant cells (Table 1).

Table 1:
Sample DXS activity [nmol min~1mg~1]
25E. coli LJ 110 0.4 E. coli JM 109/pUCBM20dxs - IPTG 12.2 E. coli JM 109/pUCBM20dxs + IPTG 51.6 DXS (enriched) 850 30 The purified DXS protein has an apparent molecular weight of approx. 66 kDa (Fig.
3) in a sodium dodecyl sulfate-polyacrylamide electrophoresis gel (SDS-PAGE). The CA 022l927l l997-l2-23 molar mass of 66 kDa is in agreement with the molar mass of 67.6 kDa which is expected from the DNA sequence.

Example 4: 1-Deoxy-D-xylulose 5-phosphate synthase enzyme test The test of the enzymic activity of the 1-deoxy-D-xylulose 5-phosphate synthase was carried out in the presence of 200 mM sodium citrate buffer, pH 3.0, 10 mM
pyruvate, 30 mM D,L-glyceraldehyde 3-phosphate, 20 mM MgCI2, 1.5 mM thiamine diphosphate (THDP), 1 mM dithiothreitol (DTT), 0.4 mM ethylenediaminetetraacetate 10 (EDTA), 1 ,uCi of [2-14C]-pyruvate and the sample to be investigated in a total volume of 50 ,ul.

After an incubation time of from 1 to 4 hours (h) at 30~C, the reaction was stopped by adding 20% perchloric acid (5 ,ul). The supernatant was neutralized with 5 molar K2CO3 (8 ,ul).

15 U of calf intestinal alkaline phosphatase (1.5 ~I, Boehringer Mannheim, No. 108138) were added to an aliquot of 5 ,ul of the DXS reaction supernatant and the mixture was incubated at 30~C for 30 min. After it had been dephosporylated by 20 treating it with alkaline phosphatase, the reaction product, DXP, was detected, as 1-deoxy-D-xylulose, on an Aminex HPX-87H (300 x 7.8 cm) HPLC column (Bio-Rad Laboratories GmbH, Munich, FRG) by subsequently loading the solution onto an Aminex HPX-87H HPLC column and eluting it with 6 mM H2SO4 at a temperture of 65~C in accordance with the producer's instructions.
The DXP and the 1-deoxy-D-xylulose were detected using a UV monitor (185 nm) and a radio monitor (Berthold LB506C) which were connected in series. 1-Deoxy-D-xylulose 5-phosphate eluted in the exclusion volume of the column. The concentration and signal positions were determined using chemically synthesized 30 standards of the respective 1-deoxyxylulose derivatives (obtained from T. Begley, Cornell University, NewYork, U.S.A.).

1 unit (U) of DXS enzymic activity was defined as the formation of 1 ,umol of DXP/min at a temperature of 30~ C.

The enzyme lost its activity by being dialyzed against a buffer which did not contain 5 thiamine diphosphate (THDP). However, it was possible to reconstitute more than 50% of the activity when THDP was added. In this respect, the enzyme displayed reversible, thiamine diphoshate-dependent activity.

Example 5: Identification of the reaction product DXP
Pyruvate and GA3P were reacted in the presence of purified DXS under the reaction conditions specified in Example 4. A high-resolution 1H NMR spectrum at 400.13 Mhz, and a 31p NMR spectrum at 161.97 Mhz, were plotted on an AMX-400 WB
spectrometer (Bruker, Karlsruhe, FRG) and gave the following data for DXP: 5.47 (d, 1,9 Hz, 1H); 4.38 (td, 6.5 Hz,1,9 Hz, 1H); 3.90 (dd, 6.5 Hz,7.3 Hz, 2H); 2.34 (s, 3H).

These results were in agreement with the NMR data which were obtained for chemically synthesized 1-deoxy-D-xylulose 5-phosphate (DXP).

20 Example 6 Inhibition of 1-deoxy-D-xylulose 5-phosphate synthase The DXS which was purified as described in Example 3 (obtained from T. Begley, 25 Cornell University, New York, U.S.A.) was tested for its in-vitro activity as described in Example 4. The relative activity of the mixture which was measured in the absence of test substances and in the presence of 1,2 and 10 mM pyruvate was in each case defined as 100%. The DXS activity which remained in the presence of the competitor was then ascertained after the pyruvate analog (in each case 10 mM) 30 had been added (Table 2).

CA 022l927l l997-l2-23 Table 2: Inhibition of DXS by structural analogs of pyruvate DXS activity [%]
in the presence of effector (10 mM) No.1 No. 2 Pyruvate Without 11 O N a 11~ O N a (mM) inhibitor H 3C~ P ~ o N H3C_~ P ~ C H
O O

Claims (13)

1. An isolated protein which has the function of a DXS or an active fragment thereof.

2. A process for preparing a protein having the function of a DXS, or an active fragment thereof, in a recombinant host cell, which comprises a) inserting a nucleic acid molecule which encodes a protein having the function of a DXS, or an active fragment thereof, into an expression casette which is suitable for a host cell;
b) inserting the resulting expression casette, in a suitable manner, into a vector which is suitable for the host cell;
c) transforming a suitable host cell with the resulting vector;
d) culturing the host cell which has been transformed in this way in a suitable medium;
and e) isolating the protein having the function of a DXS, or the active fragment thereof, which protein or fragment is produced by said host cell, from the culture medium or the host cell in a suitable manner.

3. An isolated protein having the function of a DXS, or an active fragment thereof, which can be prepared by a process as claimed in claim 2.

4. A process for identifying DXS effectors, which comprises a) determining the enzymic activity of the DXS in the absence of a test substance;
b) determining the enzymic activity of the DXS in the presence of said test substance; and c) comparing the enzymic activities which were ascertained under a) and b).

5. The use of a protein having the function of a DXS, or an active fragment thereof, for identifying DXS effectors.

6. The use of a process as claimed in claim 4 for identifying DXS effectors.

7. The use of as claimed in claim 6 in an automated test system.

8. A DXS effector which can be identified by a process as claimed in claim 4.

9. A DXS effector which is a structural analog of pyruvate, of GA3P or of DXP.

10. An effector as claimed in one or both of claims 8 and 9 which has a pesticidal effect.

11. An effector as claimed in one or both of claims 8 and 9 which has an antibacterial effect.

12. An effector as claimed in one or both of claims 8 and 9 which has a herbicidal effect.

13. The use of an effector as claimed in one or more of claims 8 to 12 as a pesticide, as a herbicide or as an antibiotic.