CA2208528A1 - Synthesis of stereospecific oligonucleotide phosphorothioates - Google Patents

Synthesis of stereospecific oligonucleotide phosphorothioates

Info

Publication number
CA2208528A1
CA2208528A1 CA 2208528 CA2208528A CA2208528A1 CA 2208528 A1 CA2208528 A1 CA 2208528A1 CA 2208528 CA2208528 CA 2208528 CA 2208528 A CA2208528 A CA 2208528A CA 2208528 A1 CA2208528 A1 CA 2208528A1
Authority
CA
Canada
Prior art keywords
ps
rp
oligonucleotide
primer
oligonucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA 2208528
Other languages
French (fr)
Inventor
Sudhir Agrawal
Allysen M. Roskey
Jinyan Tang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Idera Pharmaceuticals Inc
Original Assignee
Hybridon, Inc.
Sudhir Agrawal
Allysen M. Roskey
Jinyan Tang
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US36263194A priority Critical
Priority to US08/362,631 priority
Application filed by Hybridon, Inc., Sudhir Agrawal, Allysen M. Roskey, Jinyan Tang filed Critical Hybridon, Inc.
Publication of CA2208528A1 publication Critical patent/CA2208528A1/en
Application status is Abandoned legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates

Abstract

Disclosed is a method for synthesizing of stereospecific (Rp) phosphorothioate oligonucleotides. In this method, a primer comprising a plurality of deoxyribonucleotides and a ribonucleotide at the 5' terminal or 5' penultimate position, is annealed to a template. The structure is contacted with a mixture of deoxynucleoside .alpha.-triphosphate Sp diastereomers and a DNA polymerase to form a PS-Rp oligodeoxynucleotide extension which is liberated as a single-stranded PS-Rp oligonucleotide by cleavage after the ribonucleotide in the primer. Also disclosed are PS-Rp oligonucleotides and oligonucleotides prepared according to this method.

Description

-CA 02208~28 1997-06-20 W O 96/19572 PCTrUS95116086 ~YN~ SIS OF STEREOSPECIFIC
OLIGONUCLEOTIDE PHOSPHOROTHIOATES

BACKGROUND OF THE lNv~NlION

This invention relates to antisense oligonucleotides. More specifically, this invention relates to methods of preparing stereospecific phosphorothioate oligonucleotides.

Phosphorothioate analogs of oligodeoxynucleotides (PS oligonucleotides) are known to be useful as antisense tools (see, e.g., Agrawal et al. (1989) Proc. Natl. Acad. Sci. (USA) 86:7790-7794). These analogs have at least one non-bridging oxygen atom that has been substituted for a sulfur atom on the phosphate group in each internucleotide phosphate linkage. Such a modification is a conservative substitution which increases nuclease resistance without significantly impairing the hybridization of the antisense molecule with target mRNA.
PS oligonucleotides have been chemically synthesized using either the phosphoramidite or the H-phosphonate approach ~both reviewed in Methods in Molecular Biolo~ (Agrawal, ed.) Volume 20, Humana Press, (1993) Totowa, NJ). Such preparative methods introduce a chiral center at each internucleotide linkage that can lead to the ~ formation of 2n diastereomers per n internucleotide linkages, and generally result in ~ 30 a mixture of about 40~ Rp and about 60~ Sp diastereoisomers.

CA 02208~28 1997-06-20 2 PCT~S95/16086 Although phosphorothioates have many useful characteristics, such as the ability to initiate RNase H activity upon hybridization and to inhibit reverse transcriptase, and increased nuclease resistance, the presence of both Rp and Sp diastereomers in a phosphorothioate product may be problematic for several reasons. Rp and Sp diastereosomers may have different biophysical properties, such as different affinities for single-stranded and double-stranded nucleic acids (see, e.g., Cossick et al. (1985) Biochem.
24:3630-3638; Kim et al. (1992) FEBS Lett. 314:29-32). Hence, it is desirable under certain circumstances to prepare only one diastereomer.
In addition, the presence of both diastereomers in the mixture makes difficult the resolution of PS-oligonucleotides from each other and from other unwanted reaction products by polyacrylamide gel electrophoresis and HPLC, as peaks resulting from these chromatographic methods tend to be broader than their phosphodiester-linked counterparts.
Furthermore, the lack of stereospecificity is, for steric reasons, partially responsible for the lower melting temperature (Tm) of PS DNA/RNA
duplexes relative to phosphodiester linked DNA-RNA
duplexes (LaPlanche et al. (1986) Nucleic Acids Res.
14:9081). Accordingly, in the context of new drug development, preparation of such analogs may require that the issue of stereochemical purity be successfully addressed.

Thus, what is needed are methods of synthesizing stereospecific (Rp or Sp) -CA 02208~28 1997-06-20 W 096/19572 PCTtUS95tl6086 diastereomers of phosphorothioate oligonucleotides.

SU~ARY OF THE INVENTION
This invention provides, in one aspect, a method of synthesizing the stereospecific Rp diastereomer or isomer of a phosphorothioate oligonucleotide. As used herein, the term "phosphorothioate oligonucleotide" or "PS
oligonucleotidell is intended to encompass at least five nucleotides covalently linked 3' to 5' via phosphorothioate internucleotide linkages, and including both Sp and Rp isomers. IIPS-Rp oligonucleotidel' refer to only the stereospecific (Rp) isomer of a PS oligonucleotide.

To produce a PS-Rp oligonucleotide according to the method of the invention, a nucleotidic primer is annealed to a complementary oligodeoxynucleotide template having 5' and 3' termini, thereby ~orming a partially double-stranded/partially single-stranded structure. The primer also has 3' and 5' termini and includes a nucleic acid sequence complementary to a 3' portion of the template. The primer comprises a plurality of deoxyribonucleotides and a ribonucleotide at its 3' terminal or 3' penultimate position.
The partially double-stranded/partially single-stranded structure is contacted with a mixture of deoxynucleoside ~-triphosphate Sp isomers and a DNA polymerase for a time necessary -WO96/19572 PCT~S95/16086 and under conditions conducive for the enzymatic synthesis o~ a PS-Rp oligodeoxynucleotide complementary to a 5' portion of the template, thereby forming a double-stranded product. In some embodiments, the deoxynucleoside ~-triphosphate Sp isomers are selected from the group consisting of deoxyguanosine 5'-(~-thio) triphosphate, deoxyadenosine 5'-(~-thio) triphosphate, deoxycytidine 5'-(~-thio) triphosphate, and thymidine 5'-(~-thio) triphosphate. ~he term DNA polymerase" refers to any enzyme able to covalently link the 3' end of one deoxyribonucleoside to the 5' end of another deoxyribonucleoside, thereby synthesizing DNA. In specific embodiments, synthesis is accomplished with DNA polymerase I, T4 DNA polymerase, Taq DNA
polymerase, or reverse transcriptase.

The double-stranded product is then cleaved after the ribonucleotide at the RNA/DNA junction such that the PS-Rp oligodeoxynucleotide is liberated from its primer and template. In some embodiments, cleavage occurs between the primer and the newly synthesized PS-Rp oligonucleotide when the ribonucleotide in the primer is at the 3' terminal position of the primer. In other embodiments, cleavage occurs between the 3' penultimate and 3' terminal nucleotide of the primer which has been extended as the PS-Rp oligonucleotide.

In some embodiments of the invention, cleavage is carried out with an endonucleolytic enzyme such as RNase A, RNase Tl, RNase T2, RNase W O 96/19S72 PCT~US95/16086 U2, RNase Nl, and RNase N2, while in other embodiments, cleavage is achieved with an alkaline. In specific embodiments, a strong alkaline or base such as a halide hydroxide selected from the group consisting of sodium hydroxide, ammonium hydroxide, lithium hydroxide, or potassium hydroxide, is used for this purpose.

Another aspect of the invention are stereospecific Rp oligonucleotides prepared according to the method of the invention.

Yet another aspect of the invention includes an oligonucleotide comprising a plurality of deoxyribonucleotides covalently linked with at least one stereospecific Rp phosphorothioate internucleotide linkage. Such stereospecific Rp phosphorothioate oligonucleotides are believed to be less mitogenic than Sp phosphorothioates or than a mixture of Rp and Sp phosphorothioates. In one embodiment, all of the deoxyribonucleotides are linked with stereospecific Rp phosphorothioate internucleotide linkages.

WO96tl9572 . PCT~S95/16086 BRIEF DESCRIPTION OF THE DRAWINGS

The foregoing and other objects of the present invention, the various features thereof, as well as the invention itself may be more fully understood from the following description, when read together with the accompanying drawings in which:

FIG. lA is a diagrammatic representation of one embodiment of the protocol for synthesizing a stereospecific PS oligonucleotide;

FIG. lB is a diagrammatic representation of another embodiment of the protocol for synthesizing a stereospecific PS oligonucleotide;

FIG. 2A is an autoradiogram demonstrating the nuclease resistance of phosphodiester (PO), stereospecific phosphorothioate (PS-Rp), and synthetic phosphorothioate (PS) oligonucleotides in bovine serum;

FIG. 2B is an autoradiogram demonstrating the nuclease resistance of PO, PS-Rp, and PS
oligonucleotides in human serum;

FIG. 3A is an autoradiogram demonstrating the nuclease resistance of PO, PS-Rp, and PS
oligonucleotides in the presence of DNA polymerase I;

CA 02208~28 1997-06-20 W O96/19572 PCTrUS95/16086 FIG. 3B is an autoradiogram demonstrating the nuclease resistance of PO, PS-Rp, and PS
oligonucleotides in the presence of T4 DNA
polymerase;
FIG. 4A is a graphic representation of the hybridization affinity of PS-Rp and PS
oligonucleotides to complementary DNA and RNA
targets, as measured by melting temperature (Tm);
FIG. 4B is a graphic representation of the hybridization affinity of PS-Rp and PS
oligonucleotides to complementary DNA and RNA
targets, as measured by circular dichroism;
FIG. 5 is a graphic representation of the ability of PS-Rp (-) and PS oligonucleotides (O) to inhibit rHIV reverse transcriptase; and FIG. 6 is an autoradiogram demonstrating the susceptibility o~ PS-Rp and PS oligonucleotides to RNase H digestion.

_ CA 02208~28 1997-06-20 W O 96/19572 PCTrUS95/16086 DE~ATT-~n DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides for procedures for synthesizing stereospecific PS-oligonucleotides, and, in particular for preparing 6 stereospecific (all Rp) oligonucleotide phosphorothioate,s using an enzymatic process.
These Rp oligonucleotides appear to bind to proteins with less affinity and are believed to be less mitogenic than their non-stereospecific counterparts.

The procedure established for synthesizing stereospecific PS-oligonucleotides (all Rp) is outlined in FIGS. lA and lB. It has been shown that DNA polymerase uses only Sp diastereomers of 2'-deoxynucleotide 5'-(~-thio) triphosphate during extension by single phosphorothioate to produce Rp linkages (Eckstein (1985) Ann. Rev. Biochem. 54: 367-402). However, such an extension was limited to incorporation of a single phosphorothioate linkage.

To carry out the synthesis of an entire stereospecific molecule, an appropriate template having the complementary nucleic acid sequence complementary to the desired sequence of the stereospecific molecule and a primer having a nucleic acid sequence complementary to a 3 ~

3 0 portion of the template are designed. Synthesis of the template is carried out using any method known in the art to produce phosphodiester-linker oligonucleotides. One such useful method uses ~-cyanoethyl phosphoramidite chemistry (Beaucage in W O 96/19572 PCTrUS95/16086 Protocols for Oligonucleotides and Analogs, Methods in Molecular BioloqY, Vol. 20 (Agrawal, ed.) Humana - Press, Totowa, NJ (1993) pp. 33-61). For synthesis of the primer, a plurality of deoxyribonucleotide phosphoramidites and a 3'-ribonucleotide at the position shown in FIG. 1) are incorporated with the use of a ribonucleoside phosphoramidite as the "synthon" or building block. This synthon is introduced to enable cleavage of the synthesized stereospecific oligonucleotide from the primer. After synthesis, deprotection is carried out using an RNA protocol such as desilylation (Damha et al. in Protocols for Oligonucleotides and Analogs, Methods in Molecular Bioloqy, Volume 20 (Agrawal, ed;) Humana Press, Totowa, NJ (1993) pp.81-114).

According to the method of the invention, the primer is annealed to the template by methods well known in the art, such as by heating for 3 minutes at 90~C, and then cooling for one hour at room temperature. The primer is then extended to form an oligonucleotide with a nucleic acid sequence complementary to the template. Extension of the primer is carried out with any enzyme capable of such synthesis, such as Taq DNA polymerase, DNA
polymerase I (Pol I polymerase), T4 DNA
polymerase, and reverse transcriptase using all four 2'-deoxynucleoside 5'-(~-thio) triphosphates, or analogs of 2'-deoxynucleoside 5'-(~-thio) triphosphates, as described by Eckstein (Ann. Rev.
Biochem. (1985) 54:367-402).
.

CA 02208~28 1997-06-20 W O~6/19572 PCT~US95/16086 After extension, the newly synthesized stereospecific PS-Rp oligonucleotide is liberated by cleavage from the primer and release from the template. Liberation may be accomplished with any procedure that will cleave the PS-Rp oligonucleotide from its primer at the ribonucleotide and will cause the PS-Rp oligonucleotide to dissociate from its template.
The ribonucleotide may be at the 3'-penultimate (FIG. lA) or 3'-terminal position (FIG. lB) of the primer before extension. Useful treatments include cleavage with a strong alkaline which digests RNA or with an endoribonuclease or other enzyme which cleaves at an RNA/DNA junction.
Preferable alkalies include halide hydroxides such as sodium hydroxide, lithium hydroxide, ammonium hydroxide, and potassium hydroxide, with the most preferable being ammonium hydroxide or potassium hydroxide. Useful enzymes include RNase A, RNase T1, RNase T2, RNase U2, RNase N1, and RNase N2, which are commercially available.

After cleavage, the product is purified by chromatography, gel electrophoresis, ultracentrifugation, or any other method known in the art that separates single-stranded oligonucleotides from themselves and from double-stranded molecules. PAGE, for example, on a 20~
polyacrylamide gel containing 8 M urea is useful for this purpose. The band containing the PS-Rp oligonucleotide is purified by locating it, for example, by W shadowing, and excising and desalted it. Generally, if synthesis is carried out using about 8 nmoles of primer and 2.5 nmoles CA 02208~28 1997-06-20 W O96J19572 PCTrUS9~/16086 of template, about 1 nmole of PS-Rp oligonucleotide product is obtained.

The oligonucleotides of the invention are useful as modulators of gene expression. For example, to determine the function of a particular gene, an oligonucleotide of the invention can be targeted to that gene in a tissue culture system and the effects of this modulation studied. If the object is to determine the role a particular protein plays in a certain biological process, the oligonucleotides of the invention can be used as a tool to suppress the production of the protein by targeting the nucleic acid that encodes the protein and then observing the biological effects brought about the suppression of the protein. In such a situation, it is not the integrated oligonucleotide that is being studied but the effects of suppressing production of the protein.
Use of the oligonucleotides of the invention in this way provides an easily executed alternative to the laborious method of mutating the targeted gene, and thereby creating a deletion mutant.

In addition, the PS-Rp oligonucleotides of the invention, like their chiral Sp counterparts, are useful as stereochemical probes of phospho-and nucleotidyltranserase, as these oligonucleotides can distinguish between the incorporation of a deoxyribonucleotide into a growing polymer via a single bond cleavage at the phosphorus of the nucleotide triphosphate as the 3'-hydroxyl of the growing chain displaces the pyrophosphate, or via two bond cleavages if a CA 02208~28 1997-06-20 WO96119572 PCT~S95/16086 covalent nucleotidyl enzyme is involved (reviewed in Brody et al. (1981) Biochem. 20:1245-1252).

The comparable stability of a PS-Rp oiigonucleotide prepared according to the method of the invention was determined by exposing it, as well as sequence-comparable PO- and PS-linked oligonucleotides, to a nuclease source such as human or bovine serum. The results in FIG. 2A
show that PS-Rp oligonucleotides are still present after 6 hours and up to 24 hours incubation in bovine serum, whereas PO oligonucleotides are not.
In human serum (FIG. 2B), PS-Rp and PS
oligonucleotides are still present after 120 minutes of incubation, whereas PO-linked oligonucleotides were digested after 60 minutes of incubation.

Consistent results were obtained when PO, PS, and PS-Rp oligonucleotides were incubated with T4 DNA polymerase I (FIG. 3A) or with DNA polymerase (FIG. 3B). As shown in FIG. 3B, both PS and PS-Rp oligonucleotides were present after 4 hours of incubation in the presence of DNA polymerase I, while PO oligonucleotides were not present after 1 hour.

These results demonstrate that PS-Rp oligonucleotides are more stable than phosphodiester-linked oligonucleotides, and have stability comparable to PS oligonucleotides in bovine and human serum, and in the presence of DNA
polymerase and T4 DNA polymerase.

CA 02208~28 1997-06-20 WO96/19572 PCT~S95/16086 PS-Rp oligonucleotide and synthetic PS-oligonucleotide were also compared for their - affinity for complementary DNA and RNA targets, as measured by melting temperature( Tm) and Circular dichroism. As shown in FIG. 4A, both PS-Rp and PS-oligonucleotides showed the same Tm with DNA
target (51.8~ and 51.9~). However, PS-Rp oligonucleotide had a higher Tm (68.9~) compared to synthetic PS-oligonucleotide (64~) with an RNA
target, indicating that it has a greater binding affinity for its target. FIG. 4B demonstrates that the difference in CD spectra for RNA duplexes is more significant than that for DNA duplexes, indicating that RNA target is more sensitive to the conformational change of PS-Rp versus PS
oligonucleotides at hybridization than the DNA
target.

One known non-sequence-specific effect of PS
oligonucleotides present as mixture of Rp and Sp diastereomers is to inhibit the enzymatic activity of reverse transcriptase. To determine whether PS-Rp isomers have the same inhibitory activity as the diasteromeric mixture, PS-Rp oligonucleotides and PS oligonucleotides were incubated individually with reverse transcriptase. As shown in FIG. 5, the PS-Rp oligonucleotide was found to be a stronger inhibitor of reverse transcriptase than the synthetic PS-oligonucleotide mixture.
The PS-Rp oligonucleotides were also subjected to RNase H digestion to determine if their ability to trigger this degradative response is comparable to that of the PS diastereomeric CA 02208~28 1997-06-20 WO96tl9572 PCTtUS95tl6086 mixtures. FIG. 6 shows that PS-Rp oligonucleotides are better substrates for RNase H
than the synthetic PS-oligonucleotide mixture.

Furthermore, these oligonucleotides are able to hybridize to complementary nucleic acid sequences and taken up by cells. Thus, stereospecific PS-Rp oligonucleotides have similar if not improved antisense characteristics as a diastereomeric Rp ~ Sp mixture of PS
oligonucleotides.

The following examples illustrate the preferred modes of making and practicing the present invention, but are not meant to limit the scope of the invention since alternative methods may be utilized to obtain similar results.

EXAMPLES
1. Synthesis of PS-Rp Oligonucleotides In a 30 ~l volume of 50 mM Tris, pH 9.0, 10 mM MgCl2, 8 nmoles primer (d-GGTGGCTAGCGTAGrUC, (SEQ ID NO:2)) and 2.5 nmoles template (d-AGAAGGAGAGAGATGGGTGCGAGAGACTACGCTAGCCACC
(SEQ ID NO:3)) were pre-annealed by heating at 90~C for 3 minutes and allowed to cool at room temperature for 1 hour. The reaction volume was increased to 1.5 ml containing 50 mM Tris, pH 9.0, 10 mM MgCl2, 5 mM DTT, 100 mM deoxyguanosine 5'-(~-thio) triphosphate, 100 mM deoxyadenosine 5'-(~-thio) triphosphate, 200 mM deoxycytidine 5'-(~-thio) triphosphate and 200 mM thymidine 5'-(~-CA 02208~28 1997-06-20 WO 96ll9572 PCTrUS95/16086 thio) triphosphate (DuPont-NEN, Boston, MA). The reaction was initiated by the addition of 2500 units of sequence grade Taq DNA polymerase (Promega Corp., Madison, WI). The mixture was incubated for 4 hours at 37~C. The reaction mixture was desalted and treated with of ammonium hydroxide solution (28-30%) at 55~C for 24 hours, or with 0.3 M KOH at 37~C for 1 hour. In other tests, the desalted reaction mixture is alternatively treated with RNase A , RNase T1, RNase T2, RNase U2, RNase N1, or RNase N2, which are available from the Sigma Chemical Co. (St.
Louis, MO) at 95~C for about 3 minutes. The product was dried and purified by PAGE on a 20%
denaturing polyacrylamide gel. The product was excised from the gel under W shadowing and eluted with 500 mM ammonium acetate and desalted by dialysis, as described in FIG. 1.

2. Nuclease Resistance of PS-Rp Oligonucleotides The stability of phosphodiester-linked (PO), stereoregular (PS-Rp), and synthetic PS-oligonucleotide (PS) in bovine and human serum was tested as follows. 60 pmole of [32p] 5'-end-labelled oligonucleotide was incubated in 100 ul of human serum (Sigma Chemical Co., St. Louis! MO) at 37~C. Aliquots of 20 ~l were sampled at time 0, 30, 60, and 120 minutes, and then incubated with 20 ~l of 20 mM Tris, pH 7.8, 10 mM NaCl, 10 mM EDTA, 0.5% SDS, and 100 ~g proteinase K at 65~C
., for one hour. The samples were extracted by phenol/chloroform, ethanol precipitated, and then analyzed by PAGE in gels containing 20%

CA 02208~28 1997-06-20 W O96/19572 PCTrUS95/16086 acrylamide, 8.3 M urea. The gel was fixed in a acetic acid/methanol/water (10:10:80), v/v/v) solution and dried for 3 hours before being subjected to autoradiography. The autoradiograms are shown in FIGS. 2A (bovine serum) and 2B (human serum).

Further comparative nuclease resistance studies were performed using T4 DNA polymerase, and DNA polymerase (Pol I). The DNA polymerase I
assay was carried out in 20 ~l volume containing 30 pmoles [32p]_5, end labelled PO, PS, or PS-Rp oligonucleotide, 50 nm Tris, pH 8.0, 5 mM MgCl2, 5 mM DTT, 0.05~ bovine serum albumin, and 5 units of DNA polymerase I (Worthington Biochemical Corp., Freehold, NJ). An aliquot was removed at time 0 and the re~;n;ng was incubated at 37~C. 5 ~l aliquots of were removed at times 1, 2, and 4 hours. To each time point aliquot 6 ,ul stop solution (95~ formamide, 10 mM EDTA, 0.05~
bromophenol blue, 0.05~ xylene cyanol) was added.
The samples were then analyzed by PAGE using a 20 acrylamide, 8.3~ urea gel. The results are shown in FIG. 3A.
The T4 DNA polymerase assays were carried out in 30 ~l volume containing 45 pmoles [32p]_5, end labelled PO, PS, or PS-Rp oligonucleotide, 50 mM
Tris, pH 8.0, 5 mM MgCl2, 5 mM DTT, 0.05~ bovine serum albumin, and 7.5 units of T4 DNA polymerase (Promega, Madison, WI). An aliquot was removed at time 0 and the remaining was incubated at 37~C. 5 ~l aliquots were removed at times 5, 15, 30, and 60 minutes. To each time point aliquot were added _ CA 02208~28 1997-06-20 W O 96/19572 PCTrUS95/16086 6 ~l stop solution (95~ formamide, 10 mM EDTA, 0.05~ bromophenol blue, 0.05~ xylene cyanol). The samples were then analyzed by PAGE in a 20~
acrylamide, 8.3~ urea gel. The results are shown in FIG. 3B.

3. Melting Temperature Studies Melting temperature (Tm) studies were carried as follows. 1.06 x 10-6 M PS-Rp or PS
oligonucleotides were placed in 10 mM phosphate, 100 mM NaCl, pH 7, subjected to temperatures ranging from 30 to 75~C, and the absorbance at A260 measured using a spectrophotometer (GBC 920, GBC, Victoria, Australia). The results are shown in FIG. 4A.

4. Circular Dichroism Studies Circular dichroism studies were performed to determine the relative binding affinity of PS-Rp and PS oligonucleotides to complementary RNA or DNA sequences. 1.06 x 10-6 M PS-Rp or PS
oligonucleotides were placed in 10 mM phosphate, 10 mM NaCl, pH 7.0, and subjected to 200-320 nm W
light using a spectropolarimeter (J-710, Jasco, Easton, MD). The results are shown in FIG. 4B.

5. Inhibition of rHIV Reverse Transcriptase In order to determine the relative ability of PS-Rp oligonucleotidçs to inhibit reverse transcriptase, the following assay was performed.
A 10 ~l reaction mixture containing 1 mM of the CA 02208~28 1997-06-20 WO96/19S72 PCT~S95/16086 preannealed [32p] -5'-end labelled primer (d-GATTCAGCTAGTCCA (SEQ ID NO:5)) and template, (d-CCAACTGTGATACGATGGACTAGCTGAATC (SEQ ID N0:6)), 50 mM Tris, pH 8.3, 10 mM MgCl2, 50 mM KCl, 5 mM DTT, 0.25 mM deoxynucleoside 5'-triphosphates (dNTPs) and various concentrations of oligonucleotide was prepared. After the addition of 0.8 units rHIV
reverse transcriptase (Worthington Biochemical Corp., Freehold, NJ), the mixture was incubated at 37~C for 1 hour. The reaction was arrested with 10 ml formamide and then analyzed by a 20~
denaturing polyacrylamide gel electrophoresis.
CPMs were measured for the extension product and rem~-n-ng primer bands, and the percentage of inhibition was calculated. The results are shown in FIG. 5.

6. RNase H Activity Assay 1 pmole of [32p] -3'-end labelled 39-mer HIV-I
gag RNA (AGAAGGAGAGAGAUGGGUGCGAGAGCGUCAGUA W AAGC
(SEQ ID NO:3)) was preannealed with 10 pmole of PS-Rp or PS oligonucleotide in 10 ml buffer (20 mM
Tris, pH 7.5, 10 mM MgCl2, 100 mM KCl, 0.1 mM DTT, 5~ glycerol). The reaction was brought up to a volume of 30 ml with the same buffer, and 40 units RNase H (Boehringer Mannheim Corp., Indianapolis, IN). An aliquot of 7 ml was removed as time (zero). 0.5 units of RNase H was added to the remainder of the mixture which was incubated at 37~C for 15 min. 7 ~l aliquots were taken and quenched with 10 ~l formamide at 1, 5, and 15 minute time points. The mixture was analyzed by PAGE on a 20~ denaturing polyacrylamide gel which CA 02208~28 l997-06-20 WO96/19572 PCT~S95/16086 was autoradiographed. The results are shown in FIG. 6.

7. Activity Assay Activity of the PS-Rp oligonucleotides is measured by assaying their ability to inhibit HIV-1 expression in H9, MOLT-3, or other cells. In this assay, 5 x 105 cells per ml are infected with 2.5-5 x 1o8 virus particles of HIV-1 strains HTLV-IIIB or HTLV-IIIC. Infection with 500-1000 virus particles per cell represents a multiplicity of infection (MOI) of 0.5-1. Infection of cells is carried out by simultaneous addition of virus and antisense oligomers to the cells cultured in medium containing RPMI 1640 (10~ (vol/vol) fetal bovine serum, 2 mM glutamine, and 250 ~l of gentamicin per ml) in a humidified atmosphere containing 5~ CO2 at 37~C. After 4 days, the cells and supernatant are ~ml ned for the level of ~IV-1 expression by measuring syncytia (MOLT-3 cells) and viral antigen expression as well as cell viability. The number of syncytia formed in MOLT-3 cells is counted after triturating the cells to obtain an even distribution of the syncytia in the culture. The average number of syncytia is obtained by counting several fields in duplicate cultures. Cell viability is measured in the presence of trypan blue, and the cells that excluded the dye are counted as viable cells.
HIV-1 antigen expression is measured in cells fixed in methanol/acetone. Briefly, the cells were pelleted and then resuspended in phosphate-buffered saline (PBS) at a concentration of 106 CA 02208~28 l997-06-20 WO96/19572 PCT~S95/16086 cells per ml. The cells are then spotted on toxoplasmosis slides, air-dried, and fixed in methanol/acetone (1:1, vol/vol) for 15 min at room temperature. The slides are next incubated with 10~ normal goat serum at room temperature for 30 min and washed with PBS (four times). HIV-1 p24 or pl7 monoclonal antibody are added to each well and the slides incubated for 30 min in a humid chamber at 37~C. The slides are washed with PBS
(four times), incubated with fluorescein isothiocyanate-labeled goat anti-mouse IgG (Cappel Laboratories, Cochranville, PA) for 30 min at 37~C, and then washed with PBS overnight. The slides are counterstained with Evan's blue, washed with PBS, mounted with 50~ glycerol, and ~ m; ned with a Zeiss fluorescence microscope. The percentages of cells fluorescing in the oligomer-treated and untreated cultures are compared.

8. Cellular Uptake Culture dishes of Human 293, HeLas3, and NIH3T3 subconfluent cells plated 24 hr previously in Dulbecco-modified Eagle's medium (DMEM), or of MDCK or HEp-2 cells grown in DMEM/Earle's balanced salt solution media (5 x 105 cells/ml; 2 ml in total) are incubated with 35S-labelled PS-Rp oligonucleotide for 16 hr. The fractionation of the cells is carried out as follows. Cells are removed from the culture plate with trypsin, harvested (1,500 rpm, 5 min, 4~C), and washed twice with 4 ml of cold phosphate-buffered saline (PBS). The cells are lysed for 10 min at 4~C in 450 ~l of buffer A (10 mM Tris-HCl, pH 7.4, 150 mM

~ ~ = = -CA 02208~28 1997-06-20 W O96/19S72 PCTrUS95/16086 NaCl, 1.5 mM MgCl2) and 50 ~1 of 5~ Nonidet P-40 (NP-40). After centrifugation at 2000 rpm for 5 min, the upper cytoplasmic fraction (combined cytosol and cell membrane) is removed and the pellet (nuclei) dissolved in 500 ~l of bu~fer A
and measured for radioactivity.

EOUIVALENTS

Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein. Such equivalents are considered to be within the scope of this invention, and are covered by the following claims.

CA 02208~28 1997-06-20 WO96tl9572 PCT~S95/16086 SEQUENCE LISTING

(1) GENERAL INFORMATION: ~
(i) APPLICANT: Hybridon, Inc.
(ii) TITLE OF INVENTION: ~YNl'~SIS OF STEREOSPECIFIC
OLIGONUCLEOTIDE PHOSPHOROTHIOATES
(iii) NUMBER OF SEQUENCES: 6 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Lappin & Kusmer (B) STREET: 200 State Street (C) CITY: Boston (D) STATE: MA
(E) COUNTRY: USA
(F) ZIP: 02109 ~v) COM~Ul~ READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COM~Ul~: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Kerner, Ann-Louise (B) REGISTRATION NUMBER: 33,523 (C) REFERENCE/DOCKET NUMBER: HYZ-028PCT
(ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: 617-330-1300 (B) TELEFAX: 617-330-1311 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA

CA 02208~28 1997-06-20 (iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

(2) INFORMATION FOR SEQ ID NO:2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA/RNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

(2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

., (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs CA 02208~28 1997-06-20 WO96/19572 PCT~S95/16086 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: RNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

(2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:
GATTCAGCTA GTCCA l5 (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: cDNA
(iii) HYPOTHETICAL: NO
(iv) ANTI-SENSE: YES
(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Claims

1. A method of synthesizing an oligonucleotide with stereospecific Rp phosphorothioate (PS) internucleotide linkages comprising the steps of:

(a) annealing a primer to a template, thereby forming a partially double-stranded/partially single stranded structure, the template having a 5' terminus and a 3' terminus and comprising a plurality of deoxyribonucleotides, and the primer having a 3' terminus and a 5' terminus and comprising a plurality of deoxyribonucleotides and a ribonucleotide at the 5' terminus or at a 5' penultimate position, the primer having a nucleic acid sequence complementary to a 5' portion of the template;

(b) contacting the structure with a mixture of deoxynucleoside .alpha.-triphosphate Sp diastereomers and a DNA polymerase for a time necessary and under conditions conducive for the enzymatic synthesis of a PS-Rp oligodeoxynucleotide extension complementary to a 5' portion of the template, thereby forming a double-stranded product;

(c) cleaving the double-stranded product after the ribonucleotide such that the PS-Rp oligodeoxynucleotide is liberated from the template and the primer.

8. The method of claim 1 wherein the ribonucleotide in the primer is at the 3' penultimate position.

9. A PS-Rp oligonucleotide prepared according to the method of claim 1.

10. An oligonucleotide comprising at least two stereospecific Rp phosphorothioates.

11. An oligonucleotide comprising a plurality of deoxyribonucleotides covalently linked with at least one stereospecific Rp phosphorothioate internucleotide linkage.

12. The oligonucleotide of claim 11 in which all of the deoxyribonucleotides are linked with stereospecific Rp phosphorothioate internucleotide linkages.
CA 2208528 1994-12-22 1995-12-12 Synthesis of stereospecific oligonucleotide phosphorothioates Abandoned CA2208528A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US36263194A true 1994-12-22 1994-12-22
US08/362,631 1994-12-22

Publications (1)

Publication Number Publication Date
CA2208528A1 true CA2208528A1 (en) 1996-06-27

Family

ID=23426885

Family Applications (1)

Application Number Title Priority Date Filing Date
CA 2208528 Abandoned CA2208528A1 (en) 1994-12-22 1995-12-12 Synthesis of stereospecific oligonucleotide phosphorothioates

Country Status (6)

Country Link
EP (1) EP0807171A1 (en)
JP (1) JPH10511267A (en)
CN (1) CN1175281A (en)
AU (1) AU4514696A (en)
CA (1) CA2208528A1 (en)
WO (1) WO1996019572A1 (en)

Families Citing this family (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2222510A1 (en) * 1995-06-07 1996-12-19 Gen-Probe Incorporated Template and primer based synthesis of enzymatically cleavable oligonucleotides
US5916777A (en) * 1995-06-07 1999-06-29 Gen-Probe Incorporated Enzymatic synthesis of oligonucleotides using 3'-ribonucleotide primers
US5739311A (en) * 1995-06-07 1998-04-14 Gen-Probe Incorporated Enzymatic synthesis of phosphorothioate oligonucleotides using restriction endonucleases
US5932450A (en) * 1995-06-07 1999-08-03 Gen-Probe Incorporated Enzymatic synthesis of oligonucleotides using digestible templates
US5652126A (en) * 1995-06-07 1997-07-29 Gen-Probe Incorporated Use of restriction endonuclease sequences for cleaving phosphorothioate oligonucleotides
US5856462A (en) * 1996-09-10 1999-01-05 Hybridon Incorporated Oligonucleotides having modified CpG dinucleosides
WO1999005160A2 (en) * 1997-07-25 1999-02-04 Hybridon, Inc. Oligonuclotides having 3' terminal stereospecific phosphorothioates
EP1067956B1 (en) 1998-04-03 2007-03-14 University Of Iowa Research Foundation Methods and products for stimulating the immune system using immunotherapeutic oligonucleotides and cytokines
DE19815864A1 (en) 1998-04-08 1999-10-14 Europ Lab Molekularbiolog 5'-modified nucleotides and their application in molecular biology and medicine
CA2333854A1 (en) * 1998-07-27 2000-02-10 University Of Iowa Research Foundation Stereoisomers of cpg oligonucleotides and related methods
US6423493B1 (en) * 1998-10-26 2002-07-23 Board Of Regents The University Of Texas System Combinatorial selection of oligonucleotide aptamers
US6951722B2 (en) 1999-03-19 2005-10-04 Takara Bio Inc. Method for amplifying nucleic acid sequence
US20030162190A1 (en) * 2001-11-15 2003-08-28 Gorenstein David G. Phosphoromonothioate and phosphorodithioate oligonucleotide aptamer chip for functional proteomics
AU2003304278B2 (en) 2002-10-16 2009-03-12 Board Of Regents Of The University Of Texas System Bead bound combinatorial oligonucleoside phosphorothioate and phosphorodithioate aptamer libraries
CN100412085C (en) 2002-11-19 2008-08-20 吕联煌;福建省血液病研究所 Bc-2 antisense thiophosphoric acid oligodeoxynucleotides anticancer drugs, preparing method and uses thereof
US7910523B2 (en) 2003-05-23 2011-03-22 Board Of Regents, The University Of Texas System Structure based and combinatorially selected oligonucleoside phosphorothioate and phosphorodithioate aptamer targeting AP-1 transcription factors
US20100178272A1 (en) 2006-08-08 2010-07-15 Klinische Pharmakologie Structure and use of 5'phosphate oligonucleotides
WO2009141146A1 (en) 2008-05-21 2009-11-26 Gunther Hartmann 5' triphosphate oligonucleotide with blunt end and uses thereof
SG171914A1 (en) 2008-12-02 2011-07-28 Chiralgen Ltd Method for the synthesis of phosphorus atom modified nucleic acids
MX342945B (en) 2009-07-06 2016-10-18 Ontorii Inc * Novel nucleic acid prodrugs and methods use thereof.
EP2508530A1 (en) 2011-03-28 2012-10-10 Rheinische Friedrich-Wilhelms-Universität Bonn Purification of triphosphorylated oligonucleotides using capture tags
KR20140068884A (en) 2011-07-19 2014-06-09 웨이브 라이프 사이언시스 피티이. 리미티드 Methods for the synthesis of functionalized nucleic acids
US9982257B2 (en) 2012-07-13 2018-05-29 Wave Life Sciences Ltd. Chiral control
JP6246121B2 (en) 2012-07-13 2017-12-13 株式会社新日本科学 Chiral-nucleic acid adjuvants
KR101850319B1 (en) 2012-07-13 2018-04-20 웨이브 라이프 사이언시스 리미티드 Asymmetric auxiliary group
EP2712870A1 (en) 2012-09-27 2014-04-02 Rheinische Friedrich-Wilhelms-Universität Bonn Novel RIG-I ligands and methods for producing them
EP3095459A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
WO2015108047A1 (en) 2014-01-15 2015-07-23 株式会社新日本科学 Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
SG11201605782UA (en) 2014-01-16 2016-08-30 Wave Life Sciences Ltd Chiral design

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2693643B2 (en) * 1991-10-15 1997-12-24 アイシス・ファーマシューティカルス・インコーポレーテッド Oligonucleotide having a chiral phosphorus bond

Also Published As

Publication number Publication date
EP0807171A1 (en) 1997-11-19
WO1996019572A1 (en) 1996-06-27
AU4514696A (en) 1996-07-10
JPH10511267A (en) 1998-11-04
CN1175281A (en) 1998-03-04

Similar Documents

Publication Publication Date Title
Spies et al. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products
Pitsch et al. Pyranosyl‐RNA (‘p‐RNA’): Base‐pairing selectivity and potential to replicate. Preliminary communication
US5286717A (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
EP0451221B1 (en) Chimeric dna-rna catalytic sequences
US5264423A (en) Inhibitors for replication of retroviruses and for the expression of oncogene products
AU710747B2 (en) Enzymatic DNA molecules
US6140491A (en) Nucleozymes
US6369208B1 (en) Capped synthetic RNA, analogs, and aptamers
JP3445131B2 (en) Oligonucleotide detection probe
US6528640B1 (en) Synthetic ribonucleic acids with RNAse activity
Query et al. Branch nucleophile selection in pre-mRNA splicing: evidence for the bulged duplex model.
US5716824A (en) 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes)
JP3019994B2 (en) Novel oligodeoxynucleotide, a method of inhibiting method of blocking the expression of a target gene using, and the expression of novel oligodeoxynucleotide and the target genes using it it
AU684748B2 (en) Foldback triplex-forming oligonucleotides
US5929226A (en) Antisense oligonucleotide alkylphosphonothioates and arylphospohonothioates
US5623065A (en) Gapped 2' modified oligonucleotides
JP4452445B2 (en) How to use the mobility-modifying nucleobase polymer and the same product
EP1097939B1 (en) Method for the synthesis of isoguanosine and of its 2'-derivatives
JP2648802B2 (en) Enhanced nucleic acid amplification method
US6146829A (en) Gapped 2' modified oligonucleotides
CA1341088C (en) Inhibition of htlv-iii by exogenous oligonucleotides
US6683167B2 (en) Hybrid oligonucleotide phosphorothioates
Stein et al. Oligodeoxynucleotides as inhibitors of gene expression: a review
Agrawal et al. Site-specific excision from RNA by RNase H and mixed-phosphate-backbone oligodeoxynucleotides.
US6060456A (en) Chimeric oligonucleoside compounds

Legal Events

Date Code Title Description
FZDE Dead