CA2134994A1 - Use of the 5' regulatory region of the beta-fetoprotein gene for expressing genes in mammalian cells - Google Patents
Use of the 5' regulatory region of the beta-fetoprotein gene for expressing genes in mammalian cellsInfo
- Publication number
- CA2134994A1 CA2134994A1 CA002134994A CA2134994A CA2134994A1 CA 2134994 A1 CA2134994 A1 CA 2134994A1 CA 002134994 A CA002134994 A CA 002134994A CA 2134994 A CA2134994 A CA 2134994A CA 2134994 A1 CA2134994 A1 CA 2134994A1
- Authority
- CA
- Canada
- Prior art keywords
- gene
- afp
- ancl
- cat
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/34—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Corynebacterium (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4715—Pregnancy proteins, e.g. placenta proteins, alpha-feto-protein, pregnancy specific beta glycoprotein
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/15—Vector systems having a special element relevant for transcription chimeric enhancer/promoter combination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/30—Vector systems having a special element relevant for transcription being an enhancer not forming part of the promoter region
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/32—Vector systems having a special element relevant for transcription being an silencer not forming part of the promoter region
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Gastroenterology & Hepatology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Gynecology & Obstetrics (AREA)
- Pregnancy & Childbirth (AREA)
- Reproductive Health (AREA)
- Toxicology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
ABSTRACT
The present invention relates to a method of expressing a heterologous gene in mammalian cells and a recombinant DNA construct for use in the method. The invention also relates to a method of specifically killing cells which constitutively express AFP.
The present invention relates to a method of expressing a heterologous gene in mammalian cells and a recombinant DNA construct for use in the method. The invention also relates to a method of specifically killing cells which constitutively express AFP.
Description
3 ~
IMPROVED MET~IOD OF EXPRESSING GENES
IN MAMII~ALIAN CEI,LS
BACKGROUND OF THE~ INVENTION
FIELD OF THE INVENTION
The present invention relates to a methocl of expressing a heterologous gene in mammalian cells, ancl a recombinant DNA construct for use in the method. More particularly the invention relates to a recombinant DNA
obtained by linking a gene cocling for a cancer-cell toxin to certain of the transcriptional regulatory regions of the human ~-fetoprotein (AFP) gene so thatthe toxin gene is transcribe(l selectively in hepatic cancer cells.
DES~TQ~L~ELATED ART
Cancer of all forms is one of the major causes of morbidity throughout the world. Research in the area of cancer chemotherapy has produced a variety of antitumor agents which have di.ffering degrees of efficacy. A variety of cancer-therapeutic agents are known, for example, alkylating agents, antimetabolites, alkaloids and carcinostatic antibiotics. Standard clinieally used agents include aclriamycin, actinomycin D, methotrexate, 5-fluorouracil, cis platinum, vincristine ancl vinblastine. However, these presently available antitumor agents are known to have variolls clisaclvantages sucll as toxicity to20 healthy cells and resistance of certaill t~lmor types.
Hepatocelllllar carcinoma (HCC) is one of the major malignant diseases in the worlcl toclay; the greatest inciclence being in Japan, China, other parts of \
~3'~9~ `
IMPROVED MET~IOD OF EXPRESSING GENES
IN MAMII~ALIAN CEI,LS
BACKGROUND OF THE~ INVENTION
FIELD OF THE INVENTION
The present invention relates to a methocl of expressing a heterologous gene in mammalian cells, ancl a recombinant DNA construct for use in the method. More particularly the invention relates to a recombinant DNA
obtained by linking a gene cocling for a cancer-cell toxin to certain of the transcriptional regulatory regions of the human ~-fetoprotein (AFP) gene so thatthe toxin gene is transcribe(l selectively in hepatic cancer cells.
DES~TQ~L~ELATED ART
Cancer of all forms is one of the major causes of morbidity throughout the world. Research in the area of cancer chemotherapy has produced a variety of antitumor agents which have di.ffering degrees of efficacy. A variety of cancer-therapeutic agents are known, for example, alkylating agents, antimetabolites, alkaloids and carcinostatic antibiotics. Standard clinieally used agents include aclriamycin, actinomycin D, methotrexate, 5-fluorouracil, cis platinum, vincristine ancl vinblastine. However, these presently available antitumor agents are known to have variolls clisaclvantages sucll as toxicity to20 healthy cells and resistance of certaill t~lmor types.
Hepatocelllllar carcinoma (HCC) is one of the major malignant diseases in the worlcl toclay; the greatest inciclence being in Japan, China, other parts of \
~3'~9~ `
the Asia and sub-Saharan Africa. Recent evidence suggests that the ineidence of hepatocellular earcinoma in Europe ancl North America is increasing. The disease is estimated to be responsible for or involved in up to approximately 1,250,000 deaths a year ancl as sllch is n~lmerically one of the world's major 5 malignant diseases.
The prognosis of HCC is poor with the worlcl-wide frequeney rate almost equalling the mortality rate. After diagnosis, the median survival time is less than four mc~nths. Long-term survival, clefinecl as sulvival longer than one year after the diagnosis, is seen only occasionally. Most ~CC patients 10 suecllmb to either the complications of liver failllre with or without massive bleeding, or to the general effects of a large tllmor burden, with eachexia, malnutrition~ infeetion and sepsis. Thollgh clistant metastases oceur (up to 90%
of patients have metastatie tumors at the time of death), hepatie disease most often limits survival. Consequently, therapies directed towards the eontrol of 15 hepatic tumors are appropriate, although it will be appreciatecl that treatment of the metastatie clisease is also of great importanee. (Berk. P. (Ecl) Seminars in Liver Disease 4, No. 2, Thieme-Stratton Ine. N.Y. N.Y. (1984).
Cllrrent therapies available to the elinieian are on the whole ineffeetive as a eure for this disease (Nerenstone ~., Caneer Treatment Review 15, 1-31 ~0 (198~). Systemie single and eombillation agent ehelllotherclpy ancl radiation are relatively ineffeetive. Sinee a eaneer eell of a patient originates from a normal eell of the same patient, these known agents fail to elearly discriminate eancer ~.. ~., ~ ......... ? .. .
cells ~rom normal ce]ls, th~ls ca~lsing vario~ls aclverse effects. Therefore, use of the known cancer-therapeutic agents is significantly limited in various ways.
To date, surgery continues to be the only potential cllre. However, at the time of diagnosis, the overwhelming majority of patients are not able to 5 undergo radical surgery. In certain studies (Nerenstone et al. supra) it was found that less than 3% of patients were considered capable of unclergoing surgery and of the small percentage that clo, approximately 50% suffer from postoperative morbidity (Nerenstone et al. sllpra). However, it is appreciated by those skilled in the art that novel approaches and entities for cancer therapies 10 are required.
Gene therapy involves the stable integration of new genes into particular target cells ancl the expression of those genes, once they are in place, to alter the phenotype of that particl~lar target cell (for review see Anderson, W.F.
Science 226: 401-~09, 1984; McCormick, 1~. Biotechnology 3: 690-693, 15 1985).
Genetic ablation takes advantage of tisslle specificity of certain gene reglllatory elements to express a toxin gene in a cell specific manner. For example, Goring et al. (1987) Science 235: 456-458 have shown that the ~2-crystallin prornoter is ab]e to clirect expression of a linke(l lacZ gene in the lens 20 fiber cells in transgenic mice in a cleveloplnental manner. When the cliphtheria toxin A-chain (DT-A) gene is expressecl in a similar manller in the lens ~Iber cells in mice, microphthalmic mice having lcnses cleFicient of fiber cells are obtained (Brietman et al., (1987) Science 238: 1563-1565). When an attenuated 2~4~
DT-A gene (tox 176) is used, transgenic mice which displayed predominately cataracts or clinical anophthalmia were obtained (Brietman et al. (1990) Mol.
Cell Biol. 10: 474-479).
Palmiter et al. (1987) Cell 50: 435-443 have llsed the elastase I
S promoter/enhancer to drive the expression of the DT-A gene in pancreatic acinar cells to yield mice lacking a normal pancreas.
Alternatively, the expression of a gene encocling an enzyme capable of selective conversion of chemical agents to cytotoxic or cytostatic metabolites has been proposed. (European Patent Application No. 0 415 731). A
lû molecular cllimaera is constructed whicll consists of a natural transcriptional reg~llatory region attached to a gene encocling all enzyme which is capable of converting a metabolite into the toxin. Upon administration of the molecular chimaera to the patient and the metabolite, the enzyme is expressed in the cancer cells, which enzyme converts the metabolite into the toxin thereby 15 killing the cancer cells. However, this proced~lre requires the administration of two chemicals. Also, the possibility exists that the metabolite may be converted into the toxin in the incorrect cells res~llting in toxicity to normal cells. ~
method of controlling the expression of a toxin gene in cancer cells would be useful.
2 ~ 3 ~
SUMMARY OF TME INVENTION
The present invention is clirectecl to a method of expressing a heterologous gene in mammcllian cells and to a recombinant DNA eonstruet for use in the method.
~eeordingly, one aspeet of the present invention provides a method of expressing a heterologous gene in a mammalian cell comprising inserting a DNA eonstruet into a mamlnalian eell, said construct comprising an AFP
enhaneer region and an AFP promotor funetionally linkecl to the heterologous gene in the absenee of an AFP silencer region, ancl expressing the heterologous 10 gene in the mammalian eells.
Another aspect of the present invention provides a method of killing eells whieh eonstitutively express AI~P eomprising inserting a DMA
eonstruet into a mammalian eell, said construct comprising an enhaneer region, an AFP sileneer region ancl a promoter sequenee funetionally linked to a direet 15 toxin gene and expressing the toxin gene in the mammalian eells under eonditions sueh that only eells which constitutively express AFP are killed.
Also providecl are mutated enhancer dolllaills ancl sileneer regions usefill in the methods of this invention.
Further advantages of the present invention will beeome apparent fronn ~0 the following deseription of the invention with referenee to the attaehed clrawings.
,,,, ~ ~ " ~,, , ,; ","~, "",;,, ,~, ",, " ,"~"~""" ,"~ ip '~
~ ~ 3 ~
_RIEF DESCRIPTION OF THE DRAWINGS
Fig. lA illustrates CAT fusion genes containing the huma1l albumin and o~-fetoprotein (AFP) 5'-flanking regions. Positions of the enhancers (E, SEQ ID
NO:1, EA and Eb nucleoti(les 1700 to 1712 of SEQ ID NO:12), promoters (P
S SEQ ID NOS:2, 3,4 ancl 5), glucocorticoid - responsive element (G) and AT-rich elements are also indicatecl.
Fig. lB illustrates CAT activities expressecl in Hul 1-7 and hul-I-1/e1-2 cells transfected with the CAT fusion genes shown in Fig lA. CAT activities as a pereentage of pSV2-CA'I' activity are shown above the autoradiograms.
10 Cm - chloramphenicol; l-Ac, l-acetate chloramphenicol; 3-Ac, 3-acetate chloramphenieol .
Fig. lC illustrates the effeets of clexalnethasone on CAT aetivities in HuH-7 and huH-1/c1-2 cells transfected with pAF1.0-CAT. Cm, 1-Ac and 3-Ac are as defined in Fig. lB. -~ ancl - indicate the presenee and absenee of 15 dexamethasone respectively.
Fig. lD illustrates the AFP enhallcer/SV40 early promoter fusion genes;
Hi, Hind III; Bg, Bglll.
Fig. 2 illllstrates the detection o~ sileneer aetivities by deletion analysis.
The preeise end points of the cleletion are inclicatecl in base pairs from the AFP
20 eap site. The elosecl bars in(licate AFP 5' -flanlcing seqllences and the dotted lines indieate deletecl seqllences. Tlle CAT activities are expressecl relative to pAFO.2(13g)-CAT(pAFO.2) which contains the 169 bp /~FP promoter region.
..
: . ;: ~ ; . : ~ , .
.
2 ~
Fig. 3A i~lustrates the plasmicls constrllcted to test the effect of the position of the silencer region.
Fig. 3B illustrates the position (lepenclent suppression of SV40 enhaneer aetivity by the Sd silencer re~ion. This fig~lre shows the CAT activities 5 expressed in HuH-7, huH-I/cl-2 ancl HeLa cells after trans~fection with CAT
filsion genes shown in Fig. 3A. The smaller letters correspond to the plasmid eonstruets in Fig, 3A.
Fig. 4 illllstrates the silencer region. The endpoints of deletion are indieated in base pairs from the AFP cap site. CAT activities expressed are 10 shown as pereentages of the pSV2-C~' aetivity above the eorresponcling fragmel1ts. Hi, Elincl III; Bg, Bglll.
Fig. SA illustrates the nlleleoticle seqllenee of the human AFP distal sileneer regions (SEQ ID NO:6). The 17 bp repeatecl elements are underlined.
Fig. 5B illustrates the nueleotide seqllenee of the human AFP proximal 15 silencer region (S13Q ID NO:7). The 17 bp repeatecl element is unclerlirled.
Fig. SC is a eomparison of the 17 bp repeated elements in the distal and proximal sileneer regions.
Fig. 6A illustrates t,he C/~T aetivity of eonstrllcts having the 31 bp sileneer region. C,~ Ae ancl 3-~e are as clefirlecl in Fig. IB.
~0 Fig. 613 illllstrates the n~lcleotide seqllences of tl1e wilcl-type (SBQ ID
NO:8) and mlltant (SFQ IO NO:9) Fragments.
Fig. 6C illustrates the relationsllip between the nllmber of eopies of the 31 bp Scl fragmellt ancl transeription sllppressive aetivity.
- \ l 2~3~
Fig. 7 illustrates the str~lcture of the cliphtheria toxin gene and restriction maps of pSV2-CAT, pSV2tHToxin (SEQ ID NOS.: lO and 11), pTHX1 and pTH1-176.
Fig. 8 indieates the CAT activities expressed in HuH-7 and HeLa eells 5 transfeeted with pSV2-CAT together with pSV2/H Toxin, pTH1-176 or pUC19.
Fig. 9 illustrates ~ restrietion map of a pSV2/H'r/neor plasmid into whieh a neomyein-resistant gene was ineorporatecl allcl shows the transforrnation frequeney of G418 resistant colonies after transfeetion with various plasmids.
Fig. 10A illustrates restriction maps of: a DNA fragment eontaining the 10 AFP gene and the transeriptional reglllatory elements (a promoter P (SEQ ID
NO:4 and 5), enhaneers E" (n~lcleotide regions from SEQ ID NO: 12)and E~
nueleoticles 1700 to 1712 of SEQ ID NO: 12), sileneers Sl (SEQ ID NO:~) and S2 (SEQ ID NO:7) and a glllcocorticoid reactive site G) loeated in the 5'-flanlcing region of the AFP gene; pAF4.9/HToxin; pAF~.9[a2.7]/HToxin;
15 pAF4.9 [A2.7] (S) 8/HToxin; pAF(AB)2(S)~/HToxin; pAF(A13),(S)B/HToxin;
pAF(A)2~B)~(S)8/HToxin; pAF(A)3(B)~/HToxin; pAF0.2/HToxin; ancl pGEM/HToxin. The relative levels oF CAT expression from pSV2-CAT in Hu~I-7 and h~lH-l/e1-2 cells transfectecl with the above plasmicls are indieated.
Fig. 10B illllstrates the restrietion maps of pSVAF(AB)l(S)B/HToxin and 20 pSVAE7(AB)l/HToxin. Ilhe relative levels ot expression from pSV2-CA~' in Hll~I-7 ancl huH-l/e1-2 eells transfected witll the above plaslnicls are indieated.
Fig. 11A is a graph inclieati1lg the close-clepenclelley of the killing efteet ot' variolls reeombinallt plasmicls on ~ H-7 cel ls.
. . : . , :
~ : . . .
~ ~ 3 '~
Fig. 11B is a graph inclic~ting the close-clepenclency of the killing effeet of various recombinar)t plasmi(ls on h~lH-1/c1-2 cells.
Fig. 11C is a graph inclieating the close-depenciency of the killing effect of var;ous recombinant plasmicls on HeLa cells.
Pig. 11D is a graph indicating the dose-clepenclency of the killing effect of various recombinant plasmicls on COS7 cells.
Fig. 12 is the nucleoti(le seqllence of 2.2 kb DNA between -5.1 and -2.9 kb of the human AFP gene (SEQ ID NO: 12). The 408bp region used to eonstruct pSVAF0.4-CAT is boxed. The solid arrow indicates an enhancer 10 eore seqllenee.
Fig. 13 illustrates the variolls mlltant AFP promoters (PEII (SEQ ID
NO:13) and MPEII SEQ ID NO:14)). "72" indicates the 72bp repeats from the SV40 regulatory region.
Fig. 14 illustrates the relative CAT activity observed with various wild-15 type and mutant AFP enhancers ancl wikl-type and mutallt sileneers.
Fig. 15A illustrates the DNA (SEQ ID NO:26) and amino aeid sequence (SEQ ID NO:27) of the Diphtheria Toxin A-ehain.
F;g. 15B illustrates the DNA (SEQ ID NO:28) and amino aeid sequenee (SEQ ID NO:29) of the HToxin gene.
~0 l~RlPTION OF THE PRE~PERRED E ODIMEN'rS
The present invention relates to a metho(l for eontlolling the expression of a heterologous gene in mammalian cells. The invention also relates to a 2~3~
method of destroying cancerolls cells and a recombinant DNA construct for use in sueh a method. Specifically, the present invention provides for the combination of certain elements from the 5' reg~llatory region of the ~-fetoprotein gene functionally linkecl to a heterologous gene for expression in 5 mammalian eells. In particular, it has been found that by combining different silencer, enhancer and promoter elements, it is possible to control the level of expression of a heterologous gene f~lnctionally linked to the transcriptional regulatory region.
The albumin (ALB) and o~-fetoprotein (AFP) genes exhibit extensive 10 homology with regarcl to nllcleic acid seqllence, gene str~lcture, amino acid sequence and protein seconclary foklillg (for review see Ingram_t al. PNAS 78 4694-4698 (1981). These genes are inclepetlclently b~lt reciprocally expressed in ontogeny. In normal development ALB transcription steadily increases with fetal growth and continnes at a high level thro~lgho~lt aclulthood.
15 Transeriptional expression of AI,B in the acl~llt is conFlne(l to the liver. AFP is normally expressecl in the yolk sac in fetal liver, ancl the fetal gastrointestinal traet, bllt deelines after birth ancl is harclly cletectable ;n non-pathologie or non-regenerating adult liver or in other nornlal acl~llt tiss~le. However, A~P
transeription in acl~llt liver often increases clramatically in hepatocell~llar 20 eareinoma (HCC). In acklition, trallscriptioll may also be elevated in non-serninomatolls and t`ixecl carcillollla of the testis; in encloclermal sinus tumors, in certain teratoearcinomas, ancl in certaill gastrointestillal t-lrnors. Liver specific expression of AFP ancl ALB is the res~llt of interactiorls of the regulatory ., , . ~ ... .. ~ : ~ . . .. . . . . . . ... ..
2 1 ~
sequences of their genes with trans-activating, transcriptional factors found in nuclear extracts -from liver.
The methods of this invention may be ~Ised to control the expression of heterologous genes in tisslle cultllre. This may be important where high levels 5 of transcription of the heterologous genes are llndesirable, because large concentrations of the heterologous protein withhl the cell leads to cell cleath.
Further, where it is clesire~l to express genes in normal liver cells, those genes may be linked to AFP reglllatory regions with the silencer region deleted to .
thereby allow the expression of that heterologous gene in all liver cells. While 10 other promoters may be llseful for this pllrpose, the AFP promoter and enhancer are preferred becallse the ~ P promoter is a strong promoter with a high level of transcriptional activity. Since the AFP regulatory elements are assembled in such a manner as to permit the expression of a linked gene in liver, inborn errors of metabolism dlle to the lack or abnormality of a gene rnay 15 be corrected by the present invention. S~lch inborn errors include phenylketonuria, urea cycle disor(lers, hemophiliacs, ol~-antitryps;n cleficiency, and mucopolysaccharicle ~leficiency. Furtllermore, this method should be usefill for treating viral hepatitis, sucll as callsecl by hepatitis C vims, by introducing the gene encocling interferon which has been shown to be highly 20 effective against HCV.
The methods of the present hlvelltioll may also be llseful in the treatment of hepatocellular cancer. ~t has been showll by the inventors that is possible to arrest the growtl1 of, or kill, mammalian carcinoma cells with a recombinimt ~ ~ 3 ~
expression fragment comprising a AFP transcriptional regulatory sequences linked to a toxin gene. This recombinant expression vector may be incorporated into an infective virion. Upon administration of an infective virion eontaining the reeombinant expression fraglllent to a patiellt, the toxin is seleetively expressecl in the target cell. It has been found that the level of expression of the toxin will vary (lepending on the type of eancer eell. By the methods of the present invention, it is possible to acljllst the level of expression of the toxin in the cells. The control of expression may be advantageous to prevent necrosis of liver tisslle in the patiellt or alternatively, to increase the rate of eell death for cancer cells whicl- clo not express large amount of AFP
protein.
In mammalian cells, eertain genes are ubiq~litously expressed. Most genes, however, are expressed hl a temporal ancl/or tissue-specific manner, or are aetivated in response to an extracelllllar inclucer. For example, certain genes are aetively transeribecl only at very precise times in ontogeny in speci~lc eell types or in response to some incllleing stimullls. This regulation is rnecliated in part by the interaction between transcriptional regulatory sequenees (whieh are for example promoter ancl enllallcer reglllatory DNA sequenees), and sequenee-speeifie, DNA-bin(lillg transcril)tiollal protehl faetors.
In mammalian eells, norrnally two DNA seqllences are required for the eoînplete an(l effieient trarlseliptiollal reglllation of genes that eneode messenger RNA's in mammalian cells: promoters ancl enllancers. "Promoters" are loeated immediately upstrealll (S') frolll the start site of transeription. Promoter 2 :~ 3 '~
sequenees are required for accllrate ancl efficient initiation of transeription. A
typieal promoter incl~lcles an AT-rich region cal]ed a TATA box (whieh is located approximately 30 base pairs 5' trom the start site of transeription initiation start site).
S The activity of promoter sequences are mo(lllklte(l by other sequenees ealled "enhaneers". The "enhancer" seqllence may be a great clistcmce from the promoter in either an upstream, (S') or downstream (3') position. Hence, enhaneers operate in an orientation- ancl position-inclepenclent manner.
However, based on similar strllctllral organization and function that may be interehangecl the absolllte clistinction between prollloters and enhaneers is somewhat arbitrary. Enhancers increase the rate ot transcription from the promoter seq~lence. It is preclominantly the interaction between sequence-speeifie transeriptional factors with the promoter ancl enhancer sequences that enable mammalian cells to achieve tisslle-specific gene expression. The 15 presenee of these transcriptiollal protein factors (tisslle-specific, trans-activating faetors) bound to the promoter ancl enhancers (cis-acting, reglllatory sequences) enable other components of the transcriptiollal machillery, inclllding RNA
polymerase, to initiate transcriptioll with tisslle-speci~ic selectivity and aceuraey.
The "sileneer" is a DNA region which inhibits transcription initiation by ~0 intertering with enhaneer activity.
The term "fllnctioncllly linkecl" as llsecl herein Ineans that the transeription regulatory region is lhlked to the heterologolls gene in sueh a /--\ 2 ~ 3 l~
manner that the expression of the heterologolls gene is controlled by the transcription regulatory regiom The term "transcription regulatory region" as usecl herein includes all of the sequences involved in the transcription of a gene including enhancers, S silencers and promoters.
Similar to the reglllatory structllre of the ALB gene, the regulatory elements of the AFP genes promote tisslIe specific expression in certain liver pathologies, such as HCC (Mol. Cel. Biol. 6: 477-487 (1988); Science 235:
53-5g (1987). The regulatory elements of a Inammalian AFP gene consist of a 10 specific 5' promoter-proximal region (locate~l in some mammalian species between 85 ancl 52 bp 5' to the gene). This seclllence is essential for transcription in hepatomas. In ad(litioll, there are upstream (5') regulatory elements well definecl for the murine AFP gene which behave as classical enhancers (Mol. Cel. Biol. 6: 477-487 (1986); Science 235: 53-58 (1987).
15 These upstream regulatory elements are desigllatecl elelnents I, II and III and are located between 1,000 to 7,600 bp 5" to the transcription initiation site for the murine AFP gene. These three enhancer dolllains are not filnctionally equivalent at generating tisslle-specific expression of AFP. Elements I and II
have the greatest capacity to direct liver-specific expression of AFP. It is ~0 important to note that the reglllatory seqllellces of the AFP gene aclvantageollsly contain the seqllences not only for tisslle-specific transcriptional activation but also for repression of expression in tissues which shollkl not express AFP.
~3'~
The regulatory regions of the h~lman AFP gene have been characterized.
A structural gene placeci in the correct orientation 3' to the wild-type AFP
regu1atory sequences will enable that structllral gene to be selectively expressed in fetal liver, hepatomas, non seminomatous c arcinomas of the testis, certain 5 teratocarcinomas, certain gastrointestinal tln1lors and other normal ancl pathological tissues which specifically express AFP. The DNA fragment containing the transcriptional reglllatory region of the AFP gene, which is a part of the recombinal1t DNA of tl~e present invel1tiol1~ should be a DNA
fragment obtained from tl1e reg~llatory region of the AFP gene, that is, the 5'-10 flanking region (the llpstream region) of the AFP gene.
As used herein the term "AFI' pron1oter" means a promoter *om a mammalian AFP gene region. Prelerably the promoter is from the human AFP
gene region. More preferably the promoter comprises the seqllence disclosed in Fig. 13 (SEQ ID NOS:4, 5, 13 and 14). The promoter may be the wild-type 15 promoter or it may be a mutate~l promoter. As usecl herein the term "AFP
enhancer" means a DNA seqllence enco(ling an enhancer from a mammalian AFP gene region. Preferably the enhallcer is from the humarl AFP gene region. More preferably the enl1ancer comprises the seqllences of clomain A or domain B as disclosed in Fig. 14 (SEQ lD NOS: 15-24). The enhancer may be 2() the wilcl-type enh.lncer or a lnlltate~l enllancer. As llsecl hereil1 the term "AFP
silencer" means a DNA seqllence enco~ling a malnlnalian AFP silencer.
Preferably the silencer is From the h1ll11al1 AFP genc region. More preferably the silencer comprises tlle DNA seq1lellce as clisclosecl in Fig. 5 (SEQ ID NOS:
-"` 2 ~ 4 6 and 7). The silencer may be the wilcl-type silencer or a mutated silencer.
The silencer may be the clistal silencer or the proximal silencer.
The above-described transcriptional reglllatory DNA fragment rnay be either a native 5'-flanking seqllence of the AFP gene or a recombinant DNA
S fragment containing one or more of the enhancer, silencer and promoter of the AFP gene. The native 5'-flanking noll-co(ling region of the AFP gene eontains two enhancer sites, two silencer sites ancl one promoter site, as shown in Fig 10, whereas the recombinant DNA fragment may have variable numbers of enhaneer and silencer elements.
Further, as shown in Fig. 10, the native AFP gene has a glucocorticoicl responsive element (g) in the trallscliptional regllkltory regiom Uncler the presence of glucocorticoicl, the responsive element moclifies the expression of AFP. Therefore, when a recombinant DNA fragment containing the glucocortieoid responsive element is usecl the expression of a cancer-cell 15 damaging protein can be reglllatecl by aclministering gl~lcocorticoid.
The toxin gene may be a DNA fragment encocling a substance which alters, damages or kills not only cancer cells bllt also normal cells. Because, as deseribed above, the expression of the gene in the recombinant DNA construet of the present invention is eontlollecl by the transcriptional reg~llatory region of 20 the AFP gene, the DNA fragment enco~ling for s~lch a substanee ean be eontrolled sueh that it is trallscribecl only ill AFP-proclllcing cancer cells. Such genes may eneode for clireet toxhls or inclirect toxins. Examples of "direet toxins" are toxin genes, sllch as cliphtlleria toxh1 (Maxwell, I.H., et al., Caneer 2 1 3 '~
Res., 46:4660-4664 (1986)) an~l ricin [Weiner, L. M., et al., 1989, Masui, H., et al., 1989]; cytokine genes [Blankensteill, T., et al., J. Exp. Med., 173, lV47-1052 (1991), Colombo, M. P., et al., J. Exp. Med., 173, 889-897 ~1991), Leone, A., et al., Cell, 65, 25-35 (1991~]; tumor suppressor genes 5 (Huang, M. J. S., et al., Science, ~42, 1563-1566 (1988), Mercer, W. E., et al., Proe. Natl. Acad. Sci. USA, 88, 1958-1962 (1988)]; tumor vaccination genes, [Wallich, R., et al., Natllre, 315, 301-305 (1985), Rollins, B., et al., Mol. Cell. Biol., Il, 3125-3131 (1991)~ DNA seq~lences that yield anti-sense RNA to oneogenes; genes encoding t~lmoroiclal substances JE/McP-1; genes that 10 produee anti-vims substallces; arlcl genes that ind~lce apoptosis.
Preferably, the clirect tOXill is clipl)thelia toxin (DT). This toxin catalyzes the transfer of the ADP-ribose nloiety of NAD to elongation factor 2 (EF-2) thereby bloeking plotein synthesis an(l ca~lsing cell death. DT consists of 535 amino aeicls eomprising two sllb~lnits designated the A and B ehains (see 15 Fig. 15A). The A chain (DT-A) which comprises the 193 amino-terminal residues (SEQ ID NO:~7) cataly~es A~:)P-ribosylation of EF-2 and the B ehain (DT-B) whieh eomprises the 3~2 earboxyl termillal residues promotes the binding of the toxin to eells allcl the entry of DT-A into the eytosolic eompartment. DT-A is extremely toxic once ;nsicle tlle cell and there is 20 evidence that the introdllctioll of a single molecllle of this protein is lethal for a eell. (Yamaiz~lmi et al. 1978) More preferably, an attenllated l`orm ot` the D1'-A gene will be used in this invention. F:or example, an attellllatecl form of DT-A (tox 176) has been : ': ~. . . : - : ... .: ::: . .~...... -: .: : :: .
?.~3i~9~
generated through chemical mlltagenesis of the wikl-type DT-A gene (SEQ ID
NO:29) (Uchida et al. 1973; Yamaiz~lmi et al. 1978) (see Fig. 15B). The mutant toxin has been shown to be abollt 30-fold less toxic than the wild-type protein. Such attemlatecl forms of toxhl may enhance target cell specificity and S prove to be highly versatile ancl effective agents for targeted cell killing.
Both the wild-type ancl m~ltallt DT-~ genes have been cloned and seqllenced (Green~lel(l et al (1983); PNAS 80: 6853-6857). They differ in the second position of codon 128, reslllthlg in the sllbstitlltion of aspartic acid for a glycine in the dedllcecl amhlo acid seqllence. Several inactive DT-A mutants 10 have also been isolatecl (Giannini et al. 1984; Kaczorek et al., 1983). These stu(lies have revealed amino acicl resicllles critical for biological filnctions of DT-A. Knowleclge of the relationship between seqllence changes and diminished DT-A activity can be llsecl by one skilled in the art to generate additional DT-A
mutants with varying degrees of cytotoxicity. One skilled in the art, given the 15 disclosure of this application, colllcl generate recombinant DNA constructs for expression of the mlltant toxin in cancer cells.
Alternatively an indirect toxin or enzyme pro-(lrllg combinations may also be llsed; providing the enzyme is capable of selectively activating the aclministered compollnd f~ither clilectly or througll an intermecliate to a cytostatic 20 or cytotoxic metabolite. Eqllally the choice of compollncl will clepencl on the enzyme systcm used, bllt mllst be selectively Inetabolize(l by the enzyme e;ther clirectly or inclirectly to a cytotoxic or cytostatic metabolite. One skilled in the art could select sllch a colllpollll(h '' ' ~ ~ ' . .
.. . ...
` ` 2 ~ 4 The varieella zoster virlls (VZV) encodes a specific thymidine kinase protein. The gene has been clonecl, seq~iencecl ancl charaeterizecl (J. Gen.
Virol. 67: 1759-1816)). The VZV thymicline kinase will, in eontrast to the mammalian enzyme~ selectively monophosphorylate speeifie purine arabinosicles and substitllted pyrimicline eompoullcls. 9-(~-D -arabinofuranosyl)-6methoxy-9 H -pwrine is eonverted to 9-~-D-arabinof~ranosyl adenine tripohosphate [Ara ATP] by this enzyme. [E~llropean Patent f\pplieation No. 0 415 731 whieh is ineorporated by referenee herein].
Other enzyme pro-clrug eombhlations inelucle the baeterial (for example from Pselldomonas) enzyllle earboxypeptidase G2 with the pro-drug para-N-bis (2-ehloroethyl) aminobenzoyl gllltamie aeicl. Cleavage of the glutamie aeid moiety from this eompolln(l releases a toxie benzoie aeicl mllstard; alkaline phosphatase from, for example, ealf hltestine, will eonvert inaetive phosphorylated eompouncls sueh as etoposicle-phosphate, doxorubiein-phosphate, mitomyein phosphate, to toxie clephospllorylatecl metabolites. Penieillin-V
amidase will eonvert phenoxyaeetamicle clerivatives of doxorubiein and melphalan to toxie metabolites ancl the fllngal (for example from Fusarillm oxysporum) eytosine deaminase will eonvert S-fllloroetosine to toxie S-fluorouraeil.
The heterologolls gene for expression in mallllllalian eells may be any gene eapable of being expressecl in mammaliall eells. For example, the gene may be phenylalanille hydroxylase, llrea eyele enzyllles, elotting ~aetors, o~,-antitrypsin, muec)polysaeellaricle or interferon.
.. , .. .. ".. .. .. ~ .. . . . ~ ........ .... - .- . .. . . . . .
~:~3 ~3~L~
The veetor earrying sweh a reeombinant DNA showid be able to enter human eells ancl have no aclverse effeet on hwmall normal eells. Examples of the veetor are: p]asmicl veetors, retroviralveetors, ancl aclenoviralveetors.
A variety of methods are available to introclwee foreign genes into 5 mammalian eells in vitro. The most popwlar teehniqwes are the ealeiwm phosphate preeipitation methocl (Graham ancl van cler Eb, 1973), DEAE-dextran-mediatecl transfeetion (Lopata et al. 1984), liposome mediatecl transfeetion (Cwdd 1984) ancl eleetroporation (Potter et al. 1984). In the eale;um phosphate preeipitation proeecl~lre, DNA is eopreeipitatecl with calcium 10 phosphate to form insolwble partieles whiell are talcen wp by eells by phagoeytosis.
The DEAE-dextran protoeol is a highly effieient and reproclweible transfeetion proeedwre. A solwtioll eontailling 2mg/ml of the clesired DNA, 250mg/ml of DEAE-dextlan (MvS00.000; Sigma), 50 mM Tris-HCI, pH7.5, ;s 15 filtered through 0,2,u filter ancl acklecl to the ewltllre meclillrn. Following an incllbation for 2 howrs at 37C, the mecliwm is removed and the cells washed three times with meclillm and ewltllred in growth medilllll for 58 hours.
Liposome - mecliatecl transt`eetioll is anotller transfeetion proeedwre. A
solution eontaining I ,ug ancl lO /ll eationie liposornes (I mg/ml) is acldecl to 0.5 ~0 ml serwm-free medilll1l. 'rhis is applied to eells ancl h1ellbated at 37C tor 3 to S howrs. The meclillm is thell replaee(l with fresh growth meclium and ewltllred for ~8 howrs.
2~3~9~
Electroporation uses an electric fïelcl to open ~Ip pores in the eell which allow entry of DNA molecl~les preslllnably throllgh diffusion (Fromm et al.
1985; Neumann et al. 1982; Wong and Nellmann 1982). Electroporation is most conveniently done llSing suspellsioll cllltllres, whereas the calcium S phosphate precipitation method ancl lhe DEAE-clextran-mecliated transfection are most easily clone using monolayer cllltllres.
The techniqlle of retroviral int`ection of cells to integrate artificial genes into mammalian cells in mcllllmals employs retroviral shuttle vectors which are ~-known in the art, (see tor example Miller ancl B~ltimore (1986) Mol. and Cell 10 E3iol. 6: 2895-290~). Essentially, retroviral shllttle vectors are generatecl using the I~NA form of the retrovirlls containecl in a plasrnicl. These plasmids also eontain seqllences necessary for selection and growth in bacteria. Retroviral shuttle veetors are constr~lcted ~Ising stan(larcl moleclllar biology techniqlles well known in the art. Retroviral shllttle vectors have the parental endogenolls 15 retroviral genes (eg. gag, ~ ancl env) remove(l and the DNA sequence of interest inserted, such as the moleclllar chimaeras which have been described.
They however, contain appropriate retloviral reglllatory seqllences for viral encapsiclation, proviral insertion hlto the target genome, message splicing, termination an(l polyadenylatioll. Retroviral shllttle vectors can be derivecl from ~0 the Moloney mllrine lelllcemicl vir~ls (Mo-MLV) b~lt it will be appreciatecl that other retroviruses ean be llse(l s~lch as the closely related Moloney murine sareoma virlls. (Eillropeall Patellt Applic~tioll No. 0 ~15 731 which is incorporatecl herehl by reference). Certain DNA virllses may also prove to be 2~3~
usefill as a clelivery system. The bovine papilloma virlls [BPV] replicates extraehromosomally so that cielivery system basecl on BPV have the advantage that the delivered gene is maintainecl in a nonintegrated manner.
The aclvantages of a retroviral-mecliatecl gene transfer system are the S high ef~leieney of the gene clelivery to the targetecl tissue, sequence speeifie integration regarding the viral genome (at the 5' ancl 3' long terminal repea~
(LTR) sequel1ees) and little rearrangements of clelivered DNA eompared to other DNA clelivery systems.
Aeeordingly in one embo(liment of the present invention there is 10 providecl a retroviral shllttle vector comprising a DNA seq~lenee eomprising a S' viral l,TR seqllence, a cis acthlg psi encapsiclation sequence, a reeombinant DNA eonstrllet ancl a 3' viral LTR seqllence.
In one emboclhoellt, ancl to help elhllinate non-tissue-speeiFIe expression of the moleelllar ehimaera, the recombinant DNA eonstrllet may be plaeed in 15 opposite transeriptional orientation to the 5' retroviral LTR. In acldition, a dominant seleetable marker gene may also be inellldecl whieh is transeriptionally clriven from the 5' LTR seqllellce. Sllch a clominal1t selectable marker gene may be the baeterial neomyein-resistance gene NEO (Aminoglycoside 3"
phosphotransl~erase type 11), whiell eonfers on ellkaloytie eells resistallee to the 20 neomye;n analogue G418 sl.llpl1ate ((iF,NE3'rlClN) The NEO gene aids in the seleetion ol~ paekaging cells whiell eontaill these seqllenees. Other veetors eontaining a NEO gene as a selectable markel have been cleseribed, for example, the N2 veetor (Seience ~30: 1395-1398 (1985).
9 ~
A theoretical problem associatecl with retroviral shuttle vectors is the potential of retroviral long termhlal repeat (LTR) regulatory sequences transcriptionally activating a cellular oncogene at the site of integration in the host genome. This problem may be diminished by creating SIN vectors. SIN
5 vectors are self-activating vectors whicll contain a cleletion comprising the promoter and enhancer regions in the retroviral L,TR. The LTR seqllences of SIN vectors do not transcriptionally activate 5' or 3' genomic sequences. The transcriptional inactivation of the viral LTR seq~lences diminishes insertional aetivation of adjacent target cell DNA seqllences and also aids in the selected 10 expression of the clelivere(l moleclllar chilllaera. SIN vectors are created by removal of approxhllately 299 bp hl the 3' viral l,'I'R seq~lence (Biotechniques 4 504-512 (1986).
Thus pref`erably the retroviral shuttle vector of the present invention are SIN vectors.
Since the parental retroviral gag, pol an(l env genes have been removed from these shllttle vectors, a helper virlls system may be utilized to provide the ~ag, pol ancl env retroviral gene pro(lllcts necessary to package or eneapsidate the retroviral vector into an h1tective virion. This is accomplished by utilizing specializecl "packaging" cell lhles, which are capable of generating infectious, 20 synthetic vir~ls yet are ~leficient in the ability to pro(lllce any detectable wikl-type virus. In this way the altiricial synthetic virlls contains a chimaera of the present inventioll package(l intc) syntlletic artificial hllectiolls virions free of wilcl-type helper virlls. 'l`his is base~l on the tact that the helper virus that is 2 ~ 3 ~
-2~-stably integrated into the packaging cell contains the viral stmetural genes, but is laeking the psi site, a cis acting regulatory seq~lenee whieh must be eontained in the viral genomie RNA molecllle Çor it to be eneapsidated into an infeetious viral partiele.
In addition to removal of the psi site, adclitional alterations ean be made to the helper virlls LTR reglllatory seqllenees to insure that the helper virus is not paekaged in virions an(l is bloekecl at the level of reverse transeription and viral integration.
Seleetivity of expression may be aclditionally improved by selective 10 infeetion of liver eells. The retroviral env gene present in the packaging cell line defines the speeifieity for host int`eetion. The env gene used ;n eonstrueting the paekaging eell line is mo(lifiecl to generate artifieial, infeetive virions that seleetively infeet hepatoeytes. As an example, a retroviral env gene introdueed into the paelcaging eell may be modifiecl in sueh a way that the 15 artifieial, infeetive virion's envelope glycoprotein selectively infeets hepatocytes via the specifie receptor mediatecl binding lltilizecl by the hepat;tis B virus (HBV).
HBV primarily hlfects hepatocytes via specific receptor mediated bincling. The HBV proteins encode(l by the pre-Sl ancl pre-S2 sequenees play a 20 major role in the ~ttaehmellt of HBV to hepatocytes (Hepaclna Viruses edite(l Robinson Q~ 189-2031 205-221, 1987). The env gene of the paekaging eell is modi~led to inclllcle the hepatoeyte bhl(lillg site of the large S HBCV
envelope protein. Sllch modificatiolls ol` the env gelle intro(lllced into the ~. , , . ., , ,. ~ , . .. . . .. . . . .
The prognosis of HCC is poor with the worlcl-wide frequeney rate almost equalling the mortality rate. After diagnosis, the median survival time is less than four mc~nths. Long-term survival, clefinecl as sulvival longer than one year after the diagnosis, is seen only occasionally. Most ~CC patients 10 suecllmb to either the complications of liver failllre with or without massive bleeding, or to the general effects of a large tllmor burden, with eachexia, malnutrition~ infeetion and sepsis. Thollgh clistant metastases oceur (up to 90%
of patients have metastatie tumors at the time of death), hepatie disease most often limits survival. Consequently, therapies directed towards the eontrol of 15 hepatic tumors are appropriate, although it will be appreciatecl that treatment of the metastatie clisease is also of great importanee. (Berk. P. (Ecl) Seminars in Liver Disease 4, No. 2, Thieme-Stratton Ine. N.Y. N.Y. (1984).
Cllrrent therapies available to the elinieian are on the whole ineffeetive as a eure for this disease (Nerenstone ~., Caneer Treatment Review 15, 1-31 ~0 (198~). Systemie single and eombillation agent ehelllotherclpy ancl radiation are relatively ineffeetive. Sinee a eaneer eell of a patient originates from a normal eell of the same patient, these known agents fail to elearly discriminate eancer ~.. ~., ~ ......... ? .. .
cells ~rom normal ce]ls, th~ls ca~lsing vario~ls aclverse effects. Therefore, use of the known cancer-therapeutic agents is significantly limited in various ways.
To date, surgery continues to be the only potential cllre. However, at the time of diagnosis, the overwhelming majority of patients are not able to 5 undergo radical surgery. In certain studies (Nerenstone et al. supra) it was found that less than 3% of patients were considered capable of unclergoing surgery and of the small percentage that clo, approximately 50% suffer from postoperative morbidity (Nerenstone et al. sllpra). However, it is appreciated by those skilled in the art that novel approaches and entities for cancer therapies 10 are required.
Gene therapy involves the stable integration of new genes into particular target cells ancl the expression of those genes, once they are in place, to alter the phenotype of that particl~lar target cell (for review see Anderson, W.F.
Science 226: 401-~09, 1984; McCormick, 1~. Biotechnology 3: 690-693, 15 1985).
Genetic ablation takes advantage of tisslle specificity of certain gene reglllatory elements to express a toxin gene in a cell specific manner. For example, Goring et al. (1987) Science 235: 456-458 have shown that the ~2-crystallin prornoter is ab]e to clirect expression of a linke(l lacZ gene in the lens 20 fiber cells in transgenic mice in a cleveloplnental manner. When the cliphtheria toxin A-chain (DT-A) gene is expressecl in a similar manller in the lens ~Iber cells in mice, microphthalmic mice having lcnses cleFicient of fiber cells are obtained (Brietman et al., (1987) Science 238: 1563-1565). When an attenuated 2~4~
DT-A gene (tox 176) is used, transgenic mice which displayed predominately cataracts or clinical anophthalmia were obtained (Brietman et al. (1990) Mol.
Cell Biol. 10: 474-479).
Palmiter et al. (1987) Cell 50: 435-443 have llsed the elastase I
S promoter/enhancer to drive the expression of the DT-A gene in pancreatic acinar cells to yield mice lacking a normal pancreas.
Alternatively, the expression of a gene encocling an enzyme capable of selective conversion of chemical agents to cytotoxic or cytostatic metabolites has been proposed. (European Patent Application No. 0 415 731). A
lû molecular cllimaera is constructed whicll consists of a natural transcriptional reg~llatory region attached to a gene encocling all enzyme which is capable of converting a metabolite into the toxin. Upon administration of the molecular chimaera to the patient and the metabolite, the enzyme is expressed in the cancer cells, which enzyme converts the metabolite into the toxin thereby 15 killing the cancer cells. However, this proced~lre requires the administration of two chemicals. Also, the possibility exists that the metabolite may be converted into the toxin in the incorrect cells res~llting in toxicity to normal cells. ~
method of controlling the expression of a toxin gene in cancer cells would be useful.
2 ~ 3 ~
SUMMARY OF TME INVENTION
The present invention is clirectecl to a method of expressing a heterologous gene in mammcllian cells and to a recombinant DNA eonstruet for use in the method.
~eeordingly, one aspeet of the present invention provides a method of expressing a heterologous gene in a mammalian cell comprising inserting a DNA eonstruet into a mamlnalian eell, said construct comprising an AFP
enhaneer region and an AFP promotor funetionally linkecl to the heterologous gene in the absenee of an AFP silencer region, ancl expressing the heterologous 10 gene in the mammalian eells.
Another aspect of the present invention provides a method of killing eells whieh eonstitutively express AI~P eomprising inserting a DMA
eonstruet into a mammalian eell, said construct comprising an enhaneer region, an AFP sileneer region ancl a promoter sequenee funetionally linked to a direet 15 toxin gene and expressing the toxin gene in the mammalian eells under eonditions sueh that only eells which constitutively express AFP are killed.
Also providecl are mutated enhancer dolllaills ancl sileneer regions usefill in the methods of this invention.
Further advantages of the present invention will beeome apparent fronn ~0 the following deseription of the invention with referenee to the attaehed clrawings.
,,,, ~ ~ " ~,, , ,; ","~, "",;,, ,~, ",, " ,"~"~""" ,"~ ip '~
~ ~ 3 ~
_RIEF DESCRIPTION OF THE DRAWINGS
Fig. lA illustrates CAT fusion genes containing the huma1l albumin and o~-fetoprotein (AFP) 5'-flanking regions. Positions of the enhancers (E, SEQ ID
NO:1, EA and Eb nucleoti(les 1700 to 1712 of SEQ ID NO:12), promoters (P
S SEQ ID NOS:2, 3,4 ancl 5), glucocorticoid - responsive element (G) and AT-rich elements are also indicatecl.
Fig. lB illustrates CAT activities expressecl in Hul 1-7 and hul-I-1/e1-2 cells transfected with the CAT fusion genes shown in Fig lA. CAT activities as a pereentage of pSV2-CA'I' activity are shown above the autoradiograms.
10 Cm - chloramphenicol; l-Ac, l-acetate chloramphenicol; 3-Ac, 3-acetate chloramphenieol .
Fig. lC illustrates the effeets of clexalnethasone on CAT aetivities in HuH-7 and huH-1/c1-2 cells transfected with pAF1.0-CAT. Cm, 1-Ac and 3-Ac are as defined in Fig. lB. -~ ancl - indicate the presenee and absenee of 15 dexamethasone respectively.
Fig. lD illustrates the AFP enhallcer/SV40 early promoter fusion genes;
Hi, Hind III; Bg, Bglll.
Fig. 2 illllstrates the detection o~ sileneer aetivities by deletion analysis.
The preeise end points of the cleletion are inclicatecl in base pairs from the AFP
20 eap site. The elosecl bars in(licate AFP 5' -flanlcing seqllences and the dotted lines indieate deletecl seqllences. Tlle CAT activities are expressecl relative to pAFO.2(13g)-CAT(pAFO.2) which contains the 169 bp /~FP promoter region.
..
: . ;: ~ ; . : ~ , .
.
2 ~
Fig. 3A i~lustrates the plasmicls constrllcted to test the effect of the position of the silencer region.
Fig. 3B illustrates the position (lepenclent suppression of SV40 enhaneer aetivity by the Sd silencer re~ion. This fig~lre shows the CAT activities 5 expressed in HuH-7, huH-I/cl-2 ancl HeLa cells after trans~fection with CAT
filsion genes shown in Fig. 3A. The smaller letters correspond to the plasmid eonstruets in Fig, 3A.
Fig. 4 illllstrates the silencer region. The endpoints of deletion are indieated in base pairs from the AFP cap site. CAT activities expressed are 10 shown as pereentages of the pSV2-C~' aetivity above the eorresponcling fragmel1ts. Hi, Elincl III; Bg, Bglll.
Fig. SA illustrates the nlleleoticle seqllenee of the human AFP distal sileneer regions (SEQ ID NO:6). The 17 bp repeatecl elements are underlined.
Fig. 5B illustrates the nueleotide seqllenee of the human AFP proximal 15 silencer region (S13Q ID NO:7). The 17 bp repeatecl element is unclerlirled.
Fig. SC is a eomparison of the 17 bp repeated elements in the distal and proximal sileneer regions.
Fig. 6A illustrates t,he C/~T aetivity of eonstrllcts having the 31 bp sileneer region. C,~ Ae ancl 3-~e are as clefirlecl in Fig. IB.
~0 Fig. 613 illllstrates the n~lcleotide seqllences of tl1e wilcl-type (SBQ ID
NO:8) and mlltant (SFQ IO NO:9) Fragments.
Fig. 6C illustrates the relationsllip between the nllmber of eopies of the 31 bp Scl fragmellt ancl transeription sllppressive aetivity.
- \ l 2~3~
Fig. 7 illustrates the str~lcture of the cliphtheria toxin gene and restriction maps of pSV2-CAT, pSV2tHToxin (SEQ ID NOS.: lO and 11), pTHX1 and pTH1-176.
Fig. 8 indieates the CAT activities expressed in HuH-7 and HeLa eells 5 transfeeted with pSV2-CAT together with pSV2/H Toxin, pTH1-176 or pUC19.
Fig. 9 illustrates ~ restrietion map of a pSV2/H'r/neor plasmid into whieh a neomyein-resistant gene was ineorporatecl allcl shows the transforrnation frequeney of G418 resistant colonies after transfeetion with various plasmids.
Fig. 10A illustrates restriction maps of: a DNA fragment eontaining the 10 AFP gene and the transeriptional reglllatory elements (a promoter P (SEQ ID
NO:4 and 5), enhaneers E" (n~lcleotide regions from SEQ ID NO: 12)and E~
nueleoticles 1700 to 1712 of SEQ ID NO: 12), sileneers Sl (SEQ ID NO:~) and S2 (SEQ ID NO:7) and a glllcocorticoid reactive site G) loeated in the 5'-flanlcing region of the AFP gene; pAF4.9/HToxin; pAF~.9[a2.7]/HToxin;
15 pAF4.9 [A2.7] (S) 8/HToxin; pAF(AB)2(S)~/HToxin; pAF(A13),(S)B/HToxin;
pAF(A)2~B)~(S)8/HToxin; pAF(A)3(B)~/HToxin; pAF0.2/HToxin; ancl pGEM/HToxin. The relative levels oF CAT expression from pSV2-CAT in Hu~I-7 and h~lH-l/e1-2 cells transfectecl with the above plasmicls are indieated.
Fig. 10B illllstrates the restrietion maps of pSVAF(AB)l(S)B/HToxin and 20 pSVAE7(AB)l/HToxin. Ilhe relative levels ot expression from pSV2-CA~' in Hll~I-7 ancl huH-l/e1-2 eells transfected witll the above plaslnicls are indieated.
Fig. 11A is a graph inclieati1lg the close-clepenclelley of the killing efteet ot' variolls reeombinallt plasmicls on ~ H-7 cel ls.
. . : . , :
~ : . . .
~ ~ 3 '~
Fig. 11B is a graph inclic~ting the close-clepenclency of the killing effeet of various recombinar)t plasmi(ls on h~lH-1/c1-2 cells.
Fig. 11C is a graph inclieating the close-depenciency of the killing effect of var;ous recombinant plasmicls on HeLa cells.
Pig. 11D is a graph indicating the dose-clepenclency of the killing effect of various recombinant plasmicls on COS7 cells.
Fig. 12 is the nucleoti(le seqllence of 2.2 kb DNA between -5.1 and -2.9 kb of the human AFP gene (SEQ ID NO: 12). The 408bp region used to eonstruct pSVAF0.4-CAT is boxed. The solid arrow indicates an enhancer 10 eore seqllenee.
Fig. 13 illustrates the variolls mlltant AFP promoters (PEII (SEQ ID
NO:13) and MPEII SEQ ID NO:14)). "72" indicates the 72bp repeats from the SV40 regulatory region.
Fig. 14 illustrates the relative CAT activity observed with various wild-15 type and mutant AFP enhancers ancl wikl-type and mutallt sileneers.
Fig. 15A illustrates the DNA (SEQ ID NO:26) and amino aeid sequence (SEQ ID NO:27) of the Diphtheria Toxin A-ehain.
F;g. 15B illustrates the DNA (SEQ ID NO:28) and amino aeid sequenee (SEQ ID NO:29) of the HToxin gene.
~0 l~RlPTION OF THE PRE~PERRED E ODIMEN'rS
The present invention relates to a metho(l for eontlolling the expression of a heterologous gene in mammalian cells. The invention also relates to a 2~3~
method of destroying cancerolls cells and a recombinant DNA construct for use in sueh a method. Specifically, the present invention provides for the combination of certain elements from the 5' reg~llatory region of the ~-fetoprotein gene functionally linkecl to a heterologous gene for expression in 5 mammalian eells. In particular, it has been found that by combining different silencer, enhancer and promoter elements, it is possible to control the level of expression of a heterologous gene f~lnctionally linked to the transcriptional regulatory region.
The albumin (ALB) and o~-fetoprotein (AFP) genes exhibit extensive 10 homology with regarcl to nllcleic acid seqllence, gene str~lcture, amino acid sequence and protein seconclary foklillg (for review see Ingram_t al. PNAS 78 4694-4698 (1981). These genes are inclepetlclently b~lt reciprocally expressed in ontogeny. In normal development ALB transcription steadily increases with fetal growth and continnes at a high level thro~lgho~lt aclulthood.
15 Transeriptional expression of AI,B in the acl~llt is conFlne(l to the liver. AFP is normally expressecl in the yolk sac in fetal liver, ancl the fetal gastrointestinal traet, bllt deelines after birth ancl is harclly cletectable ;n non-pathologie or non-regenerating adult liver or in other nornlal acl~llt tiss~le. However, A~P
transeription in acl~llt liver often increases clramatically in hepatocell~llar 20 eareinoma (HCC). In acklition, trallscriptioll may also be elevated in non-serninomatolls and t`ixecl carcillollla of the testis; in encloclermal sinus tumors, in certain teratoearcinomas, ancl in certaill gastrointestillal t-lrnors. Liver specific expression of AFP ancl ALB is the res~llt of interactiorls of the regulatory ., , . ~ ... .. ~ : ~ . . .. . . . . . . ... ..
2 1 ~
sequences of their genes with trans-activating, transcriptional factors found in nuclear extracts -from liver.
The methods of this invention may be ~Ised to control the expression of heterologous genes in tisslle cultllre. This may be important where high levels 5 of transcription of the heterologous genes are llndesirable, because large concentrations of the heterologous protein withhl the cell leads to cell cleath.
Further, where it is clesire~l to express genes in normal liver cells, those genes may be linked to AFP reglllatory regions with the silencer region deleted to .
thereby allow the expression of that heterologous gene in all liver cells. While 10 other promoters may be llseful for this pllrpose, the AFP promoter and enhancer are preferred becallse the ~ P promoter is a strong promoter with a high level of transcriptional activity. Since the AFP regulatory elements are assembled in such a manner as to permit the expression of a linked gene in liver, inborn errors of metabolism dlle to the lack or abnormality of a gene rnay 15 be corrected by the present invention. S~lch inborn errors include phenylketonuria, urea cycle disor(lers, hemophiliacs, ol~-antitryps;n cleficiency, and mucopolysaccharicle ~leficiency. Furtllermore, this method should be usefill for treating viral hepatitis, sucll as callsecl by hepatitis C vims, by introducing the gene encocling interferon which has been shown to be highly 20 effective against HCV.
The methods of the present hlvelltioll may also be llseful in the treatment of hepatocellular cancer. ~t has been showll by the inventors that is possible to arrest the growtl1 of, or kill, mammalian carcinoma cells with a recombinimt ~ ~ 3 ~
expression fragment comprising a AFP transcriptional regulatory sequences linked to a toxin gene. This recombinant expression vector may be incorporated into an infective virion. Upon administration of an infective virion eontaining the reeombinant expression fraglllent to a patiellt, the toxin is seleetively expressecl in the target cell. It has been found that the level of expression of the toxin will vary (lepending on the type of eancer eell. By the methods of the present invention, it is possible to acljllst the level of expression of the toxin in the cells. The control of expression may be advantageous to prevent necrosis of liver tisslle in the patiellt or alternatively, to increase the rate of eell death for cancer cells whicl- clo not express large amount of AFP
protein.
In mammalian cells, eertain genes are ubiq~litously expressed. Most genes, however, are expressed hl a temporal ancl/or tissue-specific manner, or are aetivated in response to an extracelllllar inclucer. For example, certain genes are aetively transeribecl only at very precise times in ontogeny in speci~lc eell types or in response to some incllleing stimullls. This regulation is rnecliated in part by the interaction between transcriptional regulatory sequenees (whieh are for example promoter ancl enllallcer reglllatory DNA sequenees), and sequenee-speeifie, DNA-bin(lillg transcril)tiollal protehl faetors.
In mammalian eells, norrnally two DNA seqllences are required for the eoînplete an(l effieient trarlseliptiollal reglllation of genes that eneode messenger RNA's in mammalian cells: promoters ancl enllancers. "Promoters" are loeated immediately upstrealll (S') frolll the start site of transeription. Promoter 2 :~ 3 '~
sequenees are required for accllrate ancl efficient initiation of transeription. A
typieal promoter incl~lcles an AT-rich region cal]ed a TATA box (whieh is located approximately 30 base pairs 5' trom the start site of transeription initiation start site).
S The activity of promoter sequences are mo(lllklte(l by other sequenees ealled "enhaneers". The "enhancer" seqllence may be a great clistcmce from the promoter in either an upstream, (S') or downstream (3') position. Hence, enhaneers operate in an orientation- ancl position-inclepenclent manner.
However, based on similar strllctllral organization and function that may be interehangecl the absolllte clistinction between prollloters and enhaneers is somewhat arbitrary. Enhancers increase the rate ot transcription from the promoter seq~lence. It is preclominantly the interaction between sequence-speeifie transeriptional factors with the promoter ancl enhancer sequences that enable mammalian cells to achieve tisslle-specific gene expression. The 15 presenee of these transcriptiollal protein factors (tisslle-specific, trans-activating faetors) bound to the promoter ancl enhancers (cis-acting, reglllatory sequences) enable other components of the transcriptiollal machillery, inclllding RNA
polymerase, to initiate transcriptioll with tisslle-speci~ic selectivity and aceuraey.
The "sileneer" is a DNA region which inhibits transcription initiation by ~0 intertering with enhaneer activity.
The term "fllnctioncllly linkecl" as llsecl herein Ineans that the transeription regulatory region is lhlked to the heterologolls gene in sueh a /--\ 2 ~ 3 l~
manner that the expression of the heterologolls gene is controlled by the transcription regulatory regiom The term "transcription regulatory region" as usecl herein includes all of the sequences involved in the transcription of a gene including enhancers, S silencers and promoters.
Similar to the reglllatory structllre of the ALB gene, the regulatory elements of the AFP genes promote tisslIe specific expression in certain liver pathologies, such as HCC (Mol. Cel. Biol. 6: 477-487 (1988); Science 235:
53-5g (1987). The regulatory elements of a Inammalian AFP gene consist of a 10 specific 5' promoter-proximal region (locate~l in some mammalian species between 85 ancl 52 bp 5' to the gene). This seclllence is essential for transcription in hepatomas. In ad(litioll, there are upstream (5') regulatory elements well definecl for the murine AFP gene which behave as classical enhancers (Mol. Cel. Biol. 6: 477-487 (1986); Science 235: 53-58 (1987).
15 These upstream regulatory elements are desigllatecl elelnents I, II and III and are located between 1,000 to 7,600 bp 5" to the transcription initiation site for the murine AFP gene. These three enhancer dolllains are not filnctionally equivalent at generating tisslle-specific expression of AFP. Elements I and II
have the greatest capacity to direct liver-specific expression of AFP. It is ~0 important to note that the reglllatory seqllellces of the AFP gene aclvantageollsly contain the seqllences not only for tisslle-specific transcriptional activation but also for repression of expression in tissues which shollkl not express AFP.
~3'~
The regulatory regions of the h~lman AFP gene have been characterized.
A structural gene placeci in the correct orientation 3' to the wild-type AFP
regu1atory sequences will enable that structllral gene to be selectively expressed in fetal liver, hepatomas, non seminomatous c arcinomas of the testis, certain 5 teratocarcinomas, certain gastrointestinal tln1lors and other normal ancl pathological tissues which specifically express AFP. The DNA fragment containing the transcriptional reglllatory region of the AFP gene, which is a part of the recombinal1t DNA of tl~e present invel1tiol1~ should be a DNA
fragment obtained from tl1e reg~llatory region of the AFP gene, that is, the 5'-10 flanking region (the llpstream region) of the AFP gene.
As used herein the term "AFI' pron1oter" means a promoter *om a mammalian AFP gene region. Prelerably the promoter is from the human AFP
gene region. More preferably the promoter comprises the seqllence disclosed in Fig. 13 (SEQ ID NOS:4, 5, 13 and 14). The promoter may be the wild-type 15 promoter or it may be a mutate~l promoter. As usecl herein the term "AFP
enhancer" means a DNA seqllence enco(ling an enhancer from a mammalian AFP gene region. Preferably the enhallcer is from the humarl AFP gene region. More preferably the enl1ancer comprises the seqllences of clomain A or domain B as disclosed in Fig. 14 (SEQ lD NOS: 15-24). The enhancer may be 2() the wilcl-type enh.lncer or a lnlltate~l enllancer. As llsecl hereil1 the term "AFP
silencer" means a DNA seqllence enco~ling a malnlnalian AFP silencer.
Preferably the silencer is From the h1ll11al1 AFP genc region. More preferably the silencer comprises tlle DNA seq1lellce as clisclosecl in Fig. 5 (SEQ ID NOS:
-"` 2 ~ 4 6 and 7). The silencer may be the wilcl-type silencer or a mutated silencer.
The silencer may be the clistal silencer or the proximal silencer.
The above-described transcriptional reglllatory DNA fragment rnay be either a native 5'-flanking seqllence of the AFP gene or a recombinant DNA
S fragment containing one or more of the enhancer, silencer and promoter of the AFP gene. The native 5'-flanking noll-co(ling region of the AFP gene eontains two enhancer sites, two silencer sites ancl one promoter site, as shown in Fig 10, whereas the recombinant DNA fragment may have variable numbers of enhaneer and silencer elements.
Further, as shown in Fig. 10, the native AFP gene has a glucocorticoicl responsive element (g) in the trallscliptional regllkltory regiom Uncler the presence of glucocorticoicl, the responsive element moclifies the expression of AFP. Therefore, when a recombinant DNA fragment containing the glucocortieoid responsive element is usecl the expression of a cancer-cell 15 damaging protein can be reglllatecl by aclministering gl~lcocorticoid.
The toxin gene may be a DNA fragment encocling a substance which alters, damages or kills not only cancer cells bllt also normal cells. Because, as deseribed above, the expression of the gene in the recombinant DNA construet of the present invention is eontlollecl by the transcriptional reg~llatory region of 20 the AFP gene, the DNA fragment enco~ling for s~lch a substanee ean be eontrolled sueh that it is trallscribecl only ill AFP-proclllcing cancer cells. Such genes may eneode for clireet toxhls or inclirect toxins. Examples of "direet toxins" are toxin genes, sllch as cliphtlleria toxh1 (Maxwell, I.H., et al., Caneer 2 1 3 '~
Res., 46:4660-4664 (1986)) an~l ricin [Weiner, L. M., et al., 1989, Masui, H., et al., 1989]; cytokine genes [Blankensteill, T., et al., J. Exp. Med., 173, lV47-1052 (1991), Colombo, M. P., et al., J. Exp. Med., 173, 889-897 ~1991), Leone, A., et al., Cell, 65, 25-35 (1991~]; tumor suppressor genes 5 (Huang, M. J. S., et al., Science, ~42, 1563-1566 (1988), Mercer, W. E., et al., Proe. Natl. Acad. Sci. USA, 88, 1958-1962 (1988)]; tumor vaccination genes, [Wallich, R., et al., Natllre, 315, 301-305 (1985), Rollins, B., et al., Mol. Cell. Biol., Il, 3125-3131 (1991)~ DNA seq~lences that yield anti-sense RNA to oneogenes; genes encoding t~lmoroiclal substances JE/McP-1; genes that 10 produee anti-vims substallces; arlcl genes that ind~lce apoptosis.
Preferably, the clirect tOXill is clipl)thelia toxin (DT). This toxin catalyzes the transfer of the ADP-ribose nloiety of NAD to elongation factor 2 (EF-2) thereby bloeking plotein synthesis an(l ca~lsing cell death. DT consists of 535 amino aeicls eomprising two sllb~lnits designated the A and B ehains (see 15 Fig. 15A). The A chain (DT-A) which comprises the 193 amino-terminal residues (SEQ ID NO:~7) cataly~es A~:)P-ribosylation of EF-2 and the B ehain (DT-B) whieh eomprises the 3~2 earboxyl termillal residues promotes the binding of the toxin to eells allcl the entry of DT-A into the eytosolic eompartment. DT-A is extremely toxic once ;nsicle tlle cell and there is 20 evidence that the introdllctioll of a single molecllle of this protein is lethal for a eell. (Yamaiz~lmi et al. 1978) More preferably, an attenllated l`orm ot` the D1'-A gene will be used in this invention. F:or example, an attellllatecl form of DT-A (tox 176) has been : ': ~. . . : - : ... .: ::: . .~...... -: .: : :: .
?.~3i~9~
generated through chemical mlltagenesis of the wikl-type DT-A gene (SEQ ID
NO:29) (Uchida et al. 1973; Yamaiz~lmi et al. 1978) (see Fig. 15B). The mutant toxin has been shown to be abollt 30-fold less toxic than the wild-type protein. Such attemlatecl forms of toxhl may enhance target cell specificity and S prove to be highly versatile ancl effective agents for targeted cell killing.
Both the wild-type ancl m~ltallt DT-~ genes have been cloned and seqllenced (Green~lel(l et al (1983); PNAS 80: 6853-6857). They differ in the second position of codon 128, reslllthlg in the sllbstitlltion of aspartic acid for a glycine in the dedllcecl amhlo acid seqllence. Several inactive DT-A mutants 10 have also been isolatecl (Giannini et al. 1984; Kaczorek et al., 1983). These stu(lies have revealed amino acicl resicllles critical for biological filnctions of DT-A. Knowleclge of the relationship between seqllence changes and diminished DT-A activity can be llsecl by one skilled in the art to generate additional DT-A
mutants with varying degrees of cytotoxicity. One skilled in the art, given the 15 disclosure of this application, colllcl generate recombinant DNA constructs for expression of the mlltant toxin in cancer cells.
Alternatively an indirect toxin or enzyme pro-(lrllg combinations may also be llsed; providing the enzyme is capable of selectively activating the aclministered compollnd f~ither clilectly or througll an intermecliate to a cytostatic 20 or cytotoxic metabolite. Eqllally the choice of compollncl will clepencl on the enzyme systcm used, bllt mllst be selectively Inetabolize(l by the enzyme e;ther clirectly or inclirectly to a cytotoxic or cytostatic metabolite. One skilled in the art could select sllch a colllpollll(h '' ' ~ ~ ' . .
.. . ...
` ` 2 ~ 4 The varieella zoster virlls (VZV) encodes a specific thymidine kinase protein. The gene has been clonecl, seq~iencecl ancl charaeterizecl (J. Gen.
Virol. 67: 1759-1816)). The VZV thymicline kinase will, in eontrast to the mammalian enzyme~ selectively monophosphorylate speeifie purine arabinosicles and substitllted pyrimicline eompoullcls. 9-(~-D -arabinofuranosyl)-6methoxy-9 H -pwrine is eonverted to 9-~-D-arabinof~ranosyl adenine tripohosphate [Ara ATP] by this enzyme. [E~llropean Patent f\pplieation No. 0 415 731 whieh is ineorporated by referenee herein].
Other enzyme pro-clrug eombhlations inelucle the baeterial (for example from Pselldomonas) enzyllle earboxypeptidase G2 with the pro-drug para-N-bis (2-ehloroethyl) aminobenzoyl gllltamie aeicl. Cleavage of the glutamie aeid moiety from this eompolln(l releases a toxie benzoie aeicl mllstard; alkaline phosphatase from, for example, ealf hltestine, will eonvert inaetive phosphorylated eompouncls sueh as etoposicle-phosphate, doxorubiein-phosphate, mitomyein phosphate, to toxie clephospllorylatecl metabolites. Penieillin-V
amidase will eonvert phenoxyaeetamicle clerivatives of doxorubiein and melphalan to toxie metabolites ancl the fllngal (for example from Fusarillm oxysporum) eytosine deaminase will eonvert S-fllloroetosine to toxie S-fluorouraeil.
The heterologolls gene for expression in mallllllalian eells may be any gene eapable of being expressecl in mammaliall eells. For example, the gene may be phenylalanille hydroxylase, llrea eyele enzyllles, elotting ~aetors, o~,-antitrypsin, muec)polysaeellaricle or interferon.
.. , .. .. ".. .. .. ~ .. . . . ~ ........ .... - .- . .. . . . . .
~:~3 ~3~L~
The veetor earrying sweh a reeombinant DNA showid be able to enter human eells ancl have no aclverse effeet on hwmall normal eells. Examples of the veetor are: p]asmicl veetors, retroviralveetors, ancl aclenoviralveetors.
A variety of methods are available to introclwee foreign genes into 5 mammalian eells in vitro. The most popwlar teehniqwes are the ealeiwm phosphate preeipitation methocl (Graham ancl van cler Eb, 1973), DEAE-dextran-mediatecl transfeetion (Lopata et al. 1984), liposome mediatecl transfeetion (Cwdd 1984) ancl eleetroporation (Potter et al. 1984). In the eale;um phosphate preeipitation proeecl~lre, DNA is eopreeipitatecl with calcium 10 phosphate to form insolwble partieles whiell are talcen wp by eells by phagoeytosis.
The DEAE-dextran protoeol is a highly effieient and reproclweible transfeetion proeedwre. A solwtioll eontailling 2mg/ml of the clesired DNA, 250mg/ml of DEAE-dextlan (MvS00.000; Sigma), 50 mM Tris-HCI, pH7.5, ;s 15 filtered through 0,2,u filter ancl acklecl to the ewltllre meclillrn. Following an incllbation for 2 howrs at 37C, the mecliwm is removed and the cells washed three times with meclillm and ewltllred in growth medilllll for 58 hours.
Liposome - mecliatecl transt`eetioll is anotller transfeetion proeedwre. A
solution eontaining I ,ug ancl lO /ll eationie liposornes (I mg/ml) is acldecl to 0.5 ~0 ml serwm-free medilll1l. 'rhis is applied to eells ancl h1ellbated at 37C tor 3 to S howrs. The meclillm is thell replaee(l with fresh growth meclium and ewltllred for ~8 howrs.
2~3~9~
Electroporation uses an electric fïelcl to open ~Ip pores in the eell which allow entry of DNA molecl~les preslllnably throllgh diffusion (Fromm et al.
1985; Neumann et al. 1982; Wong and Nellmann 1982). Electroporation is most conveniently done llSing suspellsioll cllltllres, whereas the calcium S phosphate precipitation method ancl lhe DEAE-clextran-mecliated transfection are most easily clone using monolayer cllltllres.
The techniqlle of retroviral int`ection of cells to integrate artificial genes into mammalian cells in mcllllmals employs retroviral shuttle vectors which are ~-known in the art, (see tor example Miller ancl B~ltimore (1986) Mol. and Cell 10 E3iol. 6: 2895-290~). Essentially, retroviral shllttle vectors are generatecl using the I~NA form of the retrovirlls containecl in a plasrnicl. These plasmids also eontain seqllences necessary for selection and growth in bacteria. Retroviral shuttle veetors are constr~lcted ~Ising stan(larcl moleclllar biology techniqlles well known in the art. Retroviral shllttle vectors have the parental endogenolls 15 retroviral genes (eg. gag, ~ ancl env) remove(l and the DNA sequence of interest inserted, such as the moleclllar chimaeras which have been described.
They however, contain appropriate retloviral reglllatory seqllences for viral encapsiclation, proviral insertion hlto the target genome, message splicing, termination an(l polyadenylatioll. Retroviral shllttle vectors can be derivecl from ~0 the Moloney mllrine lelllcemicl vir~ls (Mo-MLV) b~lt it will be appreciatecl that other retroviruses ean be llse(l s~lch as the closely related Moloney murine sareoma virlls. (Eillropeall Patellt Applic~tioll No. 0 ~15 731 which is incorporatecl herehl by reference). Certain DNA virllses may also prove to be 2~3~
usefill as a clelivery system. The bovine papilloma virlls [BPV] replicates extraehromosomally so that cielivery system basecl on BPV have the advantage that the delivered gene is maintainecl in a nonintegrated manner.
The aclvantages of a retroviral-mecliatecl gene transfer system are the S high ef~leieney of the gene clelivery to the targetecl tissue, sequence speeifie integration regarding the viral genome (at the 5' ancl 3' long terminal repea~
(LTR) sequel1ees) and little rearrangements of clelivered DNA eompared to other DNA clelivery systems.
Aeeordingly in one embo(liment of the present invention there is 10 providecl a retroviral shllttle vector comprising a DNA seq~lenee eomprising a S' viral l,TR seqllence, a cis acthlg psi encapsiclation sequence, a reeombinant DNA eonstrllet ancl a 3' viral LTR seqllence.
In one emboclhoellt, ancl to help elhllinate non-tissue-speeiFIe expression of the moleelllar ehimaera, the recombinant DNA eonstrllet may be plaeed in 15 opposite transeriptional orientation to the 5' retroviral LTR. In acldition, a dominant seleetable marker gene may also be inellldecl whieh is transeriptionally clriven from the 5' LTR seqllellce. Sllch a clominal1t selectable marker gene may be the baeterial neomyein-resistance gene NEO (Aminoglycoside 3"
phosphotransl~erase type 11), whiell eonfers on ellkaloytie eells resistallee to the 20 neomye;n analogue G418 sl.llpl1ate ((iF,NE3'rlClN) The NEO gene aids in the seleetion ol~ paekaging cells whiell eontaill these seqllenees. Other veetors eontaining a NEO gene as a selectable markel have been cleseribed, for example, the N2 veetor (Seience ~30: 1395-1398 (1985).
9 ~
A theoretical problem associatecl with retroviral shuttle vectors is the potential of retroviral long termhlal repeat (LTR) regulatory sequences transcriptionally activating a cellular oncogene at the site of integration in the host genome. This problem may be diminished by creating SIN vectors. SIN
5 vectors are self-activating vectors whicll contain a cleletion comprising the promoter and enhancer regions in the retroviral L,TR. The LTR seqllences of SIN vectors do not transcriptionally activate 5' or 3' genomic sequences. The transcriptional inactivation of the viral LTR seq~lences diminishes insertional aetivation of adjacent target cell DNA seqllences and also aids in the selected 10 expression of the clelivere(l moleclllar chilllaera. SIN vectors are created by removal of approxhllately 299 bp hl the 3' viral l,'I'R seq~lence (Biotechniques 4 504-512 (1986).
Thus pref`erably the retroviral shuttle vector of the present invention are SIN vectors.
Since the parental retroviral gag, pol an(l env genes have been removed from these shllttle vectors, a helper virlls system may be utilized to provide the ~ag, pol ancl env retroviral gene pro(lllcts necessary to package or eneapsidate the retroviral vector into an h1tective virion. This is accomplished by utilizing specializecl "packaging" cell lhles, which are capable of generating infectious, 20 synthetic vir~ls yet are ~leficient in the ability to pro(lllce any detectable wikl-type virus. In this way the altiricial synthetic virlls contains a chimaera of the present inventioll package(l intc) syntlletic artificial hllectiolls virions free of wilcl-type helper virlls. 'l`his is base~l on the tact that the helper virus that is 2 ~ 3 ~
-2~-stably integrated into the packaging cell contains the viral stmetural genes, but is laeking the psi site, a cis acting regulatory seq~lenee whieh must be eontained in the viral genomie RNA molecllle Çor it to be eneapsidated into an infeetious viral partiele.
In addition to removal of the psi site, adclitional alterations ean be made to the helper virlls LTR reglllatory seqllenees to insure that the helper virus is not paekaged in virions an(l is bloekecl at the level of reverse transeription and viral integration.
Seleetivity of expression may be aclditionally improved by selective 10 infeetion of liver eells. The retroviral env gene present in the packaging cell line defines the speeifieity for host int`eetion. The env gene used ;n eonstrueting the paekaging eell line is mo(lifiecl to generate artifieial, infeetive virions that seleetively infeet hepatoeytes. As an example, a retroviral env gene introdueed into the paelcaging eell may be modifiecl in sueh a way that the 15 artifieial, infeetive virion's envelope glycoprotein selectively infeets hepatocytes via the specifie receptor mediatecl binding lltilizecl by the hepat;tis B virus (HBV).
HBV primarily hlfects hepatocytes via specific receptor mediated bincling. The HBV proteins encode(l by the pre-Sl ancl pre-S2 sequenees play a 20 major role in the ~ttaehmellt of HBV to hepatocytes (Hepaclna Viruses edite(l Robinson Q~ 189-2031 205-221, 1987). The env gene of the paekaging eell is modi~led to inclllcle the hepatoeyte bhl(lillg site of the large S HBCV
envelope protein. Sllch modificatiolls ol` the env gelle intro(lllced into the ~. , , . ., , ,. ~ , . .. . . .. . . . .
3 '~
packaging cell may be performecl by stan(lar~l molecular biology techniques well known in the art and will facilitate viral llptake in the target tissue.
The infective virion accordillg to the invention may be formulated by techniques well known in the art ancl may be presented as a formulation with a 5 pharmacelltica]ly acceptable carrier theret`ore. Pharmace~ltical acceptable carriers, in this instance, may comprise a liqllid lneclillm sllitable for use as a vehicle to intro~luce tlle infective virion into the patient. An example of such a carrier is saline. The infective virion may be a sollltion or suspension in such a vehicle. Stabilizers and antioxiclants and/or other excipients may also be 10 present in sllch pharmaceutical formlllations which may be administered by intra-veno~ls or intra-arterial int`llsion. In the case of treating HCC intra-hepatic arterial infllsion may be a~lvantageolls~
The amounts an(l precise regime in treating a mammal, will of course be the responsibility of the attendallt physician, and will depend on a number of 15 factors including the type and severity of the condition to be treated. However, for HCC, an intrahepatic arterial infllsion of the artificial infective virion at the titre of between 2 x 105 an(l 2 x 107 colony t`orlning units per ml (CFU/ml) infeetive virions is likely to be sllitable for a typical tumor. Total amount of virions infilsed will be ~lependellt on tlmlor size and wolllcl probably be given in 20 divided doses.
Where the heterologolls gelIe enco(:les for a metabolic enzyme, a metabolite mllst also be adlnilIistele(l to the malIlmal. Tlle close ot the drug will a(lvantageo~lsly be in the range (). I to ~50 mg per kilogram bo(ly weight of ,.- . ~ .. . . . ..... . .
:, j : : : , .
" " , " . .. . ....... .. .. ..... ..
3~9~
recipient per day, prefer~bly 0.1 to 100 mg per kilogram bocly weigh~. One skilled in the art colllcl (letermille the closage to be ~clministered based on a number of factors, incl~lcling the metabolic enzyme contemplated.
The term "s~lbstantially colnplete Icill" means that the number of viable S cells has been reducecl by a I log re(l~lctioll, for example, ~from 10'1 to 103 cells.
More preferably, the nllmber of viable cells has been redllced by 2 logs. ~ven more preferably, it has been reclllcecl by 3 logs.
The following exalnples serve to illllstrate the present invention but should not be constrlled as a limitation thereof:
10 ~am~le I
iHIlH-7 is a hulllall hepatollla cell line proclllcillg AFP which was obtainecl from Dr. J. Sato, Okayama University, Japan. (Nakabayashi et al., (1982) Cancer Res. 22:3858). Hu~1-7 was cllltllrecl in a chemically del~lnecl medium ISE-RPMI, which contains ethanolamine (30 ~g/ml) in IS-RPMI.
15 huH-1/c1-2 is a clone isolatecl from the parental huH-1 hllman hepatoma cell line (Huh and Utakoji (1981) Ganll 72:178-179). It was obtained from Dr.
Huh, University of Tokyo, Japan an(l was cllltllrecl in ISE-RPMI with 1% fetal calf serum. HeLa is a hlllnall cell line (Gey, (1952) Cancer Res. 12:264) which cloes not prodllce AFP. HeLa cells were cllltllred in ISE-RPMI with S%
2() fetal calf serum. COS 7 cells are all al`rican greell monlcey kiclney cell line whicll cloes not proclllce Al P. 1'he COS 7 cells were obtainecl from ATCC and were cllltllrecl in lSF-RPMI with ~'r/o fe~al calf serllm.
2~3 ,L~9!~
In all eases, transfeetion was performecl by the ealei~lm phosphate preeipitation methocl as cleseribecl by Nakabayael1i et al. (1989) J. Biol. Chem.
204: 266-271. In e,rcler to cletermine CAT aetivity, the transfeeted eells were Iysed by several eyeles of freezing ancl thawing and eentrifugecl at 15,000 rpm S for S min. The sllpernatallt was heate(l at 60C for 10 mh1. ancl analyzed for ehloramphenieol aeetyltransferase (CA I ) aetivity aeeorcling to Gorman et al.
(1982) Mol. Cell. Biol. 2:1044. rhis heat treatmellt is essential for the deteetion of CAT aetivity in hllH-I/e1-2 eells. Similar heat treatment of extraets resulted in a 3.5 folcl inerease in HllH-7 eell CAT aetivity.
pBR-CAT was eonstrlletecl by insertillg the HincllII-BamHI fragment obtainecl from pSV0-CAT obtaine~l Irom Dr. B. ~Ioward, (NCI/NIH) (Gorman et al. (1982) Mol. Cell Biol. 2:1044) h1to pBR322 pllrehasecl from BR~"
Gaitherburg MD aeeorcling to the methocl of Walker et al., (1983) Nature 306:557. This plasmicl eontains the CAT eocling sequence and the SV40 15 polyadenlyation signal but laeks the SV40 enhaneer ancl early promoter elements.
CAT f~lsion genes were eonstr~letecl l)y lh1kirlg the CAT gene to AFP 5'-flanking seq~lenees obtainecl by restrietion en~yme cligestion or polymerase chain reaction ancl inserting them into the Hh1clIII site of pBR-CAT.
Speeifieally, pAFI.0-CA'r was eonstrlletecl by insertil1g the 980 bp seqllenee between -951 all(l -1-29 relative to the eap site of the hllman AFP gene into the HinclIII slte at the S' encl o~` the C~ll gene of pBR-C~\T.
':' ` :,: ;, ~ ' . . :: .'.`. ': , ': .: .~:: :
~ ~ 3 '~
To construct pAF5. I-CAT contai1ling the 5. l kb of the AFP 5'-flanking sequence, pAF1.0-CAT was digeste(l completely with Pstl, partially with E~coRI
and a 5.7 kb DNA seq~lence containing a 0.9kb EcoRI-HinclIlI human AFP
DNA fragment (-870 to ~29), the C~T gene and the pBR322 replication or;gin S was recovered. pHAL-2w-Eco4.2, (a clone containing 4.2 kb AFP DNA from -5.1 to -871 bp insertecl at the EcoRI site o~ pBR322) was cligested completely with PstI and partially with EcoRI. A 4.9 kb DNA fragmellt consisting of the 4.2 kb AFP EcoRI DNA and the 748 bp Pstl-EcoRI DNA fragment of pBR32 was isolated ancl ligate(l to the 5.7 kb DNA derivecl from pAFI.0-CAT.
10 _xam~Q2, Expression of CAT g_ le (lriven by_the AFP 5'-flanklng region in ~ H-7 ancl hllH-I/c1-2 cells.
To cletermine whether the (liff`erellces in AFP procluction in HuH-7 and huH-1/c1-2 cells are cllle to clifferellces in transcriptional regulatory aictivities vf the AFP S'-flanking regions, the cells were transfectecl with plasmicls containing 15 the CAT gene to which variolls lengths of AFP 5'-Flanking sequences were linked. Transfection an(l analysis of CAT activity were performed as described in Example 1. The reslllts of the test are shown in F'igllres lA ancl IB. The amounts of cell extract llsecl ancl the hlcllbatioll thlles were 25 ,ug ancl 20 minlltes for HllH-7 (lanes I - 5) an(l 100 ,ug an~l 180 minlltes for huM-I/c1-2 20 (lanes 6- 10).
The 5.1 kb AFP 5'-rlallking DNA which contains the full AFP enhanc,er region (-~ /-3.~kb) s~lpportecl a higll level of Ct'~'l' expression in HllH-7 (F;g.
~ ! 2 ~
lB, lane 3) but only a low level of expressioll in hllH-I/c1-2 (Fig. lB, lane 8).
CAT expression support by the 1.0 kb AFP promoter region was also greater in HuH-7 than in hllH-I/c1-2 (Fig. IB, klnes 4 and 9). Thus there is a eorrelation between transeriptional activities of the AFP 5'-flanking sequences and the 5 levels of AFP produetioll hl HllH-7 ancl hllH-I/e1-2, respeetively.
Comparison of CAT activities supportecl by S. l kb (eontaining the AFP
enhaneer) and 1.0 kb (withollt the AFP enllancer) of the AFP 5'-flanking sequenee showed that the AFP enhancer sthlllllatecl the AFP promoter activity 25-fold in HuH-7 (Fig. IB, lanes 3 ancl 4) but only 2-folcl in huH-I/e1-2 (Fig.
10 lB, lanes 8 and 9). These results h~(licate that hl hllH-I/cl-2 eells the AFP
enhaneer does not stimlllate the AFP promoter as muell as in HuH-7 eells.
2 ;~ 3 '~
Example 3. Analvsis of AFP promoter ancl enhancer activities in l~lIH-7 and hu~-l/e1-2 eells To show that enhancer activation of the AFP promoter is seleetively inhibitecl in h~IH-l/e1-2 eells as sllggested above, it is important to establish that 5 both the AFP enh~neer and the prollloter are active in this eell line.
To analyze the f~lnetionality of the AF P promoter, the effeet of dexamethasone was tested on the AFP promoter activity. This test is based on the observation that dexamethasone stimlllates the AFP promoter only when it is i~unetional. (Nakabayashi et al., (1989) J. Biol. Chem. 264:266) HIIH-7 and 10 huH-I/e1-2 eells were transtectecl with p~\Fl.OCAT inellbated w;th or without 3 x 10 6 M dexametllasone for 2 ~lays ancl allalyze~l for CAT aetivity. The amounts of extraet ancI the incub~tion times were 25 ~g and 20 min. for HuE~-7 eells (lanes l and 2) and 100 lilg and 180 minlltes for hllH-I/e1-2 eells (lanes 3 and 4). See Fig. I C .
It was found that dexamethasolle stimlllatecI CAT aetivity supported by the l.0 kb AFP promoter 9 I`okl in h~lH-I/e1-2 ancl 12-fold in HuH-7 cells.
This reslllt inclieates that the AFP promoter is ~;lnetiollaI hl huH-l/e1-2 eells.
Next the aetivity of the AFP enIlaneer was (Ietermirlecl in HIIH-7 and huE[-l/e1-2 eells. The 2.4 kb t;lll enhaneer region (-5.3/-2.9kb) ancl two 20 subregions, 0.3 kb domaill A ( ~.0/-3.7 kb) an~l 0.4 Icb dolnain B (-3.7/-3.3 kb) were indivklllally teste~I hl eolljllllclioll with SV40 promoter.
To eonstr~let pSV I '-C'A'I`, the plas~ l pSV2-CAT was digested with ~eel and Sphl an~I the smclIIer fragment was removecI. 'I'he remaining DNA
. 2~3~9~
was made blunt-ended by treatment with the l~rge fragment of DNA polymerase I and ligated through BglII linkers. Tllis plasmi(l contains only 30~ of one SV40 72 bp repeat sequence and the TATA box.
pSVAF2.4-CAT w~s constrllcted by inserting the 2.4 kb BglII-BglII
5 fragment between -5.3 and -2.9 kb of the AFP gene prep~recl from )~HAI,-2W
into the BglII site of pSVl'-CAT. rhe pl~smid AH~L-2W was described in Urano et al. (1984) Gene 32:255-'~61.
pSVAF0.~-CAT was constructed by inserting the 408 bp HindII- HaeIII
fragment between -3.7 and -3.3 kb of the AF;P gene which had been blunt-10 encled into the BglII site of pSV I '-CArr.
pSVAF0.3-CAT was constrllcte(l by digesting PSVAF2.9-CAT with BgllI. The released 2.4-kb fllll enh~llcer fr~gment was digested with D:raI and HindlI~ to release the 318-bp fr~gment. Tlle Hin~lllI end o-f this fragment was converted to blunt end, BgllT liners were attache~l to both ends and the fragrnent 15 was inserted into the BglII site ot pSVI'-CAT.
All of these enhancer regions stimlll~te(l the SV40 promoter activity to essentially the same clegrees in ~lu3~1-7 ~lncl huH-I/c1-2 cells. See Table 1.
TABLE 1. Exl~r~ssioll of CAT ~ICtiVity frolll Vnrio~ls AF'I'-CAT fllsion ~ncs.
CAI` activity Ccll linc pSV2-CAT
__ pSVAF- pSVAF pSVAF- pSVI' 2.4-CAT 0.3-CAT0.4-CAT CAT
pmol/h/,u~ of % ~/0 % % %
protcin _ ____ _ l 7 731 100 fi2 ('1'1)22 (lfi) 5.9 (~
l/cl 2 46 100 68 (38)25 (1~1) 7.2 (O1.8 (1) 30 ~ 1 32 100 3 5 (1 7) 3.~1 (l.6) 3.2 (1.5) 2.1 (1) 3 '~
This finding indicates that the AFP enhallcer elements are as ac~ive in huH-1/c1-2 cells as in HllH-7 cells. These res~llts sllggest that positive transcription factors regulatillg the AFP enhancer ancl promoter are not limitin~
in huH-1/c1-2 cells.
5 Example 4. Negative control elemellts sllppress AFP enhancer activity in hllH- l/cl-2 cells.
The examples clescribecl above sllpportecl the view that the AFP enhancer is unable to stimlllate the promoter hl hllH-l.c1-2 cells. To test wllether this is due to the action of negative regulatory elements locatecl between the enhancer 10 and the promoter, variolls lengths of DNA clownstrealll of the enhancer (at -2.9 kb) of the 5.1 kb AFP 5'-flankillg seqllellce in pAF5. 1 -CAT were deleted. (Fig.
2) To aehieve the cliflerent cleletions, the plasmicl pAF5. I-CAT was digested completely with Bglll ancl with Sacl or BstNI or partially with HindII~[. The SacI or BstNI or Hill(llll sites were blllnt enclecl with Klenow fragment and 15 ligatecl to BglTI linkers. The plasmicl was then religatecl. These deletions ha~
little effeet on CAT expression in HllH-7. In hllH-l/c1-2, on the other hancl, CAT expression changed with several cleletions. In particlllar, significant inereases were observecl with cleletions from -2.9 kb to -951 bp ([~2.0~ in Fig.2) (3.6 fold) and from 2.9 kb to -169 bp ([~2.7] in Fig. 2) (lO-fold). These 20 results suggest that at least two negative control regiolls exist between -1822 and -169 bp; one from -1822 to -951 (clistal silencer "Sd") and the other from -402 to -169 bp (proximal silencer "Sp"). Ill acldition, a small but eonsistent inerease in CAT activity was observecl associatecl with the cleletion from -95l to -402 bp ([~2.5] in Pig. 2) whicll may s~lggest the presence of a thircl, weak 25 negative control elemellt in this region.
The 875-bp Sd region was analyze(l for transcriptioll-s~lppressive aetivity by inserting it baek into pAr~S. 1[~2.7l-CAT in whicll a 2.7 kb sequenee from -2,9 to -169 bp had been (lelete(l. Tlle Scl DNA was cllt from the AFP region with HindlII ancl bl~lnt enclecl with Klenow fragment. BgllI linkers were ligated 2~3~
to the 875-bp fragment and the fragment was insertecl into the BglII site in theplasmid pAF5.1[~2.7]-CAT. The resllltant constr~lct ([~2.73+875) showed a flve-fold lower CAT activity than the parelltal plasmicl [~2.7] in huH-l/el-~eells (Fig. 2). To furtller clelimit the silencer activity, the 875 bp DNA
5 fragment was clividecl into two fragments by cligestion with DraI enzyme to obtain a 409 bp 5'-fragment (from -lg22 to -1414) and a 389 bp 3' -fragment (from ~1336 to -948), ancl each lragment was testecl separately for suppressive CAT aetivity. The 409 bp 5' fragmellt ([~2.7] -~409) suppressed CAT aetivity strongly, whereas the 3' fragment ([~2.7] -~389) clicl so weakly (Fig. 2). This 10 finding indieates that the major silencer activity is containecl in the ~09 bp 5' fragment. In the absence of the enhancer, the 5' fragment weakly stimulated AFP promoter activity. These reslllts hl(lica~e that the action of Sd is to interfere with the AFP enllancer activity withollt affecting AFP promoter activity.
In the absence of the entile sllppressor region ([~2.7])7 the CAT activity expressecl in huH-l/e1-2 is four fokl lower than that in HllH-7 (25.9 versus 116), This fincling sllggests that another mechanism exists in huH-l/e1-2 to suppress the intrinsic AFP promoter activity, althollgh this accollnts only partially for the large dirference in AFP proclllction between HllH-7 ancl huH-20 1 /cl-2 .
Example 5. The Scl element Sll~ Q etivitv in a position-c penclent mannerL
The effeet of the Sd region on a heterologolls enhaneer was examinecl by inserting the 875 bp Sd region (from -1822 to -948 bp) illtO the BgllI site in the 25 SV40 enhancer of pSV1.6-CAT (Sphl site converte(l to E3glll site) in normal (cl) ancl reverse orientatiolls (e) (Fig. 3A). The resllltant constructs expressecl much lower CAT aetivity in hllH-l/c1-2 cells than dicl the parental plasmicl, indieatin,g that Sd ean sllppress the heterc)logolls SV~0 enhancer in an orientation-in(leperlclent manner. Sllppression ot' ClAT activity was also observed in HuH-730 and HeL,a cells althollgh to mllch lesser extents. This finding suggests that the 2 :~ 3 ~
Sd activity is not strictly cell type specific. To show that the observed effects are not due to the clisrllption of tl1e SV40 enhancer, a 924 bp DNA (from -4.9 to -4.0 kb) of the AFP gene with no known regllkltory activity was inserted at the BglII site of pSV1.6-CAT as a control (c) (Fig. 3B). No signi~lcant S changes in CAT expression were observecl with the 924 bp DNA insert as compared to pSVl.6-CAT.
The orientation-inclepen(lel1t sllppressiol1 was also observecl with the 409 bp Sd fragment in the SV40 enhancer. Tlle 409 bp fragment (from -1822 to -1414bp) was insertecl into the Accl (a ancl b), Bglll (f and g) or BamHI (h and 10 i) site in normal ancl reverse orientcltions. When it was inserted ~lpstream of the SV40 enhancer or clownstreall1 of the CAT gene, no s~lppression effect was observed in either orientation in al1y of the cell lines testecl. These results show that the effeet of Scl is orientation inclepel1clent b~lt position clependent.
Example 6. klentifïcatiol1 of a silencer elen1el1~
To delimit the Scl region tl1at exerts transcriptional suppression, we inserted various lengths of Scl sllbfragments in the SV40 enhancer (BglIl site) of pSV1.6-CAT (Fig. 4). The longest fragment is a Hindlll fragment of 875 bp.
This fragment was blllnt en(lecl ancl 13glll linkers were attached ancl the fragment was insertecl into the Bglll site of the SV40 enl1ancer. In acldition, 20 two sub-fragmel1ts from tlle 875 bp Hil1cllll fragmel1t were obtained by digesting the fragment witll Dral ancl blllnt encled. BglII linkers were attached and the fragments were inseltecl into the Bglll site of the SV40 enhaneer. The 31 bp fragment was syntl1esizecl by DN~ Syntl1esis Laboratory, IJniversity of Calgary as two single strancls ol` 3 l bp ancl anl1ealecl these eomplementary 25 strands to make clollble-stranclecl DN~\. 'l'his was ligatecl into the Bgll[ site of the SV40 enhancer.
Five fragmel1ts covering the region llpstrealll of -1760 suppressed CAT
aetivity, The shortest active fragnl(,~nt was 31 bp long, from -1790 to -1760.
Fo~lr other fragments coveril1g the region clownstream of -1750 were inactive 30 (Fig. 4). The 22C~-bp Sp region from -402 to -1'74 was also tested in a similar s,~ ,,, , : ,, " , , " , , , ~ , ~ ", " " , 3 ~
manner. It showecl transcription-sllppressive activity, altllol~gh to a lesser degree than did Sd (Fig. 4).
We follnd that the 31-bp fragment whicl~ exhibited suppressive activity contains a 17-bp stretch, 5'-CTTCATAACTAATACrr-3', which is repeated S four tirnes within a 90-bp region frolll -1810 to -1720 (Fig. SA (SEQ ID
NO:6), underline(l). A simiklr seclllence is also t`ollncl in the Sp region (Fig. 5B
(SEQ ID NO:7), unclerlille~l). In all cases, the first six n~lcleotides, CTTCAT,and the last two, TT, are completely conserve(l (Fig. SC). DNase I
footprinting analysis by the metho~l of Saw~claishi et ~1. (1988) Mol. Cell Biol.
10 8:5179-5187 showecl that these seqllences were protected by nuclear extracts prepared from huH-I/c1-2.
To further characteriz~e the fllnctioll of theses seqllences, we inserted the 31-bp oligonucleoti(le (from -1790 to -1760 bp (SEQ ID NO:8)) into the BgllI, AccI or ~3amHI site of pSVI.6-CA'I'. A m~ltant fragmellt with three-nllcleotide 15 substitlltions was inserted into the Bglll site (SEQID NO:9). The mutant sequence was synthesizecl. These constrllcts were transfected into huH-l/c1-2 orHuH-7 cells ancl 2 days later c~ r activities were analyzecl as clescribecl ;n Example 1. The amollnts of extract ancl incllbation times were 25 ,ug ancl 20 min. for HuH-7 (lanes 1 to 6) ancl 100 ~ug ancl 180 min. for huH-l/c1-2 (lanes 720 to 12). See Fig. 6, lanes I ancl 7, pSVl.6-CAT (positive control); 2 and 8, wild-type 31 bp fragmellt inserte(l in Bglll; 3 ancl 9, mlltant fragment inserted in Bglll; 4 an(l 10, wil~l-type fragment insertecl in Accl; S and 11, wild-type fragment inserte(l in BamHI; 6 ancl l~, pSVI'-CAT (negative control).
The fragment insertecl witllin the SV40 enhancer strongly sllppressed 25 CAT activity in huH-l/c1-2 (F;ig. 6~, lane 8), bllt only a weak sllppression was observed in ~Ill1~1-7 (Fig. 6A, lane 2). 'I'he insertioll of the fragment llpstrean~
of the SV40 enllallcer (F;ig. 6A, kllles 4 an~l 10) or (lownstream of the CAT
gene (Fig. 6A, lanes 5 an(l 11) lla(l no effect on CAT activity in either cell line.
Substitution of thlee nllcleoti(les withill the 17-bp repeated seqllence SEQ ID
30 NO:9) (Fig. 6B) resnlte(l in loss of slll)pressive activ;ty (Fig. 6A, lane 9). This ~Inding confirms the association of the s~lppressive activity with this sequence.
2`~'19~
To determine the relationslIip between transcriptional s~ppression and the number of copies o~ the Scl elements, one, three, or eight copies of the 31-bp sequence (SEQ ID NO:8) was inserted into pAF5.1[~2.7]-CAT. The 31 bp synthetic fragmen1 whiclI has Bglll sites on both entls was ligated into the BglII
5 site of pAF5. 1 [a2.7]-CAT. In or~ler to obtain mllltiple copies of the fragment, the 31 bp fragment was mllltillIerizecl by selt:ligation ancl then inserted into the BgllI site of pAF5. 1[~2.7~-CAT, wllich was thell trallsfectecl into Hu~I-7 or huH-l/cl-~ cells. The level of CAT activity was measllred by the method of Example 1 (see Fig. 6C). Analysis oF CAT expression from these constructs 10 showed that C~T activity decrease~l with increasing n1lmber of copies of thissequence in hllH-I/c1-2 bllt not in 1~Illl-I-7 (Fig. 6C). The CAT activities areexpresse(l relative to tllat of pA1~0.2-CAT.
E~Lmple 7.
Referring to Fig. 7, the cliplltlIeria toxin gene, a known gene, codes l~r 15 diphtheria toxin consisting of alI A ancl B-cllain. It is known that diphlheria toxin can kill ellkaryotic cells by blocl<;ng protein synthesis. The B-chain is involved in the bincling of the ~ chaill to a cell. The seqllence of the A and Bchain of the DT gene is pllblished. [Greenfielcl, 1,., et al., Proc. Natl. Acacl.
Sci. USA, 80, 6853-6857 (1983)1 See Fig. I5A (SEQ ID NO:9). The DF,-A
20 gene and the tox-176 gene were obtained from Dr. Bernstein, Mount Sinai Hospital, Toronto. A DNA fragmelIt coclilIg for a nlo(lifie(l A-chain (HToxin) (SEQ ID NOS: 28 and 29) was llsed. TlIis modifiecl DNA fragment was macle by using PCR synthesis. This DN~ fragment (HToxilI) encodes for an A-chain having Cys as the 66th amino aci(l an(l Arg as the 194tlI amino aci(l, insteacl of 25 the nahlral A-chain llaving 'I yr alId Pro, respectively, as reportecl by areenflelcl and others. This DNA fragllIelIt was plovi(le(l with a ~1in(1111 restriction en~yme cleavage site at the N-terlllillal an(l a lilpal restriction enzyme cleavage site at the C-termincll, llsing synthetic primers contail1illg the HlndllI Ol the HpaI site, respectively.
2~3~ 9~l~
pSV2-CAT [ob~ine(l from Dr. s. ~-1. Howarcl, NCI/NIH~ [Gorman, et al.. Mo. Cell. Biol..2, 104 (1982)] w~s cligestecl by Hind 11I and Hpal to remove the CAT gene, ancl the DNA fragment eneocling the HToxin DNA was inserted into the plasmicl to construet a recombillallt plasmid pSV2/HToxin.
5 This reeombinant pklslllicl was use(l as a positive eontrol beeause it is expressed nonspeeifiea]ly in most eell lh~es ~lnder the (lireetion of the SV40 early promoter.
The plasmicl p'l`~lXI was obtainecl lrom Dr. Bernstein, Mount Sinai Hospital, Toronto. It eontahls a wild-type DT-A gene next to the 10 metallothionein gene promoter.
The plasmicl pTHX-176 eontaills a mutant DT-A gene having Asn instead of Gly irl the 128th position from the N-termin1ls. This plasmid was obtained from Dr. A. Bemsteill, Mo~lnt Shlai Hospital, Toronto.
The eell-killing effeet of pSV2/HToxill was cleterminecl by compar;ng it 15 with the cell-killing effeets of other plasmicls. More speeifieally, HuH-7 cells were transfeetecl by the methocl of Example 1 with pSV2-CAT alone or w;th pTHX1, pT~i[1-i76 or pSV2/~l'l`oxin. Then, the CAT aetivities expressed by these transfected cells were cletermillecl. The ability of a particular vector to suppress protein synthesis is inclieatecl by the level of CAT aetivity. As the 20 amount of protein synthesis is s~lppressecl, the level of CAT aetivity decreases [Nakabayashi H., et al., Mol. Cell. Biol., 11(12), 5885-5893 (1991)]. The res~llts, shown in Fig. 8, hldieate that pTHXl and pSV2/HToxin have substantially the same level of supplessillg effeet on the CAT aetivity ancl therefore substantially the same level of eell-killing effeet. pTHI-176 exhibited 25 a level of s~lppressing el`feet abollt one thild of the level exhibite(l by pTHXI.
The results inclieatecl that the AFP reglllatory seqllenees llsecl clireetecl the expression of the H'roxill gene hl AFP procllleillg hepatoma eells.
ExamR~2LtLerla toxi!) o!l eell lhles The plasmkl pSV~/Hrl~/lleo' ~vas obtainecl by linking the neomyein 30 resistant gene (neo') ~Stratagene, La Jolla, CA] to the above-mentioned /~ ~
~ :~ 3 '~
pSV/HToxin. The plasmicl psv2lHrroxin w~s iclgestecl with B~mHI and then with the Klenow fragme'1t to form blllnt encls. pMCl-lleor (Stratagene, La Jo1laCA) was treated with XhoI ancl Sall to release the neo' gene (1083 bp). This was inserted into the treatecl pSV2/HToxill plaslllicl above by blunt end ligation.
The plasmid pMCI-neor w~s obt~inecl from Stratagene, La Jolla, CA.
HuH-7 cells an(l HeL~ cells were transfected with pSV2/HT/neor (see Fig. 9) or a eontrol plasmicl pMC1-rleo' (Strategene) by the calcium phosphate method of Ex~ample 1. Transrorlllclllts havillg neo' were selectecl by using G418 (GIBCO). Following transf~ction, cells were treate(l with 50 ,ug/ml of G418 for two days ancl then with increasillg alnollnts (llp to 200 ,ug/ml for HuH-7 cells and 1 mg/rnl for HeLa cells) f`or 3-4 weeks. When the HeLa and HuH-7 cells were transfecte(l witll the control plasmid, pMC1-neo, both cell lines formed eolonies of the transforlllallts becallse the plasmicl has the neo' gene.On the other hancl, when the He~.a all(l H~IH-7 cells were transfected with the lS plasmid pSV/HT/Ileo' whicll has the neo' gelle, neitller of the cell lines formed colonies beeallse the plasl-nicl pSV/~l'r/lleo' also has H Toxin gene expression, ...
resulting in deatll of the trclllsf~orlnallts~ Neither of the cell lines transfected with pUC19 (E~RL), whiell cloes no~ COlltclill either of the genes (i.e. a negative control) formecl colonies (see Table 2). These reslllts prove that the HToxin 20 gene has a cell-killing effeet in both HllH-7 ancl HeLa cells.
Table 2 Plasmicl Nllmber of Colonies (105 cells) _ H~1_1-7 HeLa___ pMC I neo' 4 . 2 0. 5 pSV2/HToxin/lleor 0 0 e~C C~ _ _ _O _ O _ r~l2Le~PJffeet of t!le Slelce! Rc~iQll~oQtlle Cell-~lllillg~y_DIplltlleria in.
Vilriolls reeolllbillallt plaslllicls as showll in Fig. 10 wele eonstruetecl by 30 linking the HToxin gene to I~N~ cllaills eontaillillg (lifferent lengtlls of the . ~
~`' ` 2~3'13~
transcriptional regulatory regions Or the AFP gene. More specifically, the above-mentionecl pSV2/HTox;n was cligestecl by Hind Ill and BamHI to obtain a DNA fragment having 759 bp which inclu(le(l the HToxin gene. The 759 bp DNA fragment was inserte(l in between the Hh-(llll ancl BamHI sites of the S pGEM-7Z vector (Promega), thlls constrllcting pGEM7Z/HToxin. The plasmid pAFa,.9/HToxin comprises the entire transcliptional regulatory region of the AFP gene, ancl the HToxin gene controlle(l by the transcriptional regulatory reglon.
The 4 9 kb 5'-flanking region Or the AFP gene was obtained by partially 10 digesting pAF5.1-CAT (Example 1) with Hincllll, electrophoresing the resultant fragments in a 0.4% agarose, then collecting the 4.9 kb DNA fragment. The collected fragment was inserte(l into the l-lincllll site of the above-mentionedpGEM72/HToxin, thlls obtahlillg the clesirecl plasmicl, pAF4.9/HToxin.
pAF4.9[~2.7]/HToxill in whicll the 4.9 kb 5'-l`lankillg region of the AFP gene 15 lacks a region from -2.9 I<b to -169 bp, (i.e. the silencer region) was obtained by partially digesting pAF5. 1 [Q2.7J-CAT with ~Iindlll ancl inserting the resultant 2.2 kb DNA fragmellt into the Hin(l llT site of pGEM/HToxin.
The plasmicl pAF4.9 [~2.7](S)8/HToxill comprises the transcriptional ~egulatory region of the AFP gene ancl the H'l'oxin gene controllecl by the AFP
20 enhancer, 8 copies of the AFP silencer element ancl the promoter. This was obtained by partially digesting pAF5.1[L~2.7](S)~-CAT (Example 6) with HindllI ancl inserting the 2.~kb flagment havillg tlle enhancer ancl 8 copies ofthe silencer elements ancl the promoter hlto the Hincllll site of pGEM/HToxin.
pAF0.2/~IToxin was obtaine(l by the followhlg steps: cligestion of 25 pA~74.9[~2.7~/~IToxill by Smal, ligation with a Bglll linker, Bglll cligestion and removal of short fraglllellts belween the Smal ancl Bglll sites, ancl then Bglllself-ligation. The plasmicl p/\F0.2/HToxill is a conlparative example that lacksthe enhancer ancl silencer seq~lences.
The plasmicl pAF;(AB)~(S)~/H'roxill was generatecl by cligesting 30 pAF4.9[~2.71 (S)~/HToxill with EcoRI ancl inserting the 72.8-bp Dral-HaellI
fragment (-4.0/-3.3 kb) after attachillg EcoRI linkers.
3 ~
-~o-The plasmi~l pAF(AB),(S)~/HToxin was generated by digesting pAF4.9[D2.7](S)K/HToxill with EcoRI allcl insertillg two coyies of the DraI-HaeIlI fragment (-4.0/-3.3 kb) after ~ttaclling EcoRI linlcers.
The plasmid pAF;(A)3(B),(S)K/HToxin was generatecl by digesting S pAF(AB)~(S)g/HToxin with Xbal inserting two copies of DraI-HindIIi fragment (-4.0/-3.7 kb) after convertillg blllnt ends ancl attaching XbaI linkers.
The plasmid pAF: (A)1(B),/I-lToxin was generated by removing 8 eopies of sileneer element from pAl (A)3(B),(S)~/~l'l'oxin by cligestion with BglII
f'ollowed by religation.
Two hepatoma cell lines (HllH-7, hllH-l) alld two non-hepatie eell lines (HeLa, COS) wele transfected with the recombin~nt plastnicls eontain;ng the HToxin gene together witll pSV2-C~\rr. The cell-d~ma~ing effeets expressed in the transt`eeted eells were examille~l by ~leterminillu the level of suppression of CAT expression eausecl by the HToxin expression by the methods of Example 1. HuH-7 eells were cllltllre(l in ISE~-RPMI alone, hllH-I/e1-2 cells were eultured in ISE-RPMI with I U/o fetcll cllf serllm. The non-hepatie eell lines were eultllred in ISE-RPMI with 5% fet~ll c~lf serum.
0.5 x 105 eells/cm~ of HeLa an(l COS7 [Gluzman, Y., Cell, 23, 175-182 (1981)] and 0.5 x 105 eells/em2 of HllH-7 ancl h~lH-I/e1-2 [Hllh, N. and IJtakoji, T., Gann, 72, 178-179 (1981)] were inoclllatecl ancl transfeeted with 10 ' ' ~4g of pSV2/Hl'oxin ancl variolls amollnts of the above-clescribed reeombinant plasmids by the Ca2~r precipitatioll metllod [Gormall et al., Mol. Cell. Biol., 2, 104 (1982)]. Arter 48 hollrs, the cells were collectecl and the CAT activities were determined. The reslllts are showll in F;ig. I l. As inclieated in the figllres, pSV2/HToxin strongly supplessecl the CAT activity in all the cell lines, and pAF4.9/HToxirl strongly sllppresse~l tlle CAT activity in the AFP hi~hly-prodlleing hepatoma eell line ~[llH-7 (F;g. 1 IA) bllt dicl not sllppress CAT
~ctivity in Illl~I- I/el-2 r ig 1 113) all(l the llon-llepatie cell lines, I-Ie'La (Fig. l lC) or COS7(Fig.llD). pAF4.9 [~2.7'~/~lToxill, lacking the sileneer region, 30 supl)ressed the C~T ~ctivily il~ ~Ill1-1-7 alld hll~l-l/el-~. On the other halld, pAF4.9[~2.7](S)K/~I'roxill havillg 8 copies of silencer sequences sllppressed the 213~9J~L~
CAT activity in HllH-7 (Fig. I IA) bllt not in hllH-I/c1-2 (Fig. llb).
pAF0.2/HToxin lacking the AFP trallscriptiollal reglllatory region except for 200 bp of the promoter region clicl not sllppress the CAT activity in any of thecell lines.
The results show that the HToxin gene can be expressed selectively in AFP highly-prod~lcillg hepatomcl cells by llsing recombinant DNA according to the present invention, sllch as pAF;4.9/HToxill ancl pAF4.9[~2.7~(S)8/HToxin.
The effect of increasing the nlllllber of AFP c1lhancers elements on the expression of the CAT gene was cleterlllille(l to be as follows.
Relative CAT Activity AFP enhancer clomain A I copy 6.8 ~ copies 52.4 AFP enhallcer clolllaill 13 I copy 3.3 3 copies 34 .5 As described above, a recombillallt DNA enters both normal and cancer cells but ca~lses the expression of the linkecl gene selectively in AFP-producing cells. Therefore, the recombirla1lt DNA of the present invelltion can be suitably used as a gene cancer-therape~ltic agent which (lamages or kills AFP-producing cells, e.g. hepatocelllllar carcinolncl~ witho~lt aclversely affecting normal cells.
20 ~ple 10. Generation of sln~u---_c se sllbstitlltion nll.ltations in the AFP
To introcluce single-base mlltaliolls ill PE ancl IvIPE seqllences, an oligonucleoticle-clirectecl in vilro mlltagenesis system version 2 (Amersham) was used. This system was basecl on the metllocl of Eclcsteill ancl coworkers (Taylor 2S et al., 198Sa; 'raylor et al. 1985b; Nakalllaye ancl E~ckstein, 1986; Sayers et al., 1988). Tlle proce~lllre lltilize~l single-stlan~le~l pBS-200 plasmi~l DNA as a tenlplate. Tllis single-strancle(l DNA was hybliclizecl to an oligonllcleoticle primer (spamlillg PE or MPE regiolls) harboring a mlltation at the clesired site.
The primecl single-strandecl pBS-200 plasmicl was thell extended to form the coînplementary strancl. Sllbseq~lently, the wild type strand was removed, and resynthesized llsing the mutallt stralld as template. For this purpose, eight 5 oligonucleotides were syntllesizecl (supplied by 'I'he Regional DNA Synthesis Laboratory, University of Calgaly). To generate point m~ltations in PE, the following oligonucleoticles were llsed as mlltant primers: PE mutant I, PE
mutant II, PE mlltant 111, PE mlltant IV (see Table 3).
To generate pOillt mlltations in MPE, the following oligonucleotides 10 were used as mutant primers: Ml'E mlltant 1, MPE mlltant II, MPE mutant III, and MPE mutant IV (see Table 3). The mlltatecl pBS-200 [PE and MPE]
plasmids were introd~lced into E. coli XL-lBllle host bacteria. In order to obtain the correct mlltatiolls, pBS-200 plasmids prepared from 12 to 48 bacterial colonies were screellecl by sillgle-lane sequellcing. The correct 15 mutants were fultller confirllle(l by seclllellcillg the entire sequences.
3 L~
-~3-List of oligonucleoti~le primers used in this shldy Names SEQ ID Seq~lences (5' to 3') NO:
CAT ¦ 30 dCAACGGTGGTATATCCAGTG
S AdML 31 dACTCATGCCCGC'm'rrGAGA .~:;
~-globin 32 dG'l'GATAGTAGCCTTGTCCTC :
PE mutant I 33 clA l GCTG rGAA rrA rTG
PE mutant II 34 dCTGTrAAGTA':l`TGGCA
PE mutant III 35 ~I T rAATTATGGGCAAAT
RE mutant IV 36 ~IATTATTGGAAAATGTC
MPE mutant I 37 clcAAAAGGTGAcTAGrr MP~ mutant ll 38 dAGGTTACGAGTTAACA
MPB mutant III 39 clTTACTAGTGAACAGGC
MPE mutant IV 4() clCTAGT'rAAAAGGCA'rT
Pr- 169 BgllI 41 dGA'l'CAGA'['C'rrrACAAATAACCGCTATGC
TG
PR - 98 BglII 42 dGArlCAGATCTlTrCAACCTAAGGAAATA
KS 43 dCGAGGTCGACGGTATCG
SK 44 (ITCTAaAACTAGTGGATC
T3 45 clA'FrAACCCTCACrrAAAG
t7 46 clTAATACGACTCACTATAGGG
This mutagenesis create(l pl~smi(l PEII, MPEII and PEII, MPEII which are shown in Fig. 13 (SEQ ID NOS: ~, 5, 13 arl(l 14). The plasmkls were transfected into HuH-7 cells by the metllo(ls of Example 1.
'rhe level oF promotel activity was measllrecl by measllrillg the CAT
~5 activity by the metho(ls ol` Example 1. 'I`he res~llts show that all mutations resllltecl ;n clecreasecl prollloter activity, particlllarly MPEII.
2 ~ 3 ~
Example 11. Generati n of sin;~,le-close s~lbstit~ltion mlltations in the AFP
enhaneer and sileneer reg~iolls.
Wild-type and mlltant enhallcel- an(l silencer elements were synthesized (SIE~OS:8, 15-25) (Fig. 14) ancl inserted into the Bglll site of pAF0.2-CAT.
5 The resulting plasmi(ls were transf`ectecl into HIIH-7 eells by the methods ofExample 1. The level of CAT aetivity was deterlllille(l by the method of F,xample 1. The reslllts hldicate that the wikl-type enllancer elements stimulatecl CAT expression in a higllly dose-~lepell~lellt mallner, i.e., 3 copies of enhaneer elements reslllte~l in abollt a 10-fokl inerease in CAT expression over10 one eopy of enhaneer elemellt. The mlltant enhalleer, on the other halld, showed m~lch less stimlllcltory activity ancl close clependency.
While the present invention hcls been clescribecl with reference to what are presently considere(l to be the prei`erlecl examples, it is to be unclerstood that the invention is not Ihnite~l to ~he disclose(l examples. To the eontrary, the 15 invention is intenclecl to cover variolls mo(lificatiolls ancl equivalent arrangements inclllclecl withill the spirit ancl scope of the appen~lecl elaims.
~ . 2 ~
~5 References The ~ollowing references are cite~l in this appiication at the re]evant portion of the application.
European Patent Applicatioll No. 0 415 731.
S Behringer, R.R., Matthews, L.S.~ Pallniter, R.D. and Brinster, R.L.
1988. Dwarf mice prodllce~l by genetic ab!ation of growth hormone-expressing cells. Genes. Dçve!. 2, 453-461.
/
Berk. P. (ed) ~Seminars in l,iver Disease _ No. 2 Thieme Stratton Inc. NY NY (1984).
Blankenstein, T., Qin, Z., Uberkl, K., Ml~ller, W., Rosen, H., Volk, H.D., ancl Diamantstein, 1. (1991). I`llmor sllppression after tunrlor cell-targeted tlimor necrosis factorgelle tr~nsfer. J Exp. Med., 173, 1047-lS Breitman, M.L., Clapofe, S., Rosant, J., Tsui, L.C., Glode, M., Maxwell, ~.H. an~l Berllstein A. 1987. Genetic ablation: Targeted expression of a tOXill gene CclllSeS IlliCrOplltllallllia ill transgenic mice.
_cience23~, 1563-1565.
Breitman, M.L., Romboll, H., Maxwell, I.~l., Klintworth, G.K. and Bernstein, A. 1990. Genetic ablation in transgenic mice with an attenllate(l dipl-theria ~oxin A Gene. Mol. Cell. Biol. 10, 474-479.
Colombo, M.P., Perrari, a., Stoppacciaro, A., Parenza, M., Roclolfo, M., Mavillo, F., and Parmiani, G. (1991). Gralllllocyte co~ony-stimulating factor gene transfel suppresses t~lmorigenicity of a murine adenocarcinollla in vivo. J. Exp. Me~l., 173, 889-897.
Culver, K.W., Ram, Z., Wallbri~lge, S., Isllii, H., Olclfield, H.O., and Blaese, I~.M. (1992). 11l vivo gene transfer with retrov;ral vector-proclucer cells lor tre~tmellt of experilllelltal brain tllmors. Science, 25~;, 1550-1552.
0 Dubensky, T.W., Campbell, B.A., all~l Villarre~ll, L.P. (1984). Virect transfection of viral an~l plasl~ l DNA illtO the liver or spleen of mice.
Proc. Natl. Aca(l_~Sci. USA, 81, 7529-7533.
Ellis, J. ancl Bernstein, ~. (1989). Gene talgetill~, with retroviral vectors: Reconlbin~ltion by ~ene convelsioll inlo regions of nonl1omology . 1~1. Cel I . 13i()1, 2, 1621 - 1627.
2 ~ 3 ~
-~6-Felgner, P.L. and Rllodes, ~. (1991). Gene ther~pe~ltics. Nature, 349, 351 -352.
Gey, (1952) C~ncer Res. 12:264. ~-Giannini, G., Rapplloli, R. and Ratti, G. 1984. The amillo-aeid sequenee of two non-toxic mlltallts of ~liphtheria toxin: CRM45 ancl CRM197. Nucl. Acicls Res. 12, 4063-4069.
Goring, et al . (1987) Science 235 :456-458.
Gorman, et al. (1982) Mol. Cell. Biol 2: 1044.
Graham, F. an~l van der Eb, A. 1973. A new techniqlle for the assay of infeetivity of hllmall adellovirlls 5 VNA. Viroiogy 52, 456-467.
Greenfield, L., Bjorn, M.J., Horn, C., Follg, D., 13llek, G.A., Collier, R.J., ancl -~aplan, D.A. (1983). Nllcleoticle sequence of the struet-lral gene for cliphtlleria tOXill earrie~l by corynebacteriophage ~'. Proe. Natl.
Aead Sei. USA, 80, 6853-6857.
Gutierrez, A.A., Lelnoine, N.E., an~l Sikora, K. (1992). Gene therapy for eaneer. Lllleet, 332, 715-721.
Friedman, T. (1989). I'rogress towarcl hlmlall gene therapy. Seienee, 224, 1275-1281.
Huang, H.J.S., Yee, J.K., Shew, J.Y., et al. (1988). Sllppression of the neoplastie phellotype by replaeement of the RB gene in hllman eaneer eells. Science, 242, 1563- 1566.
Huber, B.E., Rieharcls, C.A., ancl Krenitsky, T.~. (1991). Retroviral-mecliatecl gene therapy t`or the treatmellt of hepatoeelllllar earcinoma:
An innovative approaeh for cancer therapy. Proe. Natl. Aeacl. Sei~
~, 8~, 8039-80~3.
Huh ancl Utakoji (1981) Gallll 72:178-179.
Ingram, et al., (1981) PNAS 78:4694.
Kaezorek, M., Delpeyrollx` 11., Chellciller, N. Streeek, R.E. (1983).
Nneleoticle seqllence arl(l explessioll of the (liphtlleria ~(~x228 gene in E'~chell~hi(l c(J/i. _eiellcç, 221, 855-858.
Kaltecla, Y., Iwai, K., an(l Uchi~la, 1'. (1989). Inctease~l expression of ~ 2~ 3l~9~
-~17-DNA cointrodllcecl wilh nllcle~r plo~eil- in a~ t r~t liver. Science, 243, 375-378.
Kuriyama, S., Yoshikclwa, M., Ishizaka, S., Tslljii, r., Ikenaka, K., Kagawa, T., Morita, N., ancl Micoshiba, K. (1991). A potential S approach for gene therapy targeting hepatoma llsing a liver-specific promoter on a retroviral vector. Cell Strllc._F Inc. 16, 503-510.
Leone, A., Flatow, IJ., King, C.R., et al. (1991). Reclllced tumour incidence metastatic potentiai an(l cyclok;ne responsivelless of nn23 transfectecl meklnollla cells. Ceil, 65, 25-35.
Lopata, M.A., Clevelancl, D.W. an(l Sollner-Webb, B. 1984. H;gh-Level expression of a chloramphellicol acetyltransFerase gene by DEAE-dextran-mecliatecl DNA transfectioll collplecl with a climethyl sultoxide or glycerol shock treatlnent. Nucl. Aci(ls Res. L2, 5707-.
Masui, H., Kamrath, H., ~pell, G., Houston, L.L., an~l Menclelsohn, J.
(1989). Cytotoxicity agaillst hlllnan t~lmor cells mecliated by the conjugate of anti-epklermall growtll t`actor receptor monoclollal antibody to reeombillallt ricin A chaill. Cancer Res., 49, 3482-3488.
Maxwell, I.H., Maxwell, F., ancl Clo~le, L.M. (1986). Regulatecl expression oF a diphtlleria toxin-A-chain gene transfected into human cells: Possible strategy lor in~lllcing cancer cell s-licicle. Cancer Res., a,6, 4660-466~.
Maxwell, F., Maxwell, I.H., allcl Clode, L.M. (1987). Cloning, sequence, determination, ancl expressioll hl transl`ecte~l cells of the coding sequence for the tox 176 a~tenllate~l ~liplltlleria toxin A chain. Mol. Cell. B , 7, 1576-1579.
Mereer, W.E., Shielcls, M.rr., Lin, D., Appella, E., lJlrich, S.J. (1991).
Growth sllppression in~ ce~l by wikl-type p53 protein is accompanied by selective dowll-reg~lkltioll oF proliFerating-cell nllclear antigen expression. Proc. Natl. Aca~l. Sci. USA, 88, 1958-1962.
30 Miller, A.D. (1992). Hllman gene thelapy comes of age. ~hlre, ~, ~55-~60.
Miller ancl 13aitimore (1986) M~ol,~ln(l Cell. B ol 6:2895-2902.
Miyanohara, A., Sharkey, M.P., Witztllm, J.l.,., Steinberg, D., ancl ~L3~
-~8-Frieclmann, T. (198c.). Ef~ïcient expression of retrovirai vector-transduced h~lMan low clensity lipoproteill (LDL) receptor-deficient rabbit fibroblast in vitro. I'roc. Natl. Aca(l_i llSA, 85, 6538-6542.
Nakabayashi, H., Taketa, K., Miyano, K., Yamalle, T., ancl Sato, J.
(1982). Growth of h~llllclll hepatoma cells lines with differentiated functiolls in chel1licllly (lelinccl me~ ml., Cancer Res., 42, 3858-3863.
Nakabayashi, H., Taketa, K., Yamalle, T., Miyano, K., ancl Sato, J.
(1984). Phenotypical stability of a hllmall hepatoma cell line, HuH-7, ;n ]ong-term clllture with cllemically ~leline~l meclilnn. Japan. J. Cancer Res. (Gann!, 75, 151-158.
Nakabayashi, H., Watanabe, ~C., Saito, A., Ohtsllrll, A., Sawaclaislli, K., and Tamaoki, T. (1989). Transcriptional reg-llation of cx-fetoprotein expression by clexametllasolle in hllman hepatoma cells. J. Biol. Chem., 264, 266-271.
. .- ~- .,~. . . - ` . ~ . . . . . . .
2~ 3~
Nakabayashi, H., Hashil1loto, T., Miyao, T., Tjollg, T., Chan, J., and Tamaoki, r. (1991). A position-clepellclellt silencer plays a rnajor role in repressing cY-t`etoproteill expression in hllman hepatoma. Mol. CelL
Biol., Il, S Nerenstone, et al., Ca!lcer Treat!llent_R_view, 15 1-31 (1988).
Neumann, E., Schacfer-Ri~ler, M., Wang, Y., ancl Hofschneider, P.H.
1982. Gene transfer into mollse Iyoma cells by electroporation in high electric fielcls. EMBOl 1, 841-845.
Otsuru, A., Nagataki, S., ICoji, '1'. an(l 'ralllaoki, '1'. 1988. Analysis of alphafetoprotein gene expressioll in hepatocell~llar carcinoma and liver cirrhosis by In Sitll hybri~li7ation. Cancel 62, 1105- 1112.
Palmiter, R.D., Behringer, R.R., Qllaife, C.J., Maxwell, F., Maxwell, I.H. ancl Brinster, ~L. 1987. Cell lineaye ablation in transgenic mice by cell-specific expression of a toxhl gene. Cell 50, 435-443.
Pappenheimer, A.M. Jr. 1977. Dipl~ eria toxin. Ann. Rev. Biochem.
46, 69-94.
Potter, H., Weirl L. allcl l,e~ler, P, 1984., Enllallcer-clepenclent expression of hlllllall K hnl~ logloblllill genes introducecl into mOIlSe pre-B Iymphocytes by electroporation. Proc. Natl. Acacl. Sci. U.S.A.
81 7161-7165.
Rollins, B. and Sllnday, M. (19.91). Supplessioll of tllmollr formation ln V1VO by expression Or the JE gene hl maligllallt cells. Mol. Cell.
Biol., 11, 3125-3131.
Rosenberg, S.A., Aebersolcl, P., Cornetta, K., Sasicl, A., Morgan, R., Moen, R., Karson, E.M., Lotze, M.T., Yang, J.C., Topalian, S.L., Merino, M.J., Clllver, K., IVliller, D., Blaese, R.M., Anclerson, W.F.
(1990). Gene transr`er illtO hlllllalls-lllllllllllotllerapy of patients with aclvancecl melalloma, ~ISillg tlmlor-illfiltratillg Iymphocytes modifiecl by retroviral gene trans(l~lctioll N. Enyl. J. Mecl., 323, 570-578.
Sawaclaishi, K., Morhlaga, rl~. an(l 'I'amaolci, T. 1988. lnteractiorl of a l1CPatOma-S1)eC jfjC 11llCIeal l;aG~C)I with trallscl iption-reg~llatory seqllences of the hlllllall cY-letol)roteill all(l alt)lllnill genes. Mol. Cell Biol. 8, S179-5187.
r ~
2 ~ 3 ~
-s()-Thorpe, P.E., Wallace, P.M., Kl~o~vvles, P.P., Relf, M.G., Brown, A.N.F., Watson G.J., Blakey, D.C., allcl Newell, D.R. (1988~. Improved antitumor effects of imm~lllotoxills prepare~l with cleglycosylated ricin A-chain and hindeled clislllfi(le linkages. Cancer Res., 48, 6396-6403.
Uchida, T., Pappenheilller, A.M. ~ncl Gre~ally, R. 1973. Diphtheria toxin ancl related proteills. 1. Isolation ancl properties of mutant proteins serologically relate(l to dil)lltlleria toxin. J Biol Chem. 2248, 3838-3844.
Urano, et al. (1984) Gene 32:255-261.
Wallich, R., Blllb~lc, N., Hallllllerli~ J., et al. (1985). Abregat;on of metastatic properties of tllmollr cells by cle novo expression of H2K
antigens following ~12 gene transfection. Natllre, 315, 301-305.
Watanabe, K., Saito, A. an(l Tamaoki, r. 1987. Cell-specific enhancer activity in a fdr llpstlealll region ol a hl~ an c~-fetoprotein gene. J. Biol.
Chem . 262, 4812-4818.
Weatherall, D.J. (1991). Gene thelapy in pcrspective. Natllre, 349, 255-276.
Wilson, J.M., Grossmall, M., Wll, C.H., Chow(lllllry, N.R., Wu, G.Y.~
and Chowdllllry~ J.R. (1992). Hepatocyte-(lirecte(l gene transfer 1n vlvo leads to transient improvemellt ol hypercholesterolemia in low density liproprotein receptor-deficiellt rabbits. J. Biol. Chern, 267, 963-967.
Wilson, J.M., Grossman, M., Cabrercl, J.A., Wll, C.H., an(l Wu C;.Y.
(1992). A novel mechallism for achieving transgelle persistence In vivo after somatic gene trallsl`er into hepatocytes. J. Biol. Chem., 267, 11483-11489.
Wu, C.H., Wilson, J.~l., all(l Wll, G.Y. (1989). 'rargeting genes:
l~elivery an(l persistellt explessiol) ol` a loreigll gene driven by mammalian reglllatory elemellts nl vlvo. J. Biol. Chem., 264, 16985-16987, 30 Yan~, N-S, Bllrtlkllol(ler, J., Roberts B., Martillell, B., an(l McCabe, D.
(1990). 5LI VlVC) alld ill ~5~ gelle trallsfer to malllmaliall somatic cells by particle bonlbal(llllell~ 87, 9568-9572.
Wu, C,~.Y. an(l Wll, C.~l. (1988). Rec~ptor-llle(liate(l gene delivery and expression _l v_! J. 13iQI, C`_c~ '~63, 14621-14624.
~, ., . : : .
.. . . . .
~--`; ` 2 ~
Wu, C3.Y. and W~l, C.H. (1988). Evi(lel~ce for targetecl gene clelivery to Hep G2 Hepatoma eells in VitlO. E~ioehemistrY, 27, 887-892.
Wong, T.K. and Neulllallll, E. 1982. Eleetrie fielcl meclia~ecl gene transfer.
Bioehem. BiophYs. Res. Comm 107, 584-587.
5 Wu, G.Y., Wu, C.~. ancl Rubill, M.L. 1985. Aeetaminophen hepatotoxieity ancl targetecl reselle: A moclel for speeifie ehemotherapy of hepatoeell~llar eareinoma. _lepatology 5, 709-713.
Wu, G.Y. and W~l, C.~l. 1987. Reeeptor-mecliatecl in vitro gene transformation by a soluble DNA elrlier system. J. lBiol. Chem. 262, 4429-4432.
Yamaizllmi, M., Mekacla, E., Uehicla, T. ancl Okacla, Y. 1978. One molecule of cliphtheria toxin fragmellt A intlod~leecl into a cell can kill the cell. Cell L 5, 245-250.
~11 publieations, patellts allcl pa~ent appliea~iolls are herein ineorporated 15 by reference in their entire~ty to the sallle extent ElS if eaeh in(livid~lalpublication, patent or paten~ appliea~ion was speeifieally allcl inclivicl~lallyinclicated to be incorporatecl by referenee in its entirety.
packaging cell may be performecl by stan(lar~l molecular biology techniques well known in the art and will facilitate viral llptake in the target tissue.
The infective virion accordillg to the invention may be formulated by techniques well known in the art ancl may be presented as a formulation with a 5 pharmacelltica]ly acceptable carrier theret`ore. Pharmace~ltical acceptable carriers, in this instance, may comprise a liqllid lneclillm sllitable for use as a vehicle to intro~luce tlle infective virion into the patient. An example of such a carrier is saline. The infective virion may be a sollltion or suspension in such a vehicle. Stabilizers and antioxiclants and/or other excipients may also be 10 present in sllch pharmaceutical formlllations which may be administered by intra-veno~ls or intra-arterial int`llsion. In the case of treating HCC intra-hepatic arterial infllsion may be a~lvantageolls~
The amounts an(l precise regime in treating a mammal, will of course be the responsibility of the attendallt physician, and will depend on a number of 15 factors including the type and severity of the condition to be treated. However, for HCC, an intrahepatic arterial infllsion of the artificial infective virion at the titre of between 2 x 105 an(l 2 x 107 colony t`orlning units per ml (CFU/ml) infeetive virions is likely to be sllitable for a typical tumor. Total amount of virions infilsed will be ~lependellt on tlmlor size and wolllcl probably be given in 20 divided doses.
Where the heterologolls gelIe enco(:les for a metabolic enzyme, a metabolite mllst also be adlnilIistele(l to the malIlmal. Tlle close ot the drug will a(lvantageo~lsly be in the range (). I to ~50 mg per kilogram bo(ly weight of ,.- . ~ .. . . . ..... . .
:, j : : : , .
" " , " . .. . ....... .. .. ..... ..
3~9~
recipient per day, prefer~bly 0.1 to 100 mg per kilogram bocly weigh~. One skilled in the art colllcl (letermille the closage to be ~clministered based on a number of factors, incl~lcling the metabolic enzyme contemplated.
The term "s~lbstantially colnplete Icill" means that the number of viable S cells has been reducecl by a I log re(l~lctioll, for example, ~from 10'1 to 103 cells.
More preferably, the nllmber of viable cells has been redllced by 2 logs. ~ven more preferably, it has been reclllcecl by 3 logs.
The following exalnples serve to illllstrate the present invention but should not be constrlled as a limitation thereof:
10 ~am~le I
iHIlH-7 is a hulllall hepatollla cell line proclllcillg AFP which was obtainecl from Dr. J. Sato, Okayama University, Japan. (Nakabayashi et al., (1982) Cancer Res. 22:3858). Hu~1-7 was cllltllrecl in a chemically del~lnecl medium ISE-RPMI, which contains ethanolamine (30 ~g/ml) in IS-RPMI.
15 huH-1/c1-2 is a clone isolatecl from the parental huH-1 hllman hepatoma cell line (Huh and Utakoji (1981) Ganll 72:178-179). It was obtained from Dr.
Huh, University of Tokyo, Japan an(l was cllltllrecl in ISE-RPMI with 1% fetal calf serum. HeLa is a hlllnall cell line (Gey, (1952) Cancer Res. 12:264) which cloes not prodllce AFP. HeLa cells were cllltllred in ISE-RPMI with S%
2() fetal calf serum. COS 7 cells are all al`rican greell monlcey kiclney cell line whicll cloes not proclllce Al P. 1'he COS 7 cells were obtainecl from ATCC and were cllltllrecl in lSF-RPMI with ~'r/o fe~al calf serllm.
2~3 ,L~9!~
In all eases, transfeetion was performecl by the ealei~lm phosphate preeipitation methocl as cleseribecl by Nakabayael1i et al. (1989) J. Biol. Chem.
204: 266-271. In e,rcler to cletermine CAT aetivity, the transfeeted eells were Iysed by several eyeles of freezing ancl thawing and eentrifugecl at 15,000 rpm S for S min. The sllpernatallt was heate(l at 60C for 10 mh1. ancl analyzed for ehloramphenieol aeetyltransferase (CA I ) aetivity aeeorcling to Gorman et al.
(1982) Mol. Cell. Biol. 2:1044. rhis heat treatmellt is essential for the deteetion of CAT aetivity in hllH-I/e1-2 eells. Similar heat treatment of extraets resulted in a 3.5 folcl inerease in HllH-7 eell CAT aetivity.
pBR-CAT was eonstrlletecl by insertillg the HincllII-BamHI fragment obtainecl from pSV0-CAT obtaine~l Irom Dr. B. ~Ioward, (NCI/NIH) (Gorman et al. (1982) Mol. Cell Biol. 2:1044) h1to pBR322 pllrehasecl from BR~"
Gaitherburg MD aeeorcling to the methocl of Walker et al., (1983) Nature 306:557. This plasmicl eontains the CAT eocling sequence and the SV40 15 polyadenlyation signal but laeks the SV40 enhaneer ancl early promoter elements.
CAT f~lsion genes were eonstr~letecl l)y lh1kirlg the CAT gene to AFP 5'-flanking seq~lenees obtainecl by restrietion en~yme cligestion or polymerase chain reaction ancl inserting them into the Hh1clIII site of pBR-CAT.
Speeifieally, pAFI.0-CA'r was eonstrlletecl by insertil1g the 980 bp seqllenee between -951 all(l -1-29 relative to the eap site of the hllman AFP gene into the HinclIII slte at the S' encl o~` the C~ll gene of pBR-C~\T.
':' ` :,: ;, ~ ' . . :: .'.`. ': , ': .: .~:: :
~ ~ 3 '~
To construct pAF5. I-CAT contai1ling the 5. l kb of the AFP 5'-flanking sequence, pAF1.0-CAT was digeste(l completely with Pstl, partially with E~coRI
and a 5.7 kb DNA seq~lence containing a 0.9kb EcoRI-HinclIlI human AFP
DNA fragment (-870 to ~29), the C~T gene and the pBR322 replication or;gin S was recovered. pHAL-2w-Eco4.2, (a clone containing 4.2 kb AFP DNA from -5.1 to -871 bp insertecl at the EcoRI site o~ pBR322) was cligested completely with PstI and partially with EcoRI. A 4.9 kb DNA fragmellt consisting of the 4.2 kb AFP EcoRI DNA and the 748 bp Pstl-EcoRI DNA fragment of pBR32 was isolated ancl ligate(l to the 5.7 kb DNA derivecl from pAFI.0-CAT.
10 _xam~Q2, Expression of CAT g_ le (lriven by_the AFP 5'-flanklng region in ~ H-7 ancl hllH-I/c1-2 cells.
To cletermine whether the (liff`erellces in AFP procluction in HuH-7 and huH-1/c1-2 cells are cllle to clifferellces in transcriptional regulatory aictivities vf the AFP S'-flanking regions, the cells were transfectecl with plasmicls containing 15 the CAT gene to which variolls lengths of AFP 5'-Flanking sequences were linked. Transfection an(l analysis of CAT activity were performed as described in Example 1. The reslllts of the test are shown in F'igllres lA ancl IB. The amounts of cell extract llsecl ancl the hlcllbatioll thlles were 25 ,ug ancl 20 minlltes for HllH-7 (lanes I - 5) an(l 100 ,ug an~l 180 minlltes for huM-I/c1-2 20 (lanes 6- 10).
The 5.1 kb AFP 5'-rlallking DNA which contains the full AFP enhanc,er region (-~ /-3.~kb) s~lpportecl a higll level of Ct'~'l' expression in HllH-7 (F;g.
~ ! 2 ~
lB, lane 3) but only a low level of expressioll in hllH-I/c1-2 (Fig. lB, lane 8).
CAT expression support by the 1.0 kb AFP promoter region was also greater in HuH-7 than in hllH-I/c1-2 (Fig. IB, klnes 4 and 9). Thus there is a eorrelation between transeriptional activities of the AFP 5'-flanking sequences and the 5 levels of AFP produetioll hl HllH-7 ancl hllH-I/e1-2, respeetively.
Comparison of CAT activities supportecl by S. l kb (eontaining the AFP
enhaneer) and 1.0 kb (withollt the AFP enllancer) of the AFP 5'-flanking sequenee showed that the AFP enhancer sthlllllatecl the AFP promoter activity 25-fold in HuH-7 (Fig. IB, lanes 3 ancl 4) but only 2-folcl in huH-I/e1-2 (Fig.
10 lB, lanes 8 and 9). These results h~(licate that hl hllH-I/cl-2 eells the AFP
enhaneer does not stimlllate the AFP promoter as muell as in HuH-7 eells.
2 ;~ 3 '~
Example 3. Analvsis of AFP promoter ancl enhancer activities in l~lIH-7 and hu~-l/e1-2 eells To show that enhancer activation of the AFP promoter is seleetively inhibitecl in h~IH-l/e1-2 eells as sllggested above, it is important to establish that 5 both the AFP enh~neer and the prollloter are active in this eell line.
To analyze the f~lnetionality of the AF P promoter, the effeet of dexamethasone was tested on the AFP promoter activity. This test is based on the observation that dexamethasone stimlllates the AFP promoter only when it is i~unetional. (Nakabayashi et al., (1989) J. Biol. Chem. 264:266) HIIH-7 and 10 huH-I/e1-2 eells were transtectecl with p~\Fl.OCAT inellbated w;th or without 3 x 10 6 M dexametllasone for 2 ~lays ancl allalyze~l for CAT aetivity. The amounts of extraet ancI the incub~tion times were 25 ~g and 20 min. for HuE~-7 eells (lanes l and 2) and 100 lilg and 180 minlltes for hllH-I/e1-2 eells (lanes 3 and 4). See Fig. I C .
It was found that dexamethasolle stimlllatecI CAT aetivity supported by the l.0 kb AFP promoter 9 I`okl in h~lH-I/e1-2 ancl 12-fold in HuH-7 cells.
This reslllt inclieates that the AFP promoter is ~;lnetiollaI hl huH-l/e1-2 eells.
Next the aetivity of the AFP enIlaneer was (Ietermirlecl in HIIH-7 and huE[-l/e1-2 eells. The 2.4 kb t;lll enhaneer region (-5.3/-2.9kb) ancl two 20 subregions, 0.3 kb domaill A ( ~.0/-3.7 kb) an~l 0.4 Icb dolnain B (-3.7/-3.3 kb) were indivklllally teste~I hl eolljllllclioll with SV40 promoter.
To eonstr~let pSV I '-C'A'I`, the plas~ l pSV2-CAT was digested with ~eel and Sphl an~I the smclIIer fragment was removecI. 'I'he remaining DNA
. 2~3~9~
was made blunt-ended by treatment with the l~rge fragment of DNA polymerase I and ligated through BglII linkers. Tllis plasmi(l contains only 30~ of one SV40 72 bp repeat sequence and the TATA box.
pSVAF2.4-CAT w~s constrllcted by inserting the 2.4 kb BglII-BglII
5 fragment between -5.3 and -2.9 kb of the AFP gene prep~recl from )~HAI,-2W
into the BglII site of pSVl'-CAT. rhe pl~smid AH~L-2W was described in Urano et al. (1984) Gene 32:255-'~61.
pSVAF0.~-CAT was constructed by inserting the 408 bp HindII- HaeIII
fragment between -3.7 and -3.3 kb of the AF;P gene which had been blunt-10 encled into the BglII site of pSV I '-CArr.
pSVAF0.3-CAT was constrllcte(l by digesting PSVAF2.9-CAT with BgllI. The released 2.4-kb fllll enh~llcer fr~gment was digested with D:raI and HindlI~ to release the 318-bp fr~gment. Tlle Hin~lllI end o-f this fragment was converted to blunt end, BgllT liners were attache~l to both ends and the fragrnent 15 was inserted into the BglII site ot pSVI'-CAT.
All of these enhancer regions stimlll~te(l the SV40 promoter activity to essentially the same clegrees in ~lu3~1-7 ~lncl huH-I/c1-2 cells. See Table 1.
TABLE 1. Exl~r~ssioll of CAT ~ICtiVity frolll Vnrio~ls AF'I'-CAT fllsion ~ncs.
CAI` activity Ccll linc pSV2-CAT
__ pSVAF- pSVAF pSVAF- pSVI' 2.4-CAT 0.3-CAT0.4-CAT CAT
pmol/h/,u~ of % ~/0 % % %
protcin _ ____ _ l 7 731 100 fi2 ('1'1)22 (lfi) 5.9 (~
l/cl 2 46 100 68 (38)25 (1~1) 7.2 (O1.8 (1) 30 ~ 1 32 100 3 5 (1 7) 3.~1 (l.6) 3.2 (1.5) 2.1 (1) 3 '~
This finding indicates that the AFP enhallcer elements are as ac~ive in huH-1/c1-2 cells as in HllH-7 cells. These res~llts sllggest that positive transcription factors regulatillg the AFP enhancer ancl promoter are not limitin~
in huH-1/c1-2 cells.
5 Example 4. Negative control elemellts sllppress AFP enhancer activity in hllH- l/cl-2 cells.
The examples clescribecl above sllpportecl the view that the AFP enhancer is unable to stimlllate the promoter hl hllH-l.c1-2 cells. To test wllether this is due to the action of negative regulatory elements locatecl between the enhancer 10 and the promoter, variolls lengths of DNA clownstrealll of the enhancer (at -2.9 kb) of the 5.1 kb AFP 5'-flankillg seqllellce in pAF5. 1 -CAT were deleted. (Fig.
2) To aehieve the cliflerent cleletions, the plasmicl pAF5. I-CAT was digested completely with Bglll ancl with Sacl or BstNI or partially with HindII~[. The SacI or BstNI or Hill(llll sites were blllnt enclecl with Klenow fragment and 15 ligatecl to BglTI linkers. The plasmicl was then religatecl. These deletions ha~
little effeet on CAT expression in HllH-7. In hllH-l/c1-2, on the other hancl, CAT expression changed with several cleletions. In particlllar, significant inereases were observecl with cleletions from -2.9 kb to -951 bp ([~2.0~ in Fig.2) (3.6 fold) and from 2.9 kb to -169 bp ([~2.7] in Fig. 2) (lO-fold). These 20 results suggest that at least two negative control regiolls exist between -1822 and -169 bp; one from -1822 to -951 (clistal silencer "Sd") and the other from -402 to -169 bp (proximal silencer "Sp"). Ill acldition, a small but eonsistent inerease in CAT activity was observecl associatecl with the cleletion from -95l to -402 bp ([~2.5] in Pig. 2) whicll may s~lggest the presence of a thircl, weak 25 negative control elemellt in this region.
The 875-bp Sd region was analyze(l for transcriptioll-s~lppressive aetivity by inserting it baek into pAr~S. 1[~2.7l-CAT in whicll a 2.7 kb sequenee from -2,9 to -169 bp had been (lelete(l. Tlle Scl DNA was cllt from the AFP region with HindlII ancl bl~lnt enclecl with Klenow fragment. BgllI linkers were ligated 2~3~
to the 875-bp fragment and the fragment was insertecl into the BglII site in theplasmid pAF5.1[~2.7]-CAT. The resllltant constr~lct ([~2.73+875) showed a flve-fold lower CAT activity than the parelltal plasmicl [~2.7] in huH-l/el-~eells (Fig. 2). To furtller clelimit the silencer activity, the 875 bp DNA
5 fragment was clividecl into two fragments by cligestion with DraI enzyme to obtain a 409 bp 5'-fragment (from -lg22 to -1414) and a 389 bp 3' -fragment (from ~1336 to -948), ancl each lragment was testecl separately for suppressive CAT aetivity. The 409 bp 5' fragmellt ([~2.7] -~409) suppressed CAT aetivity strongly, whereas the 3' fragment ([~2.7] -~389) clicl so weakly (Fig. 2). This 10 finding indieates that the major silencer activity is containecl in the ~09 bp 5' fragment. In the absence of the enhancer, the 5' fragment weakly stimulated AFP promoter activity. These reslllts hl(lica~e that the action of Sd is to interfere with the AFP enllancer activity withollt affecting AFP promoter activity.
In the absence of the entile sllppressor region ([~2.7])7 the CAT activity expressecl in huH-l/e1-2 is four fokl lower than that in HllH-7 (25.9 versus 116), This fincling sllggests that another mechanism exists in huH-l/e1-2 to suppress the intrinsic AFP promoter activity, althollgh this accollnts only partially for the large dirference in AFP proclllction between HllH-7 ancl huH-20 1 /cl-2 .
Example 5. The Scl element Sll~ Q etivitv in a position-c penclent mannerL
The effeet of the Sd region on a heterologolls enhaneer was examinecl by inserting the 875 bp Sd region (from -1822 to -948 bp) illtO the BgllI site in the 25 SV40 enhancer of pSV1.6-CAT (Sphl site converte(l to E3glll site) in normal (cl) ancl reverse orientatiolls (e) (Fig. 3A). The resllltant constructs expressecl much lower CAT aetivity in hllH-l/c1-2 cells than dicl the parental plasmicl, indieatin,g that Sd ean sllppress the heterc)logolls SV~0 enhancer in an orientation-in(leperlclent manner. Sllppression ot' ClAT activity was also observed in HuH-730 and HeL,a cells althollgh to mllch lesser extents. This finding suggests that the 2 :~ 3 ~
Sd activity is not strictly cell type specific. To show that the observed effects are not due to the clisrllption of tl1e SV40 enhancer, a 924 bp DNA (from -4.9 to -4.0 kb) of the AFP gene with no known regllkltory activity was inserted at the BglII site of pSV1.6-CAT as a control (c) (Fig. 3B). No signi~lcant S changes in CAT expression were observecl with the 924 bp DNA insert as compared to pSVl.6-CAT.
The orientation-inclepen(lel1t sllppressiol1 was also observecl with the 409 bp Sd fragment in the SV40 enhancer. Tlle 409 bp fragment (from -1822 to -1414bp) was insertecl into the Accl (a ancl b), Bglll (f and g) or BamHI (h and 10 i) site in normal ancl reverse orientcltions. When it was inserted ~lpstream of the SV40 enhancer or clownstreall1 of the CAT gene, no s~lppression effect was observed in either orientation in al1y of the cell lines testecl. These results show that the effeet of Scl is orientation inclepel1clent b~lt position clependent.
Example 6. klentifïcatiol1 of a silencer elen1el1~
To delimit the Scl region tl1at exerts transcriptional suppression, we inserted various lengths of Scl sllbfragments in the SV40 enhancer (BglIl site) of pSV1.6-CAT (Fig. 4). The longest fragment is a Hindlll fragment of 875 bp.
This fragment was blllnt en(lecl ancl 13glll linkers were attached ancl the fragment was insertecl into the Bglll site of the SV40 enl1ancer. In acldition, 20 two sub-fragmel1ts from tlle 875 bp Hil1cllll fragmel1t were obtained by digesting the fragment witll Dral ancl blllnt encled. BglII linkers were attached and the fragments were inseltecl into the Bglll site of the SV40 enhaneer. The 31 bp fragment was syntl1esizecl by DN~ Syntl1esis Laboratory, IJniversity of Calgary as two single strancls ol` 3 l bp ancl anl1ealecl these eomplementary 25 strands to make clollble-stranclecl DN~\. 'l'his was ligatecl into the Bgll[ site of the SV40 enhancer.
Five fragmel1ts covering the region llpstrealll of -1760 suppressed CAT
aetivity, The shortest active fragnl(,~nt was 31 bp long, from -1790 to -1760.
Fo~lr other fragments coveril1g the region clownstream of -1750 were inactive 30 (Fig. 4). The 22C~-bp Sp region from -402 to -1'74 was also tested in a similar s,~ ,,, , : ,, " , , " , , , ~ , ~ ", " " , 3 ~
manner. It showecl transcription-sllppressive activity, altllol~gh to a lesser degree than did Sd (Fig. 4).
We follnd that the 31-bp fragment whicl~ exhibited suppressive activity contains a 17-bp stretch, 5'-CTTCATAACTAATACrr-3', which is repeated S four tirnes within a 90-bp region frolll -1810 to -1720 (Fig. SA (SEQ ID
NO:6), underline(l). A simiklr seclllence is also t`ollncl in the Sp region (Fig. 5B
(SEQ ID NO:7), unclerlille~l). In all cases, the first six n~lcleotides, CTTCAT,and the last two, TT, are completely conserve(l (Fig. SC). DNase I
footprinting analysis by the metho~l of Saw~claishi et ~1. (1988) Mol. Cell Biol.
10 8:5179-5187 showecl that these seqllences were protected by nuclear extracts prepared from huH-I/c1-2.
To further characteriz~e the fllnctioll of theses seqllences, we inserted the 31-bp oligonucleoti(le (from -1790 to -1760 bp (SEQ ID NO:8)) into the BgllI, AccI or ~3amHI site of pSVI.6-CA'I'. A m~ltant fragmellt with three-nllcleotide 15 substitlltions was inserted into the Bglll site (SEQID NO:9). The mutant sequence was synthesizecl. These constrllcts were transfected into huH-l/c1-2 orHuH-7 cells ancl 2 days later c~ r activities were analyzecl as clescribecl ;n Example 1. The amollnts of extract ancl incllbation times were 25 ,ug ancl 20 min. for HuH-7 (lanes 1 to 6) ancl 100 ~ug ancl 180 min. for huH-l/c1-2 (lanes 720 to 12). See Fig. 6, lanes I ancl 7, pSVl.6-CAT (positive control); 2 and 8, wild-type 31 bp fragmellt inserte(l in Bglll; 3 ancl 9, mlltant fragment inserted in Bglll; 4 an(l 10, wil~l-type fragment insertecl in Accl; S and 11, wild-type fragment inserte(l in BamHI; 6 ancl l~, pSVI'-CAT (negative control).
The fragment insertecl witllin the SV40 enhancer strongly sllppressed 25 CAT activity in huH-l/c1-2 (F;ig. 6~, lane 8), bllt only a weak sllppression was observed in ~Ill1~1-7 (Fig. 6A, lane 2). 'I'he insertioll of the fragment llpstrean~
of the SV40 enllallcer (F;ig. 6A, kllles 4 an~l 10) or (lownstream of the CAT
gene (Fig. 6A, lanes 5 an(l 11) lla(l no effect on CAT activity in either cell line.
Substitution of thlee nllcleoti(les withill the 17-bp repeated seqllence SEQ ID
30 NO:9) (Fig. 6B) resnlte(l in loss of slll)pressive activ;ty (Fig. 6A, lane 9). This ~Inding confirms the association of the s~lppressive activity with this sequence.
2`~'19~
To determine the relationslIip between transcriptional s~ppression and the number of copies o~ the Scl elements, one, three, or eight copies of the 31-bp sequence (SEQ ID NO:8) was inserted into pAF5.1[~2.7]-CAT. The 31 bp synthetic fragmen1 whiclI has Bglll sites on both entls was ligated into the BglII
5 site of pAF5. 1 [a2.7]-CAT. In or~ler to obtain mllltiple copies of the fragment, the 31 bp fragment was mllltillIerizecl by selt:ligation ancl then inserted into the BgllI site of pAF5. 1[~2.7~-CAT, wllich was thell trallsfectecl into Hu~I-7 or huH-l/cl-~ cells. The level of CAT activity was measllred by the method of Example 1 (see Fig. 6C). Analysis oF CAT expression from these constructs 10 showed that C~T activity decrease~l with increasing n1lmber of copies of thissequence in hllH-I/c1-2 bllt not in 1~Illl-I-7 (Fig. 6C). The CAT activities areexpresse(l relative to tllat of pA1~0.2-CAT.
E~Lmple 7.
Referring to Fig. 7, the cliplltlIeria toxin gene, a known gene, codes l~r 15 diphtheria toxin consisting of alI A ancl B-cllain. It is known that diphlheria toxin can kill ellkaryotic cells by blocl<;ng protein synthesis. The B-chain is involved in the bincling of the ~ chaill to a cell. The seqllence of the A and Bchain of the DT gene is pllblished. [Greenfielcl, 1,., et al., Proc. Natl. Acacl.
Sci. USA, 80, 6853-6857 (1983)1 See Fig. I5A (SEQ ID NO:9). The DF,-A
20 gene and the tox-176 gene were obtained from Dr. Bernstein, Mount Sinai Hospital, Toronto. A DNA fragmelIt coclilIg for a nlo(lifie(l A-chain (HToxin) (SEQ ID NOS: 28 and 29) was llsed. TlIis modifiecl DNA fragment was macle by using PCR synthesis. This DN~ fragment (HToxilI) encodes for an A-chain having Cys as the 66th amino aci(l an(l Arg as the 194tlI amino aci(l, insteacl of 25 the nahlral A-chain llaving 'I yr alId Pro, respectively, as reportecl by areenflelcl and others. This DNA fragllIelIt was plovi(le(l with a ~1in(1111 restriction en~yme cleavage site at the N-terlllillal an(l a lilpal restriction enzyme cleavage site at the C-termincll, llsing synthetic primers contail1illg the HlndllI Ol the HpaI site, respectively.
2~3~ 9~l~
pSV2-CAT [ob~ine(l from Dr. s. ~-1. Howarcl, NCI/NIH~ [Gorman, et al.. Mo. Cell. Biol..2, 104 (1982)] w~s cligestecl by Hind 11I and Hpal to remove the CAT gene, ancl the DNA fragment eneocling the HToxin DNA was inserted into the plasmicl to construet a recombillallt plasmid pSV2/HToxin.
5 This reeombinant pklslllicl was use(l as a positive eontrol beeause it is expressed nonspeeifiea]ly in most eell lh~es ~lnder the (lireetion of the SV40 early promoter.
The plasmicl p'l`~lXI was obtainecl lrom Dr. Bernstein, Mount Sinai Hospital, Toronto. It eontahls a wild-type DT-A gene next to the 10 metallothionein gene promoter.
The plasmicl pTHX-176 eontaills a mutant DT-A gene having Asn instead of Gly irl the 128th position from the N-termin1ls. This plasmid was obtained from Dr. A. Bemsteill, Mo~lnt Shlai Hospital, Toronto.
The eell-killing effeet of pSV2/HToxill was cleterminecl by compar;ng it 15 with the cell-killing effeets of other plasmicls. More speeifieally, HuH-7 cells were transfeetecl by the methocl of Example 1 with pSV2-CAT alone or w;th pTHX1, pT~i[1-i76 or pSV2/~l'l`oxin. Then, the CAT aetivities expressed by these transfected cells were cletermillecl. The ability of a particular vector to suppress protein synthesis is inclieatecl by the level of CAT aetivity. As the 20 amount of protein synthesis is s~lppressecl, the level of CAT aetivity decreases [Nakabayashi H., et al., Mol. Cell. Biol., 11(12), 5885-5893 (1991)]. The res~llts, shown in Fig. 8, hldieate that pTHXl and pSV2/HToxin have substantially the same level of supplessillg effeet on the CAT aetivity ancl therefore substantially the same level of eell-killing effeet. pTHI-176 exhibited 25 a level of s~lppressing el`feet abollt one thild of the level exhibite(l by pTHXI.
The results inclieatecl that the AFP reglllatory seqllenees llsecl clireetecl the expression of the H'roxill gene hl AFP procllleillg hepatoma eells.
ExamR~2LtLerla toxi!) o!l eell lhles The plasmkl pSV~/Hrl~/lleo' ~vas obtainecl by linking the neomyein 30 resistant gene (neo') ~Stratagene, La Jolla, CA] to the above-mentioned /~ ~
~ :~ 3 '~
pSV/HToxin. The plasmicl psv2lHrroxin w~s iclgestecl with B~mHI and then with the Klenow fragme'1t to form blllnt encls. pMCl-lleor (Stratagene, La Jo1laCA) was treated with XhoI ancl Sall to release the neo' gene (1083 bp). This was inserted into the treatecl pSV2/HToxill plaslllicl above by blunt end ligation.
The plasmid pMCI-neor w~s obt~inecl from Stratagene, La Jolla, CA.
HuH-7 cells an(l HeL~ cells were transfected with pSV2/HT/neor (see Fig. 9) or a eontrol plasmicl pMC1-rleo' (Strategene) by the calcium phosphate method of Ex~ample 1. Transrorlllclllts havillg neo' were selectecl by using G418 (GIBCO). Following transf~ction, cells were treate(l with 50 ,ug/ml of G418 for two days ancl then with increasillg alnollnts (llp to 200 ,ug/ml for HuH-7 cells and 1 mg/rnl for HeLa cells) f`or 3-4 weeks. When the HeLa and HuH-7 cells were transfecte(l witll the control plasmid, pMC1-neo, both cell lines formed eolonies of the transforlllallts becallse the plasmicl has the neo' gene.On the other hancl, when the He~.a all(l H~IH-7 cells were transfected with the lS plasmid pSV/HT/Ileo' whicll has the neo' gelle, neitller of the cell lines formed colonies beeallse the plasl-nicl pSV/~l'r/lleo' also has H Toxin gene expression, ...
resulting in deatll of the trclllsf~orlnallts~ Neither of the cell lines transfected with pUC19 (E~RL), whiell cloes no~ COlltclill either of the genes (i.e. a negative control) formecl colonies (see Table 2). These reslllts prove that the HToxin 20 gene has a cell-killing effeet in both HllH-7 ancl HeLa cells.
Table 2 Plasmicl Nllmber of Colonies (105 cells) _ H~1_1-7 HeLa___ pMC I neo' 4 . 2 0. 5 pSV2/HToxin/lleor 0 0 e~C C~ _ _ _O _ O _ r~l2Le~PJffeet of t!le Slelce! Rc~iQll~oQtlle Cell-~lllillg~y_DIplltlleria in.
Vilriolls reeolllbillallt plaslllicls as showll in Fig. 10 wele eonstruetecl by 30 linking the HToxin gene to I~N~ cllaills eontaillillg (lifferent lengtlls of the . ~
~`' ` 2~3'13~
transcriptional regulatory regions Or the AFP gene. More specifically, the above-mentionecl pSV2/HTox;n was cligestecl by Hind Ill and BamHI to obtain a DNA fragment having 759 bp which inclu(le(l the HToxin gene. The 759 bp DNA fragment was inserte(l in between the Hh-(llll ancl BamHI sites of the S pGEM-7Z vector (Promega), thlls constrllcting pGEM7Z/HToxin. The plasmid pAFa,.9/HToxin comprises the entire transcliptional regulatory region of the AFP gene, ancl the HToxin gene controlle(l by the transcriptional regulatory reglon.
The 4 9 kb 5'-flanking region Or the AFP gene was obtained by partially 10 digesting pAF5.1-CAT (Example 1) with Hincllll, electrophoresing the resultant fragments in a 0.4% agarose, then collecting the 4.9 kb DNA fragment. The collected fragment was inserte(l into the l-lincllll site of the above-mentionedpGEM72/HToxin, thlls obtahlillg the clesirecl plasmicl, pAF4.9/HToxin.
pAF4.9[~2.7]/HToxill in whicll the 4.9 kb 5'-l`lankillg region of the AFP gene 15 lacks a region from -2.9 I<b to -169 bp, (i.e. the silencer region) was obtained by partially digesting pAF5. 1 [Q2.7J-CAT with ~Iindlll ancl inserting the resultant 2.2 kb DNA fragmellt into the Hin(l llT site of pGEM/HToxin.
The plasmicl pAF4.9 [~2.7](S)8/HToxill comprises the transcriptional ~egulatory region of the AFP gene ancl the H'l'oxin gene controllecl by the AFP
20 enhancer, 8 copies of the AFP silencer element ancl the promoter. This was obtained by partially digesting pAF5.1[L~2.7](S)~-CAT (Example 6) with HindllI ancl inserting the 2.~kb flagment havillg tlle enhancer ancl 8 copies ofthe silencer elements ancl the promoter hlto the Hincllll site of pGEM/HToxin.
pAF0.2/~IToxin was obtaine(l by the followhlg steps: cligestion of 25 pA~74.9[~2.7~/~IToxill by Smal, ligation with a Bglll linker, Bglll cligestion and removal of short fraglllellts belween the Smal ancl Bglll sites, ancl then Bglllself-ligation. The plasmicl p/\F0.2/HToxill is a conlparative example that lacksthe enhancer ancl silencer seq~lences.
The plasmicl pAF;(AB)~(S)~/H'roxill was generatecl by cligesting 30 pAF4.9[~2.71 (S)~/HToxill with EcoRI ancl inserting the 72.8-bp Dral-HaellI
fragment (-4.0/-3.3 kb) after attachillg EcoRI linkers.
3 ~
-~o-The plasmi~l pAF(AB),(S)~/HToxin was generated by digesting pAF4.9[D2.7](S)K/HToxill with EcoRI allcl insertillg two coyies of the DraI-HaeIlI fragment (-4.0/-3.3 kb) after ~ttaclling EcoRI linlcers.
The plasmid pAF;(A)3(B),(S)K/HToxin was generatecl by digesting S pAF(AB)~(S)g/HToxin with Xbal inserting two copies of DraI-HindIIi fragment (-4.0/-3.7 kb) after convertillg blllnt ends ancl attaching XbaI linkers.
The plasmid pAF: (A)1(B),/I-lToxin was generated by removing 8 eopies of sileneer element from pAl (A)3(B),(S)~/~l'l'oxin by cligestion with BglII
f'ollowed by religation.
Two hepatoma cell lines (HllH-7, hllH-l) alld two non-hepatie eell lines (HeLa, COS) wele transfected with the recombin~nt plastnicls eontain;ng the HToxin gene together witll pSV2-C~\rr. The cell-d~ma~ing effeets expressed in the transt`eeted eells were examille~l by ~leterminillu the level of suppression of CAT expression eausecl by the HToxin expression by the methods of Example 1. HuH-7 eells were cllltllre(l in ISE~-RPMI alone, hllH-I/e1-2 cells were eultured in ISE-RPMI with I U/o fetcll cllf serllm. The non-hepatie eell lines were eultllred in ISE-RPMI with 5% fet~ll c~lf serum.
0.5 x 105 eells/cm~ of HeLa an(l COS7 [Gluzman, Y., Cell, 23, 175-182 (1981)] and 0.5 x 105 eells/em2 of HllH-7 ancl h~lH-I/e1-2 [Hllh, N. and IJtakoji, T., Gann, 72, 178-179 (1981)] were inoclllatecl ancl transfeeted with 10 ' ' ~4g of pSV2/Hl'oxin ancl variolls amollnts of the above-clescribed reeombinant plasmids by the Ca2~r precipitatioll metllod [Gormall et al., Mol. Cell. Biol., 2, 104 (1982)]. Arter 48 hollrs, the cells were collectecl and the CAT activities were determined. The reslllts are showll in F;ig. I l. As inclieated in the figllres, pSV2/HToxin strongly supplessecl the CAT activity in all the cell lines, and pAF4.9/HToxirl strongly sllppresse~l tlle CAT activity in the AFP hi~hly-prodlleing hepatoma eell line ~[llH-7 (F;g. 1 IA) bllt dicl not sllppress CAT
~ctivity in Illl~I- I/el-2 r ig 1 113) all(l the llon-llepatie cell lines, I-Ie'La (Fig. l lC) or COS7(Fig.llD). pAF4.9 [~2.7'~/~lToxill, lacking the sileneer region, 30 supl)ressed the C~T ~ctivily il~ ~Ill1-1-7 alld hll~l-l/el-~. On the other halld, pAF4.9[~2.7](S)K/~I'roxill havillg 8 copies of silencer sequences sllppressed the 213~9J~L~
CAT activity in HllH-7 (Fig. I IA) bllt not in hllH-I/c1-2 (Fig. llb).
pAF0.2/HToxin lacking the AFP trallscriptiollal reglllatory region except for 200 bp of the promoter region clicl not sllppress the CAT activity in any of thecell lines.
The results show that the HToxin gene can be expressed selectively in AFP highly-prod~lcillg hepatomcl cells by llsing recombinant DNA according to the present invention, sllch as pAF;4.9/HToxill ancl pAF4.9[~2.7~(S)8/HToxin.
The effect of increasing the nlllllber of AFP c1lhancers elements on the expression of the CAT gene was cleterlllille(l to be as follows.
Relative CAT Activity AFP enhancer clomain A I copy 6.8 ~ copies 52.4 AFP enhallcer clolllaill 13 I copy 3.3 3 copies 34 .5 As described above, a recombillallt DNA enters both normal and cancer cells but ca~lses the expression of the linkecl gene selectively in AFP-producing cells. Therefore, the recombirla1lt DNA of the present invelltion can be suitably used as a gene cancer-therape~ltic agent which (lamages or kills AFP-producing cells, e.g. hepatocelllllar carcinolncl~ witho~lt aclversely affecting normal cells.
20 ~ple 10. Generation of sln~u---_c se sllbstitlltion nll.ltations in the AFP
To introcluce single-base mlltaliolls ill PE ancl IvIPE seqllences, an oligonucleoticle-clirectecl in vilro mlltagenesis system version 2 (Amersham) was used. This system was basecl on the metllocl of Eclcsteill ancl coworkers (Taylor 2S et al., 198Sa; 'raylor et al. 1985b; Nakalllaye ancl E~ckstein, 1986; Sayers et al., 1988). Tlle proce~lllre lltilize~l single-stlan~le~l pBS-200 plasmi~l DNA as a tenlplate. Tllis single-strancle(l DNA was hybliclizecl to an oligonllcleoticle primer (spamlillg PE or MPE regiolls) harboring a mlltation at the clesired site.
The primecl single-strandecl pBS-200 plasmicl was thell extended to form the coînplementary strancl. Sllbseq~lently, the wild type strand was removed, and resynthesized llsing the mutallt stralld as template. For this purpose, eight 5 oligonucleotides were syntllesizecl (supplied by 'I'he Regional DNA Synthesis Laboratory, University of Calgaly). To generate point m~ltations in PE, the following oligonucleoticles were llsed as mlltant primers: PE mutant I, PE
mutant II, PE mlltant 111, PE mlltant IV (see Table 3).
To generate pOillt mlltations in MPE, the following oligonucleotides 10 were used as mutant primers: Ml'E mlltant 1, MPE mlltant II, MPE mutant III, and MPE mutant IV (see Table 3). The mlltatecl pBS-200 [PE and MPE]
plasmids were introd~lced into E. coli XL-lBllle host bacteria. In order to obtain the correct mlltatiolls, pBS-200 plasmids prepared from 12 to 48 bacterial colonies were screellecl by sillgle-lane sequellcing. The correct 15 mutants were fultller confirllle(l by seclllellcillg the entire sequences.
3 L~
-~3-List of oligonucleoti~le primers used in this shldy Names SEQ ID Seq~lences (5' to 3') NO:
CAT ¦ 30 dCAACGGTGGTATATCCAGTG
S AdML 31 dACTCATGCCCGC'm'rrGAGA .~:;
~-globin 32 dG'l'GATAGTAGCCTTGTCCTC :
PE mutant I 33 clA l GCTG rGAA rrA rTG
PE mutant II 34 dCTGTrAAGTA':l`TGGCA
PE mutant III 35 ~I T rAATTATGGGCAAAT
RE mutant IV 36 ~IATTATTGGAAAATGTC
MPE mutant I 37 clcAAAAGGTGAcTAGrr MP~ mutant ll 38 dAGGTTACGAGTTAACA
MPB mutant III 39 clTTACTAGTGAACAGGC
MPE mutant IV 4() clCTAGT'rAAAAGGCA'rT
Pr- 169 BgllI 41 dGA'l'CAGA'['C'rrrACAAATAACCGCTATGC
TG
PR - 98 BglII 42 dGArlCAGATCTlTrCAACCTAAGGAAATA
KS 43 dCGAGGTCGACGGTATCG
SK 44 (ITCTAaAACTAGTGGATC
T3 45 clA'FrAACCCTCACrrAAAG
t7 46 clTAATACGACTCACTATAGGG
This mutagenesis create(l pl~smi(l PEII, MPEII and PEII, MPEII which are shown in Fig. 13 (SEQ ID NOS: ~, 5, 13 arl(l 14). The plasmkls were transfected into HuH-7 cells by the metllo(ls of Example 1.
'rhe level oF promotel activity was measllrecl by measllrillg the CAT
~5 activity by the metho(ls ol` Example 1. 'I`he res~llts show that all mutations resllltecl ;n clecreasecl prollloter activity, particlllarly MPEII.
2 ~ 3 ~
Example 11. Generati n of sin;~,le-close s~lbstit~ltion mlltations in the AFP
enhaneer and sileneer reg~iolls.
Wild-type and mlltant enhallcel- an(l silencer elements were synthesized (SIE~OS:8, 15-25) (Fig. 14) ancl inserted into the Bglll site of pAF0.2-CAT.
5 The resulting plasmi(ls were transf`ectecl into HIIH-7 eells by the methods ofExample 1. The level of CAT aetivity was deterlllille(l by the method of F,xample 1. The reslllts hldicate that the wikl-type enllancer elements stimulatecl CAT expression in a higllly dose-~lepell~lellt mallner, i.e., 3 copies of enhaneer elements reslllte~l in abollt a 10-fokl inerease in CAT expression over10 one eopy of enhaneer elemellt. The mlltant enhalleer, on the other halld, showed m~lch less stimlllcltory activity ancl close clependency.
While the present invention hcls been clescribecl with reference to what are presently considere(l to be the prei`erlecl examples, it is to be unclerstood that the invention is not Ihnite~l to ~he disclose(l examples. To the eontrary, the 15 invention is intenclecl to cover variolls mo(lificatiolls ancl equivalent arrangements inclllclecl withill the spirit ancl scope of the appen~lecl elaims.
~ . 2 ~
~5 References The ~ollowing references are cite~l in this appiication at the re]evant portion of the application.
European Patent Applicatioll No. 0 415 731.
S Behringer, R.R., Matthews, L.S.~ Pallniter, R.D. and Brinster, R.L.
1988. Dwarf mice prodllce~l by genetic ab!ation of growth hormone-expressing cells. Genes. Dçve!. 2, 453-461.
/
Berk. P. (ed) ~Seminars in l,iver Disease _ No. 2 Thieme Stratton Inc. NY NY (1984).
Blankenstein, T., Qin, Z., Uberkl, K., Ml~ller, W., Rosen, H., Volk, H.D., ancl Diamantstein, 1. (1991). I`llmor sllppression after tunrlor cell-targeted tlimor necrosis factorgelle tr~nsfer. J Exp. Med., 173, 1047-lS Breitman, M.L., Clapofe, S., Rosant, J., Tsui, L.C., Glode, M., Maxwell, ~.H. an~l Berllstein A. 1987. Genetic ablation: Targeted expression of a tOXill gene CclllSeS IlliCrOplltllallllia ill transgenic mice.
_cience23~, 1563-1565.
Breitman, M.L., Romboll, H., Maxwell, I.~l., Klintworth, G.K. and Bernstein, A. 1990. Genetic ablation in transgenic mice with an attenllate(l dipl-theria ~oxin A Gene. Mol. Cell. Biol. 10, 474-479.
Colombo, M.P., Perrari, a., Stoppacciaro, A., Parenza, M., Roclolfo, M., Mavillo, F., and Parmiani, G. (1991). Gralllllocyte co~ony-stimulating factor gene transfel suppresses t~lmorigenicity of a murine adenocarcinollla in vivo. J. Exp. Me~l., 173, 889-897.
Culver, K.W., Ram, Z., Wallbri~lge, S., Isllii, H., Olclfield, H.O., and Blaese, I~.M. (1992). 11l vivo gene transfer with retrov;ral vector-proclucer cells lor tre~tmellt of experilllelltal brain tllmors. Science, 25~;, 1550-1552.
0 Dubensky, T.W., Campbell, B.A., all~l Villarre~ll, L.P. (1984). Virect transfection of viral an~l plasl~ l DNA illtO the liver or spleen of mice.
Proc. Natl. Aca(l_~Sci. USA, 81, 7529-7533.
Ellis, J. ancl Bernstein, ~. (1989). Gene talgetill~, with retroviral vectors: Reconlbin~ltion by ~ene convelsioll inlo regions of nonl1omology . 1~1. Cel I . 13i()1, 2, 1621 - 1627.
2 ~ 3 ~
-~6-Felgner, P.L. and Rllodes, ~. (1991). Gene ther~pe~ltics. Nature, 349, 351 -352.
Gey, (1952) C~ncer Res. 12:264. ~-Giannini, G., Rapplloli, R. and Ratti, G. 1984. The amillo-aeid sequenee of two non-toxic mlltallts of ~liphtheria toxin: CRM45 ancl CRM197. Nucl. Acicls Res. 12, 4063-4069.
Goring, et al . (1987) Science 235 :456-458.
Gorman, et al. (1982) Mol. Cell. Biol 2: 1044.
Graham, F. an~l van der Eb, A. 1973. A new techniqlle for the assay of infeetivity of hllmall adellovirlls 5 VNA. Viroiogy 52, 456-467.
Greenfield, L., Bjorn, M.J., Horn, C., Follg, D., 13llek, G.A., Collier, R.J., ancl -~aplan, D.A. (1983). Nllcleoticle sequence of the struet-lral gene for cliphtlleria tOXill earrie~l by corynebacteriophage ~'. Proe. Natl.
Aead Sei. USA, 80, 6853-6857.
Gutierrez, A.A., Lelnoine, N.E., an~l Sikora, K. (1992). Gene therapy for eaneer. Lllleet, 332, 715-721.
Friedman, T. (1989). I'rogress towarcl hlmlall gene therapy. Seienee, 224, 1275-1281.
Huang, H.J.S., Yee, J.K., Shew, J.Y., et al. (1988). Sllppression of the neoplastie phellotype by replaeement of the RB gene in hllman eaneer eells. Science, 242, 1563- 1566.
Huber, B.E., Rieharcls, C.A., ancl Krenitsky, T.~. (1991). Retroviral-mecliatecl gene therapy t`or the treatmellt of hepatoeelllllar earcinoma:
An innovative approaeh for cancer therapy. Proe. Natl. Aeacl. Sei~
~, 8~, 8039-80~3.
Huh ancl Utakoji (1981) Gallll 72:178-179.
Ingram, et al., (1981) PNAS 78:4694.
Kaezorek, M., Delpeyrollx` 11., Chellciller, N. Streeek, R.E. (1983).
Nneleoticle seqllence arl(l explessioll of the (liphtlleria ~(~x228 gene in E'~chell~hi(l c(J/i. _eiellcç, 221, 855-858.
Kaltecla, Y., Iwai, K., an(l Uchi~la, 1'. (1989). Inctease~l expression of ~ 2~ 3l~9~
-~17-DNA cointrodllcecl wilh nllcle~r plo~eil- in a~ t r~t liver. Science, 243, 375-378.
Kuriyama, S., Yoshikclwa, M., Ishizaka, S., Tslljii, r., Ikenaka, K., Kagawa, T., Morita, N., ancl Micoshiba, K. (1991). A potential S approach for gene therapy targeting hepatoma llsing a liver-specific promoter on a retroviral vector. Cell Strllc._F Inc. 16, 503-510.
Leone, A., Flatow, IJ., King, C.R., et al. (1991). Reclllced tumour incidence metastatic potentiai an(l cyclok;ne responsivelless of nn23 transfectecl meklnollla cells. Ceil, 65, 25-35.
Lopata, M.A., Clevelancl, D.W. an(l Sollner-Webb, B. 1984. H;gh-Level expression of a chloramphellicol acetyltransFerase gene by DEAE-dextran-mecliatecl DNA transfectioll collplecl with a climethyl sultoxide or glycerol shock treatlnent. Nucl. Aci(ls Res. L2, 5707-.
Masui, H., Kamrath, H., ~pell, G., Houston, L.L., an~l Menclelsohn, J.
(1989). Cytotoxicity agaillst hlllnan t~lmor cells mecliated by the conjugate of anti-epklermall growtll t`actor receptor monoclollal antibody to reeombillallt ricin A chaill. Cancer Res., 49, 3482-3488.
Maxwell, I.H., Maxwell, F., ancl Clo~le, L.M. (1986). Regulatecl expression oF a diphtlleria toxin-A-chain gene transfected into human cells: Possible strategy lor in~lllcing cancer cell s-licicle. Cancer Res., a,6, 4660-466~.
Maxwell, F., Maxwell, I.H., allcl Clode, L.M. (1987). Cloning, sequence, determination, ancl expressioll hl transl`ecte~l cells of the coding sequence for the tox 176 a~tenllate~l ~liplltlleria toxin A chain. Mol. Cell. B , 7, 1576-1579.
Mereer, W.E., Shielcls, M.rr., Lin, D., Appella, E., lJlrich, S.J. (1991).
Growth sllppression in~ ce~l by wikl-type p53 protein is accompanied by selective dowll-reg~lkltioll oF proliFerating-cell nllclear antigen expression. Proc. Natl. Aca~l. Sci. USA, 88, 1958-1962.
30 Miller, A.D. (1992). Hllman gene thelapy comes of age. ~hlre, ~, ~55-~60.
Miller ancl 13aitimore (1986) M~ol,~ln(l Cell. B ol 6:2895-2902.
Miyanohara, A., Sharkey, M.P., Witztllm, J.l.,., Steinberg, D., ancl ~L3~
-~8-Frieclmann, T. (198c.). Ef~ïcient expression of retrovirai vector-transduced h~lMan low clensity lipoproteill (LDL) receptor-deficient rabbit fibroblast in vitro. I'roc. Natl. Aca(l_i llSA, 85, 6538-6542.
Nakabayashi, H., Taketa, K., Miyano, K., Yamalle, T., ancl Sato, J.
(1982). Growth of h~llllclll hepatoma cells lines with differentiated functiolls in chel1licllly (lelinccl me~ ml., Cancer Res., 42, 3858-3863.
Nakabayashi, H., Taketa, K., Yamalle, T., Miyano, K., ancl Sato, J.
(1984). Phenotypical stability of a hllmall hepatoma cell line, HuH-7, ;n ]ong-term clllture with cllemically ~leline~l meclilnn. Japan. J. Cancer Res. (Gann!, 75, 151-158.
Nakabayashi, H., Watanabe, ~C., Saito, A., Ohtsllrll, A., Sawaclaislli, K., and Tamaoki, T. (1989). Transcriptional reg-llation of cx-fetoprotein expression by clexametllasolle in hllman hepatoma cells. J. Biol. Chem., 264, 266-271.
. .- ~- .,~. . . - ` . ~ . . . . . . .
2~ 3~
Nakabayashi, H., Hashil1loto, T., Miyao, T., Tjollg, T., Chan, J., and Tamaoki, r. (1991). A position-clepellclellt silencer plays a rnajor role in repressing cY-t`etoproteill expression in hllman hepatoma. Mol. CelL
Biol., Il, S Nerenstone, et al., Ca!lcer Treat!llent_R_view, 15 1-31 (1988).
Neumann, E., Schacfer-Ri~ler, M., Wang, Y., ancl Hofschneider, P.H.
1982. Gene transfer into mollse Iyoma cells by electroporation in high electric fielcls. EMBOl 1, 841-845.
Otsuru, A., Nagataki, S., ICoji, '1'. an(l 'ralllaoki, '1'. 1988. Analysis of alphafetoprotein gene expressioll in hepatocell~llar carcinoma and liver cirrhosis by In Sitll hybri~li7ation. Cancel 62, 1105- 1112.
Palmiter, R.D., Behringer, R.R., Qllaife, C.J., Maxwell, F., Maxwell, I.H. ancl Brinster, ~L. 1987. Cell lineaye ablation in transgenic mice by cell-specific expression of a toxhl gene. Cell 50, 435-443.
Pappenheimer, A.M. Jr. 1977. Dipl~ eria toxin. Ann. Rev. Biochem.
46, 69-94.
Potter, H., Weirl L. allcl l,e~ler, P, 1984., Enllallcer-clepenclent expression of hlllllall K hnl~ logloblllill genes introducecl into mOIlSe pre-B Iymphocytes by electroporation. Proc. Natl. Acacl. Sci. U.S.A.
81 7161-7165.
Rollins, B. and Sllnday, M. (19.91). Supplessioll of tllmollr formation ln V1VO by expression Or the JE gene hl maligllallt cells. Mol. Cell.
Biol., 11, 3125-3131.
Rosenberg, S.A., Aebersolcl, P., Cornetta, K., Sasicl, A., Morgan, R., Moen, R., Karson, E.M., Lotze, M.T., Yang, J.C., Topalian, S.L., Merino, M.J., Clllver, K., IVliller, D., Blaese, R.M., Anclerson, W.F.
(1990). Gene transr`er illtO hlllllalls-lllllllllllotllerapy of patients with aclvancecl melalloma, ~ISillg tlmlor-illfiltratillg Iymphocytes modifiecl by retroviral gene trans(l~lctioll N. Enyl. J. Mecl., 323, 570-578.
Sawaclaishi, K., Morhlaga, rl~. an(l 'I'amaolci, T. 1988. lnteractiorl of a l1CPatOma-S1)eC jfjC 11llCIeal l;aG~C)I with trallscl iption-reg~llatory seqllences of the hlllllall cY-letol)roteill all(l alt)lllnill genes. Mol. Cell Biol. 8, S179-5187.
r ~
2 ~ 3 ~
-s()-Thorpe, P.E., Wallace, P.M., Kl~o~vvles, P.P., Relf, M.G., Brown, A.N.F., Watson G.J., Blakey, D.C., allcl Newell, D.R. (1988~. Improved antitumor effects of imm~lllotoxills prepare~l with cleglycosylated ricin A-chain and hindeled clislllfi(le linkages. Cancer Res., 48, 6396-6403.
Uchida, T., Pappenheilller, A.M. ~ncl Gre~ally, R. 1973. Diphtheria toxin ancl related proteills. 1. Isolation ancl properties of mutant proteins serologically relate(l to dil)lltlleria toxin. J Biol Chem. 2248, 3838-3844.
Urano, et al. (1984) Gene 32:255-261.
Wallich, R., Blllb~lc, N., Hallllllerli~ J., et al. (1985). Abregat;on of metastatic properties of tllmollr cells by cle novo expression of H2K
antigens following ~12 gene transfection. Natllre, 315, 301-305.
Watanabe, K., Saito, A. an(l Tamaoki, r. 1987. Cell-specific enhancer activity in a fdr llpstlealll region ol a hl~ an c~-fetoprotein gene. J. Biol.
Chem . 262, 4812-4818.
Weatherall, D.J. (1991). Gene thelapy in pcrspective. Natllre, 349, 255-276.
Wilson, J.M., Grossmall, M., Wll, C.H., Chow(lllllry, N.R., Wu, G.Y.~
and Chowdllllry~ J.R. (1992). Hepatocyte-(lirecte(l gene transfer 1n vlvo leads to transient improvemellt ol hypercholesterolemia in low density liproprotein receptor-deficiellt rabbits. J. Biol. Chern, 267, 963-967.
Wilson, J.M., Grossman, M., Cabrercl, J.A., Wll, C.H., an(l Wu C;.Y.
(1992). A novel mechallism for achieving transgelle persistence In vivo after somatic gene trallsl`er into hepatocytes. J. Biol. Chem., 267, 11483-11489.
Wu, C.H., Wilson, J.~l., all(l Wll, G.Y. (1989). 'rargeting genes:
l~elivery an(l persistellt explessiol) ol` a loreigll gene driven by mammalian reglllatory elemellts nl vlvo. J. Biol. Chem., 264, 16985-16987, 30 Yan~, N-S, Bllrtlkllol(ler, J., Roberts B., Martillell, B., an(l McCabe, D.
(1990). 5LI VlVC) alld ill ~5~ gelle trallsfer to malllmaliall somatic cells by particle bonlbal(llllell~ 87, 9568-9572.
Wu, C,~.Y. an(l Wll, C.~l. (1988). Rec~ptor-llle(liate(l gene delivery and expression _l v_! J. 13iQI, C`_c~ '~63, 14621-14624.
~, ., . : : .
.. . . . .
~--`; ` 2 ~
Wu, C3.Y. and W~l, C.H. (1988). Evi(lel~ce for targetecl gene clelivery to Hep G2 Hepatoma eells in VitlO. E~ioehemistrY, 27, 887-892.
Wong, T.K. and Neulllallll, E. 1982. Eleetrie fielcl meclia~ecl gene transfer.
Bioehem. BiophYs. Res. Comm 107, 584-587.
5 Wu, G.Y., Wu, C.~. ancl Rubill, M.L. 1985. Aeetaminophen hepatotoxieity ancl targetecl reselle: A moclel for speeifie ehemotherapy of hepatoeell~llar eareinoma. _lepatology 5, 709-713.
Wu, G.Y. and W~l, C.~l. 1987. Reeeptor-mecliatecl in vitro gene transformation by a soluble DNA elrlier system. J. lBiol. Chem. 262, 4429-4432.
Yamaizllmi, M., Mekacla, E., Uehicla, T. ancl Okacla, Y. 1978. One molecule of cliphtheria toxin fragmellt A intlod~leecl into a cell can kill the cell. Cell L 5, 245-250.
~11 publieations, patellts allcl pa~ent appliea~iolls are herein ineorporated 15 by reference in their entire~ty to the sallle extent ElS if eaeh in(livid~lalpublication, patent or paten~ appliea~ion was speeifieally allcl inclivicl~lallyinclicated to be incorporatecl by referenee in its entirety.
Claims (14)
1. A method of expressing a heterologous gene in a mammalian liver cell comprising inserting a DNA construct into a mammalian liver cell, said construct comprising an AFP enhancer region and an AFP promoter functionally linked to the heterologous gene in the absence of an AFP silencer region, and expressing the heterologous gene in the mammalian liver cells.
2. The method of Claim 1 wherein the construct comprises three or more AFP enhancer regions.
3. A method of killing cells which constitutively express AFP
comprising inserting a DNA construct into a mammalian cell, said construct comprising an enhancer region, an AFP silencer region and a promoter sequence functionally linked to a direct toxin gene and expressing the toxin gene in the mammalian cells under conditions such that the cells which constitutively express AFP are substantially killed.
comprising inserting a DNA construct into a mammalian cell, said construct comprising an enhancer region, an AFP silencer region and a promoter sequence functionally linked to a direct toxin gene and expressing the toxin gene in the mammalian cells under conditions such that the cells which constitutively express AFP are substantially killed.
4. The method of Claim 3 wherein the construct comprises three or more silencer regions.
5. The method of Claim 3 wherein the construct comprises three or more enhancer regions.
6. A isolated mutated silencer region comprising the sequence in Figure 14.
7. An isolated mutated AFP enhancer domain selected from the group consisting of A and B.
8. The isolated mutated AFP enhancer of Claim 7, selected from the group consisting of A1, A2, A3 and A4.
9. The isolated mutated AFP enhancer domain A1 of Claim 8 comprising the sequence in Figure 14.
10. The isolated mutated enhancer domain A2 of Claim 8 comprising the sequence in Figure 14.
11. The isolated mutated enhancer domain A3 of Claim 8 comprising the sequence in Figure 14.
12. The isolated mutated enhancer domain A4 of Claim 8 comprising the sequence in Figure 14.
13. The isolated mutant enhancer domain B of Claim 7 comprising the sequence in Figure 14.
14. An isolated HToxin gene comprising the sequence of Figure 15B.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US08/148,058 US5804407A (en) | 1993-11-04 | 1993-11-04 | Method of expressing genes in mammalian cells |
| US08/148,058 | 1993-11-04 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2134994A1 true CA2134994A1 (en) | 1995-05-05 |
Family
ID=22524063
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002134994A Abandoned CA2134994A1 (en) | 1993-11-04 | 1994-11-03 | Use of the 5' regulatory region of the beta-fetoprotein gene for expressing genes in mammalian cells |
Country Status (2)
| Country | Link |
|---|---|
| US (5) | US5804407A (en) |
| CA (1) | CA2134994A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6254862B1 (en) | 1997-03-03 | 2001-07-03 | Calydon, Inc. | Adenovirus vectors specific for cells expressing alpha-fetoprotein and methods of use thereof |
| US6676935B2 (en) | 1995-06-27 | 2004-01-13 | Cell Genesys, Inc. | Tissue specific adenoviral vectors |
| US7011976B1 (en) | 1997-03-03 | 2006-03-14 | Calydon, Inc. | Adenovirus vectors specific for cells expressing alpha-fetoprotein and methods of use thereof |
| US7157571B2 (en) | 2004-09-30 | 2007-01-02 | Industrial Technology Research Institute | Hepatoma specific chimeric regulatory sequence |
| EP3438125A1 (en) * | 2017-07-31 | 2019-02-06 | Modern Meadow, Inc. | Yeast strains and methods for controlling hydroxylation of recombinant collagen |
Families Citing this family (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6551618B2 (en) | 1994-03-15 | 2003-04-22 | University Of Birmingham | Compositions and methods for delivery of agents for neuronal regeneration and survival |
| US5998205A (en) | 1994-11-28 | 1999-12-07 | Genetic Therapy, Inc. | Vectors for tissue-specific replication |
| US6638762B1 (en) | 1994-11-28 | 2003-10-28 | Genetic Therapy, Inc. | Tissue-vectors specific replication and gene expression |
| US20020068049A1 (en) * | 1998-09-10 | 2002-06-06 | Henderson Daniel R. | Tissue specific adenoviral vectors |
| EP1148779B1 (en) * | 1999-01-06 | 2007-12-12 | Merrimack Pharmaceuticals, Inc. | Expression of secreted human alpha-fetoprotein in transgenic animals |
| US7208576B2 (en) * | 1999-01-06 | 2007-04-24 | Merrimack Pharmaceuticals, Inc. | Non-glycosylated human alpha-fetoprotein, methods of production, and uses thereof |
| AU2001276371A1 (en) * | 2000-06-30 | 2002-01-14 | Epigenomics Ag | Method and nucleic acids for analysing the methylation of genes implicated pharmacogenomics |
| CN100338220C (en) * | 2005-03-28 | 2007-09-19 | 中国人民解放军军事医学科学院野战输血研究所 | Liver highly expression regulating gene sequence and its application |
| DE102005055128B4 (en) * | 2005-11-15 | 2015-04-02 | Universität Rostock | Viral vector, its use for the treatment of hepatocellular carcinoma and pharmaceutical agents comprising the vector |
| US20100115640A1 (en) * | 2007-03-09 | 2010-05-06 | The Curators Of The University Of Missouri | Methods for Conditional and Inducible Transgene Espression to Direct the Development of Embryonic, Embryonic Stem, Precursor and Induced Pluripotent Stem Cells |
| US8865293B2 (en) * | 2008-12-15 | 2014-10-21 | 3M Innovative Properties Company | Optically active materials and articles and systems in which they may be used |
| US20100304873A1 (en) * | 2009-05-28 | 2010-12-02 | Lipa Markowitz | Bowling Ball and Football Game Controller |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8919607D0 (en) * | 1989-08-30 | 1989-10-11 | Wellcome Found | Novel entities for cancer therapy |
| US5206153A (en) * | 1990-06-27 | 1993-04-27 | Snow Brand Milk Products Co., Ltd. | Method of producing human α-fetoprotein and product produced thereby |
-
1993
- 1993-11-04 US US08/148,058 patent/US5804407A/en not_active Expired - Fee Related
-
1994
- 1994-11-03 CA CA002134994A patent/CA2134994A1/en not_active Abandoned
-
1995
- 1995-06-06 US US08/466,604 patent/US5843776A/en not_active Expired - Fee Related
- 1995-06-07 US US08/478,042 patent/US5807738A/en not_active Expired - Fee Related
-
1996
- 1996-05-13 US US08/645,215 patent/US5827686A/en not_active Expired - Fee Related
-
2001
- 2001-04-09 US US09/828,455 patent/US20030104621A1/en not_active Abandoned
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6676935B2 (en) | 1995-06-27 | 2004-01-13 | Cell Genesys, Inc. | Tissue specific adenoviral vectors |
| US6254862B1 (en) | 1997-03-03 | 2001-07-03 | Calydon, Inc. | Adenovirus vectors specific for cells expressing alpha-fetoprotein and methods of use thereof |
| US6585968B2 (en) | 1997-03-03 | 2003-07-01 | Cell Genesys, Inc. | Adenovirus vectors specific for cells expressing alpha-fetoprotein and methods of use thereof |
| US7011976B1 (en) | 1997-03-03 | 2006-03-14 | Calydon, Inc. | Adenovirus vectors specific for cells expressing alpha-fetoprotein and methods of use thereof |
| US7157571B2 (en) | 2004-09-30 | 2007-01-02 | Industrial Technology Research Institute | Hepatoma specific chimeric regulatory sequence |
| US7972851B2 (en) | 2004-09-30 | 2011-07-05 | Industrial Technology Research Institute | Liver specific chimeric regulatory sequence and use thereof |
| EP3438125A1 (en) * | 2017-07-31 | 2019-02-06 | Modern Meadow, Inc. | Yeast strains and methods for controlling hydroxylation of recombinant collagen |
Also Published As
| Publication number | Publication date |
|---|---|
| US5804407A (en) | 1998-09-08 |
| US5807738A (en) | 1998-09-15 |
| US5843776A (en) | 1998-12-01 |
| US5827686A (en) | 1998-10-27 |
| US20030104621A1 (en) | 2003-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US5807738A (en) | Method of expressing genes in mammalian cells | |
| JP4057644B2 (en) | Prostate active tissue-specific enhancer | |
| JP4571306B2 (en) | Use of triplex-structured DNA sequences for introduction of nucleotide sequences | |
| EP0334301B1 (en) | Recombinant retroviruses | |
| JP3755827B2 (en) | Integrable recombinant adenoviruses, their production and their therapeutic use | |
| WO1990007936A1 (en) | Recombinant therapies for infection and hyperproliferative disorders | |
| JP2003265193A (en) | RECOMBINANT p53 ADENOVIRUS | |
| CA2216878A1 (en) | Viral vectors and their use for treating hyperproliferative disorders, in particular restenosis | |
| JPH10507061A (en) | Gene delivery vector and packaging cell line using plasmid DNA packaged in adenovirus | |
| JPH10501686A (en) | AAV-mediated delivery of DNA to cells of the nervous system | |
| CA2257148A1 (en) | Mini-adenoviral vector | |
| ES2202368T3 (en) | RETROVIRAL VECTOR HYBRIDS AND ITS USE FOR GENE TRANSFER. | |
| US20040132679A1 (en) | Induction of pancreatic islet formation | |
| JPH08506722A (en) | Retroviral vectors for treating tumors and cell lines containing them | |
| Gould et al. | Vectors for the treatment of autoimmune disease | |
| CA2176585A1 (en) | Recombinant adenoviruses for gene therapy in cancers | |
| JP2000507229A (en) | Recombinant adenovirus vector for human tumor gene therapy | |
| US20030192066A1 (en) | Minimal adenoviral vector | |
| AU696399B2 (en) | Delivery system controlled through factors associated with HIV and cell | |
| CA2373121A1 (en) | Vector-mediated delivery of integrating transposon sequences | |
| Boulikas | Status of gene therapy in 1997: molecular mechanisms, disease targets, and clinical applications | |
| AU8788998A (en) | Vascular specific regulatory elements contained in the desmin 5' flanking region | |
| KR20010085261A (en) | Methods and compositions useful for modulation of angiogenesis using tyrosine kinase Src | |
| US7267978B1 (en) | Chimeric transcriptional regulatory element compositions and methods for increasing prostate-targeted gene expression | |
| RU2283865C2 (en) | Sequence disposed upstream from carp gene, vector containing the same and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request | ||
| FZDE | Discontinued |