CA2110518C - Ctla4 receptor, fusion proteins containing it and uses thereof - Google Patents

Ctla4 receptor, fusion proteins containing it and uses thereof Download PDF

Info

Publication number
CA2110518C
CA2110518C CA002110518A CA2110518A CA2110518C CA 2110518 C CA2110518 C CA 2110518C CA 002110518 A CA002110518 A CA 002110518A CA 2110518 A CA2110518 A CA 2110518A CA 2110518 C CA2110518 C CA 2110518C
Authority
CA
Canada
Prior art keywords
ctla4
antigen
protein
cells
fusion protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CA002110518A
Other languages
French (fr)
Other versions
CA2110518A1 (en
Inventor
Peter S. Linsley
Jeffrey A. Ledbetter
Nitin K. Damle
William Brady
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bristol Myers Squibb Co
Original Assignee
Bristol Myers Squibb Co
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=24907003&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=CA2110518(C) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Bristol Myers Squibb Co filed Critical Bristol Myers Squibb Co
Priority to CA002580812A priority Critical patent/CA2580812A1/en
Publication of CA2110518A1 publication Critical patent/CA2110518A1/en
Application granted granted Critical
Publication of CA2110518C publication Critical patent/CA2110518C/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70521CD28, CD152
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/02Fusion polypeptide containing a localisation/targetting motif containing a signal sequence
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/32Fusion polypeptide fusions with soluble part of a cell surface receptor, "decoy receptors"
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/866Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof involving immunoglobulin or antibody fragment, e.g. fab', fab, fv, fc, heavy chain or light chain
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10TECHNICAL SUBJECTS COVERED BY FORMER USPC
    • Y10STECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y10S530/00Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof
    • Y10S530/868Chemistry: natural resins or derivatives; peptides or proteins; lignins or reaction products thereof involving autoimmunity, allergy, immediate hypersensitivity, delayed hypersensitivity, immunosuppression, or immunotolerance

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biomedical Technology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Rheumatology (AREA)
  • Pain & Pain Management (AREA)
  • Physics & Mathematics (AREA)
  • AIDS & HIV (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pulmonology (AREA)
  • Microbiology (AREA)

Abstract

The invention identifies the CTLA4 receptor as a ligand for the B7 antigen.
The complete amino acid sequence encoding human CTLA4 receptor gene is provided. Methods are provided for expressing CTLA4 as an immunoglobulin fusion protein, for preparing hybrid CTLA4 fusion proteins, and for using the soluble fusion proteins, fragments and derivatives thereof, including monoclonal antibodies reactive with B7 and CTLA4, to regulate T cell interactions and immune responses mediated by such interactions.

Description

CTL4A RECEPTOR, FUSION PROTEINS CONTAINING IT AND USES THEREOF
FIELD OF THE INVENTION

The present invention relates to expression of the CTLA4 receptor gene, identification of the interaction between the receptor and cells expressing B7 antigen, and to methods for regulating cellular interactions involving the CTLA4 receptor.

BACKGROUND OF THE INVENTION

The hallmark of a vertebrate immune system is the ability to discriminate "self" from "non-self" (foreign).
This property has led to the evolution of a system requiring multiple signals to achieve optimal immune activation (Janeway, Cold Springiarbor Svmta. Ouant. Biol.
54:1-14 (1989)). T cell-B cell interactions are essential to the immune response. Levels of many cohesive moledules found on T cells and B cells increase during an immune response (Springer et al., (1987), &upra; Shaw and Shimuzu, f;urrent Opi nign inImmunoloerv, Eds. Kindt and Long, 1:92-97 (1988)); and Hemler ImmunolM TQdav 9:109-113 (1988)).
Increased levels of these molecules may help explain why activated B cells are more effective at stimulating antigen-specific T cell proliferation than are resting B
cells (Kaiuchi et al., J. Immun ol. 131:109-114 (1983);
Kreiger et al., T. Immunol. 135:2937-2945 (1985); McKenzie, J. Immunol. 141:2907-2911 (1988); and Hawrylowicz and Unanue, J. Immunol. 141:4083-4088 (1988)).

2jj~51g 2 The generation of a T lymphocyte ("T cell") immune response is a complex process involving cell-cell interactions (Springer et al., A. Rev. Immunol. 5:223-252 (1987)), particularly between T and accessory cells such as B cells, and production of soluble immune mediators (cytokines or lymphokines) (Dinarello and Mier, New Enal.
Jour. Med 317:940-945 (1987)). This response is regulated by several T-cell surface receptors, including the T-cell receptor complex (Weiss et al., Ann. Rev. Immunol. 4:593-619 (1986)) and other "accessory" surface molecules (Springer et al., (1987) supra). Many of these accessory molecules are naturally occurring cell surface differentiation (CD) antigens defined by the reactivity of monoclonal antibodies on the surface of cells (McMichael, Ed., Leukocvte Tvoing III, Oxford Univ. Press, Oxford, N.Y.
(1987)).
Antigen-independent intercellular interactions involving lymphocyte accessory molecules are essential for an immune response (Springer et al., (1987), suRjra). For example, binding of the T cell-associated protein, CD2, to its ligand LFA-3, a widely expressed glycoprotein (reviewed in Shaw and Shimuzu, supra), is important for optimizing antigen-specific T cell activation (Moingeon et al., Nature 339:314 (1988)). Another important adhesion system involves binding of the LFA-1 glycoprotein found on lymphocytes, macrophages, and granulocytes (Springer et al., (1987), supra; Shaw and Shimuzu (1988), supra) to its ligands ICAM-1 (Makgoba et al., Nature 331:86-88 (1988)) and ICAM-2 (Staunton et al., a re 339:61-64 (1989)). The T cell accessory molecules CD8 and CD4 strengthen T cell adhesion by interaction with MHC class I (Norment et a1.,Nature 336:79-81 (1988)) and class II (Doyle and Strominger, Nature 330:256-259 (1987)) molecules, respectively. "Homing receptors" are important for control of lymphocyte migration (Stoolman, Cell 56:907-910 (1989)).
The VLA glycoproteins are integrins which appear to mediate lymphocyte functions requiring adhesion to extracellular 3 21105.18 matrix components (Hemler, Su2ra). The CD2/LFA-3, LFA-1/ICAM-1 and ICAM-2, and VLA adhesion systems are distributed on a wide variety of cell types (Springer et al., (1987), supra; Shaw and Shimuzu, (1988,) supra and Hemler, (1988), gld8rsi) -It was proposed many years ago that B lymphocyte activation requires two signals (Bretscher and Cohn, Science 169:1042-1049 (1970)) and now it is believed that all lymphocytes require two signals for their optimal activation, an antigen specific or clonal signal, as well as a second, antigen non-specific signal (Janeway, sgpra).
Freeman et al. (J. Immunol. 143(8):2714-2722 (1989)) isolated and sequenced a cDNA clone encoding a B cell activation antigen recognized by mAb B7 (Freeman et al., J...
Inmunol. 138:3260 (1987)). COS cells transfected with this cDNA have been shown to stain by both labeled mAb B7 and mAb BB-1 (Clark et al., Human Immunol. 16:100-113 (1986);
Yokochi et al., J. Immunol. 128:823 (1981)); Freeman et al.,(1989) supra; and Freedman et al., (1987) ,supra) ).
In addition, expression of this antigen has been detected on cells of other lineages, such as :nonocytes (Freeman et al., sugra). 'a The signals required for a T helper cell (T.) antigenic response are provided by antigen-presenting cells (APC). The first signal is initiated by interaction of the T cell receptor complex (Weiss, J. Clin. Invest, 86:1015 (1990)) with antigen presented in the context of class II
major histocompatibility complex (rIIiC) molecules on the APC
(Allen, Immunol. Today 8:270 (1987)). This antigen-specific signal is not sufficient to generate.a-full response, and in the absence of a second signal may actually lead to clonal inactivation or anergy (Schwartz, science 248:1349 (1990)). The requirement for a second "costimulatory"
signal provided by the rIIiC has been demonstrated in a WO 93/00431 PCI'/US92/05202 number of experimental systems (Schwartz,supra; Weaver and Unanue, Immunol. Today 11:49 (1990)). The molecular nature of these second signal(s) is not completely understood, although it is clear in some cases that both soluble molecules such as interleukin (IL)-1 (Weaver and Unanue, suRra) and membrane receptors involved in intercellular adhesion (Springer, Nature 346:425 (1990)) can provide costimulatory signals.

CD28 antigen, a homodimeric glycoprotein of the immunoglobulin superfamily (Aruffo and Seed, groc. Natl.
Acad. Sci. 84:8573-8577 (1987)), is an accessory molecule found on most mature human T cells (Damle et al., J_.
Immunol. 131:2296-2300 (1983)). Current evidence suggests that this molecule functions in an alternative T cell activation pathway distinct from that initiated by the T-cell receptor complex (June et al., Mol. Cell. Biol.
7:4472-4481 (1987)). Monoclonal antibodies (mAbs) reactive with CD28 antigen can augment T cell responses initiated by various polyclonal stimuli (reviewed by June et al., suvra). These stimulatory effects may result from mAb-induced cytokine production (Thompson et al., Proc. Natl.
Acad. Sci 86:1333-1337 (1989); and Lindsten et al., Science 244:339-343 (1989)) as a consequence of increased mMA
stabilization (Lindsten et al., (1989), Bgpra). Anti-CD28 mAbs can also have inhibitory effects, i.e., they can block autologous mixed lymphocyte reactions (Damle et al., Proc=
Hatl. Acad. Sci. 78:5096-6001 (1981)) and activation of antigen-specific T cell clones (Lesslauer et al., Eur. J.
Immunol. 16:1289-1296 (1986)).

Studies have shown that CD28 is a counter-receptor for the B cell activation antigen, B7/BB-1 (Linsley et al, Proc. Natl. Acad. Sci. USA 87:5031-5035 (1990)). For convenience the B7/BB-1 antigen is hereafter referred to as the "B7 antigen". interactions between CD28 and B7 antigen have been characterized using genetic WO 93/00431 ~ 110 5 PCT/US92/05202 fusions of the extracellular portions of B7 antigen and CD28 receptor, and Immunoglobulin (Ig) C71 (constant region heavy chains) (Linsley et al, J. Exp. Med. 173:721-730 (1991)). Immobilized B7Ig fusion protein, as well as 87 5 positive CHO cells, have been shown to costimulate T cell proliferation. T cell stimulation with B7 positive CHO
cells also specifically stimulates increased levels of transcripts for IL-2. Additional studies have shown that anti-CD28 mAb inhibited IL-2 production induced in certain T cell leukemia cell lines by cellular interactions with a B cell leukemia line (Kohno et al., Cell. Immunol. 131-1-10 (1990)).

CD28 has a single extracellular variable region (V)-like domain (Aruffo and Seed, supra). A homologous molecule, CTLA4 has been identified by differen'tial screening of a murine cytolytic-T cellcDNA library (Brunet et al., a ure 328:267-270 (1987)). Transcripts for this molecule have been found in T cell populations having cytotoxic activity, suggesting that CTLA4 might function in the cytolytic response (Brunet et al., supra; and Brunet et al., Immunol. Rev. 103-21-36 (1988)). Researchers have reported the cloning and mapping of a gene for the human counterpart of CTLA4 (Dariavach et al., Eur. J. Immun0f.
18:1901-1905 (1988)) to the same chromosomal region (2q33-34) as CD28 (Lafage-Pochitaloff et al., Immunoaenetics 31:198-201 (1990)). Sequence comparison between this human CTLA4 DNA and that encoding CD28 proteins reveals significant homology of sequence, with the greatest degree of homology in the juxtamembrane and cytoplasmic regions (Brunet et al., 1988, gunra; Dariavach et al., 1988, The high degree of homology between CD28 and CTLA4, together with, the co-localization of their genes, raises questions as to whether these molecules are also functionally related. However, since the protein product of CTLA4 has not yet been successfully expressed, these questions remain unanswered.

Expression of soluble derivatives of cell-surface glycoproteins in the immunoglobulin gene superfamily has been achieved for CD4, the receptor for HIV-1, and CD28 and B7 receptors, using hybrid fusion molecules consisting of DNA sequences encoding amino acids corresponding to portions of the extracellular domain of CD4 receptor fused to antibody domains (immunoglobulin -yi (Capon et al., Nature 337:525-531 (1989) (CD4) and Linsley et al., J. Exn.
Med., supra (CD28 and B7)).

It would be useful to obtain expression of a soluble protein product of the heretofore unexpressed CTLA4 gene, and to identify a natural ligand for CTLA4 that is involved in functional responses of T cells. The soluble protein product could then be used to regulate T cell responses in vivo to treat pathological conditions.
SUMMARY OF THE INVENTION

Accordingly, the present invention provides the complete and correct DNA sequence encoding the amino ac!id sequence corresponding to the CTLA4 receptor protein, and identifies B7 antigen as a natural ligand for the CTLA4 receptor. The invention also provides a method for expressing the DNA'as a CTLA4 immunoglobulin (Ig) fusion protein product. Embodiments of the invention include CTLA4Ig fusion protein, and hybrid fusion proteins including CD28Ig/CTLA4Ig fusion proteins. Also provided are methods for using the CTLA4 fusion protein, B71g fusion protein, hybrid fusion proteins, and fragments and/or derivatives thereof, such as monoclonal antibodies reactive with CTLA4 and the B7 antigen, to regulate cellular interactions and immune responses.
The human CTLA receptor protein of the invention is encoded by 187 amino acids and includes a newly identified N-linked glycosylation site.

The CTLA4Ig fusion protein of the invention binds the B7 antigen expressed on activated B cells, and cells of other lineages, a ligand for CD28 receptor on T cells. The CTLA4Ig binds B7 antigen with significantly higher affinity than B7 binding to the CD28 receptor. The CTLA4Ig construct has a first amino acid sequence corresponding to the extracellular domain of the CTLA4 receptor fused to a second amino acid sequence corresponding to the human Ig C71 domain. The first amino acid sequence contains amino acid residues from about position 1 to about position 125 of the amino acid sequence corresponding to the extracellular domain of CTLA4 joined to a second amino acid sequence containing amino acid residues corresponding to the hinge, CH2 and CH3 regions of human IgC71. The fusion protein is preferably produced in dimeric form. Soluble CTLA4Ig is a potent inhibitor in vitro of T and B
lymphocyte responses.

Also contemplated in the invention are hybrid fusion proteins such as CD28Ig/CTLA4Ig fusion protei'hs having a first amino acid sequence corresponding to fragments of the extracellular domain of CD28 joined to a second amino acid sequence corresponding to fragments of the extracellular domain of CTLA4Ig and a third amino acid sequence corresponding to the hinge, CH2 and CH3 regions of human IgCyl. One embodiment of the hybrid fusion proteins is a CD28Ig/CTLA4Ig fusion construct having a first amino acid sequence containing amino acid residues from about position 1 to about position 94 of the amino acid sequence corresponding to the extracellular domain of CD28, joined a second amino acid sequence containing amino acid residues from about position 94 to about position 125 of the amino acid sequence corresponding to the extracellular domain of WO 93/00431 PC1'/US92/05202 2~ 1051g 8 CTLA4, joined to a third amino acid sequence containing amino acids residues corresponding to the hinge, CH2 and CH3 regions of human IgC7l.

Also included in the invention is a method for regulating T cell interactions with other cells by inhibiting the interaction of CTLA4-positive T cells with B7 positive cells by reacting the T cells with ligands for the CTLA4 receptor. The ligands include B71g fusion protein, a monoclonal antibody reactive with CTLA4 receptor, and antibody fragments.

The invention also provides a method for regulating T cell interactions with B7 positive cells, using a ligand for the B7 antigen. Such a ligand is ther CTLA4Ig fusion protein of the invention, its fragments or derivatives, the CD28Ig/CTLA4Ig fusion protein hybrid, or a monoclonal antibody reactive with the B7 antigen.
The invention further includes a method for treating immune system diseases mediated by T cell interactions with B7 positive cells by administering a ligand reactive with B7 antigen to regulate T ceell interactions with B7 positive cells. The ligand is the - CTLA4Ig fusion protein, or the CD28Ig/CTLA4Ig fus.ion protein hybrid, or a monoclonal antibody reactive with B7 antigen.

A ukonoclonal antibody reactive with the CTI.A4Ig fusion protein and a monoclonal antibody reactive with CD28Ig/CTLA4Ig fusion protein are described for use in regulating cellular interactions.

A novel Chinese Hamster Ovary cell line stably expressing the CTLA4Ig fusion protein is also disclosed.

8a A first aspect of the invention provides for an isolated CTLA4 receptor protein having the amino acid sequence depicted in SEQ ID NO:14.
A second aspect of the invention provides for An isolated soluble CTLA4 protein which binds a B7 antigen comprising the the extracellular domain of CTLA4 of SEQ ID
NO:14 beginning with alanine at position 1 and ending with aspartic acid at position 125.
A third aspect of the invention provides for an isolated CTLA4 protein which binds a 37 antigen expressed on activated B cells, comprising the 187 amino acids shown in SEQ
ID NO:14 beginning with alanine at position 1 and ending with asparagine at position 187.
A fourth aspect of the invention provides for an isolated soluble CTLA4 protein having the extracellular domain of CTLA4, as shown in SEQ ID No.: 14 beginning with alanine at position 1 and ending with aspartic acid at position 125, or a fragment thereof which binds a B7 antigen, which protein binds a B7 antigen expressed on activated B cells.
A fifth aspect of the invention provides for an isolated CTLA4 protein which binds a B7 antigen comprising the amino acids shown in SEQ ID NO:14 beginning with alanine at position 1 and ending with asparagine at position 187.
A sixth aspect of the invention provides for A
CTLA4Ig fusion protein which binds a B7 antigen, said protein having a first amino acid sequence comprising the extracellular domain of CTLA4, as shown in SEQ ID No.: 14 beginning with alanine at position 1 and ending with aspartic acid at position 125, or a fragment thereof which binds a 37 antigen, and a second amino acid sequence comprising the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
A seventh aspect of the invention provides for a CTLA4Ig fusion protein which binds a B7 antigen, said protein having (a) a first amino acid sequence beginning with alanine at amino acid position 1 and ending with aspartic acid at 8b amino acid position 125 of SEQ ID NO:14 or a portion thereof which binds a B7 antigen and (b) a second amino acid sequence comprising the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
An eighth aspect of the invention provides for A
CD281g/CTLA41g fusion protein hybrid which binds a B7 antigen, said fusion hybrid comprising a first amino acid sequence corresponding to a portion of the extracellular domain of CD28 receptor fused to a second amino acid sequence corresponding to a portion of the extracellular domain of CTLA4 receptor of SEQ. ID NO: 14 beginning with lysine at amino acid position 94 and ending at aspartic acid at amino acid position 125, and a third amino acid sequence corresponding to the hinge, CH2 and CH3 regions of immunoglobulin Cgammal molecule.
A ninth aspect of the invention provides for A
CTLA4Ig fusion protein reactive with a B7 antigen and produced by DNA deposited as ATCC 68629, wherein the DNA comprises (a) a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID
NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.

A tenth aspect of the invention provides for A
CTLA4Ig fusion protein expressed by a cell deposited as ATCC
Accession No. 10762 and wherein the cell comprises a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 and a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.

A further aspect of the invention provides for A
CTLA4Ig fusion protein produced by a method comprising growing a host vector system, which system comprises a vector having DNA in an eukaryotic cell so as to produce the CTLA4Ig fusion protein in the host and recovering the CTLA4Ig fusion protein so produced, the DNA comprising (a) a first nucleic acid sequence beginning with guanine at position 1 and ending with 8c cytosine at position 375 of SEQ ID NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.

A further aspect of the invention provides for a CTLA4Ig fusion protein produced by a method comprising growing a Chinese Hamster Ovary cell comprising a vector having DNA
so as to produce the CTLA4Ig fusion protein in the CHO cell and recovering the CTLA4Ig fusion protein so produced, the DNA
comprising a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.

A still further aspect of the invention provides for a DNA molecule comprising a sequence encoding the amino acid sequence of a CTLA4Ig fusion protein reactive with B7 antigen and having ATCC No. 68629, wherein the DNA sequence comprises (a) a first nucleotide sequence encoding an extracellular domain of CTLA4 beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:l3 or portion thereof which binds a B7 antigen, and (b) a second nucleotide sequence encoding the hinge, CH2 and CH3 of an immunoglobulin molecule.

A still further aspect of the invention provides for an in vitro method for regulating functional CTLA4 positive T cell interactions with B7 positive cells comprising contacting the B7 positive cells with a ligand for a B7 antigen, in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4 molecule.

A still further aspect of the invention provides for the use of a ligand for a B7 antigen, for treating an immune system disease mediated by T-cell interactions with B7-positive cells, said ligand being for contact with the B7 8d positive cells in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4 protein.

A still further aspect of the invention provides for the use of a ligand for a B7 antigen for regulating functional T cell interactions with B7 positive cells, said ligand being for contact with the B7 positive cells in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4.

Yet a further aspect of the invention provides for the use of a ligand for a 37 antigen, for treating an immune system disease mediated by T-cell interactions with 37-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is a CTLA4Ig fusion protein.

Yet a further aspect of the invention provides for the use of a ligand for a B7 antigen, for regulating functional T-cell interactions with B7-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is a CTLA4Ig fusion protein.

A still further aspect of the invention provides for A Chinese Hamster Ovary cell line having an ATCC No. 10762 and stably expressing CTLA41g fusion protein.

WO 93/00431 2 ~f 1 .0'5 1'$ PCT/US92/05202 9 :!

$RIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a diagrammatic representation of CTLA4Ig fusion constructs as described in Example 2, infra.
Figure 2 is a photograph of a gel obtained from SDS-PAGE chromatographic purification of CTLA4Ig as described in Example 2, infra.

Figure 3 depicts the complete amino acid sequence encoding human CTLA4 receptor (SEQ ID NOs: 13 and 14) fused to the oncostatin M signal peptide (position -25 to -1), and including the newly identified N-linked glycosylation site (position 109-111), as described in Example 3, infra.
Figure 4 depicts the results of FACSR analysis of binding of the B71g fusion protein to CD28- and CTLA4-transfected COS cells as described in Example 4, infra.
Figure 5 depicts the results of FACSR analysis of binding of purified CTLA4Ig on B7 antigen-positive (B7') CHO
cells and on a lymphoblastoid cell line (PM LCL) as described in Example 4, infra.
Figure 6 is a graph illustrating competition binding analysis of '25I labeled B71g to immobilized CTLA4Ig as described in Example 4, infra.

Figure 7 is a graph showing the results of Scatchard analysis of 125I-labeled B7Ig binding to immobilized CTLA4Ig as described in Example 4, infra.

Figure 8 is a photograph of a gel from SDS-PAGE
chromatography of immunoprecipitation analysis of B7 positive CHO cells and PM LCL cells surface-labeled with 125I
as described in Example 4, infra.

WO 93/00431 PCi'/US92/05202 21~0518 10 Figure 9 is a graph depicting the effects on proliferation of T cells of CTLA4Ig as measured by [3H]-thymidine incorporation as described in Example 4, infra.

Figure 10 is a bar graph illustrating the effects of CTLA4Ig on helper T cell (Th)-induced immunoglobulin secretion by human B cells as determined by enzyme immunoassay (ELISA) as described in Example 4, infra.

pETAILED DESCRIPTION OF THE INVENTION

In order that the invention herein described may be more fully understood, the following description.is set forth.
This invention is directed to the isolation and expression of the human CTLA4 receptor found on T cell surfaces, which binds to the B7 antigen expressed on activated B cells, and cells of other lineages, and to expression of soluble fusion protein products of the CTLA4 receptor gene. The invention also provides methods for using the expressed CTLA4 receptor to regulate cellular interactions, including T cell interactions with B7 positive cells.
In a preferred embodiment, the complete and correct DNA sequence encoding the amino acid sequence corresponding to human CTLA4 receptor protein of the invention is cloned using PCR. The cDNA containing the complete predicted codi'ng sequence of CTLA4 was assembled from two PCR fragments amplified from H38 RNA, and inserted into the expression vector, CDMB as described in detail in the Examples, infra. Isolates were transfected into COS
cells and tested for binding of B71g, a soluble- fusion protein having an amino.acid sequence corresponding to the extracellular domain of B7 and a human immunoglobulin (Ig) C7l region, as described by Linsley et al., J. EXp. Med.

11 (,~~~U~~O
173:721-730 (1991).

The DNA sequence of one isolate, designated as OMCTLA4, was then determined and found to correspond exactly to the predicted human CTLA4 seqiuence, fused at the N-terminus to the signal peptide from oncostatin M. The CTLA4 receptor is encoded by 187 amino acids (exclusive of the signal peptide and stop codons) and includes a newly identified N-linked glycosylation site at amino acid positions 109-111 (see Figure 3, infra). The CTLA4 receptor is expressed using the oncostatin M signal peptide.

In another preferred embodiment, soluble forms of the protein product of the CTLA4 receptor gene (CTLA4Ig) are prepared using fusion proteins 'having a first ainino acid sequence corresponding to the extracellular domain of CTLA4 and a second amino acid sequence corresponding to the human IgCyl domain. Cloning and expression plasmids (CDM8 and nLN) were constructed containing cDNAs encoding portions of the amino acid sequence corresponding to human CTLA4 receptor based on the cDNA sequence described herein, where the cDNA encoding a first amino acid sequence corresponding to a fragment of the extracellular domain=of the CTLP.4 receptor gene is joined to DNA encoding a second amino acid sequence corresponding to an IgC region that permits the expression of the CTLA4 receptor gene by altering the solubility of the expressed CTLA4 protein.
Thus, soluble CTLA4Ig fusion protein is encoded by a first amino acid sequence containing amino acid residues from about position 1 to about position 125 of the amino acid sequence corresponding to the extracellular domain of CTLA4 joined to a second amino acid sequence containing amino acid residues corresponding to the hinge, CH2 and CH3 regions of human IgC71. The fusion protein is preferably produced in dimeric form. The construct was then transfected into COS or CHO cells, and CTLA4Ig was purified and identified as a dimer.

DNA encoding the amino acid sequence corresponding to the CTLA4Ig fusion protein has been deposited with the American Type Culture Collection (ATCC) in Rockville, Maryland, under the provisions of the Budapest Treaty on May 31, 1991 and has been accorded ATCC
accession number: 68629.

The present invention provides the first protein product of CTLA4 transcripts in the form of a soluble fusion protein. The CTLA4Ig protein forms a disulfide-linked dimer of M. of approximately 50,000 subunits, indicating that native CTLA4 probably exists on the T cell surface as a disulfide-linked homodimer.

B7 antigen has been shown to be a ligand for CD28 receptor on T cells (Linsley et al., Proc. Natl. Acad. Sci.
USA, supra). The CTLA4 receptor molecule appears functionally and structurally related to the CD28 receptor;
both are receptors for the B cell activation antigen, B7, while CTLA4 appears to have higher affinity for B7, among the highest yet reported for lymphoid adhesion systems.
However, CTLA4Ig was shown to bind more strongly to,JB7 positive (B7')=cell lines than CD28Ig. Other experiments demonstrated that CTLA4 is a higher affinity receptor for B7 antigen than CD28 receptor. Additionally, CTLA4Ig was shown to bind a single protein on lymphoblastoid cells which is similar in size to the B7 antigen. CTLA4Ig inhibited T cell proliferation and inhibited Tg induced IgM
production.

In another preferred embodiment, hybrid fusion proteins having amino acid sequences corresponding to fragments of different receptor proteins were constructed.
For example, amino acid sequences corresponding to selected fragments of the extracellular domains of CD28 and CTLA4 were linked to form CD28Ig/CTLA4Ig hybrid fusion proteins.
Thus, a CD28Ig/CTLA4Ig fusion protein was obtained having a first amino acid sequence containing amino acid residues corresponding to a fragment of the extracellular domain of CD28 joined to a second amino acid sequence corresponding to a fragment of the extracellular domain of CTLA4Ig and to a third amino acid sequence corresponding to the hinge, CH2 and CH3 regions of human IgC-yl. One embodiment of the hybrid fusion proteins is a.CD28Ig/CTLA4Ig fusion construct having a first amino acid sequence containing amino acid residues from about position 1 to about position 94 of the amino acid sequence corresponding to the extracellular domain of CD28, joined to a second amino acid sequence containing amino acid residues from about position 94 to about position 125 of the amino acid sequence corresponding to the extracellular domain of CTLA4, joined to a third amino acid sequence corresponding to the hinge, CH2 and CH3 regions of human IgCyi.

The techniques for cloning and expressing DNA
sequences encoding the amino acid sequences corresponding to the CTLA4 receptor protein, soluble fusion proteins and hybrid fusion proteins, e.g synthesis of oligonucleotides, PCR, transforming cells, constructing vectors, expression systems, and the like are well-established in the art, and most practitioners are familiar with the standard resource materials for specific conditions and procedures. However, the following paragraphs are provided for convenience and notation of modifications where necessary, and may serve as a guideline.

CloniLna and Exoression of Coding Sequencgs for Recgptors and Fusion Proteins Fusion protein constructs corresponding to CD28IgCy1 and B7IgCy1 for characterizing the CTLA4Ig of the present invention, and for preparing CD28Ig/CTLA4Ig fusion hybrids, were prepared as described by Linsley et al., Exp. Med. 173:721-730 (1991). Alternatively, cDNA clones may be prepared from RNA obtained from cells expressing B7 antigen and CD28 receptor based on knowledge of the published sequences for these proteins (Aruffo and Seed, and Freeman, supra) using standard procedures.

CTLA4Ig fusions consisting of DNA encoding amino acid sequences corresponding to the extracellular domain of CTLA4 and the hinge, CH2 and CH3 regions of human IgGyi were constructed by ligation of PCR fragments. The cDNA
encoding the amino acid sequences is amplified using the polymerase chain reaction ("PCR") technique (see U.S.
Patent Nos. 4,683,195 and 4,683,202 to Mullis et al. and Mullis & Faloona, Methods Enzymol. 154:335-350 (1987)).
CTLA4Ig fusion polypeptides were obtained having DNA
encoding amino acid sequences containii-g amino acid residues from about position 1 to about position 125 of the amino acid sequence corresponding to the extracellular domain of CTLA4 and DNA encoding amino acid sequences corresponding to the hinge, CH2 and CH3 regions of Ig Cyl.

Because the expression of CTLA4 receptor protein in human lymphoid cells has not been previously reported, it was necessary to locate a source of CTLA4 mRNA. PCR
cDNA made from the total cellular RNA of several human leukemia cell lines was screened, using as primers, oligonucleotides from the published sequence of the CTLA4 gene (Dariavach et al., pupra). Of the cDNA tested, H38 cells (an HTLV II-associated leukemia line) provided the best yield of PCR products having the expected size. Since a signal peptide for CTLA4 was not identified in the CTLA4 gene, the N terminus of the predicted sequence of CTLA4 was fused to the signal peptide of oncostatin M (Malik et al., Molec. and Cell. Biol. 9:2847 (1989)) in two steps using oligonucleotides as described in the Examples, infra. The WO 93/00431 15 8PCT/L)S92/05202 product of the PCR reaction was ligated with cDNA encoding the amino acid sequences corresponding to the hinge, CH2 and CH3 regions of Ig Cyl into a expression vector, such as CDM8 or nLN.
To obtain DNA encoding full length human CTLA4, a cDNA encoding the transmembrane and cytoplasmic domains of CTLA4 was obtained by PCR from H38 cells and joined with a fragment from CTLA4Ig, obtained as described above, encoding the oncostatin M signal peptide fused to the N
terminus of CTLA4, using oligonucleotide primers as described in the Examples, infra. PCR fragments were ligated into the plasmid CDMB, resulting in an expression plasmid encoding the full length CTLA4 gene, and designated OMCTLA4.

For construction of DNA encoding the amino acid sequence corresponding to hybrid fusion proteins, DNA
encoding amino acids corresponding to portions of the extracellular domain of one receptor gene is joined to DNA
encoding amino acids corresponding to portions of the extracellular domain of another receptor gene, and to DNA
encoding the amino acid sequences corresponding to the .*
hinge, CH2 and CH3 regions of human IgCyl using procedures as described above for the B7Ig, CD28Ig and CTIA4Ig constructs. Thus, for example, DNA encoding amino acid residues from about position 1 to about position 94 of the amino acid sequence corresponding to the extracellular domain of the CD28 receptor is joined to DNA encoding amino acid residues from about position 94 to about position 125 of the amino acid sequence corresponding to the extracellular domain of the CTLA4 receptor and to DNA
encoding the amino acid sequences corresponding to the hinge, CH2 and CH3 regions of human IgCyl.

To produce large quantities of cloned DNA, WO 93/00431 PCI'/US92/05202 21l0518 16 vectors containing DNA encoding the fusion constructs of the invention are transformed into suitable host cells, such as the bacterial cell line E. coli strain MC1061/p3 (Invitrogen Corp., San Diego, CA) using standard procedures, and colonies are screened for the appropriate plasmids.

The clones containing DNA encoding fusion constructs obtained as described above are then transfected into suitable host cells for expression. Depending on the host cell used, transfection is performed using standard techniques appropriate to such cells. For example, transfection into mammalian cells is accomplished using DEAE-dextran mediated transfection, CaPO4 co-precipitation, lipofection, electroporation, or protoplast fusion, and other methods known in the art including: lysozyme fusion or erythrocyte fusion, scraping, direct uptake, osmotic or sucrose shock, direct microinjection, indirect microinjection such as via erythrocyte-mediated techniques, and/or by subjecting host cells to electric currents. The above list of transfection techniques is not considered to be exhaustive, as other procedures for introducing genetic information into cells will no doubt be developed.

,e Expression in eukaryotic host cell cultures derived from multicellular organisms is preferred (see Tissue Cuitures, Academic Press, Cruz and Patterson, Eds.
(1973)). These systems have=the additional advantage of the ability to splice out introns and thus can be used directly to express genomic fragments. Useful host cell lines include Chinese hamster ovary (CHO), monkey kidney (COS), VERO and HeLa cells. In the present invention, cell lines stably expressing the fusion constructs are preferred.
Expression vectors for such cells ordinarily include promoters and control sequences compatible with mammalian cells such as, for example, CMV promoter (CDM8 vector) and avian sarcoma virus (ASV) (rrLN vector). Other commonly used early and late promoters include those from Simian Virus 40 (SV 40) (Fiers, et al., Nature 273:113 (1973)), or other viral promoters such as those derived from polyoma, Adenovirus 2, and bovine papilloma virus.
The controllabl'e promoter, hMTII (Karin, et al., Nature 299:797-802 (1982)) may also be used. General aspects of mammalian cell host system transformations have been described by Axel (U.S. Patent No. 4,399,216 issued Aug.
16, 1983). It now appears, that "enhancer" regions are important in optimizing expression; these are, generally, sequences found upstream or downstream of the promoter region in non-coding DNA regions. Origins of replication may be obtained, if needed, from viral sources. However, integration into the chromosome is a.common mechanism.for DNA replication in eukaryotes.

Although preferred host cells for expression of the fusion constructs include eukaryotic cells such as COS
or CHO cells, other eukaryotic microbes may be used as hosts. Laboratory strains of Saccharomyces cerevisiae, Baker's yeast, are most used although other strains such as Schizosaccharomyces pombe may be used. Vectors employing, for example, the 2A origin of replication of Broach, Meth.
Enz. 101:307 (1983), or other yeast compatible origins of replications (see, for example, Stinchcomb et al., Nature 282:39 (1979)); Tschempe et al., gene 10:157 (1980); and Clarke et al., Meth. Enz. 101:300 (1983)) may be used.
Control sequences for yeast vectors include promoters for the synthesis of glycolytic enzymes (Hess et al., v.
Enzyme Rea. 7:149 (1968); Holland et al., DS.ochemistrv 17:4900 (1978)). Additional promoters known in the art include the CMV promoter provided in the CDMB vector (Toyama and Okayama, FEBS 268:217-221 (1990); the promoter for 3-phosphoglycerate kinase (Hitzeman et al., J. Biol.
Chem. 255:2073 (1980)), and those for other glycolytic 1s enzymes. ther promoters, which have the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and enzymes responsible for maltose and galactose utilization. It is also believed terminator sequences are desirable at the 31 end of the coding sequences. Such terminators are found in the 3' untranslated region following the coding sequences in yeast-derived genes.

Alternatively, prokaryotic cells may be used as hosts for expression. Prokaryotes most frequently are represented by various strains of E. coli; however, other microbial strains may also be used. Commonly used prokaryotic control sequences which are defined herein to include promoters for transcription initiation, optionally with an operator, along' with ribosome binding site sequences, include such commonly used. promoters as the 20= beta-lactamase (penicillinase) and lactose (lac) promoter systems (Chang et al., Nature 198: 1056 (1977)), the tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. 8:4057 (1980)) and the lambda derived PL promoter and N-gene ribosome binding site (Shimatake et al., Nature 292:128 (1981)). =' The nucleotide sequences encoding CD28Ig and CTLA4Ig proteins, and fusion hybrid proteins such as CD28Ig/CTLP,4Ig, may be expressed in a variety of systems as set forth below. The cDNA may be excised by suitable restriction enzymes and ligated into suitable prokaryotic or eukaryotic expression vectors for such expression.
Because CD28 and CTLA4 receptor proteins occur in nature as dimers, it is believed that successful expression of these proteins requires an expression system which permits these proteins to form as dimers. Truncated versions of these proteins (i.e. formed by introduction of a stop codon into ~

the sequence at a position upstream of the transmembrane region of the protein) appear not to be expressed. The expression of CD28 and CTLA4 receptors as fusion proteins permits dimer formation of these proteins. Thus, expression of CTLA4 protein as a fusion product is preferred in the present invention.

A stable CHO line of the invention, designated Chinese Hamster Ovary Cell Line CTLA4Ig-24, is preferred for expression of CTLA4Ig and has been deposited with the ATCC under the terms of the Budapest Treaty on May 31, 1991, and accorded ATCC accession number 10762.

Expression of the CTLA4 receptor of the- invention is accomplished transfecting a cell line such as COS cells, and detecting expression by binding of the CTLA4-transfected cells to a ligand for.the CTLA4 receptor, for example by testing for binding of the cells to B7Ig fusion protein.
Sequences of the resulting constructs are confirmed by DNA sequencing using known procedures, for example as described by Sanger-et al., Proc. Natl. Acad.
Sci. USA 74:5463 (1977), as further described by Messing et al., Nucleic Acids Res. 9:309 (1981), or by the method of Maxam et al. Methods Enzymol. 65:499 (1980)).

Recovery of Protein Products As noted above, CD28 and CTLA4 receptor genes are not readily expressed as mature proteins using direct expression of DNA encoding the truncated protein. To enable homodimer formation, DNA encoding the amino acid sequence corresponding to the extracellular domains of CD28 and CTLA4, and including the codons for a signal sequence such as that of oncostatin M in cells capable of appropriate processing, is, fused with, DNA encoding the amino a~l lO~sequece corresponding to the Fc domain of a naturally dimeric protein. Purification of these fusion protein products after secretion from the cells is thus facilitated using antibodies reactive with the anti-immunoglobulin portion of the fusion proteins. When secreted into the medium, the fusion protein product is recovered using standard protein purification techniques, for example by application to protein A columns.

USE

CTLA4Ig fusion protein and/or fragments of the fusion protein may be used to react with B7 positive cells, such as B cells, to regulate immune responses mediated by T cell interactions with the B7 antigen positive cells.
CTLA4Ig fusion protein and CTLA4Ig/CD28Ig hybrid proteins, and/or fragments and derivatives of these proteins, may also be used to react with B7 positive cells, including B cells, to regulate immune responses mediated by T cell dependent B cell responses. The term "fragment" as used herein means a portion of the amino acid sequence encoding the protein referred to as "CTLA4" . A fragment of the CTLA4Ig fusion protein that may be used is'ra polypeptide having an amino acid sequence corresponding to some portion of the amino acid sequence corresponding. to the CTLA4 receptor used to obtain the CTLA4Ig fusion protein as described herein.

The B7 antigen expressed on activated B cells and cells of other lineages, and the CD28 receptor expressed on T cells, can directly bind to each other, and this interaction can mediate cell-cell interaction. Such interactions directly trigger the CD28 activation pathway in T cells, leading to cytokine production, T cell proliferation, and B cell differentiation into immunoglobulin producing cells. The activation of B cells that occurs, can cause increased expression of B7 antigen and further CD28 stimulation, leading to a state of chronic inflammation such as in autoimmune diseases, allograft rejection, graft versus host disease or chronic allergic reactions. Blocking or inhibiting this reaction may be effective in preventing T cell cytokine production and thus preventing or reversing inflammatory reactions.

CTLA4Ig is shown herein to be a potent inhibitor of in vitro lymphocyte functions requiring T and B cell interaction. This indicates the importance of interactions between the B7 antigen and its counter-receptors, CTLA4 and/or CD28. The cytoplasmic domains of murine and human CTLA4 are similar (Dariavach et al., ~u ra, 1988), suggesting that this region has important functional properties. The cytoplasmic domains of CD28 and CTLA4 also share homology.

CTLA4 is a more potent inhibitor in vitro of lymphocyte responses than either anti-BB1, or anti-CD28 mAbs. CTLA4Ig does not have direct stimulatory effects on T cell proliferation to=counteract its inhibitory effects.
Therefore, the CTLA4Ig fusion protein may perform as a better inhibitor in vivo than anti-CD28 monoclo.nal antibodies. The immunosuppressive effects of CTLA4Ig in vitro suggests its use in therapy for treatment of autoimmune disorders involving abnormal T cell activation or Ig production.

The CTLA4Ig fusion protein is expected to exhibit inhibitory properties in vivo. Thus, it is expected that CTLP.4Ig will act to inhibit-T cells in a manner similar to the effects observed for the anti-CD28 antibody, under similar conditions in vIvo. Under conditions where T
cell/B cell interactions are occurring as a result of contact between T cells and B cells, binding of introduced CTLA4Ig to react with B7 antigen positive cells, for WO 93/00431 P(.'I'/US92/05202 ~rl 22 example B cells, may interfere, i.e. inhibit, the T cell/B
cell interactions resulting in regulation of immune responses. Because of this exclusively inhibitory effect, CTLA4Ig is expected to be useful in vivo as an inhibitor of T cell activity, over non-specific inhibitors such as cyclosporine and glucosteroids.

In one embodiment, the CTLA4Ig fusion protein or CTLA4Ig/CD28Ig hybrid proteins, may be introduced in a suitable pharmaceutical carrier in vivo, i.e. administered into a human subject for treatment of pathological conditions such as immune system diseases or cancer.
Introduction of the fusion protein in vivo is expected to result in interference with T cell interactions with other cells, such as B cells, as a result of binding of the ligand to B7 positive cells. The prevention of normal T
cell interactions may result in decreased T cell activity, for example, decreased T cell proliferation. In addition, administration of the fusion protein in vivo is expected to result in regulation of in vivo levels of cytokines, including, but not limited to, interleukins, e.g.
interleukin ("IL")-2, IL-3, IL-4, IL-6, IL-8, growth factors including tumor growth factor ("TGF"), colony stimulating factor ("CSF"), interferons ("IFNs"), and tumpr necrosis factor ("TNF") to promote desired effects in a subject. For example, when the fusion protein is introduced in vivo, it may block production of cytokines, which contribute to malignant growth, for example of tumor cells. The fusion protein may also block proliferation of viruses dependent on T cell activation, such as the virus that causes AIDS, HTLV1.

Under some circumstances, as noted above, the effect of administration of the CTLA4Ig fusion protein or its fragments in vivo is inhibitory, resulting from blocking by the fusion protein of the CTLA4 and CD28 triggering resulting from T cell/B cell contact. For 21105, 1g ex3mple, the CTLA4Ig protein may block T cell proliferation. Introduction of the CTLA4Ig fusion protein in vivo will thus produce effects on both T and B cell-mediated immune responses. The fusion protein may also be administered to a subject in combination with the introduction of cytokines or other therapeutic reagents.
In an additional embodiment of the invention, other reagents, including derivatives reactive with the CTLA4Ig fusion protein or the CTLA4 receptor are used to regulate T cell interactions. For example, antibodies, and/or antibody fragments reactive with the CTLA4 receptor may be screened to identify those capable of inhibiting the binding of the CTLA4Ig.fusion protein to the B7 antigen.
The antibodies or antibody fragments such as Fab or F(ab')2 fragments, may then be used to react=with the T cells,-for example, to inhibit T cell proliferation.

Monoclonal antibodies reactive with CTLA4 20= receptor, may be produced by hybridomas prepared using known procedures, such as those introduced by Kohler and Milstein (see Kohler and Milstein, Nature, 256:495-97 (1975)), and modifications thereof, to regulate cellular interactions.
.=
These techniques involve the use of an animal which is primed to produce a particular antibody. The animal can be primed by injection of an immunogen (e.g. the B71g fusion protein, CTLA4Ig fusion protein or CD28Ig/CTLA4Ig hybrid fusion protein) to elicit the desired immune response, i.e. production of antibodies from the primed animal. A primed animal is also one which is expressing a disease. Lymphocytes derived from the lymph nodes, spleens or peripheral blood of primed, diseased animals can be used to search for a particular antibody.
The lymphocyte chromosomes encoding desired immunoglobulins are immortalized by fusing the lymphocytes with myeloma cells, generally in the presence of a fusing agent such as polyethylene glycol (PEG). Any of a number of myeloma cell lines may be used as a fusion partner according to standard techniques; for example, the P3-NS1/1-Ag4-1, P3-x63-Ag8.653, Sp2/0-Ag14, or HL1-653 myeloma lines. These myeloma lines are available from the ATCC, Rockville, Maryland.

The resulting cells, which include the desired hybridomas, are then grown in a selective medium such as HAT medium, in which unfused parental myeloma or lymphocyte cells eventually die. Only the hybridoma cells survive and can be grown under limiting dilution conditions to obtain isolated clones. The supernatants of the hybridomas are screened for the presence of the desired specificity, e.g.
by immunoassay techniques using the CTLA4Ig protein that has been used for immunization. Positive clones can then be subcloned under limiting dilution conditions, and the monoclonal antibody produced can be isolated.
Various conventional methods can be used for isolation and purification of the monoclonal antibodies so as to obtain them free from other proteins and contaminants. Commonly used methods for purifyipg monoclonal antibodies include ammonium sulfate precipitation, ion exchange chromatography, and affinity chromatography (see Zola et al., in Monoclonal Hvbridoma Antibodies: Techniques and Aipplications, Hurell (ed.) pp.
51-52 (CRC Press, 1982)). Hybridomas produced according to these methods can be propagated in -vitro or in vivQ (in ascites fluid) using techniques known in the art (see generally Fink et al., Prog. Clin. Pathol., 9:121-33 (1984), Fig. 6-1 at p. 123).

Generally, the individual cell line may be propagated in vitro, for example, in laboratory culture vessels, and the culture medium containing high WO 93/00431 2 11 il p~ 5 18 PG'T/US92/05202 concentrations of a single specific monoclonal antibody can be harvested by decantation, filtration, or centrifugation.
In addition, fragments of these antibodies 5 containing the active binding region reactive with the extracellular domain of CTLA4 receptor, such as Fab, F(ab')2 and Fv fragments may be produced. Such fragments can be produced using techniques well established in the art (see e.g. Rousseaux et al., in 10 Methods Enzymol., 121:663-69, Academic Press (1986)).
Anti-B7 monoclonal antibodies prepared as described above may be used to bind to B7 antigen to inhibit interactions of CD28-positive or CTLA4-positive T
15 cells with B7 positive cells. Anti-CTLA4 monoclonal antibodies may be used to bind to CTLA4 receptor to inhibit the interaction of CTLA4-positive T cells with other cells.
In another embodiment, the CTLA4Ig fusion 20 protein may be used to identify additional compounds capable of regulating the interaction between CTLA4 and the B7 antigen. Such compounds may include small naturally occurring molecules that can be used to react with E cells and/or T cells. For example, fermentation .
25 broths may be tested for the ability to inhibit CTLA4/B7 interactions. In addition, derivatives of the CTI,A4Ig fusion protein as described above may be used to regulate T cell proliferation. For example, the fragments or derivatives may be used to block T cell proliferation in graft versus host (GVH) disease which accompanies _ allogeneic bone marrow transplantation. The CD28-mediated T cell proliferation pathway is cycl.osporine-resistant, in contrast to proliferation driven by the CD3/Ti cell receptor complex (June et al., 1987, sgpra).
Cyclosporine is relatively ineffective as a treatment for GVH disease (Storb, Blood 68:119-125 (1986)). GVH
disease is thought to be mediated by T lymphocytes which WO 93/00431 . PC.'i'/US92/05202 express CD28 antigen (Storb and Thomas, Immunol. Rev.
88:215-238 (1985)). Thus, the CTLA4Ig fusion protein may be useful alone, or in combination with immunosuppressants such as cyclosporine, for blocking T
cell proliferation in GVH disease.

Regulation of CTLA4-positive T cell interactions with B7 positive cells, including B cells, by the methods of the invention may thus be used to treat pathological conditions such as autoimmunity, transplantation, infectious diseases and neoplasia.
The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.

Preparation of B7Iy and CD28Ig Fusion Proteins Receptor-immunoglobulin C gamma (IgC7) fusion proteins B71g and CD28Ig were prepared as described by Linsley et al., in J. Exn. Med. 173:721-730 (1991).
Briefly, DNA encoding amino acid sequences corresponding to the respective receptor protein (e.g. B7) was joined to DNA
encoding amino acid sequences corresponding to the hinge, CH2 and CH3 regions of human IgCyl. This was accomplished as follows.

Polymerase Chain Reaction (PCR1. For PCR, DNA
fragments were amplified using primer pairs as described below for each fusion protein. PCR reactions (0.1 ml final volume) were run in = polymerase buffer (Stratagene, La Jolla, CA), containing 20 moles each of dNTP; 50-100 pmoles of the indicated primers; template (1 ng plasmid or cDNA synthesized from < 1 g total RNA
using random hexamer primer, as described by Kawasaki in PCR Protocols, Academic Press, pp. 21-27 (1990); and Taa polymerase (Stratagene). Reactions were run on a thermocycler (Perkin Elmer Corp., Norwalk, CT) for 16-30 cycles (a typical cycle consisted of steps of 1 min at 94 C, 1-2 min at 50 C and 1-3 min at 72 C).

Plasmid Construction. Expression plasmids containing cDNA encoding CD28, as described by Aruffo and Seed, Proc. Natl. Acad. Sci. USA 84:8573 (1987)), were provided by Drs. Aruffo and Seed (Mass General Hospital, Boston, MA). Plasmids containing cDNA encoding CD5, as described by Aruffo, Cell 61:1303 (1990)), were provided by Dr. Aruffo. Plasmids containing cDNA encoding B7, as described by Freeman et al., J. Immunol. 143:2714 (1989)), were provided by Dr. Freeman (Dana Farber Cancer Institute, Boston, MA). For initial attempts at expression of soluble forms of CD28 and B7, constructs were made (OMCD28 and OMB7) as described by Linsley et al., J. Exp. Med., suvra, in which stop codons were introduced upstream of the transmembrane domains and the native signal peptides were replaced with the signal peptide from oncostatin M(Malik et al., Mol. Cell Biol.
9:2847 (1989)). These were made using synthetic oligonucleotides for reconstruction (OMCD28) or as primers (OMB7) for PCR. OMCD28, is a CD28 cDNA modified for more efficient expression by replacing the signal peptide with the analogous region from oncostatin M.
CD28Ig and B71g fusion constructs were made in two parts.
The 5' portions were made using OMCD28 and OMB7 as templates and the oligonucleotide, CTAGCCACTGAAGCTTCACCATGGGTGTACTGCTCACAC
(SEQ ID NO:1), (encoding the amino acid sequence corresponding to the oncostatin M signal peptide) as a WO 93/00431 PCr/US92/05202 2~105'18 28 forward primer, and either TGGCATGGGCTCCTGATCAGGCTTAGAAGGTCCGGGAAA (SEQ ID NO:2), or, TTTGGGCTCCTGATCAGGAAAATGCTCTTGCTTGGTTGT (SEQ ID NO:3) as reverse primers, respectively. Products of the PCR
reactions were cleaved with restriction endonucleases (Hind III and Bc1I) as sites introduced in the PCR
primers and gel purified.
~=
The 3' portion of the fusion constructs corresponding to human IgCryl sequences was made by a coupled reverse transcriptase (from Avian myeloblastosis virus; Life Sciences Associates, Bayport, NY)-PCR
reaction using RNA from a myeloma cell line producing human-mouse chimeric mAb L6 (provided by Dr. P. Fell, and M. Gayle, Bristol-Myers Squibb Company, Pharmaceutical Research Institute, Seattle, WA) as template. The oligonucleotide, AAGCAAGAGCATTTTCCTGATCAGGAGCCCAAATCTTCTGACAAAACTCACACATCC
CCACCGTCCCCAGCACCTGAACTCCTG (SEQ ID NO:4), was used as forward primer, and CTTCGACCAGTCTAGAAGCATCCTCGTGCGACCGCGAGAGC
(SEQ ID NO:5) as reverse primer. Reaction products were cleaved with Bc1I and Xbal and gel purified. Final constructs were assembled by ligating HindIII/Bcll cleaved fragments containing CD28 or B7 see3uences together with Bcll/XbaI cleaved fragment containing IgC71 sequences into HindIII/Xbal cleaved CDM8. Ligation products were transformed into MC1061/p3 E. coli cells and colonies were screened for the appropriate plasmids.
Sequences of the resulting constructs were confirmed by DNA sequencing.

The construct encoding B7 contained DNA
encoding amino acids corresponding to amino acid residues from approximately position 1 to approximately position 215 of the extracellular domain of B7. The construct encoding CD28 contained DNA encoding amino acids corresponding to amino acid residues from approximately position 1 to approximately position 134 of the extracellular domain of CD28.

CD5Ig was constructed in identical fashion, using CATTGCACAGTCAAGCTTCCATGCCCATGGGTTCTCTGGCCACCTTG
(SEQ ID NO:6), as forward primer and ATCCACAGTGCAGTGATCATTTGGATCCTGGCATGTGAC (SEQ ID NO:7) as reverse primer. The PCR product was restriction endonuclease digested and ligated with the IgCyi fragment as described above. The resulting construct (CDSIg) encoded a mature protein having an amino acid sequence containing amino acid residues from position 1 to position 347 of the sequence corresponding to CD5, two amino acids introduced by the construction procedure (amino acids DQ), followed by DNA encoding amino acids corresponding to the IgCyi hinge region.

Cell Culture and Transfections. COS (monkey kidney cells) were transfected with expression plasmids expressing CD28 and B7 using a modification of the protocol of Seed and Aruffo (Proc. Natl. Acad. Sci.
84:3365 (1987) ). Cells were seeded at 106 per 10 cm diameter culture dish 18-24 h before transfection. Plasmid DNA was added (approximately 15 g/dish) in a volume of 5 mis of serum-free DMEM containing 0.1 mM cloroquine and 600 g/ml DEAE Dextran, and cells were incubated for 3-3.5 h at 37 C.
Transfected cells were then briefly treated (approximately 2 min) with 10% dimethyl sulfoxide in PBS
and incubated at 37 C for 16-24 h in DMEM containing 10%
FCS. At 24 h after transfection, culture medium was removed and replaced with serum-free DMEM (6 ml/dish).
Incubation was continued for 3 days at 37 C, at which time the spent medium was collected and fresh serum-free medium was added. After an additional 3 days at 37 C, the spent medium was again collected and cells were discarded.

CHO cells expressing CD28, CD5 or B7 were isolated as described by Linsley et al., (1991) supra, as 5 follows: Briefly, stable transfectants expressing CD28, CD5, or B7, were isolated following cotransfection of dihydrofolate reductase-deficient Chinese hamster ovary (dhfr" CHO) cells with a mixture of the appropriate expression plasmid and the selectable marker, pSV2dhfr 10 (Linsley et al., Proc. Natl. Acad. Sci. USA 87:5031 (1990)). Transfectants were then grown in increasing concentrations of methotrexate to a final level of 1 M and were maintained in DMEM supplemented with 10o fetal bovine serum (FBS) , 0.2 mM proline and 1 M methotrexate. CHO lines 15 expressing high levels of CD28 (CD28+ CHO) or B7 (B7+ CHO) were isolated by multiple rounds of fluorescence-activated cell sorting (FACSR) following indirect immunostaining with mAbs 9.3 or BB-1. Amplified CHO cells negative for surface expression of CD28 or B7 (dhfr+ CHO) were also isolated by 20 FACSR from CD28-transfected populations.

Immunostaining and FACSR Analysis. Transfected CHO
25 or COS cells or activated T cells were analyzed by indirect immunostaining. Before staining, CHO cells were removed from their culture vessels by incubation in PBS
containing 10 mM EDTA. Cells were first incubated with murine mAbs 9.3 (Hansen et al., ImmunoQenetics 10:247 30 (1980)) or BB-1 (Yokochi et al., J. Immunol. 128:823 (1981)), or with Ig fusion proteins (all at 10 g/ml in DMEM containing 10t FCS) for 1-2 h at 4 C. Cells were then washed, and incubated for an additional 0.5-2h at 4 C
with a FITC-conjugated second step reagent (goat anti-mouse Ig serum for murine mAbs, or goat anti-human Ig Cy serum for fusion proteins (Tago, Inc., Burlingame, CA)).
Fluorescence was analyzed on a FACS IV cell sorter WO 93/00431 PCr/US92/05202 (Becton Dickinson and Co., Mountain View, CA) equipped with a four decade logarithmic amplifier.

Purification of Ia Fusion Proteins. The first, second and third collections of spent serum-free culture media from transfected COS cells were used as sources for the purification of Ig fusion proteins. After removal of cellular debris by low speed centrifugation, medium was applied to a column (approximately 200-400 ml medium/ml packed bed volume) of immobilized protein A (Repligen Corp., Cambridge, MA) equilibrated with 0.05 M sodium citrate, pH 8Ø After application of the medium, the column was washed with 1 M potassium phosphate, pH 8, and bound protein was eluted with 0.05 M sodium citrate, pH
3. Fractions were collected and immediately neutralized by addition of 1/10 volume of 2 M Tris, pH S. Fractions containing the peak of A280 absorbing material were pooled and dialyzed against PBS before use. Extinction coefficients of 2.4 and 2.8, ml/mg for. CD28Ig and B71g, respectively, by amino acid analysis of solutions of known absorbance. The recovery of purified CD28Ig and B71g binding activities were nearly quantitative as judged by FACSR analysis after indirect fluorescent staining of B7+ and CD28' CHO cells. -~

PreRaration of =LA4Ig Fusion Protein A soluble genetic fusion encoding CTLA4Ig between the extracellular domain of CTLA4 and an IgCy1 domain was constructed in a manner similar to that described above for the CD28Ig construct. The extracellular domain of the CTLA4 gene was cloned by PCR
using synthetic oligonucleotides corresponding to the published sequence (Dariavach et al., Eur. Jour. Immunol.
18:1901-1905 (1988)).

WO 93/00431 PCr/US92/05202 21~ fl5~ 8 32 Because a signal peptide for CTLA4 was not identified in the CTLA4 gene, the N-terminus of the predicted sequence of CTLA4 was fused to the signal peptide of oncostatin M (Malik et al., Mol. and Cell.
Biol. 9:2847 (1989)) in two steps using overlapping oligonucleotides. For the first step, the oligonucleotide, CTCAGTCTGGTCCTTGCACTCCTG
TTTCCAAGCATGGCGAGCATGGCAATGCACGTGGCCCAGCC (SEQ ID N :8) (which encoded the C terminal 15 amino acids from the oncostatin M signal peptide fused to the N terminal 7 amino acids of CTLA4) was used as forward primer, and TTTGGGCTCCTGATCAGAATCTGGGCACGGTTG (SEQ ID NO:9) (encoding amino acid residues 119-125 of the amino acid sequence encoding CTLA4 receptor.and containing a Bcl I
restriction enzyme site) as reverse primer. The template for this step was cDNA synthesized from 1 pg of total RNA
from H38 cells (an HTLV II infected T cell leukemic cell line provided by Drs. Salahudin and Gallo, NCI, Bethesda, MD). A portion of the PCR product from the first step was reamplified, using an overlapping forward primer, encoding the N terminal portion of the oncostatin M
signal peptide and containing a Hind III restriction endonuclease site, CTAGCCACTGAAGCTTCACCAATGGGTGTACTGCTCACACAGAGGACGCTGCTCAGV
CTGGTCCTTGCACTC (SEQ ID NO:10) and the same reverse primer. The product of the PCR reaction was digested with Hind III and Bcl I and ligated together with a Bcl 1/Xba I cleaved cDNA fragment encoding the amino acid sequences corresponding-to the hinge, CH2 and CH3 regions of IgCyl into the Hind III/Xba I cleaved expression vector, CDMB or Hind III/Xba I cleaved expression vector ffLN (provided by Dr. Aruffo).

A map of the resulting CTLA4Ig fusion construct is shown in Figure 1. Sequences displayed in this figure show the junctions between CTLA4 (upper case letters, unshaded regions) and the signal peptide, SP, of WO 93/00431 PC'T/US92/05202 oncostatin M (dark shaded regions), and the hinge, H, of IgCyl (stippled regions). The amino acid in parentheses was introduced during construction. Asterisks (*) indicate cysteine to serine mutations introduced in the IgCy hinge region. The immunoglobulin superfamily V-like domain present in CTLA4 is indicated, as are the CH2 and CH3 domains of IgCyl.

Expression plasmids, CDM8, containing CTLA4Ig were then transfected into COS cells using DEAE/dextran transfection by modification (Linsley et al., 1991, supra) of Y
the protocol described by Seed and Aruffo, 1987, supra.
Expression"plasmid constructs (nLN or CDM8) containing cDNA encoding the amino acid sequence of CTLA4Ig, was transfected by lipofection using standard procedures into dhfr' CHO lines to obtain novel cell lines stably expressing CTLA4Ig.
DNA encoding the amino acid sequence corresponding to CTLA4Ig has been deposited with the ATCC
under the Budapest Treaty on May 31, 1991, and has been accorded ATCC
accession number 68629.

A preferred stable transfectant, expressing CTLA4Ig, designated Chinese Hamster Ovary Cell Line, CTLA4Ig-24, was made by screening B7 positive CHO cell lines for B7 binding activity in the medium using immunostaining. Transfectants were maintained in DMEM
supplemented with 10% fetal bovine serum (FBS), 0.2 mM
proline and 1 M methotrexate.

The CTLA4Ig-24 CHO cell line has been deposited with the ATCC under the Budapest Treaty on May 31, 1991 and has been accorded accession number ATCC 10762.

21~0518 34 CTLA4Ig was purified by protein A
chromatography from serum-free conditioned supernatants (Figure 2). Concentrations of CTLA4Ig were determined assuming an extinction coefficient at 280 nm of 1.6 (experimentally determined by amino acid analysis of a solution of known absorbance). Molecular weight standards (lanes 1 and 3. Figure 2) and samples (1 pg) of CTLA4Ig (lanes 2 and 4) were subjected to SDS-PAGE (4-12%
acrylamide gradient) under non-reducing conditions (-J3ME, lanes 1 and 2) or reducing conditions (+ OME, lanes 3 and 4) Proteins were visualized by staining with Coomassie Brilliant Blue.

Under non-reducing conditions, CTLA4Ig migrated as a Mr approximately 100,000 species, and under reducing conditions, as a Mr approximately 50;000 species (Figure 2). Because the IgC y hinge disulfides were eliminated during construction, CTLA4Ig, like CD28Ig, is a dimer presumably joined through a native disulfide linkage.

CTLA4 Recetitor To reconstruct DNA encoding the amino acid =' sequence corresponding to the full length human CTLA4 gene, cDNA encoding amino acids corresponding to a fragment of the transmembrane and cytoplasmic domains of CTLA4 was cloned by PCR and then joined with cDNA
encoding amino acids corresponding to a fragment from CTLA4Ig that corresponded to the oncostatin M signal peptide fused to the N-terminus of CTLA4. Procedures for PCR, and cell culture and transfections were as described above in Example 1 using COS cells and DEAE-dextran transfection.
Because the expression of CTLA4 receptor protein in human lymphoid cells has not been previously reported, it was necessary to locate a source of CTLA4 mRNA. PCR cDNA reverse transcribed from the total cellular RNA of H38 cells, as noted above, was used for cloning by PCR. For this purpose, the oligonucleotide, (SEQ ID NO:11), (encoding the first 11 amino acids in the predicted coding sequence) was used as a forward primer, and TGATGTAACATGTCTAGATCAATTGATGGGAATAAAATAAGGCTG
(SEQ ID N0:12) (homologous to the last 8 amino acids in 10 CTLA4 and containing a Xba I site) as reverse primer.
The template again was a cDNA synthesized from 1 g RNA
from H38 cells. Products of the PCR reaction were cleaved with the restriction endonucleases Nco I and Xba I and the resulting 316 bp product was gel purified. A
15 340 bp Hind III/Nco I fragment from the CTLAIg fusion described above was also gel-purified, and both restri>tion fragments were ligated into Hind III/Xba I
cleaved CDM8 to form OMCTLA.

20 The resulting construct corresponded to full length CTLA4 (SEQ ID NOs: 13 and 14) and the oncostatin M
signal peptide. The construct is shown in Figure 3 and was designated OMCTLA4. The sequence for CTLA4 shown in Figure 3 differs from the predicted human CTLA4 DNA 14 25 sequence (Dariavach et al., suDra) by a base change such that the previously reported alanine at amino acid position 111 of the amino acid sequence shown, encodes a threonine. This threonine is part of a newly identified N-linked glycosylation site that may be important for 30 successful expression of the fusion protein.
Ligation products were transformed into MC1061/p3 E. coli cells and colonies were screened for the appropriate plasmids. Sequences of the resulting 35 constructs were confirmed by DNA sequence analysis.

WO 93/00431 PC'I'/US92/05202 Characterization of CTLA4Ia To characterize the CTLA4Ig constructs, several isolates, CD28Ig, B71g, and CD5Ig, were prepared as described above and were transfected into COS cells as described in Examples 2 and 3, and were tested by FACSR
analysis for binding of B71g. In addition to the above-mentioned constructs, CDMB plasmids containing cDNAs encoding CD7 as described by Aruffo and Seed, (EMBO Jour.
6:3313-3316 (1987)).

nAbs. Murine monoclonal antibodies (mAbs) 9.3 (anti-CD28) and G19-4 (anti-CD3), G3-7 (anti-CD7), BB-1 (anti-B7 antigen) and rat mAb 187.1 (anti-mouse K chain) have been described previously (Ledbetter et al., Proc.
Natl. Acad. Sci. 84:1384-1388 (1987); Ledbetter et al., Blood 75:1531 (1990); Yokochi et al., supra) and were purified from ascites before use. The hybridoma producing mAb OKTB was obtained from the ATCC, Rockville, MD, and the mAb was also purified from ascites before use. mAb 4G9 (anti-CD19) was provided by Dr. E.
Engleman, Stanford University, Palo Alto, CA). Purified human-mouse chimeric mAb L6 (having human C71 Fc portion) was a gift of Dr. P. Fell and M. Gayle (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA).

immunostaining and FACSR Analysis. Prior to staining, COS or CHO cells were removed from their culture vessels by incubation in PBS containing 10 mM
EDTA. Cells were first-incubated with mAbs or Ig fusion proteins at 10 g/ml in DMEM containing 10% FBS for 1-2 hr at 4 C. Cells were then washed, and incubated for an additional 0.5-2 hrs at 40 C with FITC-conjugated goat anti-mouse immunoglobulin or with FITC-conjugated goat anti-human Ig C=y serum (both from Tago, Burlingame, CA).
When binding of both mAbs and Ig fusion proteins were measured in the same experiment, FITC-conjugated anti-mouse and anti-human second step reagents were mixed together before use. Fluorescence on a total of 10,000 cells was then analyzed by FACSR.

Peripheral Blood Lymvhocyte Separation and Stimulation. Peripheral blood lymphocytes (PBLs) were isolated by centrifugation through Lymphocyte Separation Medium (Litton Bionetics, Kensington, MD).
Alloreactive T cells were isolated by stimulation of PBL
in a primary mixed lymphocyte reaction (MLR). PBL were cultured at 106/ml irradiated (5000 rad) T51 LCL. EBV-transformed lymphoblastoid cell lines (LCL), PM (Bristol-Myers Squibb Co.) and T51 (Bristol-Myers Squibb Co.) were maintained in RPMI supplemented with 10% PBS. After 6 days, alloreactive "blasts" cells were cryopreserved.
Secondary MLR were conducted by culturing thawed alloreactive blasts together with fresh irradiated T51 LCL in the presence and absence of mAbs and Ig fusion proteins. Cells were cultured in 96 well flat bottom plates (4 x 104 alloreactive blasts and 1 x 104 irradiated T51 LCL cells/well, in a volume of 0.2 ml) in RPMI
=' containing 10i PBS. Cellular proliferation of quadruplicate cultures was measured by uptake of [3H]-_ thymidine during the last 6 hours of a 2-3 day culture.
PHA-activated T cells were prepared by culturing PBLs with 1 g/ml PHA (Wellcome, Charlotte, NC) for five days, and one day in medium lacking PHA. Viable cells were collected by sedimentation through Lymphocyte Separation Medium before use. Cells were stimulated with mAbs or transfected CHO cells for 4-6 hr at 37 C, collected by centrifugation and used to prepare RNA.
CD4' T cells were isolated from PBLs by WO 93/00431 PCT/[JS92/05202 separating PBLs from healthy donors into T and non-T
cells using sheep erythrocyte rosetting technique and further separating T cells by panning into CD4' cells as described by Damle et al., J. Immunol. 139:1501 (1987).
B cells were also purified from peripheral blood by panning as described by Wysocki and Sato, Proc. Natl.
Acad. Sci. 75:2844 (1978), using anti-CD19 mAb 4G9. To measure T,,-induced Ig production, 106 CD4+ T cells were mixed with 106 CD19+ B cells in 1 ml of RPMI containing 10% FBS.
Following culture for 6 days at 37 C, production of human IgM
was measured in the culture supernatants using solid phase ELISA as described by Volkman et al., Proc. Natl. Acad. Sci.
USA 78:2528 (1981) . Briefly, 96-well flat bottom microtiter ELISA plates (Corning, Corning, NY) were coated with 200 g1/well of sodium carbonate buffer (pH 9.6) containing 10 }cg/ml of affinity-purified goat anti-human IgG or IgM
antibody (Tago, Burlingame, CA), incubated overnight at 4 C, and then washed with PBS and wells were further blocked with 2% BSA in PBS (BSA-PBS). Samples to be assayed were added at appropriate dilution to these wells and incubated with 200 l/well of 1:1000 dilution of horseradish peroxidase (HRP) -conjugated F(abl)2 fraction of affinity-purified goat anti-human IgG or IgM antibody (Tago). The plates were then washed, and 100 l/well of o-phenylenediamine (Sigma Chemical Co., St. Louis,'MO) solution (0.6 mg/ml in citrate-phosphate buffer with pH
5.5 and 0.045% hydrogen peroxide). Color development was stopped with 2 N sulfuric acid. Absorbance at 490 nm was measured with an automated ELISA plate reader. Test and control samples were run in triplicate and the values of absorbance were compared to those obtained with known IgG
or IgM standards run simultaneously with the supernatant samples to generate the standard curve using which the concentrations of Ig in the culture supernatant were quantitated. Data are expressed as ng/ml of Ig SEM of either triplicate or quadruplicate cultures.

Immunoprecipitation Analysis and SDS PAGE. Cells were surface-labeled with 125 1 and subjected to immunoprecipitation analysis. Briefly, PHA-activated T
cells were surface-labeled with 1251 using lactoperoxidase and Hz0Z as described by Vitetta et al., J. Exp. Med.
134:242 (1971). SDS-PAGE chromatography was performed on linear acrylamide gradients gels with stacking gels of 50 acrylamide. Gels were stained with Coomassie Blue, destained, and photographed or dried and exposed to X ray film (Kodak XAR-5).

Binding Assays. B71g was l-abeled with 1251 to a specific activity of approximately 2 x 106 cpm/pmole.
Ninety-six well plastic dishes were coated for 16-24 hrs with a solution containing CTLA4Ig (0.5 g in a volume of 0.05 ml of 10 mM Tris, pH 8). Wells were blocked with binding buffer (DMEM containing 50 mM BES (Sigma Chemical Co.), pH 6.8, 0.1% BAS, arid 10% FCS) before addition of a solution (0.09 ml) containing 125I B71g (approximately 5 x 105 cpm) in the presence or absence of competitor.
Following incubation for 2-3 hrs at 23 C, wells were washed once with binding buffer, and four times with PBS.
Bound radioactivity was then solubilized by addition of 0.5N NaOH, and quantified by gamma counting.

Binding to B7Ig. The functional activity of the OMCTLA4 construct encoding the complete human CTLA4 DNA
gene, is shown in the experiment shown in Figure 4. COS
cells were transfected with expression plasmids CD7, OMCD28 and OMCTLA4 as described above. Forty-eight hours following transfection, cells were collected and incubated with medium only (no addition) or with mAbs 9.3, B71g, CD5Ig or G3-7. Cells were then washed and WO 93/00431 P(.'I /US92/05202 binding was detected by a mixture of FITC-conjugated goat anti-mouse Ig and FITC-conjugated goat anti-human Ig second step reagents. Transfected cells were tested for expression of the appropriate cell surface markers by 5 indirect immunostaining and fluorescence was measured using FACSR analysis as described above.

As shown in Figure 4, mAb 9.3 bound to CD28-transfected COS cells, but not to CTLA4-transfected 10 cells. In contrast, the B71g fusion protein (but not control CD5Ig fusion protein) bound to both CD28- and CTLA4-transfected cells. CD7-transfected COS cells bound neither mAb 9.3 nor either of the fusion proteins. This indicates that CD28 and CTLA4 both bind the B cell 15 activation antigen, B7. Furthermore, mAb 9.3 did not detectably bind CTLA4.

Bindinq of CTLA4Ig on B7 Positive CHO cells. To further characterize the binding of CTLA4Ig and B7, the 20 binding activity of purified CTLA4Ig on B7' CHO cells and on a lymphoblastoid cell line (PM LCL) was measured in the experiment shown in-Figure 5. Amplified transfected CHO cell lines and PM LCLs were incubated with medium only (no addition) or an equivalent concentration of 25 human IgCyl-containing proteins (10 g/ml) of CD5Ig, CD28Ig or CTLA4Ig. Binding was detected by FACSR
following addition of FITC-conjugated goat anti-human Ig second step reagents. A total of 10,000 stained cells were analyzed by FACSR.
As shown in Figure 5, CD28Ig bound to B7 CHO
cells but not to PM LCL, a'cell line which expresses relatively low levels of the B7 antigen (Linsley et al., supra, 1990). CTLA4Ig bound more strongly to both-cell lines than did CD28Ig, suggesting that it bound with higher affinity. Neither CD28Ig nor CTLA4Ig bound to CD28' CHO cells.

WO 93/00431 41 ( y~ 5 119 Q PCT/US92/05202 c~ ~ ~~il Affinity of Binding of CTLA4Ig and B7Ia. The apparent affinity of interaction between CTLA4Ig and B71g was then measured using a solid phase competition binding assay. Ninety-six well plastic dishes were coated with CTLA4Ig as described above. B71g was radiolabeled with uSI (5 X 1os cpm, 2 X 106 cpm/pmole), and added to a concentration of 4 nM in the presence of the indicated concentrations (see Figure 6) of unlabeled chimeric mAb L6, mAb 9.3, mAb BB-1 or B71g. Plate-bound radioactivity was determined and expressed as a percentage of radioactivity bound to wells treated without competitor (28,300 cpm). Each point represents the mean of duplicate determinations; replicates generally varied from the mean by < 20%. Concentrations were calculated based on a Mr of 75,000 per binding site for mAbs and 51,000 per binding site for B71g. , As shown in Figure 6, only mAb BB-1 and unlabeled B71g competed significantly for 115I-B7Ig 20' binding (half maximal effects at approximately 22 nM and approximately 175 nM, respectively). Neither chimeric mAb L6, nor mAb 9.3 competed effectively at the concentrations tested. In other experiments, the concentrations of mAb 9.3 used were sufficient to inhibit binding of 125I-B7Ig to immobilized CD28Ig or to cell surface expressed CD28 by 9 90%.

When the competition data from Figure 6 were plotted in a Scatchard representation, a dissociation constant, Kd, of approximately 12 nM was calculated for binding of 12SI-B7 to immobilized CTLA4Ig (Figure 7).
This value is approximately 20 fold lower than the previously determined Kd of binding between 125I-B7Ig and CD28 (approximately 200 nM) (Linsley et al, (1991), supra) indicating that CTLA4 is a higher affinity receptor for the B7 antigen than CD28 receptor.

WO 93/00431 PCr/US92/05202 21iQ518 42 To identify the molecule(s) on lymphoblastoid cells which bound CTLA4Ig (Figure 7), 125I-surface labeled cells were subjected to immunoprecipitation analysis (Figure 8). B7' CHO and PM LCL cells were surface-labeled with 125I, and extracted with a non-ionic detergent solution as described above. Aliquots of extracts containing approximately 1.5 X 10T cpm in a volume of 0.1 ml were subjected to immunoprecipitation analysis as described above with no addition, or 2 g each of CD28Ig, CTLA4Ig or CD5Ig. Washed immunoprecipitates were then analyzed by SDS-PAGE (10-20% acrylamide gradient) under reducing conditions. The gel was then dried and subjected to autoradiography. The left panel of Figure 8 shows an autoradiogram'obtained after a 1 day exposure.
The right panel of Figure 8 shows an autoradiogram of the same gel after a 10 day exposure. The autoradiogram in the center panel of Figure 8 was also exposed for 10 days. Positions of molecular weight standard are also indicated in this figure.
As shown by Figure 8, a diffusely migrating (Mr approximately 50,000 - 75,000; center at approximately 60,000) radiolabeled protein was immunoprecipitated by CTLA4Ig, but not by CD28Ig or CD5Ig. This molecule c migrated with B7 immunoprecipitated from B7' CHO cells by CTLA4Ig, and much more weakly, by CD28Ig. These findings indicate that CTLA4Ig binds a single protein on lymphoblastoid cells which is similar in size to the B7 antigen.
Inhibition of Immune Responses In Vitro bv CTLA4Ia Inhibition of Proliferation. Previous studies have shown that the anti-CD28 mAb, 9.3, and the anti-B7 mAb, BB-1, inhibit proliferation of alloantigen specific T.
cells, as well as immunoglobulin secretion by alloantigen-presenting B Cells (Damle, et al., Proc.

Natl. Acad. Sci. 78:5096 (1981); Lesslauer et al., ur.
J. Immunol. 16:1289 (1986)). Because CTLA4 is a high affinity receptor for the B7 antigen as demonstrated herein, soluble CTLA4Ig was tested for its ability to inhibit these responses. The effects of CTLA4Ig on T
cell proliferation were examined in the experiment shown in Figure 9.

Primary mixed lymphocyte reaction (MLR) blasts were stimulated with irradiated T51 lymphoblastoid cells (LC) in the absence or presence of concentrations of murine mAb 9.3 Fab fragments, or B71g, CD28Ig or CTLA.4Ig immunoglobulin Cy fusion proteins. Cellular proliferation was measured by [3H]-thymidine incorporation after 4 days and is expressed as the percentage of incorporation by untreated cultures (21,000 cpm). Figure 9 shows the means of quadruplicate determinations (SEM < 10%).

As shown in Figure 9, CTLA4Ig inhibited the MLR
reaction in a dose-dependant fashion by a maximum of >
90% with a 1/2 maximal response at approximately 30 ng/ml (approximately 0.8 nM). The Fab fragment of mAb 9.3, which previously was shown to be a more potent inhibito~
of MLR than whole mAb 9.3 (Damle et al., J. Immunol.
140:1753-1761 (1988)), also inhibited the MLR, but at higher concentrations (approximately 800 ng/ml or approximately 30 nM for 1/2 maximal response). B7Ig and CD28Tg did not significantly inhibit the MLR even at higher concentrations. In another experiment, addition of B71g together with CTLA4Ig partially overcame the inhibition of MLR by CTLA4Ig, indicating that the inhibition was specifically due to interactions with B7 antigen.
Inhi:bition of Immunoglobulin Secretion. The effects of CTLA41g on helper T cell (Th)-induced immunoglobulin secretion were also examined (Figure 10). CD4* T cells were mixed with allogeneic CD19' B cells in the presence or absence of the indicated immunoglobulin molecules as described above. Murine mAbs OKTB, 9.3 and BB-1 were added at 20 g/ml, and Ig fusion proteins at 10 g/ml.
After 6 days of culture, concentrations of human IgM (SEM
< 5%) in culture supernatants were determined by enzyme immunoassay (ELISA) as described above.=IgM production by B cells cultured in the absence of CD4* T cells was 11 ng/ml.

As shown in Figure~ 10, CD4* T cells stimulated IgM production by allogenic CD19+ B Cells (in the absence of CD4* T cells, IgM levels were reduced by 93%). mAbs 9.3 and BB-1 significantly'inhibited Th-induced IgM
production (63% and 65%'inhibition, respectively).
CTLA4Ig was even more effective as an inhibitor (89%
inhibition) than were these mAbs. Inhibition by control Ig molecules, mAb OKT8 and CD5Ig, was much less (< 30%
inhibition). None of these molecules significantly inhibited Ig production measured in the presence of Stavhylococcal aureus enterotoxin B. Similar results were obtained with CD4* T cells and B cells derived from other donors. These results indicate that the inhibition by,4 CTLA4Ig is specific.

The above data also demonstrate that the CTLA4 and CD28 receptors are functionally as well as structurally related. Like CD28, CTLA4 is also a receptor for the B cell activation antigen, B7. CTLA4Ig bound 125I-B7 with an affinity constant, Kd, of approximately 12 nM, a value some 20 fold higher than the affinity between CD28 and B71g (approximately 200 nM).
Thus, CTLA4 and.CD28 may be thought of as high and low affinity receptors, respectively, for the same ligand, the B7 antigen.

The apparent affinity between CD28 and B7 is similar to the affinity reported for binding of soluble alloantigen to the T cell receptor of a murine T cell hybridoma (approximately 100 nM; Schnek et al., Cell 56:47 (1989)), and is higher affinity than interactions between CD2 and LFA3 (Recny et al., J. Biol. Chem.
265:8542 (1990)), or CD4 and MHC class II molecules (Clayton et al., Nature 339:548 (1989)). The apparent affinity constant, Kd, between CTLA4 and B7 is even greater, and compares favorably with higher affinity mAbs (Kd 2-10,000 nM; Alzari et al., Ann. Rev. Immuno. 6:555 (1988)). The Kd between CTLA4 and B7 is similar to or greater than Kd values of integrin receptors and their ligands (10-2000 nM; Hautanen et al., J. Biol. Chem.
264:1437-1442 (1989); Di Minno et al., Blood 61:140-148 (1983); Thiagarajan and Kelley, J. Biol. Chem. 263:035-3038 (1988)). The affinity of interaction between CTLA4 and B7 is thus among the highest yet reported for lymphoid adhesion systems..
These results demonstrate the first expression of a functional protein product of CTLA4 transcripts.
CTLA4Ig, a fusion construct containing the extracellular domain of CTLA4 fused to an IgCyl domain, forms a ,a disuif ide-linked dimer of M. approximately 50,000 subunits (Figure 1). Because no interchain disulfides would be predicted to form in the Ig portion of this fusion, it seems likely that cysteines from CTLA4 are involved in disulfide bond formation. The analogous CD28Ig fusion protein (Linsley et al, supra, 1991) also contains interchain disulfide linkage(s). These results suggest that CTLA4 receptor, like CD28 (Hansen et al., Immunogenetics 10:247-260 (1980)), exists on the T cell surface as a disulfide linked homodimer. Although.CD28 and CTLA4 are highly homologous proteins, they are immunologically distinct, because the anti-CD28 mAb, 9.3, does not recognize CTLA4 (Figures 4 and 5).

It is not known whether CTLA4 can activate T
cells by a signalling pathway analogous to CD28. The cytoplasmic domains of murine and human CTLA4 are identical (Dariavach et al., supra 1988), suggesting that this region has important functional properties. The cytoplasmic domains of CD28 and CTLA4 also share homology, although it is unclear if this is sufficient to impart similar signaling properties to the two molecules.

CTLA4Ig is a potent inhibitor of in vitro lymphocyte functions requiring T cell and B cell collaboration (Figures 9 and 10). These findings, together with previous studies, indicate the fundamental importance of interactions between B7 antigen and its counter-receptors, CD28 and/or CTLA4, in regulating both T and B lymphocyte responses. CTLA4Ig should be a useful reagent for future investigations on the role of these interactions during immune responses. CTLA4Ig is a more potent inhibitor of in vitro lymphocyte responses than either mAb BB-1 or mAb 9.3 (Figures 9 and 10). The greater potency-of CTLA4Ig over mAb BB-1 is most likely due to the difference in affinities for B7 between these molecules (Figure 6). CTLA4Ig is also more potent than mAb 9.3, probably because,-unlike the mAb, it does not,,, also have direct stimulatory effects on T cell proliferation (June et al., Immunology Today 11:211 (1989)) to counteract its inhibitory effects. 'The immunosuppressive effects of CTLA43g in vitro suggest that future investigations are warranted into possible therapeutic effects of this molecule for treatment of autoimmune disorders involving aberrant T cell activation or Ig production.

As will be apparent to those skilled in the art to which the invention pertains, the present invention may be embodied in forms other than those specifically disclosed above without departing from the spirit or WO 93/00431 PCI'/US92/05202 essential characteristics of the invention. The particular embodiments of the invention described above, are, therefore, to be considered as illustrative and not restrictive. The scope of the present invention is as set forth in the appended claims rather*than being limited to the examples contained in the foregoing description.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Bristol-Myers Squibb Company 345 Park Avenue, New York, NY 1054 U.S.A.

(ii) TITLE OF INVENTION: CTLA4 RECEPTOR, FUSION PROTEINS CONTAINING IT AND
USES THEREOF

(iii) NUMBER OF SEQUENCES: 14 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: P. Scott Maclean (B) STREET: 307 Gilmour Street (C) CITY: Ottawa (D) PROVINCE: Ontario (E) COUNTRY: Canada (F) POSAL CODE: K2P 0P7 (G) FILE REFERENCE: 37274-0008 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: CA 2,110,518 (B) FILING DATE: 1992-06-16 (C) CLASSIFICATION: C12N 15/12 (2006.01) (viii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 723,617 (B) FILING DATE: 1991-06-27 (2) INFORMATION FOR SEQ ID NO: 1 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1 (2) INFORMATION FOR SEQ ID NO: 2 Page 1 of 7 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2 (2) INFORMATION FOR SEQ ID NO: 3 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3 (2) INFORMATION FOR SEQ ID NO: 4 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 84 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4 Page 2 of 7 CCGTCCCCAG CACCTGAACT CCTG

(2) INFORMATION FOR SEQ ID NO: 5 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 41 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5 (2) INFORMATION FOR SEQ ID NO: 6 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6 (2) INFORMATION FOR SEQ ID NO: 7 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:

Page 3 of 7 (A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7 (2) INFORMATION FOR SEQ ID NO: 8 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 65 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8 CAGCC
(2) INFORMATION FOR SEQ ID NO: 9 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9 (2) INFORMATION FOR SEQ ID NO: 10 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 72 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) Page 4 of 7 (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10 GTCCTTGCAC TC

(2) INFORMATION FOR SEQ ID NO: 11 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 33 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(C) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11 (2) INFORMATION FOR SEQ ID NO: 12 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12 (2) INFORMATION FOR SEQ ID NO: 13 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 561 base pairs (B) TYPE: nucleic acid Page 5 of 7 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Homo sapiens (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..561 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13 Ala Met His Val Ala Gln Pro Ala Val Val Leu Ala Ser Ser Arg Gly Ile Ala Ser Phe Val Cys Glu Tyr Ala Ser Pro Gly Lys Ala Thr Glu Val Arg Val Thr Val Leu Arg Gln Ala Asp Ser Gln Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser Ser Gly Asn Gln Val Asn Leu Thr Ile Gln Gly Leu Arg Ala Met Asp Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr Tyr Leu Gly Ile Gly Asn Gly Thr Gln Ile Tyr Val Ile Asp Pro Glu Pro Cys Pro Asp Ser Asp Phe Leu Leu Trp Ile Leu Ala Ala Val Ser Ser Gly Leu Phe Phe Tyr Ser Phe Leu Leu Thr Ala Val Ser Leu Ser Lys Met Leu Lys Lys Arg Ser Pro Leu Thr Thr Gly Val Tyr Val Lys Met Pro Pro Thr Glu Pro Glu Cys Glu Page 6 of 7 Lys Gln Phe Gln Pro Tyr Phe Ile Pro Ile Asn (2) INFORMATION FOR SEQ ID NO: 14 (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 187 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14 Ala Met His Val Ala Gln Pro Ala Val Val Leu Ala Ser Ser Arg Gly Ile Ala Ser Phe Val Cys Glu Tyr Ala Ser Pro Gly Lys Ala Thr Glu Val Arg Val Thr Val Leu Arg Gln Ala Asp Ser Gln Val Thr Glu Val Cys Ala Ala Thr Tyr Met Met Gly Asn Glu Leu Thr Phe Leu Asp Asp Ser Ile Cys Thr Gly Thr Ser Ser Gly Asn Gln Val Asn Leu Thr Ile Gln Gly Leu Arg Ala Met Asp Thr Gly Leu Tyr Ile Cys Lys Val Glu Leu Met Tyr Pro Pro Pro Tyr Tyr Leu Gly Ile Gly Asn Gly Thr Gln Ile Tyr Val Ile Asp Pro Glu Pro Cys Pro Asp Ser Asp Phe Leu Leu Trp Ile Leu Ala Ala Val Ser Ser Gly Leu Phe Phe Tyr Ser Phe Leu Leu Thr Ala Val Ser Leu Ser Lys Met Leu Lys Lys Arg Ser Pro Leu Thr Thr Gly Val Tyr Val Lys Met Pro Pro Thr Glu Pro Glu Cys Glu Lys Gln Phe Gln Pro Tyr Phe Ile Pro Ile Asn Page 7 of 7

Claims (49)

WHAT IS CLAIMED IS:
1. An isolated CTLA4 receptor protein having the amino acid sequence depicted in SEQ ID NO:14.
2. An isolated soluble CTLA4 protein which binds a B7 antigen comprising the the extracellular domain of CTLA4 of SEQ ID NO:14 beginning with alanine at position 1 and ending with aspartic acid at position 125.
3. An isolated CTLA4 protein which binds a B7 antigen expressed on activated B cells, comprising the 187 amino acids shown in SEQ ID
NO:14 beginning with alanine at position 1 and ending with asparagine at position 187.
4. An isolated soluble CTLA4 protein having the extracellular domain of CTLA4, as shown in SEQ ID No.: 14 beginning with alanine at position 1 and ending with aspartic acid at position 125, or a fragment thereof which binds a B7 antigen, which protein binds a B7 antigen expressed on activated B cells.
5. An isolated CTLA4 protein which binds a B7 antigen comprising the amino acids shown in SEQ ID NO:14 beginning with alanine at position 1 and ending with asparagine at position 187.
6. The soluble CTLA4 protein of claim 4 comprising the amino acids shown in SEQ ID NO:14 beginning with alanine at position 1 and ending with aspartic acid at position 125.
7. A CTLA4Ig fusion protein which binds a B7 antigen, said protein having a first amino acid sequence comprising the extracellular domain of CTLA4, as shown in SEQ ID No.: 14 beginning with alanine at position 1 and ending with aspartic acid at position 125, or a fragment thereof which binds a B7 antigen, and a second amino acid sequence comprising the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
8. A CTLA4Ig fusion protein which binds a B7 antigen, said protein having (a) a first amino acid sequence beginning with alanine at amino acid position 1 and ending with aspartic acid at amino acid position 125 of SEQ ID NO:14 or a portion thereof which binds a B7 antigen and (b) a second amino acid sequence comprising the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
9. A CD28Ig/CTLA4Ig fusion protein hybrid which binds a B7 antigen, said fusion hybrid comprising a first amino acid sequence corresponding to a portion of the extracellular domain of CD28 receptor fused to a second amino acid sequence corresponding to a portion of the extracellular domain of CTLA4 receptor of SEQ. ID NO: 14 beginning with Iysine at amino acid position 94 and ending at aspartic acid at amino acid position 125, and a third amino acid sequence corresponding to the hinge, CH2 and CH3 regions of immunoglobulin Cgamma1 molecule.
10. A CTLA4Ig fusion protein reactive with a B7 antigen and produced by DNA deposited as ATCC 68629, wherein the DNA comprises (a) a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
11. A CTLA4Ig fusion protein expressed by a cell deposited as ATCC
Accession No. 10762 and wherein the cell comprises a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 and a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
12. A CTLA4Ig fusion protein produced by a method comprising growing a host vector system, which system comprises a vector having DNA in an eukaryotic cell so as to produce the CTLA4Ig fusion protein in the host and recovering the CTLA4Ig fusion protein so produced, the DNA

comprising (a) a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ

ID NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
13. A CTLA4Ig fusion protein produced by a method comprising growing a Chinese Hamster Ovary cell comprising a vector having DNA so as to produce the CTLA4Ig fusion protein in the CHO cell and recovering the CTLA4Ig fusion protein so produced, the DNA comprising a first nucleic acid sequence beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 and (b) a second nucleic acid sequence encoding the hinge, CH2 and CH3 regions of an immunoglobulin molecule.
14. The CTLA4Ig fusion protein of any one of claims 7-13, wherein the CTLA4Ig fusion protein exists as a dimer.
15. The CTLA4Ig fusion protein of claim 14, wherein the CTLA4Ig fusion protein exists as a homodimer.
16. The CTLA4Ig fusion protein of any one of claims 7-13 comprising one or more glycosylated amino acid residues.
17. The CTLA4Ig fusion protein of any one of claims 7-13 having a molecular weight of about 100 kDa.
18. The CTLA4Ig fusion protein of any one of claims 7-13 wherein the CTLA4Ig is isolated.
19. The soluble CTLA4 protein of any one of claims 2, 4 and 6 comprising a non-CTLA4 protein sequence.
20. The soluble CTLA4 protein of claim 19, wherein the non-CTLA4 protein is at least a portion of an immunoglobulin molecule.
21. The CTLA4Ig fusion protein of any one of claims 7 and 8, wherein the extracellular domain of CTLA4 as shown in SEQ ID NO: 14, beginning with alanine at position 1 and ending with aspartic acid at position 125.
22. An isolated protein of any one of claims 6-17 and 19-21.
23. A DNA molecule comprising a sequence encoding the amino acid sequence of a CTLA4Ig fusion protein reactive with B7 antigen and having ATCC No. 68629, wherein the DNA sequence comprises (a) a first nucleotide sequence encoding an extracellular domain of CTLA4 beginning with guanine at position 1 and ending with cytosine at position 375 of SEQ ID NO:13 or portion thereof which binds a B7 antigen, and (b) a second nucleotide sequence encoding the hinge, CH2 and CH3 of an immunoglobulin molecule.
24. The DNA molecule of claim 23, wherein the first nucleotide sequence encoding the extracellular domain of CTLA4 beginning with guanine at position 1 and ends with cytosine at position 375 of SEQ ID NO: 13.
25. An isolated nucleic acid molecule encoding the protein of any one of claims 1-22.
26. The nucleic acid molecule of claim 25 which is a cDNA having the sequence of SEQ ID NO: 13.
27. The nucleic acid molecule of claim 25 which is a cDNA having a portion of the sequence shown in SEQ ID NO:13 beginning with guanine at position 1 and ending with cytosine at position 375.
28. A plasmid which comprises the nucleic acid molecule of any one of claims 23-27.
29. A host vector system comprising a plasmid of claim 28 in a suitable host cell.
30. The host vector system of claim 29, wherein the suitable host cell is a bacterial cell.
31. The host vector system of claim 29, wherein the suitable host cell is a eucaryotic cell.
32. A method for producing the protein of any one of claims 1 - 22, comprising growing the vector system of any one of claims 29 - 31 so as to produce the protein in the host and recovering the protein so produced.
33. The protein of any one of claims 1-22, produced by the method of claim 32.
34. A pharmaceutical composition comprising the protein of any one of claims 1-22 and 33 and a suitable pharmaceutical carrier.
35. An in vitro method for regulating functional CTLA4 positive T cell interactions with B7 positive cells comprising contacting the B7 positive cells with a ligand for a B7 antigen, in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4 molecule.
36. The method of claim 35, wherein said B7 positive cells are B cells.
37. The method of claim 35, wherein the interaction of said CTLA4-positive T
cells with said B7 positive cells is inhibited.
38. Use of a ligand for a B7 antigen, for treating an immune system disease mediated by T-cell interactions with B7-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is the protein of any one of claims 1-22 and 33.
39. The use of claim 38, wherein said ligand is for inhibition of said T-cell interactions.
40. Use of a ligand for a B7 antigen, for regulating functional T-cell interactions with B7-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is the protein of any one of claims 1-22 and 33.
41. Use of a ligand for a B7 antigen, for treating an immune system disease mediated by T-cell interactions with B7-positive cells, said ligand being for contact with the B7 positive cells in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4 protein.
42. Use of a ligand for a B7 antigen for regulating functional T cell interactions with B7 positive cells, said ligand being for contact with the B7 positive cells in an amount effective to interfere with reaction of endogenous B7 antigen with CTLA4, wherein the ligand is a soluble CTLA4.
43. Use of a ligand for a B7 antigen, for treating an immune system disease mediated by T-cell interactions with B7-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is a CTLA4Ig fusion protein.
44. Use of a ligand for a B7 antigen, for regulating functional T-cell interactions with B7-positive cells, said ligand being in an amount effective for interference with reaction of endogenous B7 antigen with CTLA4, wherein said ligand is a CTLA4Ig fusion protein.
45. The use of any one of claims 38-44 for inhibiting said interactions of said T cells with said B7 positive cells.
46. The use of any one of claims 38, 41 and 43, wherein said immune system disease is transplant rejection, graft versus host disease (GVHD), or autoimmune disorders.
47. The use of any one of claims 38 - 46, wherein said B7-positive cells are B

cells.
48. A method for producing a pharmaceutical composition useful for treating an immune system disorder mediated by T-cell interactions with B7-positive cells comprising admixing a protein of any one of claims 1-22 and 33 with a pharmaceutically acceptable carrier.
49. A Chinese Hamster Ovary cell line having an ATCC No. 10762 and stably expressing CTLA4Ig fusion protein.
CA002110518A 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof Expired - Lifetime CA2110518C (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CA002580812A CA2580812A1 (en) 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US72361791A 1991-06-27 1991-06-27
US723,617 1991-06-27
PCT/US1992/005202 WO1993000431A1 (en) 1991-06-27 1992-06-16 Ctl4a receptor, fusion proteins containing it and uses thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CA002580812A Division CA2580812A1 (en) 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof

Publications (2)

Publication Number Publication Date
CA2110518A1 CA2110518A1 (en) 1993-01-07
CA2110518C true CA2110518C (en) 2007-05-22

Family

ID=24907003

Family Applications (2)

Application Number Title Priority Date Filing Date
CA002110518A Expired - Lifetime CA2110518C (en) 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof
CA002580812A Abandoned CA2580812A1 (en) 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof

Family Applications After (1)

Application Number Title Priority Date Filing Date
CA002580812A Abandoned CA2580812A1 (en) 1991-06-27 1992-06-16 Ctla4 receptor, fusion proteins containing it and uses thereof

Country Status (21)

Country Link
US (1) US5434131A (en)
EP (1) EP0606217B2 (en)
JP (6) JP3722375B2 (en)
KR (1) KR100238712B1 (en)
AT (1) ATE170562T1 (en)
AU (1) AU661854B2 (en)
CA (2) CA2110518C (en)
DE (2) DE122007000078I2 (en)
DK (1) DK0606217T4 (en)
ES (1) ES2123001T5 (en)
FI (2) FI112082B (en)
IE (2) IE922111A1 (en)
IL (4) IL159364A (en)
LU (1) LU91375I2 (en)
MX (1) MX9203605A (en)
NL (1) NL300303I2 (en)
NO (4) NO312465B1 (en)
NZ (2) NZ243286A (en)
PT (1) PT100637B (en)
WO (1) WO1993000431A1 (en)
ZA (1) ZA924782B (en)

Families Citing this family (193)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2003455C (en) * 1988-11-23 2000-02-22 Craig B. Thompson Immunotherapy involving cd28 stimulation
US6685941B1 (en) * 1988-11-23 2004-02-03 The Regents Of The University Of Michigan Methods of treating autoimmune disease via CTLA-4Ig
CA2071478A1 (en) * 1989-10-27 1991-04-28 Jeffery A. Bluestone Methods and compositions for promoting immunopotentiation
US6406696B1 (en) 1989-10-27 2002-06-18 Tolerance Therapeutics, Inc. Methods of stimulating the immune system with anti-CD3 antibodies
US5851795A (en) * 1991-06-27 1998-12-22 Bristol-Myers Squibb Company Soluble CTLA4 molecules and uses thereof
US6090914A (en) * 1991-06-27 2000-07-18 Bristol-Myers Squibb Company CTLA4/CD28Ig hybrid fusion proteins and uses thereof
US5770197A (en) * 1991-06-27 1998-06-23 Bristol-Myers Squibb Company Methods for regulating the immune response using B7 binding molecules and IL4-binding molecules
US5637481A (en) * 1993-02-01 1997-06-10 Bristol-Myers Squibb Company Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell
US6887471B1 (en) 1991-06-27 2005-05-03 Bristol-Myers Squibb Company Method to inhibit T cell interactions with soluble B7
US5962406A (en) * 1991-10-25 1999-10-05 Immunex Corporation Recombinant soluble CD40 ligand polypeptide and pharmaceutical composition containing the same
US6472510B1 (en) * 1992-02-14 2002-10-29 Bristol-Myers Squibb Company CD40 receptor ligands
CA2089229C (en) * 1992-02-14 2010-04-13 Alejandro A. Aruffo Cd40cr receptor and ligands therefor
CA2133075A1 (en) * 1992-04-07 1993-10-14 Craig B. Thompson CD28 Pathway Immunoregulation
US5397703A (en) * 1992-07-09 1995-03-14 Cetus Oncology Corporation Method for generation of antibodies to cell surface molecules
US5747034A (en) * 1992-07-09 1998-05-05 Chiron Corporation Methods and materials for the induction of T cell anergy
US5773253A (en) * 1993-01-22 1998-06-30 Bristol-Myers Squibb Company MYPPPY variants of CTL A4 and uses thereof
US6491916B1 (en) 1994-06-01 2002-12-10 Tolerance Therapeutics, Inc. Methods and materials for modulation of the immunosuppresive activity and toxicity of monoclonal antibodies
US6024957A (en) * 1993-06-02 2000-02-15 Research Corporation Technologies, Inc. Immunomodulators and methods for the prevention and reversal of organ transplant rejection using same
US6106834A (en) 1993-06-02 2000-08-22 Research Corporation Technologies, Inc. Use of anti-CD45 leukocyte antigen antibodies for immunomodulation
EP0665852A1 (en) * 1993-07-09 1995-08-09 Amgen Boulder Inc. Recombinant ctla4 polypeptides and methods for making the same
US5861310A (en) * 1993-11-03 1999-01-19 Dana-Farber Cancer Institute Tumor cells modified to express B7-2 with increased immunogenicity and uses therefor
JPH09500788A (en) 1993-07-26 1997-01-28 ダナ・ファーバー・キャンサー・インスティテュート・インコーポレイテッド B7-2: CTLA4 / CD28 counter receptor
US6723705B1 (en) 1993-08-19 2004-04-20 Gentics Institute, Inc. Tumor cells modified to express B7-2 with increased immunogenicity and uses therefor
US6084067A (en) * 1993-07-26 2000-07-04 Dana-Farber Cancer Institute CTLA4/CD28 ligands and uses therefor
US6824779B1 (en) 1993-07-26 2004-11-30 Dana-Farber Cancer Institute, Inc. Methods for inhibiting the interaction of B7-2 with its natural ligand
US6130316A (en) * 1993-07-26 2000-10-10 Dana Farber Cancer Institute Fusion proteins of novel CTLA4/CD28 ligands and uses therefore
US20050129670A1 (en) * 1993-07-26 2005-06-16 Genetics Institute, Llc. Tumor cells modified to express B7-2 with increased immunogenicity and uses therefor
AU7526894A (en) * 1993-08-16 1995-03-14 Arch Development Corporation B7-2: ctla4/cd28 counter receptor
WO1995006738A1 (en) * 1993-09-03 1995-03-09 Schering Corporation B70(b7-2):ctla-4 bonding protein
CA2185027A1 (en) * 1994-03-08 1995-09-14 Vassiliki A. Boussiotis Methods for modulating t cell unresponsiveness
AU784510B2 (en) * 1994-03-08 2006-04-13 Dana-Farber Cancer Institute, Inc. Methods for modulating T cell unresponsiveness
US6719972B1 (en) * 1994-06-03 2004-04-13 Repligen Corporation Methods of inhibiting T cell proliferation or IL-2 accumulation with CTLA4- specific antibodies
WO1996013584A1 (en) * 1994-11-01 1996-05-09 Targeted Genetics Corporation Chimeric receptors for the generation of selectively-activatable th-independent cytotoxic t cells
ATE384127T1 (en) * 1994-12-02 2008-02-15 Schering Corp CO-STIMULATORY T-CELL SURFACE ANTIGEN SLAM
US5576423A (en) 1994-12-02 1996-11-19 Schering Corporation Antibodies to the slam protein expressed on activated T cells
US6251957B1 (en) 1995-02-24 2001-06-26 Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant virus
US6372208B1 (en) 1999-09-28 2002-04-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant virus
US5652224A (en) 1995-02-24 1997-07-29 The Trustees Of The University Of Pennsylvania Methods and compositions for gene therapy for the treatment of defects in lipoprotein metabolism
US5872154A (en) * 1995-02-24 1999-02-16 The Trustees Of The University Of Pennsylvania Method of reducing an immune response to a recombinant adenovirus
WO1996031229A1 (en) * 1995-04-05 1996-10-10 Beth Israel Hospital Association Inhibiting rejection of a graft
US6113898A (en) * 1995-06-07 2000-09-05 Idec Pharmaceuticals Corporation Human B7.1-specific primatized antibodies and transfectomas expressing said antibodies
US7175847B1 (en) * 1995-06-07 2007-02-13 Biogen Idec Inc. Treating intestinal inflammation with anti-CD80 antibodies that do not inhibit CD80 binding to CTLA-4
US7153508B2 (en) * 1995-06-07 2006-12-26 Biogen Idec Inc. Treatment of B cell lymphoma using anti-CD80 antibodies that do not inhibit the binding of CD80 to CTLA-4
US5855887A (en) * 1995-07-25 1999-01-05 The Regents Of The University Of California Blockade of lymphocyte down-regulation associated with CTLA-4 signaling
US6051227A (en) 1995-07-25 2000-04-18 The Regents Of The University Of California, Office Of Technology Transfer Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US5811097A (en) * 1995-07-25 1998-09-22 The Regents Of The University Of California Blockade of T lymphocyte down-regulation associated with CTLA-4 signaling
US7041634B2 (en) 1995-09-27 2006-05-09 Emory University Method of inhibiting immune system destruction of transplanted viable cells
US6750334B1 (en) 1996-02-02 2004-06-15 Repligen Corporation CTLA4-immunoglobulin fusion proteins having modified effector functions and uses therefor
US6107056A (en) * 1996-02-22 2000-08-22 Oaks; Martin K. SCTLA-4 gene and product
PT892643E (en) * 1996-03-20 2002-09-30 Univ Emory METHODS FOR INHIBITING AN IMMUNITY RESPONSE BLOCKING THE GP39 / CD40 AND CTLA4 / CD28 / B7 CIRCUITS AND USES FOR THE EFFECT
US5786152A (en) * 1996-04-26 1998-07-28 Amgen Inc. Methods of inhibiting syp binding to a CTLA-4 receptor
ID21676A (en) * 1996-11-08 1999-07-08 Idec Pharma Corp IDENTIFICATION OF SPECIFIC BOND INTERACTIONS INTERACTIONS BETWEEN ANTIBODIES AND ANTIGENTS OF DETERMINATION B7.1 AND B7.2 SPECIFIC HUMAN
US20060034844A1 (en) * 1996-12-04 2006-02-16 The Regents Of The University Of California Stimulation of T cells against self antigens using CTLA-4 blocking agents
US20040023917A1 (en) * 1996-12-31 2004-02-05 Bennett C. Frank Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US6319906B1 (en) 1996-12-31 2001-11-20 Isis Pharmaceuticals Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US6077833A (en) * 1996-12-31 2000-06-20 Isis Pharmaceuticals, Inc. Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US7235653B2 (en) * 1996-12-31 2007-06-26 Isis Pharmaceuticals, Inc. Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
KR19980066046A (en) * 1997-01-18 1998-10-15 정용훈 High-CTLA4-Ig fusion protein
US20030219863A1 (en) * 1997-01-31 2003-11-27 Bristol-Myers Squibb Company Soluble CTLA4 mutant molecules and uses thereof
ZA98533B (en) * 1997-01-31 1999-07-22 Bristol Myers Squibb Co Soluble CTLA4 mutant molecules and uses thereof.
JP2001523958A (en) 1997-03-21 2001-11-27 ブライハム アンド ウィミンズ ホスピタル,インコーポレイテッド CTLA-4 binding peptides for immunotherapy
SE9701127D0 (en) * 1997-03-26 1997-03-26 Karolinska Innovations Ab Antigenic fusion protein carrying GALal, 3GAL epitopes
EP0972054B1 (en) * 1997-03-27 2008-12-10 Csl Limited Enhancement of immune response using targeting molecules
DK0975755T3 (en) 1997-04-16 2007-06-11 Millennium Pharm Inc CRSP protein (cysteine-rich secreted proteins), encoding nucleic acid molecules, and uses thereof
ATE264688T1 (en) 1997-06-12 2004-05-15 Applied Research Systems CD28/CTLA-4 INHIBITING PEPTIDOMIMETICS AND PHARMACEUTICAL COMPOSITIONS CONTAINING SAME
AU9095498A (en) * 1997-09-19 1999-04-12 Yoshitomi Pharmaceutical Industries, Ltd. Oligopeptide compounds
US7223729B2 (en) * 1997-11-07 2007-05-29 Trillium Therapeutics Inc. Methods of treating allergy by administering a CD200 protein
US6955811B2 (en) * 1997-11-07 2005-10-18 Trillium Therapeutics Inc. Methods of inhibiting immune response suppression by administering antibodies to OX-2
CA2308765C (en) 1997-11-07 2010-10-12 Transplantation Technologies Inc. The use of an ox-2 protein or nucleic acid in immunomodulation
AUPP221098A0 (en) 1998-03-06 1998-04-02 Diatech Pty Ltd V-like domain binding molecules
ATE298248T1 (en) * 1998-04-15 2005-07-15 Brigham & Womens Hospital T-CELL INHIBITING RECEPTOR COMPOSITIONS AND USE THEREOF
US7078512B2 (en) 1998-05-01 2006-07-18 Schering-Plough Animal Health Corporation Nucleic acid encoding feline CD86
US7279168B2 (en) 1998-05-01 2007-10-09 Texas A & M University System Recombinant virus expressing foreign DNA encoding feline CD86 and uses thereof
US20050031611A1 (en) * 1998-05-08 2005-02-10 Beth Israel Deaconess Medical Center Transplant tolerance by costimulation blockade and T-cell activation-induced apoptosis
US6682741B1 (en) 1998-06-10 2004-01-27 The United States Of America As Represented By The Department Of Health And Human Services β2 microglobulin fusion proteins and high affinity variants
JP4087563B2 (en) * 1998-06-15 2008-05-21 ジーティーシー バイオセラピューティックス インコーポレイテッド Erythropoietin analog-human serum albumin fusion
US20050181482A1 (en) * 2004-02-12 2005-08-18 Meade Harry M. Method for the production of an erythropoietin analog-human IgG fusion proteins in transgenic mammal milk
US6593133B1 (en) 1998-07-06 2003-07-15 Nsgene A/S Neurotrophic factors
CZ20011021A3 (en) 1998-09-21 2001-10-17 Genetics Institute, Inc. Method of modulating immune response to therapeutic proteins
US6521419B1 (en) 1998-09-22 2003-02-18 Kanakaraju Koduri Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
US6800457B2 (en) 1998-09-22 2004-10-05 Bristol-Myers Squibb Company Expression vectors containing hot spot for increased recombinant protein expression in transfected cells
US7109003B2 (en) 1998-12-23 2006-09-19 Abgenix, Inc. Methods for expressing and recovering human monoclonal antibodies to CTLA-4
US6682736B1 (en) 1998-12-23 2004-01-27 Abgenix, Inc. Human monoclonal antibodies to CTLA-4
EA006972B1 (en) 1998-12-23 2006-06-30 Пфайзер Инк. Human monoclonal antibodies to ctla-4 and methods for use thereof
US7011833B1 (en) 1999-05-06 2006-03-14 Genetics Institute, Inc. Enhancing immune responses with B7-1 or B7-2 in the absence of a crosslinking agent
AU6615500A (en) * 1999-07-28 2001-02-19 Genetics Institute Inc. Preventing immune-mediated abortion by inhibiting costimulation
US7605238B2 (en) 1999-08-24 2009-10-20 Medarex, Inc. Human CTLA-4 antibodies and their uses
EP1792991A1 (en) 1999-08-24 2007-06-06 Medarex, Inc. Human CTLA-4 antibodies and their uses
EP1248645B1 (en) * 2000-01-03 2007-04-18 Tr Associates, L.L.C. Novel chimeric proteins and their use
US7572631B2 (en) * 2000-02-24 2009-08-11 Invitrogen Corporation Activation and expansion of T cells
US7541184B2 (en) 2000-02-24 2009-06-02 Invitrogen Corporation Activation and expansion of cells
AR031699A1 (en) * 2000-05-26 2003-10-01 Bristol Myers Squibb Co MUTANT MOLECULA OF CTLA4 SOLUBLE THAT LINKS TO CD80 AND / OR CD86, NUCLEIC ACID MOLECULA THAT CODIFIES, VECTOR AND VECTOR SYSTEM THAT UNDERSTANDS THIS LAST, CELLULA BONE THAT HAS IT, METHOD TO PRODUCE A PROTEIN AND MUTE PROTEIN, USE OF THE MUTING MOLECULA TO PREPARE A MEDIC
US7094874B2 (en) 2000-05-26 2006-08-22 Bristol-Myers Squibb Co. Soluble CTLA4 mutant molecules
WO2001095928A2 (en) * 2000-06-09 2001-12-20 Bristol-Myers Squibb Company Methods for regulating a cell-mediated immune response by blocking lymphocytic signals and by blocking lfa-1 mediated adhesion
US20050048614A1 (en) * 2000-06-13 2005-03-03 Children's Medical Center Corporation Biosynthetic oncolytic molecules and uses therefor
US20040034193A1 (en) * 2001-06-13 2004-02-19 Samy Ashkar Biosynthetic oncolytic molecules and uses therefor
KR100864120B1 (en) 2000-07-03 2008-10-16 브리스톨-마이어스스퀴브컴파니 Methods for Treating Rheumatic Diseases Using a Soluble CTLA4 Molecule
US20040022787A1 (en) 2000-07-03 2004-02-05 Robert Cohen Methods for treating an autoimmune disease using a soluble CTLA4 molecule and a DMARD or NSAID
US6875904B2 (en) * 2000-09-20 2005-04-05 The Ohio State University Research Foundation Animal model for identifying agents that inhibit or enhance CTLA4 signaling
US7014998B2 (en) * 2000-09-30 2006-03-21 Yale University Screening immunomodulatory agents by CTLA-4 upregulation
US9249229B2 (en) * 2000-12-08 2016-02-02 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
US20060057651A1 (en) * 2000-12-08 2006-03-16 Bowdish Katherine S Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
US20040198661A1 (en) * 2000-12-08 2004-10-07 Bowdish Katherine S. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
EP1341902A2 (en) * 2000-12-08 2003-09-10 Alexion Pharmaceuticals, Inc. Chronic lymphocytic leukemia cell line and its use for producing an antibody
US7408041B2 (en) * 2000-12-08 2008-08-05 Alexion Pharmaceuticals, Inc. Polypeptides and antibodies derived from chronic lymphocytic leukemia cells and uses thereof
US7754208B2 (en) * 2001-01-17 2010-07-13 Trubion Pharmaceuticals, Inc. Binding domain-immunoglobulin fusion proteins
US20030133939A1 (en) * 2001-01-17 2003-07-17 Genecraft, Inc. Binding domain-immunoglobulin fusion proteins
US7829084B2 (en) 2001-01-17 2010-11-09 Trubion Pharmaceuticals, Inc. Binding constructs and methods for use thereof
HUP0303930A3 (en) * 2001-01-26 2012-09-28 Univ Emory Methods of inducing organ transplant tolerance and correcting hemoglobinopathies
TW200526779A (en) * 2001-02-08 2005-08-16 Wyeth Corp Modified and stabilized GDF propeptides and uses thereof
NZ529126A (en) 2001-03-28 2010-07-30 Biogen Idec Inc Use of neublastin polypeptides for treating allodynia, hyperalgesic pain and phantom pain
US20040058445A1 (en) * 2001-04-26 2004-03-25 Ledbetter Jeffrey Alan Activation of tumor-reactive lymphocytes via antibodies or genes recognizing CD3 or 4-1BB
DK1397153T3 (en) 2001-05-23 2008-05-26 Bristol Myers Squibb Co Method for protecting allogeneic islet cell graft using soluble CTLA4 mutant molecules
KR100453877B1 (en) 2001-07-26 2004-10-20 메덱스젠 주식회사 METHOD OF MANUFACTURING Ig-FUSION PROTEINS BY CONCATAMERIZATION, TNFR/Fc FUSION PROTEINS MANUFACTURED BY THE METHOD, DNA CODING THE PROTEINS, VECTORS INCLUDING THE DNA, AND CELLS TRANSFORMED BY THE VECTOR
US20030086940A1 (en) * 2001-08-10 2003-05-08 Cristina Costa Engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system
US20040116675A1 (en) * 2001-12-14 2004-06-17 Tso J. Jun Silenced anti-cd28 antibodies and use thereof
ATE451387T1 (en) * 2001-12-18 2009-12-15 Endocube Sas NEW CELL DEATH-ASSOCIATED PROTEINS FROM THE THAP FAMILY AND PAR4-RELATED SIGNALING PATHWAYS INVOLVED IN THE CONTROL OF APOPTOSIS
US7858297B2 (en) 2001-12-18 2010-12-28 Centre National De La Recherche Scientifique Cnrs Chemokine-binding protein and methods of use
US6578724B1 (en) * 2001-12-29 2003-06-17 United States Can Company Connector for use in packaging aerosol containers
EP1585817B1 (en) 2002-02-20 2009-09-02 The General Hospital Corporation Conjugates comprising a biodegradable polymer and uses therefor
US20030219436A1 (en) * 2002-03-15 2003-11-27 Ledbetter Jeffrey A. Compositions and methods to regulate an immune response using CD83 gene expressed in tumors and using soluble CD83-Ig fusion protein
NZ536420A (en) * 2002-04-12 2008-04-30 Medarex Inc Methods of treatment using CTLA-4 antibodies
WO2003092624A2 (en) * 2002-05-02 2003-11-13 University Of Connecticut Health Center Use of heat shock proteins to enhance efficacy of antibody therapeutics
WO2004034995A2 (en) * 2002-10-15 2004-04-29 University Of Pittsburgh Of The Commonwealth System Of Higher Education Methods and reagents for inducing immunity
MXPA05006522A (en) * 2002-12-23 2006-02-17 Bristol Myers Squibb Co Product quality enhancement in mammalian cell culture processes for protein production.
EP1575998A4 (en) * 2002-12-23 2007-07-25 Bristol Myers Squibb Co Mammalian cell culture processes for protein production
UA91178C2 (en) 2003-01-31 2010-07-12 Байоджен Айдек Ма Інк. Mutated neublastin
GB0303663D0 (en) * 2003-02-18 2003-03-19 Lorantis Ltd Assays and medical treatments
US7897582B2 (en) * 2003-05-23 2011-03-01 Isis Pharmaceuticals, Inc. Oligonucleotide compositions and methods for the modulation of the expression of B7 protein
US7960355B2 (en) * 2003-05-23 2011-06-14 Isis Pharmaceuticals, Inc. Compositions and methods for the modulation of the expression of B7 protein
US6971600B2 (en) * 2003-06-30 2005-12-06 Heligear Engineering (H.K.) Co., Ltd. Oscillation mechanism for fishing reel
US7754209B2 (en) 2003-07-26 2010-07-13 Trubion Pharmaceuticals Binding constructs and methods for use thereof
MXPA06001225A (en) * 2003-08-04 2006-04-11 Bristol Myers Squibb Co Methods for treating cardiovascular disease using a soluble ctla4 molecule.
WO2005044188A2 (en) * 2003-10-27 2005-05-19 Amgen Inc. Compositions and methods to modulate an immune response to an immunogenic therapeutic agent
US20080152655A1 (en) * 2004-09-08 2008-06-26 The Ohio State University Research Foundation Combination Therapy With Anti-Ctla4 and Anti-4-1BB Antibodies
WO2006029219A2 (en) * 2004-09-08 2006-03-16 Ohio State University Research Foundation Human monoclonal anti-ctla4 antibodies in cancer treatment
GB0421465D0 (en) * 2004-09-27 2004-10-27 Chiron Srl Group A streptococcus protein
CN101198347A (en) * 2005-04-06 2008-06-11 布里斯托尔-迈尔斯斯奎布公司 Methods for treating immune disorders associated with graft transplantation with soluble CTLA4 mutant molecules
CA2614640A1 (en) 2005-07-11 2007-01-18 Macrogenics, Inc. Methods for the treatment of autoimmune disorders using immunosuppressive monoclonal antibodies with reduced toxicity
PT2298815E (en) 2005-07-25 2015-07-16 Emergent Product Dev Seattle B-cell reduction using cd37-specific and cd20-specific binding molecules
JP4899083B2 (en) * 2005-08-29 2012-03-21 Smc株式会社 Automatic reduction ratio switching device
US8501704B2 (en) 2005-11-08 2013-08-06 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
AU2013202533B2 (en) * 2005-11-08 2015-11-12 Sarepta Therapeutics, Inc. Immunosuppression Compound and Treatment Method
CA2628093A1 (en) * 2005-11-08 2007-05-18 Avi Biopharma, Inc. Antisense oligonucleotide analog compounds targeting proprocessed ctla-4 mrna
EP1954311A4 (en) 2005-12-07 2009-12-23 Medarex Inc Ctla-4 antibody dosage escalation regimens
KR101398713B1 (en) 2005-12-20 2014-06-12 브리스톨-마이어스 스큅 컴퍼니 Compositions and methods for producing a composition
DK2463305T3 (en) 2006-01-12 2016-08-29 Alexion Pharma Inc Antibodies to OX-2 / CD200 and uses thereof
US8940871B2 (en) 2006-03-20 2015-01-27 The Regents Of The University Of California Engineered anti-prostate stem cell antigen (PSCA) antibodies for cancer targeting
US7528111B2 (en) * 2006-05-12 2009-05-05 Bristol-Myers Squibb Company Method of vaccinating subjects receiving immune modulating therapy
MX2008015524A (en) 2006-06-12 2009-01-13 Trubion Pharmaceuticals Inc Single-chain multivalent binding proteins with effector function.
SG177907A1 (en) 2006-06-14 2012-02-28 Macrogenics Inc Methods for the treatment of autoimmune disorders using immunosuppressive monoclonal antibodies with reduced toxicity
BRPI0814645A2 (en) * 2007-07-25 2015-01-27 Alexion Pharma Inc METHODS AND COMPOSITIONS FOR TREATING AUTOIMMUNE DISEASE.
JP6126773B2 (en) 2007-09-04 2017-05-10 ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア High affinity anti-prostatic stem cell antigen (PSCA) antibody for cancer targeting and detection
WO2009058564A2 (en) 2007-11-01 2009-05-07 Maxygen, Inc. Immunosuppressive polypeptides and nucleic acids
WO2009126944A1 (en) 2008-04-11 2009-10-15 Trubion Pharmaceuticals, Inc. Cd37 immunotherapeutic and combination with bifunctional chemotherapeutic thereof
US7915222B2 (en) * 2008-05-05 2011-03-29 Bristol-Myers Squibb Company Method of preventing the development of rheumatoid arthritis in subjects with undifferentiated arthritis
ES2657220T3 (en) 2008-10-02 2018-03-02 Aptevo Research And Development Llc CD86 antagonist multi-target binding proteins
JP2012508774A (en) * 2008-11-13 2012-04-12 エマージェント プロダクト デベロップメント シアトル, エルエルシー CD37 immunotherapy combination therapy and use thereof
US8840889B2 (en) * 2009-08-13 2014-09-23 The Johns Hopkins University Methods of modulating immune function
US9540426B2 (en) * 2009-10-06 2017-01-10 Bristol-Myers Squibb Company Mammalian cell culture processes for protein production
US8435516B2 (en) 2009-10-12 2013-05-07 Pfizer Inc. Cancer treatment
CN102822198B (en) 2010-03-12 2016-08-31 艾伯维生物医疗股份有限公司 CTLA4 albumen and its purposes
WO2012042480A1 (en) 2010-09-28 2012-04-05 Kahr Medical Ltd. Compositions and methods for treatment of hematological malignancies
WO2013010537A1 (en) 2011-07-20 2013-01-24 Aarhus Universitet Method of treating morphea
WO2013148049A1 (en) 2012-03-29 2013-10-03 The General Hospital Corporation Recombinant cytotoxic t-lymphocyte-associated protein 4 (ctla4)
US20150118244A1 (en) 2012-05-10 2015-04-30 Bristol-Myers Squibb Company Anti-tumor antibodies as predictive or prognostic biomarkers of efficacy and survival in ipilimumab-treated patients
JP6228971B2 (en) 2012-05-11 2017-11-08 メディミューン,エルエルシー CTLA-4 variant
US8735359B2 (en) 2012-05-24 2014-05-27 Orban Biotech Llc Combinations of modalities for the treatment of diabetes
AU2013284460A1 (en) 2012-06-27 2015-01-29 Dmnomore CTLA4 fusion proteins for the treatment of diabetes
US20140112958A1 (en) 2012-10-24 2014-04-24 Mwm Biomodels Gmbh Pancreatic islets of transgenic LEA29Y animals for treating diabetes
WO2014138188A1 (en) 2013-03-07 2014-09-12 The General Hospital Corporation Human ctla4 mutants and use thereof
EP3049442A4 (en) 2013-09-26 2017-06-28 Costim Pharmaceuticals Inc. Methods for treating hematologic cancers
EP2883883A1 (en) 2013-12-16 2015-06-17 Cardio3 Biosciences S.A. Therapeutic targets and agents useful in treating ischemia reperfusion injury
JOP20200094A1 (en) 2014-01-24 2017-06-16 Dana Farber Cancer Inst Inc Antibody molecules to pd-1 and uses thereof
JOP20200096A1 (en) 2014-01-31 2017-06-16 Children’S Medical Center Corp Antibody molecules to tim-3 and uses thereof
GB2523399B (en) 2014-02-25 2019-03-13 Orban Tihamer A composition comprising ten overlapping peptide fragments of the entire preproinsulin sequence
WO2016040882A1 (en) 2014-09-13 2016-03-17 Novartis Ag Combination therapies of egfr inhibitors
ES2856844T3 (en) 2014-12-31 2021-09-28 Checkmate Pharmaceuticals Inc Combined antitumor immunotherapy
JP2018512856A (en) 2015-04-17 2018-05-24 アルパイン イミューン サイエンシズ インコーポレイテッド Immunomodulating proteins with tunable affinity
MY197562A (en) 2015-09-21 2023-06-23 Aptevo Res & Development Llc Cd3 binding polypeptides
EP3192805A1 (en) 2016-01-15 2017-07-19 Humanitas Mirasole S.p.A. Inhibitors of t cell activation or stimulation and uses thereof
MX2019009660A (en) 2017-02-28 2019-10-02 Bristol Myers Squibb Co Use of anti-ctla-4 antibodies with enhanced adcc to enhance immune response to a vaccine.
CA3055769A1 (en) 2017-04-03 2018-10-11 Oncologie, Inc. Methods for treating cancer using ps-targeting antibodies with immuno-oncology agents
WO2019067499A1 (en) 2017-09-27 2019-04-04 Alexion Pharmaceuticals, Inc. Biomarker signature for predicting tumor response to anti-cd200 therapy
MA50360A (en) 2017-10-10 2020-08-19 Alpine Immune Sciences Inc CTLA-4 VARIANTS IMMUNOMODULATOR PROTEINS AND THEIR USES
EP3617230A1 (en) 2018-09-03 2020-03-04 BioInvent International AB Novel antibodies and nucleotide sequences, and uses thereof
AU2019387218A1 (en) 2018-11-26 2021-06-03 Massachusetts Institute Of Technology Compositions and methods for immune tolerance
US20230025648A1 (en) 2019-11-21 2023-01-26 Bristol-Myers Squibb Company Label-free n-glycan quantification methods
WO2022178078A1 (en) 2021-02-19 2022-08-25 Theripion, Inc. Paraoxonase fusion polypeptides and related compositions and methods
GB202115803D0 (en) 2021-11-03 2021-12-15 Ducentis Biotherapeutics Ltd Novel proteins
WO2023214387A1 (en) 2022-05-06 2023-11-09 Ducentis Biotherapeutics Limited Novel cd200 fusion proteins
WO2023214388A1 (en) 2022-05-06 2023-11-09 Ducentis Biotherapeutics Limited Novel cd200 fusion proteins
CN114686427B (en) * 2022-05-23 2022-07-29 中国人民解放军总医院第一医学中心 Spleen-regulating B lymphocyte and preparation method and application thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4399216A (en) * 1980-02-25 1983-08-16 The Trustees Of Columbia University Processes for inserting DNA into eucaryotic cells and for producing proteinaceous materials
US4683202A (en) * 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) * 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences

Also Published As

Publication number Publication date
IL102294A (en) 2004-09-27
LU91375I2 (en) 2008-01-07
JPH06508989A (en) 1994-10-13
NO934801D0 (en) 1993-12-23
NO20020491L (en) 1994-02-21
WO1993000431A1 (en) 1993-01-07
IL102294A0 (en) 1993-01-14
JP2002017349A (en) 2002-01-22
AU2240092A (en) 1993-01-25
NO2007013I1 (en) 2007-11-26
CA2580812A1 (en) 1993-01-07
DE122007000078I2 (en) 2011-01-13
KR940701445A (en) 1994-05-28
DE122007000078I1 (en) 2008-02-14
ES2123001T3 (en) 1999-01-01
DE69226871T3 (en) 2009-09-24
EP0606217B2 (en) 2008-12-03
NO934801L (en) 1994-02-21
US5434131A (en) 1995-07-18
ZA924782B (en) 1993-12-27
NZ243286A (en) 1996-03-26
JP4159266B2 (en) 2008-10-01
CA2110518A1 (en) 1993-01-07
JP3722375B2 (en) 2005-11-30
ATE170562T1 (en) 1998-09-15
IE20010097A1 (en) 2002-03-20
PT100637A (en) 1994-05-31
MX9203605A (en) 1993-11-01
FI115057B (en) 2005-02-28
NL300303I1 (en) 2008-01-02
FI20022285A (en) 2002-12-30
NZ264712A (en) 1996-03-26
EP0606217A1 (en) 1994-07-20
IE922111A1 (en) 1992-12-30
IL159364A (en) 2005-08-31
FI935795A0 (en) 1993-12-22
DK0606217T4 (en) 2009-03-30
NO2012001I2 (en) 2016-02-29
JP2003174872A (en) 2003-06-24
IL162430A0 (en) 2005-11-20
FI112082B (en) 2003-10-31
NO2007013I2 (en) 2011-02-21
NO20020491D0 (en) 2002-01-30
NL300303I2 (en) 2008-01-02
NO318806B1 (en) 2005-05-09
DE69226871T2 (en) 1999-05-12
JP2002003399A (en) 2002-01-09
KR100238712B1 (en) 2000-01-15
JP2003096097A (en) 2003-04-03
NO2012001I1 (en) 2012-01-09
JP2003012546A (en) 2003-01-15
PT100637B (en) 1999-06-30
EP0606217B1 (en) 1998-09-02
FI935795A (en) 1993-12-22
ES2123001T5 (en) 2009-04-16
AU661854B2 (en) 1995-08-10
DK0606217T3 (en) 1998-11-09
DE69226871D1 (en) 1998-10-08
NO312465B1 (en) 2002-05-13
IL159364A0 (en) 2004-06-01

Similar Documents

Publication Publication Date Title
CA2110518C (en) Ctla4 receptor, fusion proteins containing it and uses thereof
CA2113744C (en) Methods for regulating the immune response using ctla4-binding molecules and il4-binding molecules
US6090914A (en) CTLA4/CD28Ig hybrid fusion proteins and uses thereof
US7572772B2 (en) Soluble CTLA4 mutant molecules
US5885796A (en) CTLA4 receptor and uses thereof
US5844095A (en) CTLA4 Ig fusion proteins
MXPA95001794A (en) Ctla4 molecules and il-4 link molecules and uses of mis

Legal Events

Date Code Title Description
EEER Examination request
MKEX Expiry