CA2106309A1 - Plant chitinase gene and use thereof - Google Patents

Abstract

A DNA sequence comprising the sugar beet chitinase 4 DNA sequence shown in SEQ ID NO.1 or an analogue or subsequence thereof is disclosed. The polypeptide encoded by the DNA sequence, also termed the sugar beet chitinase 4 enzyme, has a high antifungal activity due to a bifunctional catalytic activity (i.e. a chitinase and a lysozyme activity) which makes the enzyme highly effective in inhibiting the growth of chitin-containing fungi. An even improved antifungal effect is obtained when the sugar beet chitinase 4 enzyme is used in combination with other pathogenesis related proteins, especially in combination with a second different chitinase and a .beta.-1,3-glucanase. A preferred use of the DNA sequence disclosed herein, optionally in combination with DNA sequences encoding other pathogenesis related proteins, is in the construction of genetically transformed plants, especially genetically transfrmed sugar beet plants, having an increased resistance to chitin-containing fungi as compared to untransformed plants.

Description

W O 92/17~91 ~ ~ ~ 6 3 ~ 9 P~T/DK92/~010~

A PLANT CHITINASE GENE AND ~SE THEREOF

FIELD OF THE I~ENTION

The present invencion relates to a D~ sequence encoding the sugar beet chitinase referred to in the following as "the sugar beet chiti-; nase 4" or an analogue of said DNA sequence encoding a polypeptidehaving the antifungal activity of sugar beet chitinase 4, as well as to a genetic construct useful for the construction of genetically transformed plants having an increased resistance to plant pathogens containing chitin, such as phytopathogenic fungi, as compared to un-transformed plants. The genetic construct comprises and is capable ofexpressing the DNA sequence of the invention, preferably in combina-tion with a DNA sequence encoding a second chitinase different from sugar beet chitinase 4 and a DNA sequence encoding a ~-l,3-glucanase.
In another aspect, the present invention relates to a genetically transformed plant, especially a genetically transformed sugar beet plant, from which a polypeptide having the antifungal activity of the sugar beet chitinase 4 is expressed in an increased amount as com-pared to the untransformed plant, preferably in combination with a polypeptide having chitinase activity and a polypeptide having ~-l,3-glucanase activity so as to result in an increased resistance tochitin-containing plant pathogens.

.~ BACKGROUND OF THE INVENTION
~' ' Most plants are susceptible to infection by pathogens such as micro-organisms and develop various undesirable disease symptoms upon infection which cause retarded growth, reduced yield and consequently economical loss to farmers. The plants respond to infection with several defense mechanisms including phytoalexins, deposition of lignin-like material, accumulation of cell wall hydroxyproline-rich glycoproteins, pathogenesis related proteins (PR-proteins) and in-crease in the activity of several lytic enzymes such as chitinasesand ~-l,3-glucanases. Some of these responses can be induced not only directly by infec~ion, but also by exposure of the plant to elicitors isolated from fungal cell walls, and in some cases bv exposure to exogenous chemicals such as ethylene. The full capacity of the de-3a fense mechanism of the plant is~ however. normallv delaved in rela-F~EPLACEMENTSHEEr .
' ~

W O 92/17591 2 ~ ~ 6 3 ~ ~ PCT/DK9~tOolo~

-Lion ~o the onses or infection. and thus. the plant may be se~erel~
injured betore its defense mechanism reaches iLs ma~imum capaci,y.
Also. .he defense mechanism OL the ~iant ma~ no~ i~. i.self be sufr.i-cientl. s.rong .o efiectively comoat the infec ious organism. There-; fore. a normal and necessary procedure is .o trea~ inrected plan.s orplants susceptible to infection ~ith a chemical. e.g. a rungicide.
either as a prophylactic treatment or shortly after infection.

However. the use of a chemical treatment is neither desirable from an ecological nor from an economic point of view and it would be desir-able to be able to enhance the defense of the host plant itself b;introducing new and!or improved genes by genetic engineering. A
further advantageous effect of this strategy would be the immediate inhibition or the fungal attack which is obtained. leading tO a retarded epidemic establishment of the infecting fungi in plant crops and thus an overall reduction in the effect of the infection.

The cell walls of many phytopathogenic fungi contain chitin and glùcan, the chitin constituting the major component of the tips of the hyphae. The enzymes chitinase and ~-1,3-glucanase have been shown to be capable of enzymatically digesting the.fungal cell walls so as to result mainly in soluble dimers or oligomers of N-acetyl-D-glucos-amine and D-glucose.

Chitinase and ~-1.3-glucanase activity has been observed in piant species such as tobacco. barley, potato, rice, maize~ corn, bean, tomato, cucumber, wheat germ,~rape seed and pea and it has been shown that the chitinase activity increases in response to infection with most phytopathogenic fungi.

Plant chitinases have been purified and characterized from crop plants such as tobacco, barley, corn, tomato~ bean and pea, and cD~A
and genomic clones have been obtained therefrom. Plant chitinases are reviewed bv Bol and Linthorst. 1990 and Boller, 1988.

Several publications have discussed bacterial and plant chitinases and the use thereof in the construction of transgenic plants having an increased resistance to various microorganisms such as fungi.

W O 92/1759l ~ 3 `J 9 PCT/DK92/0~10X

EP 0 292 4'~ relaLes basicall; LO .:ne regenera.ion or fer.ile ~3 ma-s plants and men~ions. ..~cer 2iia . .ha. a ~obacco chi.inase gen_ ma~ be in~roduced ir. .he plan in oraer ~o ma~e i, resis.an. LC
pathogens. Chitinase genes or other sources and other plants Lnan e^
mavs are no. men.ioned.

EP 0 290 123, W0 88/00976 and US 4 940 840 disclose the use of chiti-nases of bacterial origin in the construction o:E transgenic plants:
chitinase of plan~ origin is.no~ men~ioned or alternativel; onl~
men~ioned in general terms.

~0 90/07001 discloses DNA constructs comprising a high level promoter operablv linked to a DNA sequence encoding a plant chitinase~ which constructs are used in the transformation of plants so as to achieve overexpression of chitinase in the plant and thereby conferring ; resistance eo plant pathogenic fungi. The only plant chitinase e~-emplified is a bean chitinase.

EP 0 392 225, EP 0 307 841, EP 0 332 104, EP 0 440 304 and EP 0 418 695 disclose the construction of transgenic plants harbouring DNA sequences encoding plant pathogenesis-related proteins (PRP), e.g. chitinase and ~-1,3-glucanase. Pathogenesis-related proteins from sugar beet plants or transgenic sugar beet plants are not mentioned.

EP 0 448 511 also relates to transgenic plants comprising recombinant DNA sequences encoding hydrolytic enzymes such as chitinases and glucanases. Additionally, the reference relates to compositions comprising hydrolytic enzymes such as glucanase and chitinase for use for controlling planc pa~hogens. Chitinase or glucanase from sugar beet are not mentioned.

. W0 91/06312 discloses a composition for protecting a harvested crop comprising endoenzYmes such as glucanase or chitinase. No particular source of chitinase or glucanase is mentioned.

.
, .
. . . : .
' ' ' -. ' , ~
, .. . .
.
. .~ . . . ,' , '~

~'0 92/17591 PCT/DK92/OOlOX
~1~63~ 1 Rousseau-Limou_in M. and Fri~ '1991) describe cne proauc~ion or basic and acidic PR-proteins in sugar bee~s infected wi;n Cercos?ora ~esicoia and .ine serologicai rela.ion or .hese PR-proteins ~o .h- P~-proteins in tobacco. The described PR-pro.eir.s are found to ~-seroiogical related to tobacco PR-proteins wnereas the su~ar bee chi.inase l oî the presen: ir.-enrior. does no- show a serolo-ical relationship to any known chitinase. confer below. No information about the amino acid sequence or nucleotide sequence of any of the PR-proteins is given.

In conclusion. none of the above cited publications disclose anv sugar beet chitinase enzyme or the use thereof in the construction of transgenic plan~s.

At the Phytochemical Societv of ~urope International Symposium, Norwich, United Kingdom, April 11-13~ 1989: Biochemistry and Molecu-1~ lar Biology of Plant: Pathogen Interactions, the present inventors disclosed the isolation and purification of 6 chitinase isoenzymes, including chitinase 4, from the leaves of sugar beet plants infected by Cercospora beticola, a phytopathogenic chitin-containing fungi.
The chitinase isoenzymes were characterized by their molecular weight and kinetics of chitin hydrolysis. Chitinase preparations were indi-cated to be capable of hydrolyzing newly synthesized chitin in the cell wall of the growing fungi. No further characterization was reported and the chitinase enzymes were not separately discussed.

At the APS/CPS (The American Phytopathological Society/The Canadian 25 Phytopathology Society) 1990 Joint Meeting Program held August 4-8, 1990 in Michigan, USA and at the 5th International Symposium on the Molecular Genetics of Plant-Microbe Interactions held in Interlaken, Switzerland September 9-14, 1990, the present inventors presented an abstract and a poster showing the amino acid composition of various : 30 sugar beet chitinase isoenzymes. including chitinase 4. It was mentioned - for the first time - that two serologically different groups of chitinase enzymes are present in sugar beet ?lants. This statement was no. further qualified.
. . .

WO 92tl7591 ~ 6 3 ~ 9 PCT/DK92/OOlOX

In the abstrac. and poster presented bv the presen- inventors at the 8th Congress of the Medi~erranean Phytopathological ~nion, held in Agadir, .~lorocco in October ~8-No~ember 3. 1990. i is mentioned tna an~ibodies has been raised agains~ whea ~erm chi~inase. .hree suea~
beet chitinases and two ~-1.3- giucanases and tha, ~-terminal ana parlial amino acid sequencing have been performed on ~ of the to~ai of 9 purified chitinase isoenzymes. Only the N-terminai sequence of the sugar bee~ chitinase isoenzyme 2 was disclosed.

In the Annual Report 1989 from the Center for Plan~ Biotechnology 10 (Denmar~) which issued on August 20, 1990, the above results are disclosed and it is furthermore disclosed that one of the genes encoding a sugar beet chitinase has been isolated and characteri~ed, inter alia by nucleotide sequencing. However, although i~ is not directly expressed in this publication, this gene encodes chitinase 1 and not the sugar beet chitinase 4. In retrospect and in view of the disclosure of the present application, it is evident that this chitinase is not chitinase 4 because of the high degree of homology (about 50%) with other known sequences of chitinase genes from tobacco and bean. In contrast, as it appears from Example 11, there is a very low degree of homology between chitinase 4 and the other known chitinases.

None of the above cited references mention or indicate the amino acid sequence of the sugar beet chitinase 4 enzyme or of the DNA sequence encoding sugar beet chitinase 4, neither do they mention or indicate that it would be interesting to loo~ for this sequence. In fact, the initial analysis of sugar beet chitinase 4, which revealed an enzyme with a small functional domain, suggested that the chitinase enzyme had a low chitin affinity and thus low enzymatic activity. Thus, the enzyme did not seem to be of any particular interest.

Futhermore, non of the references mention or indicate the synergistic antifungal effect which may be obtained when the sugar beet chitinase 4 enzyme is combined with an acidic chitinase and a basic ~-1,3-glucanase. This synergistic antifungal effect is reported for the first time in connection with this applica;ion.

W O 92/17;41 ~ 1 0 ~ 3 D 3 PCT/DK92/0010X

Bv the presen~ invention a novel plant chitinase has been elucidated which either alone or in combina;ion wi.h other pathogenesis-rela.ed proteins. snows promising resu1ts i~. the inhibi~ion of chi~in-con-;aining runri.
-BRIEF DISCLOSURE OF THr I.~7E~TION

In one aspect the present invention relates to a DNA sequence com-prising the sugar beet chitinase 4 DNA sequence shown in SEQ ID NO.:l or an analogue thereor the analogue being a DN.~ sequence encoding a polypeptide having the antifungal activitv of the sugar beet chiti-nase 4 as defined herein and i) being a characteristic part of the DNA sequence shown in SEO ID
NO.:l1 or ii) hybridizing with the DNA sequence shown in SEQ ID NO.:l at 55C
under the conditions specified in the "Materials and Methods" section under the heading "Identification of DNA belonging ~o the chitinase 4 gene family", or iii) encoding a polypeptide having ehe amino acid sequence of the sugar beet chitinase 4 shown in SEQ ID NO.: 2, or iv) encoding a polypeptide being recognized by an antibody raised against sugar beet chitinase 4.

The chitinase 4 DNA sequence, SEQ ID NO. :1, shown in the Sequence Listing below was determined on the basis of a cDNA clone isolated from a sugar beet cDNA library prepared as described in the Material and Methods section below on the basis of hybridization with a verv ; specific oligonucleotide probe. The oligonucleotide probe was prepar-ed on the basis of a tryptic peptide produced from a substantially 30 pure sugar beet chitinase 4 obtained as described in Materials and -Methods and in Example l below. The procedure used for isolating the chi~inase 4 DNA sequence is ou~lined in Example 4 below.

W 0 92~1?~91 21~ 6 ~ Q ~ PCT/DK92/~OlOX

Prior ;o the presen~ inven~ion. ~he amino acid sequence of the suEar bee~ chitinase 4 enzvme or the D~A sequence encoding sugar bee.
chi.inase 4 had no. been reported. and no indication had been given .ha i. could be interesting ~o loo~ for ;nese sequences. Ir. fac;.
5 ~he ini;ial analvsis of sugar bee; chitinase ~. which revealed an enzvme wi.h a small functional domain, sug~ested ;ha; ;he chi;inase : enzyme had a low chitin affinity and thus low enzymatic accivitv.
Thus the enzyme did not seem to be of any particular interest.

The elucidation of the amino acid sequence of the sugar beeL chi;i-nase 4 was an importan; step in the analYsis of the enzyme. Thus.
from the amino acid sequence it was clear that the sugar beet chiti-nase 4 belongs to the plant chitinases of the hevein class in tha. i.
contains a leader sequence~ a hevein domain and a functional (cataly-tic) domain. Hevein is a lectin which binds to chitin, and the hevein domain of the enZYme is the part of the enzyme which is expected to bind to chitin and chitin-containing struccures, e.g. of phytopaeho-genic fungi.

By hydrophobic clustering analysis usin~ the method according to Gaboriaud et al., 1987, the primary structure of chitinase 4 has been found to be more compact than the structures of other plant chitinases belonging to the sugar beet chitinase 2 class (as describ-ed in further detail below). It is anticipated that the compact structure of chitinase 4 is an advantage in order to allow the enz~me to get access to chitin structures, e.g. in the cell walls of phyto-pathogenic fungi.

Furthermore, in contrast to other known basic chitinases, chitinase 4has been found to lack a C-terminal extension which means that the enzyme is translocated to the intercellular space. and thus not to the vacuole, The presence of the enzyme in the intercellular space has been experimentally verified.

The sugar beet chitinase 4 has been found to have a surprisingly high antifungal activitv and have shown a particularly good inhibiting effect on the growth of phvtopathogenic fungi. In addition, the use of a combination of the suEar bee~ chi~inase 4 enzYme~ a second "
.

W O 92/17591 PCT/DK92tOOlOX

2~a63~3 differen chitinase and a B-1.3-glucanase in the control of phyto-pathogenic fungi has been found ~o resulc in an even more impro~ed antifungal activitv as compared .o che use of the sugar bee cniti-nase 4 alone. This svnergis.ic an~ifungai efrec~ is reportec or ~ne 5 first time in connection with this apolication.

Accordingly, in another important aspect, the present invention relates to a genetic construct comprising one or more copies of a DNA sequence comprising the chitinase 4 DNA
sequence shown in SEQ ID N0.:1 or an analogue thereof as defined above or a subsequence thereof (further defined below), one or more copies of a DNA sequence encoding a second chitinase different from the sugar beet chitinase 4, and one or more copies of a DNA sequence encoding a B-1.3-glucanase, each of.the DNA sequences being functionally connected to a promoter and a transcription termLnator capable of expressing the DNA se-quences into functional polypeptides.
"
The constituents of the genetic construct and the synergistic effect are further e~plained below.

The main use of the genetic construct of the invention is in the ~: production of a genetically transformed plant having an increaset resistance to chitin-containing plant pathogens such as phytopatho-genic fungi as compared to plants which do not contain the construct such as untransformed or natural plants. The genetically transformed plants are advantageously prepared by use of a plant transformation vector harbouring the genetic construct of the invention.

The chitinase 4 DNA sequence or an analogue thereof, and in particu-lar a specific subsequence thereof (which will be further discussed below). mav also be used in the isolation of DNA sequences belonging ~o the chitinase 4 gene family as defined above. Also. the chitinase ' DNA sequence or an analogue thereof or a genetic construc~ of the W O 92/17591 2 i ~ 6 3 3 ~ PCT/DK92/001~
G
invention mav be used in a me~hod of preparing a polypep~ide. e.g. a recombinant sugar beet chitinase enzyme, or a polvpeptide mi~ture having a potent antifungal activit~. The polypeptide or polvpeptid~
mixture mav bv prepared b~ use o~ recombinan; D~`A ,ecnniques and mav be used in the antifungal ereatment of various products. especiall food products.

DETAILED DISCLOS~RE OF THE INVENTION
.

The chitinase 4 DNA sequence, SEQ ID NO.:l encodes the basic sugar beet chitinase 4 enzyme, the amino acid sequence of which also appears from SEQ ID NO.:2. In the present context, the terms "chitinase 4" and "sugar beet chitinase 4" are used interchangeabl;.

One characteristic feature of the chitinase 4 DNA sequence of the invention and an analogue thereof is that they encode a polypeptide having the antifungal activity of the sugar beet chitinase 4. The antifungal activity of the sugar beet chitinase 4 is characteristic in that it is a bifunctional activity constituted by a chitinase activity and a lysozyme activity. As far as the present inventors are aware, this bifunctional activity has hitherto not been reported for any other basic plant chitinase of the hevein class.

In accordance herewith, the term "the antifungal activity of the sugar beet chitinase 4" denotes the characteristic bifunctional activity of the enzyme, i.e. the combination of chitinase activity and lysoæyme activity found in the sugar beet chitinase 6, The term "chitinase activity" denotes the enzyme's ability to decom-pose chitin and chitin-containing structures and the chitinase acti-vity may be determined by L) a biological assay and 2) a chemical assay. In the biological assav, the effect of chitinase 4 on growing hyphae of pathogenic fungi, i.e. the ability of chitinase 4 to de-stroy the hyphae walls and thereby retard the growth of the hyphae.
îs directly observed. In the chemical assay/ the decomposition of 3H-chi~in by chitinase 4 to result in mainly dimers of chitin is moni-torea.

- .. -: , :: ;.

W O 92tl'591 ~ ' PCT/DK9Z/0010X
21 ~339 ~o The biological assay may be carried out using any or the 3 differen.
methods described i?. ".~aterials and ~e~hods" herei~. under ~he headin~
"An~i~ungal ac~ivity". ~en a posi.ive resui. is o~ained in an~ o~
these methods, i.e. the observance or destruc~ion Ct- ~he hvphae wallc and retarda.ion of ,he ~rowth of the fungal hyphae. it is ta~en as evidence of biological chitinase 4 activit;u The chemical assay may be carried out as described in "Materials and Methods" under the heading "The radiochemical chitinase assay".
Chitinase 4 activity is shown bv hydrolysis of 3H-chitin and the resulting formation of mainly dimers of chitin in ~his assav.

The term "lvsozvme activitv" denotes the enzvme's fungal cell wall lysing ability, The lysozyme activity is determined by carrying out the lysozvme assay described in "Materials and Methods" under the heading "Lysozyme assay".
i It will be understood that the antifungal activity of the sugar beet chitinase 4 is a qualitative as well as a quantitative measure re-flecting the ability of the polypeptide to destroy components e,g, chitin, of the hyphae walls of a phytopathogenic fungus thereby inhibiting or retarding the growth of the fungus.

The analogue of the chitinasee 4 DNA sequence is a DNA sequence having at least one of the properties i)-iv) listed above. The terms used to define the analogues of the invention are explained in further de-tails below.

The term "characteriscic part" as used in connection with the ana-logue defined in i) above denotes a nucleotide sequence which is obtained from the nucleotide sequence of the chitinase 4 DNA sequence or which has a nucleotide sequence corresponding to a part of the chitinase 4 DNA sequence and which encodes a polypeptide having retained the antifungal activitv of sugar beet chitinase 4. Typical-ly, the characteristic par~ comprises a subsequence of the chitinase :: 4 DNA sequence. the subsequence being either a consecutive stretch or nucleotides of the chi.inase 4 DNA sequence or bein, composed of one W O 92/1'~91 2 ~ ~ 6 3 ~ 3 PCT/DK92/0010~

or more separate nucleo~ide sequences of the chi~inase ~ D`iA se-quence. In order .o allo~ the polvpeptide encoded b~ the charac:eris-.ic part of the chi.inase 4 DNA sequence ~o re~ain i.s characeeris,ic antifungal activi.y the par. will normally be onl~ a small num~er o.
nucleotides shorter than ~he chitinase 4 DNA sequence. e.g. l-~G.
such as 1-2~ nucleotides shor,er.

A typical example of a characteristic part of the chitinase 4 DNA
: sequence includes the nucleotides encoding the active site of chiti- nase 4.

The analogue defined in ii) above is a DNA sequence which hvbridizes with the chitinase 4 DNA sequence under the conditions specified in the "~aterials and .~ethods" section below under ~he headin~ "Identi-fication of DNA belonging to the chitinase 4 gene family". The condi-tions defined for the hybridization to take place are based on hvbri-dization experiments carried out with a number of known plant chiti-nases and sugar beet chitinase 4 and is further described in Example ll below.
.

In the present context, any DNA sequence hybridi~ing with the chiti-nase 4 DNA sequence under the hybridization conditions specified in the above cited part of "Material and Methods" is defined as belong-ing to the chitinase 4 gene family and is contemplated to encode a polypeptide having the structure and antifungal activity of the sugar beet chitinase 4. Furthermore, when the polypeptides produced from such DNA sequences react with~antibodies raised against sugar beet chitinase 4, it is a strong indication that the polypeptide encoded by the DNA sequence in question belongs to the sugar beet chitinase 4 serological class. Such DNA sequences constituting part of the present invention may either comprise sequences isolated from natural sources, e.g. plants, synthetically produced sequences or may be syntheticallv modified DNA sequences, e.g. as described below. In the : following, DNA sequences belonging to the chitinase 4 gene family are also ter~ed "chitinase related DNA sequences".

:: The analogue defined in iii) above i5 a DNA sequence which encodes apolypeptide comprising the amino acid sequence shown in SE0 ID NO.:2 ~. .

W O 92/17~91 PCT/DK92/OOlOX
2~ ~3~ ~

i.e. the~amino acid sequence o~ the ma~ure chitinase 4 enz~me. I~ is well ~nown that the same amino acid mav be encoded bv various codons.
.he codon usage being relaced. ~n~er alia. -o che preference or .he organism in ques.ion expressing the nucleotide sequence. Thus. one or more nucleotides or codons of the chitinase 4 DNA sequence of .he invention mav be exchanged by others which, wnen expressed. -esui. in a polypeptide identical to or substantially identical to the polypep-tide encoded by the chitinase 4 DNA sequence in question.

The analogue defined in iv) above is a DNA sequence encodin_ a poly-pPptide which is recognized by an antibody raised againse sugar beet chitinase 4. In the present context, the term "is recognized bv" is used interchangeably with "binds to". As it is described in Example 3 below, it has been found that the sugar beet chitinase ~ enzyme : belongs to a new serological class of basic chitinases hitherto not reported in the literature. A recent serological analysis or a rape seed chitinase has revealed a close serological resemblance between .~ this chitinase and sugar beet chitinase 4, indicating that the ana-lyzed rape seed chitinase belongs to the same new class of basic chitinases.

The antibody to be used in determining the serological relationship between the polypeptide encoded by the chitina~e 4 DNA sequence of the invention and a polypeptide encoded by a DNA sequence of another origin may be a monospecific polyclonal antibody or a monoclonal antibody. A particularly suitable antibody is a monoclonal or poly-clonal antibody prepared against one or more characteristic epitopes encoded by the chitinase 4 DNA sequence. Such epitopes are explained in further detail below.

The DNA sequences of the invention explained herein may comprise natural as well as synthetic DNA sequences~ the natural sequence typicallv being derived directly from cDNA or genomic DNA, normall~
of plant origin, e.g. as described below. A synthetic sequence may be prepared bv conventional methods for synthetically preparin~ DNA
molecules. e.~. using the principles in solid or liquid phase DNA
svnthesis such as a DNA svnthesizer 381 A (Applied Biosvstems). Of . , .

W O 92/17~91 ~ ~ ~ 3 ~ 9 PCT/DK92/0010 course. also the D~A sequence mav be of mi~ed cDNA and genomic, mixed cD~A and s~nLhe,ic and mixed genomic and s~ntheLic origin.

In the rollowin~. the composi,ion of ~he chitinase 4 DNA sequence and eacn of the domains of the chitinase 4 enzvme encoded b~ the D~A
s sequence shown in SEQ ID ~0.:1 and wi.h the amino acid sequence snowr.
in SEQ ID N0.:2 are further described and compared to other plan~
chitinàses.

The chitinase ~ DNA SEQ ID N0.:1 comprîses a leader sequence (nucleotides 2-70) encoding 23 amino acid residues, a par~
(nucleotides 71-174) encoding a hevein domain of 35 amino acid residues and a part (nucleotides 175-793) encoding a functional domain of 206 amino acid residues. The N-terminal part or the mature polypeptide chain is blocked and it has not been possible to determine the sequence by conventional amino acid sequencing methods. However, based on comparison with the DNA sequences of a wheat germ agglutinin (WGA~A) and a potato chitinase and based on an analysis by electrospray mass spectrometry (vide Example 4), the start codon of the chitinase 4 DNA sequence has been deduced, Comparison between the leader sequence from chitinase 4 DNA (SEQ ID
N0:1) and the leader sequence from the genomic chitinase 4 DNA (SEQ
ID N0.:3) shows that the two first nucleotides in the leader sequence from chitinase 4 DNA (SEQ ID N0.:1) are missing. Thus, while the leader sequence of the genomic chitinase 4 consists of 24 amino acid residues (SEQ ID N0,:4), the leader sequence from chitinase 4 consists of 24 amino acid residues although the almost full length chitinase form cDNA is missing the first amino acid Met (SEQ ID
N0,:2), Plant chitinases may be divided into 3 different groups, the hevein class, the non-hevein class and the cucumber class.

Sugar beet chitinase 4 is a basic chitinase belonging to the hevein class, However, it is distinctly different from the other basic chitinases of this class. Whereas chitinases from bean, tobacco, ' toma~o, potato, pea, poplar, barlev (T and K) and sugar beet (chiti-nase 2) have molecular weights of 32-38 ~Da ~ide Example 10), chiti-W 0 92/1759l 21 ~ ~ 3 ~ ~ PCT/DK92/OOlOX
1 ' nase 4 is smaller with a moiecular weigh. of aoou. 26 ~Da ~as determined for the mature enzyme). In addi;ion. s nce an~ibodies raised against chi.inase ~ do no. recogni~e the o~her basic chi~inases described above (~-iae E~ample 10). i- s e~ident .ha.
chitinase 4 also belong to a different serological ciass than all other basic plant chi.inases from ehe hevein class.

The primary s~ructure of the mature chitinase 4 as determined on the basis of its amino acid sequence contains 2 different domains: the hevein domain and the functional domain. At the ~-terminal par~ of the polvpeptide chain, 12 out of 35 amino acid residues are conserved compared to the hevein structure. The functional domain contain 206 amino acid residues. In the basic chitinase from .~'~cotiana tabaccum (cv. Havanna) (Shinshi et al., 1989), the hevein domain consists of 43 amino acid residues and the functional domain contains 263 amino acid residues. Although the hevein domain (i.e the chitin binding domain) of chitinase 4 is shorter than that of the tobacco chitinase, chitinase 4 has a binding affinity which is of a similar magnitude as that of the other basic chitinases belonging to the hevein class. For comparison, very poor or no binding is observed when chitinases from the non-hevein class are examined. This class of chitinases does not contain~the hevein domain, but only the functional domain. The homo-logy between the functional domains of the hevein class and the non-hevein class is very high. In addition, polyclonal antibodies raised against ehe chitinases from the hevein-class recognize the chitinases from the non-hevein class.

In general, the specific activity of the non-hevein class, the acidic chitinase from tobacco and the basic chitinase C from barley (Kragh K. M., Thesis, 1990) are approximately 6-fold lower than that of the hevein class chitinases.
:
Since the functional domain in chitinase 4 contains only 206 amino acid residues as compared to the 263 amino acid residues of the functional domain of the basic tobacco chitinase. a decrease in the specific activity was expected. Chitinase 4. however. performs ex-tremelY well and was bv the present inventors shown to be superior to chitinase T. ~'. and C from barle~ (results no. shown) when ana-::
.

2~ 963~
W O 92/17~91 PCT/DK92/0010 1~
lvzed by the radiochemical enzvme assav described in "Material anaMethods" below.

From .he above e~planation. i- will oe clear tha~ ~he mos. impor_a.,~
pares or ~he chitinase 4 DNA sequence shown in SEO ID NO.:l are the S part encoding the hevein domain and especiall; the pare encoding ene functional domain of the enzyme. While the presencê of a leader sequence in most cases is a prerequisite for allowing the polvpeptide expressed from the DNA sequence to be transported out of the cell in which it is produced, the nature and origin of the parcicular leader sequence to be used may vary and need not be the leader sequence naturally associated with the chitinase 4 enzyme. Additionally,. the leader sequence naturally associated with the chitinase 4 enzyme may be used in heterologous gene construct in transformation in plants, in particular sugar beet plants, when the encoded polypeptides are targeted to the extracellular space.

In accordance herewith, a particularly interesting DNA sequence according to the present invention is a DNA sequence comprising nucleotides 71 793 of the chitinase 4 DNA sequence shown in SEQ ID
NO.:l and encoding the hevein domain and the functional domain of the sugar beet chitinase 4 enzyme, or an analogue of said DNA sequence.

The term "analogue" is referred to as a DNA sequence which either Ai) is a characteristic part of said DNA sequence, , Aii~ hybridizes with a DNA probe prepared from said DNA se-quence, Aiii) . encodes a polypeptide having the same amino acid sequence as the polypeptide encoded by said DNA sequence, or .
Aiv) encodes a polypeptide which is recognized bv an antibody raised against a polypeptide encoded bv said DNA sequence.

A still more interesting DNA sequence of the invention is a DNA
30 sequence comprising nucleotides 1,5-793 of the chitinase 4 DNA se-.

. . . .

W O ~2/17591 PCT/DK92/OOlOX

3 0 ~
1~
quence shown in SEQ ID ~0.:1 encoding ~he func~ional domain o~ ~he sugar beet chi~inase 4 enzvme. or an analogue of said D~A sequence.
The term 'analo ue" refêrs to a D~A sequence which Bi~ is a characteristic part of said DNA sequence.

5 Bii) hybridizes with a DNA probe prepared from said DNA se-quence.
. . .
Biii) encodes a polvpeptide having the same amino acid sequence as the polvpeptide encoded bv said DNA sequence, or Bi~) encodes a polypeptide which is recognized by an antibod.
raised against a polvpeptide encoded bv said sequence.

The analogues as defined by the properties Ai)-Aiv) and Bi)-Biv) above are defined in a similar manner to the analogues of the chiti-nase 4 DNA sequence defined by ehe properties i)-iv) above.

In a further aspect, the present invention relates to a DNA sequence comprising a sugar beet chitinase 4 gene. In the present context, the term "gene" is used to indicate a DNA sequence which is involved in producing a polypeptide chain and which includes regions preceding and following the coding region (5'-upstream and 3'-downstream se-, quences) as well as intervening sequences, the so-called introns,which are placed between individual coding segments (so-called exons) or in the 5'-upstream or 3'-downstream region. The 5'-upstream region comprises a regulatory sequence which controls the expression of the gene, typically a promoter. The 3'-downstream region comprises se-quences which are involved in termination of transcription of the gene and optionally sequences responsible for polyadenvlation of the transcript and the 3' untranslated region.
.:~
An example of a DNA sequence of the invention comprising a chitinase

4 gene is the genomic sug~ar beet DNA sequence harboured in the geno-mic chitinase 4 clone (chit 4), the isolation of which is described in Example 4. The partial nucleotide sequence of the gene has been elucidated and is shown in SEO ID NO.:,. Based on comparison of ,he '' W O 92/17~ 6 3 ~ 9 PCT/DK92/0010X
1' partial DNA sequence with the D~A sequence OI the cnitinase 76 gene shown in SE~ ID ~0.:~ and fur.her discussed below. and the nucleotide sequence oI the chitinase ~ cDNA shown in SEO ID ~Q.:l. (the compari-sons are shown in Fig. 24) i~ is contemplated that ~ucleotides 356-358 of .he chitinase 4 gene sequence constitute the s~art codon or the chitinase 4 gene.

; Based on a comparison with the chitinase 76 sequence (comprising oneintron) and the DNA sequence of chitinase 1 shown in SEQ ID NO.:11 (comprising two i~trons), it is believed that the chitinase 4 gene comprises only one intron starting at nucleotide 398 downstream of the ATG start codon. The position of the intron is believed to cor-respond to a position between nucleotides 395 and 396 in the chiti-nase 4 cDNA sequence shown in SEQ ID NO.:1.

Possible 5' regulatory sequences of the chitinase 4 gene are shown in Examples 17 and 18 below.

As meneioned above, the knowledge of the amino acid sequence of~the s~tgar beet chitLnase 4 makes it possible to analyze the enzyme and elucidate the important parts of the enzyme, this being done, e.g., on the basis of a comparison with the amino acid sequence of other known chitinases. An especially interesting part of the enzyme is, for instance, a part comprising the active site of the enzyme, a part comprising epitopes of the enzyme and a part responsible for the enzyme's substrate specificity and/or binding properties.

The contemplated position of the active site of the sugar beet chiti nase 4 enzyme has been revealed by comparison to the active site of other known enzymes catalyzing the hydrolysis of other oligosacchari-des such as explained in Example 16 below. Thus, it is believed that the active site of the sugar beet chitinase 4 is constituted by amino acid residues 183 (Asp) and 189 (Glu) in SEQ ID N0.:2.
:
On the basis of the 3D-structure of the chitinase 4 enzyme which may . be elucidated by use of conventional x-ray crystallography analysis and the amino acid sequence of the enzyme, it will be possible to predict parts of the enzvme which are responsible for the enzyme's . .
.

W O 92/17591 2 ~ PCT/DK92/0010X

specific properties. Thus. in addition .o the active si~e disclosed above, also the specific amino acids or che enzvme responsible for i-s substrate specific'cv and subs-ra-- binding mav be en~.-isaged o~:
elucidated. Also. ,he amino acid residues rormin_ ,he epi~opes o. h~
enzvme may be elucida~ed. Gn ~he basis o ,ne kno~led~e o- sucr.
specific amino acids i- is possibl~ co speci~^icall. modif~. ~ne ~n~vm-so as to obtain a modified mode or ac.ion of ,he enzyme. e.g. with respec~ to an increased catalytic ac~ivity, an improved. i.e.
broadened, substrate specifici~y, an improved substrate. e.g. chitin, binding or a modified epitope. Such modifications ma~ be accomplished by use of well-known principles of pro~ein engineering. sucn as sice-directed mutagenesis, e.g. as described in Example 16 belo~.

As an example. the replacement or one or more of the Trp residues in position 169, 20~ and 206 with Tyr residues is expected to change the binding of the substra~e (chi~in) to the catalytic site and perhaps the substrate specificity. Likewise, changes of the amino acid resi-dues constituting the active site or amino acid residues which form the structure of the folded enzyme are expected to influence, e,g., the catalytic activity, substrate specificity and/or substrate bind-ing may be found to result in improved properties of the resultingmodified enzyme. Of course, the nature of the modification to be carried out will depend on the desired result, i.e. the specific desired function of the resulting modified enzyme.

: Corresponding to the chitinase ~ enzyme encoded by a DNA sequence of the invention, a DNA sequence.eneoding the modified chitinase 4 enzyme may either alone or in eombination with DNA sequenees eneod-ing other proteins, e.g. pathogenesis related proteins, such as thaumatin, osmothin and/or zeamatin (Viegers, 1991) or thionin (8Ohlmann et al., 1988), eereropin (J. Jaynes, 1989) or other enzymes sueh as chitinases and B-1-3-glueanases be used in the eonstruction of a genetieally transformed plant, preferably a sugar beet plant, having a particularly high and advantageous antifungal aetivity.
: Also. the modified ehitinase 4 enzvme may prove to be a particular interesting component of an antifungal composition as described belo~.

.

W 0 92/17~91 210 ~ 3 0 ~ PCT/DK92/OOlOX
1~
~ithin a gene family. a high degree of homology between codinP, ~-e-gions of the genes is e~pected. whereas less homolog- is e~ec~ed between non-coding regions. Between different gene families. ~he homologv may vary considerablv. The ~erm "homology" is used here to denote tne presence or the de~ree of coMplementarity between the amino acid sequence of a given polvpeptide and the amino acid sequence or another polvpeptide being analvzed as determined by use of the computer program bv Mvers and Miller. version l.OS. September 1990, using the comparison matri~:: Genetic code, the Open Gap Cost 6 and the Unit Gap cost l. See also Myers and Miller, 1988. The degree of homology between different genes, especially between the coding regions. may thus be used to assess the degree of familaritv be~ween different genes. The amino acid sequences may be deduced from a DN.
sequence or mav be obtained bv conventional amino acid sequencinF
methods. The degree of homology is preferably determined on the basis of mature proteins, i.e. without taking any leader sequence into account.

In accordance herewith, the presenC invention relates to a DNA se-quence encoding a chitinase isoenzyme which is at least 60% homo-logous with the sugar beet chitinase 4 enzyme encoded by the DNAsequence SEQ ID NO.:l and at the most 4070 homologous with the sugar beet chitinase l encoded by the DNA sequence shown in SEQ ID NO.:ll.
The minimum degree of homology of a~ least 60X has been determined on the basis of an analysis of a rape seed chitinase (based on the mature protein) which has been shown to belong to the sugar beet chitinase 4 serological class~(see Example ll). The degree of homo-logy of 40-b with chitinase l (which does not belong to the chitinase ; 4 class) reflects the minimal degree which is expected to be accept-able for a polypeptide belonging to the chitinase 4 class.

. 30 Of course, a higher degree of homology with the chitinase 4 enzyme and therefor a lower degree of homology with the chitinase l enzvme reflects an even higher similaritv herewith and accordingly. the DNA
sequence described above preferably encodes a chitinase isoenzyme which is at least 65%, e.g. at least 70~ homologous. such as at least ~5 75-b or preferably ~0% homologous with the sugar beet chitinase 4 en~vme encoded b; the DNA sequence SEQ ID NO.:l and/or a~ the most W O 92/17~91 2 ~ ~ ~ 3 ~ ~ PCT/DK92/0010~

38% such as at the mos, 35,' homologous with ~he sugar bee, chi~inase l enzyme encoded bv the DNA sequence S~Q ID ~O ll An e~;ample of a DN~ sequence encoding a pol~pep.id- being abou ,,,' homologous tO the sugar bee~ chitinase 4 en~me ana a, ,he mos~ 40',' homologous ~o the sugar bee, chitinase 1 enz~me is ~he genomic D~`
sequence (chitinase 76, the sequence of which is shown in SEQ ID
N0 5) contained in the genomic clone chitinase 76 obtained as described in Example 5 From Example lO it is evident that sugar beet chitinase 4 isolated from sugar beet leaves is recognized by an anribody raised against this sugar beet chitinase but not bv an antibod~ raised against the sugar beet chitinase 2 This is a ver~ s;rong indication of .he fac, that the sugar beet chitinase 4 belongs to a different class of chitinases than the sugar beet chitinase 2 and thus that 2 different l~ classes of sugar beet chitinases exist It is contemplated that other polypeptides belonging to the chitinase 4 family will show a similar reaction pattern and accordingly, the present invention further comprises a DNA sequence which encodes a polypeptide which is recog-nized by an antibody raised against sugar beet chitinase 4, but not by an antibody raised against sugar beet chi~inase 2 In a further aspect, the present invention relates to a modified DNA
sequence comprising a DNA sequence as defined above comprising the chitinase 4 DNA sequence or gene or an analogue thereof in which at least one nucleotide has been~deleted, substituted or modified or in which at least one additional nucleotide has been inserted so as to encode a polypeptide having retained the antifungal activity of the sugar beet chitinase 4 or having an increased antifungal activity as compared to the sugar beet chitinase 4 The polypeptide encoding bv the modified DNA sequence has normallY an amino acid sequence which is different from the amino acid sequence of the sugar beet chitinase 4 It will be understood that a modified DNA sequence of the invention will be of importance in the preparation of novel polypeptides having an increased antifungal activitY as compared to chitinase 4 W O 92/17591 2 ~ ~ ~ 3 3 3 ` PCT/DK92/0010X
'1 When "substitution~ is performed. one or more nucieotides in the fuli nucleotide sequence are replaced with one or more different nucleo-tides~ wher. ~'addition" is performed. one or more nucleo~ides are added a~ either end of the full nucleotide sequence when "inser_ior"
is performed one or more nucleotides within the full nucleotide sequence is inserted, and when "deletion" is performed one or more nucleotides are deleted from the full nucleotide sequence whether a~
either end of the sequence or at any suitable point within it.

A modified DNA sequence mav be obtained by well-known meehods. e.g., bv use of site-directed mutagenesis.

In a further aspect. the present invention relates to a subsequence of the chitinase 4 DNA sequence of SEQ ID NO.:l encoding a polypeptide which need not, but which can have the antifungal activity of the sugar beet chitinase 4. Especially interesting subsequences of the chitinase 4 DNA sequence or of the genomic DNA
sequence are subsequences comprising the nucleotide sequence defining the active site of the sugar beet chltinsse 4 enzyme. An example oE
such a subsequence is a DNA sequence comprising the active site of the sugar beet chitinase 4 en~yme, e.g. the DNA sequence encoding the following peptide named peptide 4-22 (shown by use of the conventional one-letter amino acid code) consisting of the amino ~; acids No's. 179-200 of SEQ ID N0.:2 ~ .
: S-I-G-F-D-G-L-N-A-P-E-T-V-A-N-N-A-V-T-A-F-R
. . ~
This sequence is the amino acid sequence of the tryptic peptide 4-22 obtained from the purified sugar beet chitinase 4 as described in Example 16 below. A DNA sequence encoding this polypeptide may be of significant importance for carrying out modifications of the active site with the aim of improving the antifungal activity of the result-ing polypeptide. Furthermore, the DNA sequence may be fused to a part of another DNA sequence encoding an enzyme different from the sugar beet chitinase 4 or substituted with a part of such enzyme encoding the active site thereof with the aim of obtaining a hybrid enzyme having the antifungal activitv of sugar beet chitinase 4. Of course.
~he polypeptide chain of the hvbrid en,vme should be able ~o fold ir.

~'O 92/17591 2 ~ ~ ~ 3 ~ ~ PCT/DK92/0010~

_ the correct manner so as ~o provide a useful conformation around the active si~e~

A further interes.ing DNA sequence encoding a par. of the chi~inase enzyme is a DNA sequence encoding the pol~peptide having the follow-ing amino acid sequence consisting of the amino acids No's. lS3-20_ of SEQ ID N0.:6 S-I-G-F-D-G-L-N-A-P-E-T-V-A-N-D-A-V-I-A-F-K

This polypeptide is deduced from the DNA sequence of the genomic chitinase 76 clone shown in SEQ ID N0.:5 and corresponds almost to the DNA sequence of the peptide 4-22 given above. except for the mos.
important fact that the bolded D is an N in peptide 4-22. I. is .; believed that the chitinase 76 derived polypeptide may have the same or nearly the same interesting properties and uses as the peptide 4-. 22.

Two further interesting DNA sequences are the sequence encoding the following peptide consisting of the amino acids No's. 163-169 of SE0 ID N0.:2 ~ G-P-L-Q-I-T-W

-: which is the tryptic peptide 4.19.3 of chitinase 4 and the DNA se-quence encoding the tryptic peptide 4-26 consisting of the amino ; acids No's. 201-224 of SEQ ID N0.:2 T-A-F-W-F-W-M-N-N-V-H-S-V-I-V-N-G-Q-G-F-G-A-S-I

which sequences are described in Example 16 below. The peptides comprises one and two Trp-residues. respectively. The Trp-residues are contemplated to be involved in the active site and/or substrate specificity of the chitinase 4 enzyme, e.g. as further discussed in ~xample 16 below. Analogues of these above mentioned subsequences in which at least one nucleotide has been deleted. substituted or modified or in which at least one additional nucleotide has been inserted and which still have the catalytic and/or binding activities .

, W O 92/17591 ~ ' ~ 6 3 ~ ~ PCT/D~92/oolo~

., as that o~ the three abo~e-mentioned peptides encoded b~- tne chitinase 4 DNA subsequences mav be very intersstin~.

.~nother e.~ample o, an interesting subsequence according .o the inven tion is a subsequence of the chitinase 4 DNA sequence of SEQ ID NO.:l encoding a polypeptide comprisin~ the hevein domain of the sugar beet chitinase 4 enzyme, or an analogue of said subsequence in which at least one nucleotide has been deleted~ substituted or modified or in which at least one additional nucleotide has been inserted and which subsequence is encoding a polypeptide capable of binding to chitin as determined by affinity column chromatography on regenerated chitin prepared as described in "Materials and ~ethods" under the heading "Preparation of a chitin column".
:' Due to the fact that the hevein domain of the chitinase 4 enzyme is compact and belieYed to be very efficient, i.e. capable of establish-ing an intimate binding to chitin, this domain may prove ~o be veryuseful in the modification of chitinases, such as other plant chiti-nases, containing either a weak or no hevein domain with the aim of conferring a stronger chitin-binding capability to such chitinases.
E~amples of chitinase which could advantageously be modified by insertion of the DNA sequence encoding the hevein domain of sugar beet chitinase 4 are chitinases of the non-hevein class or cucumber class (e.g. the sugar beet chitinase S~ disclosed herein).

A further interesting subsequence of the present invention is a subsequence of the chitinase 4 DNA sequence SEQ ID NO.:l encoding the leader peptide of chitinase 4 or an analogue thereof in which at least one nucleotide has been deleted, substituted or modified or in which at least one additional nucleotide has been inserted and which is capable of directing a passenger polypeptide to which it is fused out of the cell in which the fused leader and passenger polypeptide is produced to be deposited in the extracellular space.
~ ' As expiained above. epitopes of the sugar beet chitinase 4 enzyme mav be used to raise monospecific polyclonal and monoclonal antibodies which are useful in identifving chitinase 4 isoenzvmes belonging to the chitinase 4 serological class and for epitope mapping. Suitable W O 92/~7~91 PCT/DK92/0010~
21~6~9 i epi,opeS are e~Dec~ed to oe found among the hydrop.hilic pep~ides or ,he chitinase 4 amino acia sequence SEQ ID ~0.:~. becausê these pep-ides seem to be substan~iall~ differen~ .rom paD~ de parts o~ o~her chi~inases .han sugar bee chicinase 4. ,~n~iboaies leither monoclo-nal~ monospecific or pol~specificj ma; be preparec b. use of cora.en-~ional methods. e.g. as described in .~le Materials and ~'e.hods sec-: .ion below on the basis o. syntheticail~ produced Depeide parts ofthe sugar beet chitinase 4 enzyme. Based on a conventional computer analysis of the chitinase 4 DNA and amino acid sequence. the follow-~ 10 ing possiblê epitopes of the sequence SEQ ID N0.:~ have been :~ identified:

Peptide l: AGKRF~'TRA (consis~ing of amino acids No's 8/-~;) Peptide ~: C"PSY~0~' (consis,ing of amino acids ~o's `~3-160) Peptide 3: IECNGGNS Sconsisting of amino acids No's 230-237) 15 Peptide 4: TARVG~'TQYCQ (consisting of amino acids `;o's 2'1l-252) These epitopes are believed to be particularly suitable for the production of monospecific antibodies to sugar beet chitinase 4.
Peptide l and Peptide 4 are believed to be the most suitable peptide sequences to be used in the production of monospecific antibodies to chitinase 4.
';
A DNA sequence comprising a subsequence of the present invention in which one or more nucleotides have been modified, e.g. as explained above, and having substantially retained the function and/or charac-teristics of the subsequence ~hould be understood as being within the scope of the present invention.

As mentioned above, bacterial as well as plant chitinases exist. In the present context in which an impor~ant use of the DNA sequence of the invention is explained which is the construction of geneticall~
transformed plants, the most interesting types of chitinases are believed to be plant chitinases~ and accordingly it is preferred tha~
the DNA sequence of the invention or an analogue or a subsequence thereof is of plant origin. Especiallv interesting plant chitinase D~'A sequences are derived from a member of the familY Chenopodiaceae.
Solanaceae. Apiaceae. Brassicaceae. Cucurbitaceae or Fabaceae.

W O 92/17~91 21~ ~ 3 IJ ~ PCT/DK92tO010~
,.~
Fxamples of such plants are corn. alfalfa. oat. wheat, rye rice.
barley, sorghum, tobacco. cotton, sugar beet. fodder bee., sunflower.
carro~, canoia, ~oma~o, potato, so~bean. oil seed rape. cabbage, pepper, le~tuce. bean and pea.

~ The ~erms ~sequence", "subsequence" and "analogue" as used herein :~ wi~h respec~ to sequences, subsequences and analogues according to the invention should of course be understood as not comprising these ~ phenomena in their natural environment, but rather, e.g., in iso-:~ lated, purified. in vitro or recombinant form.

The chitinase 4 DNA sequence of the invention or an analogue or subsequence thereof as defined above and especially a single stranded -~ DNA or RNA sequence which is substantiall~ complementary to either :~ strand of such a DNA sequence may be used to isolate corresponding : sequences from other plants, whereupon thèy, if desirable, may be l; modified as described herein.

From the above explanation it will be clear that the chLtinase 4 DNA
seqùence of the invention or an analogue or subsequence thereof may be fused to one or more second nucleotide sequences encoding a second polypeptide or part thereof under conditions which ensure that at least part of the DNA sequence of the invention is e~pressed in conjunction with,the other nucleotide sequence(s), e.g. in the form of a fusion protein. For instance, a DNA sequence of the invention encoding a polypeptide having the antifungal activity of the sugar beet chitinase 4 enzyme may advantageously be fused to a C-terminal sequence encoding a signal peptide which gives rise to transport of the fusion protein expressed therefrom to specific organelles of the organism expressing the polypeptide, Signal peptides involving trans-port will be discussed in further detail below, Interesting subse-quences of the chitinase 4 DNA sequence, such as those described above, e,g. a subsequence encoding the hevein domain and/or an epi-tope, may likewise be fused to DNA sequences encoding other proteins, such as enzymes, e.g. chitinases, in order to confer to the proteins the desirable properties of the polypeptides encoded bv the subse-quences of the chitinase 4 DNA sequence.

WO 92/17~91 ~ 3 ~ 9 26 PCT/DK92~0010~
Also within the invention is a polypeptide encoded by the chi~inase 4 DNA sequence or an analogue or subsequence thereof as defined above.
preferably in a non-naturally occurring or recombinant form. As compared to the naturally occurring chitinase 4 enzyme, the polypep-S tide of the invention has the advantage that it mav be easil~; pro-duced in large quantities bv use of well known conventional recombi-nant productions techniques, e.g. as described in Sambrook et al., :~ 1989, and that it may be obtained in a form which is free from im-purities normally associated with the naturally occurring sugar beet chitinase 4. The polypeptide of the invention may be used as a con-s~ituent in an antifungal composition, e.g. as described below.

As it is explained above and in the examples to follow. the sugar beet chitinase 4 enzvme has been shown to have a number of advan-tageous properties including a surprisingly high antifungal activity as compared to other known chitinases such as other known sugar beet chitinases, probably due to its dual chitinase/lysozyme activity and its compact structure. Also, the strong hevein domain of the sugar beet chitinase 4 enzymes adds to its advantageous properties. Thus, the use of a DNA sequence encoding the sugar beet chitinase 4 or an analogue thereof encoding a polypeptide having the antifungal ac-tivity as defined above is expected to be very interesting in the construction of genetically modified plants.having an increased resistance to phytopathogenic fungi as compared to untransformed plants.

Accordingly, in another important aspect, the present invention relates to a genetic construct comprising 1) a promoter functionally connected to 2) a DNA sequence comprising a chitinase 4 DNA sequence or an ana-logue or a subsequence thereof as defined above and 3) a transcription terminator functionally connected to the DNA
sequence.

SUE~ST~TUT~ SHEET
IS~/EP

W O 92/1?~91 2 ~ ~ ~ 3 '~ 3 PCT/D~9~/0010~

The genetic construct ma~ be used in the construction of a geneeica;-ly modified plant in oràer to produce a plant showing an increased antifungal ac~ivi~~ as determined b~- ,he procedure given in E~ampie _ and thus an increased resis~ance .owards phv~opathogenic iungi Furthermore it is con~emplated ~hat the genetic construct ma~ be used in increasing ~he chitin-degrading capability of a plan~. An e~ample oi a genetic conscruct as defined above is given in Example l& below.
:~.
Furthermore, experiments have revealed (~ide Example 2) that when : lO phytopathogenic fungi (C. ~eticola and T. ~!ride) are treated with a composition comprising a polypeptide having the antifungal activity ~ of the sugar beet chitinase ~ in admixture with an acidic chitinase.~ and a basic B-l.3- lucanase the growth rate of the fungal hvphae isdrastically reduced and the number of germinating spores are decreas-ed. In this connection, it is contemplated that the synergistic effect will be observed in general when the sugar beet chitinase 4 is used in combination with other chitinases and ~ 1,3-glucanases, preferably of plant origin.

Thus, in another important aspect, the present invention relates to a genetic construct comprising one or more copies of a DNA sequence as defined above comprising the chitinase 4 DNA sequence shown in SEQ ID NO.:l or an analogue or subsequence thereof, one or more copies of a DNA sequence encoding a polypeptide having the activity of a second chitinase different from the sugar beet chitinase 4, and/or one or more copies of a DNA sequence encoding a polypeptide having ~-l,3-glucanase activity.

each of the DNA sequences being functionallv connected to a promoter and a transcription terminator capable of expressing the DNA se-quences into functional polvpeptides.

W O 9~/17~ 3 ~ ~ ~s PCT/DK92/0010 The pol~pep~ides with chi~inase or B-1.3-glucanase ac-i~ is pre-ferabl~ of plant origin. The chitinase and B-1.3-glucanase activit~
ma~ be determineà as e~lained in ,he section ''t~aterials and ~lechods"
below , Of particular interes. is a genetic construc~ comprisin~

one or more copies of a DNA sequence as defined above comprising the chitinase 4 DNA sequence shown in SEQ ID NO.::L or an analogue or subsequence ~hereof, one or more copies of a DNA sequence encoding an acidic chitinase having a pI equal to or less than 4.0, and ~

one or more copies of a DNA sequence encoding a basic B-1,3-glucanase having a pI of at least 9.0, each of the DNA sequences being functionally connected to a promoter and a transcription terminator capable of expressing the DNA se-quences into functional polypeptides.

In the present context, an "acidic chitinase" is defined as a chiti-nase having a pI of less than 4Ø Preferably, the acidic chitinase is a chitinase which hydrolyses chitin into chitooligosaccharides of the hexamer type. The acidic chitinase is preferably of plant origin.
Examples of such chitinases are cucumber lysozyme/chitinase and Arabidopsis as well as the acidic sugar beet chitinase SE having the DNA sequence shown in SEQ ID N0,:7 and the amino acid sequence shown in SEQ ID NO.:8 or an analogue of said DNA sequence encoding an acidic chitinase having a pI of at the mose 4.0 and preferably capable of hydrolyzing 3H-chitin into mainly hexamers.

In the prasent context. the term "basic B-1,3-glucanase" means a ~-1,3-glucanase having a pI of more than ~Ø Preferably. the basic B-1,3-glucanase is one which is capable of hydrolvzing glucan into mainly dimers~ e.g. as determined by ~he 3H-laminarin assay described in the Materials and Methods section below. The basic B-1.3-glucanase is preferablv of plan~ origin. Examples of a suitable basic B-1.3-.

W O 92/17591 21~ ~ 3 a 3 P~T/DK92/0010~
~o : glucanase are basic ~ glucanases derived from tobacco (Shinshi e al. 1990~ barley (Fincher et al., 19S6) or sugar beec e.g. the basic su~ar bee ~ iucanase 4 . Lhe DNA sequence of wnich is shown in SEQ ID ~O.:~ or an analogue ,hereor encoding a basic ~-'.,-

5 glucanase havin~ a pI or a~ least 9.0 and prererably beinE capabie o.
hvdrolv~ing 'H-laminarin into mainl~ dimers or ~-1.3-glucan. The : basic sugar beet ~-1,3-glucanase 4 is different from other plant ~-1~3-glucanases in that it does not contain a C-terminal extension as appears from the amino acid sequence SEQ ID NO.:10. The advantageous 10 effect of using the basic sugar beet ~-1.3-glucanase 4 mav in part be due to this lacking C-terminal extension.

Another interesting sugar beet chitinase is the sugar beet chitinase 1 which shows a ver~ low homologY wi~h the sugar beet chitinase 4 of the present invention, confer above. The D~A sequence of the sugar beet chitinase 1 is shown in SEQ ID NO.:11. The D~A sequence is about

6.3 kb long and encodes a polypeptide having 439 amino acid residues.
The polypeptide shown in SEQ ID N0.:12 contains a leader sequence of 26 amino acid residues, a hevein domain of 20 amino acid residues and a C-terminal extension of 23 amino acids. Additionally, the sequence contains a most interest proline rich domain of 238 amino acids which forms and interest aspect of the presene invention.

The experiments reported in Example 2 below show that the combination of the sugar beet chitinase 4 enzyme, an acidic chitinase and a basic ~-1,3-glucanase results in an increased antifungal activity as com-pared to the antifungal activ~ity of each of the constituents. The increased antifungal activity observed when using this specific combination is partly beliçved to be due to the different mode of action of the acidic chitinase, basic ~-1,3-glucanase and sugar beet chitinase 4, respectively. When the acidic chitinase is one which hydrolvses chitinase primarilv ineo hexamers tas compared to chiti-nase 4 which primarily hydrolYses chitin into dimers) and the basic ~-1,3-glucanase is one which hydrolvses glucan primarily into dimers.
it is believed that these different cleaving modes may be involved in ~ the resulting advantageous total effect.
:' W O 92/1?59i PCT/DK92/OOlOX

Furthermore. the synergis;;c efîec, obtaineà when using a combinacion ; of the sugar beet chicinase ,. a polypep~ide having the ac.ivi.~ OI a second cr.i~inase differen. trom chi,inase u e.g. an acidic ~hi.~-nase. and a polypep~ide having ,he ac.ivi,~ of a ~-1.3-glucanase, , e.g. a basic B-l~3-vlucanase is believed -o be due to the fac~ ~ha~
such combina,ion will a.cac~ both the chi in and glucan cons,icuencS
of the cell wall of phy~opatho~enic fungi and also parcs of the cell wall in which the chitin and glucan cons~ituents are intimatelv ~; cross-linked to one another. The ~-1,3-glucanase further serves to remove the outer glucan laver covering the chitin structure of chitin containing plant pathogens. e.g. phvtopathogenic fungi, resulting ir.
an exposure of the chitin structure to the enzymatic action of the chi~inase.

DNA sequences encoding the second chitinase referred to above and the B-1.3-glucanase may be obtained, e.g. from alreadv kno~ sources, or may be identified and isolated from natural sources, e.g. bv use of the techniques dLsclosed herein.

It will be understood that a large number of different genetic con-structs as defined above may be designed and prepared. Without being an exhaustive list, elements of the genetic constructs which may be varied are the number of copies of each of the DNA sequences of the genetic construct, the specific nucleotide sequence of each of the DNA sequences, the type of promoter and terminator connected to each : DNA sequence, and the type of any other associated sequences, e.g. a C-terminal or N-terminal sequence (described below). Thus, genetic constructs of the present invention may vary within wide limits.
Normally, the combination of each of the above mentioned variable elements of the genetic construct to be chosen will depend. e.g. on the desired strength of the antifungal effect to be obtained which may be determined as a function of gene dosage and specific nucleo-tide sequence of each of the DNA sequences, and the type and strength of the promoter and terminator used for each DNA sequence. Also.
expression in specific parts of the plant with respect to organs and . intracellular and e~tracellular location may be varied wi~h different tvpes of promo~er and termina~or.

' .
: , - . ~ , - ~. . .

. .

:. .: ,,: ,. ;., :
,~ , . .
.~ . , W O 92/17591 2 ~ ~ ~ 3 ~ ~ Pcr/D~92/oolo~
,1 However. in designing a genetic construc. oî the illven.ion ~hich is to be expressed in a given organism such as a plant~ one mus; be aware of ~he possible to~ic effece of â ~00 high expresSion oî one o~-more of the proteins encoded by the genetic construc~ whicn~ e ~
may lead co a lower yield of the transformed organism. e.g Dian . as compared to an untransformed organism or an or~anism no. coneâinin~
the genetic construct. Also~ when the gene~ic construcc of .he inven-tion is too large. it mav be difficult to obtain a stable introduc-tion thereof into the genome of the plant which may lead to excision of a part of or the entire genetic construct from the genome of the plant. Thus, the genetic construcc should be adapted so that the expression products therefrom are generally acceptable to the host organism.

The number of copies of the ~NA sequences of the gene~ic construct of the invention together with the activity of the genes will determine the optimal number of copies of the DNA sequences of the genetic construct of the invention. With the fast increasing knowledge within the field of plant genetic engineering, improved transformation and biological containment techniques may be developed leading to the possibility of introducing larger foreign genetic fragments into a : plant without causing retarded growth, retarded yield or recom-binational events than what is at present possible.

At present, a genetic construct is preferred which contains only a few copies of the DNA sequence of the invention. Accordingly, it is preferred that each of the DNA sequences of the genetic construct of the invention is present in only one copy. The construction of a genetic construct containing one copy of each of the DNA sequences is illustrated in the examples below.

As mentioned above, a significant antifungal effect is obtained from a protein encoded by the chitinase 4 DNA sequence of the invention or an analogue thereof. Accordingly, it is contemplated that a genetic construct of the invention, in which two copies of the chitinase 4 ; DNA sequence of the invention or an analogue thereof. and one copv of each of the DNA sequences encoding an acidic chitinase and a basic ~-1.3-glucanase are present mav show verv potent antifungal effects W O 92/17591 PCT/DK9~/0010~
27 ~63~3 when presen~ ir. a gene~icall~ transformed planc of ehe inven~ion. I.
is belie~ed tha; such a genecic construct will not pose a too heavv burden on the ~lant in which i. is harboured. Of course. also ~he choice of e.r. ?romo~er used for each DNA sequence will influence .he amount of pro~ein e~pressed ,herefrom. This ~ill be further e~plained below.

The genetic cons~ruct of the invention as described above mav be present on one or several DNA fragments. Depending on the size of the genetic construct to be introduced in an organism such as a plant. in the case of a plant typically bv means of a plant transformation vector, and the combination of promoters and transcription terminators, i~ ma~ be advantageous to introduce the construct b~ use of two or more plant transformation vec~ors and accordingly i. mav be advantageous that the genetic construct is present on two or more DNA fragments. When the use of only one plant transformation vector is desirable, it is advantageous that the genetic construct is present on one DNA fragment.

W~1en a polypeptide encoded bv the DNA sequence of the invention is to be expressed in an organism, e.g. in a plant, it is desirable that ZO the DNA sequence further comprises a nucleotide sequence encoding a leader sequence. The leader sequence may be the natural leader se-quence, or a leader sequence derived from DNA encoding another prote-in. In any event, the leader sequence is.to be functionally connected to the DNA sequence so that the polypeptide expressed from the re-sulting nucleotide sequence serves to direct the polypeptide encodedby the DNA sequence out of the cell in which it is produced.
Depending of the nature of the leader sequence employed, the polypeptide may be directed to specific locations of the organism in which it is produced, e.g. to lysosomes or vacuoles, or the passenger polypeptide mav be excreted into the intracellular room. The leader sequence may be either N-terminallY or.C-terminallv positioned.

The nature of the N-terminal sequence to be used will e.g. depend on - the particular organism and the part thereof. e.g. the specific cell or tissue, in which the polypeptide encoded bv the DNA sequence of 3~ ~he invention is to be proauced and to which part of the same cell or W O 92/17~91 2~63~ : PCT/DKg2/0010~
~3 another location in ;he or~anism the pol~pep~ide is to be transpor~-ed. A tvpical leader pep~ide has a core of hvdropnobic amino acids and thus, a suicable Ieaaer sequence ~o b~ used ir. connecsion with ;he D~A sequence of ~he ir.~en,ion is a nucleo ide sequenc~ comprisin~
a s,retch of codons encoding hvdrophobic a~ino acids.

Examples of a leader sequence to be used in the presen, context are the following leader sequences which are also part of the invention.
These leader sequences are the N-terminal leader sequence of the sugar beet chitinase 1 enzvme, the nucleotide and amino acid sequence .~ 10 of which is shown in SEQ ID NO:ll and SEQ ID N0:12, respectively, he ` .N-terminal leader sequence of the genomic chitinase 76 clone, the nucleotide and amino acid sequence of which is shown in SEQ ID N0:5 and SEQ ID N0:6, respecti~ely: the N-terminal leader sequence of ~he acidic sugar beet chitinase SE, the nucleotide and amino acid sequence of which is shown in SEQ ID N0:7 and SEQ ID N0:8, respectively; and the N-terminal sequence of the ~-1,3~glucanase 4, the nucleotide and amino acid sequence of which is shown in SEQ ID
N0:9 and SEQ ID N0:10, respectively, Another interesting sequence is DNA subsequence from the sugar beet chitinase 1 encoding the proline rich domain of the chitinase 1 gene comprising 132 amino acids and shown in SEQ ID NO:12 which may also be used in the direction of the polypeptide to specific locations of the organism, The above-. mentioned leader sequences are to be considered as non-limiting ; examples.
, 25 .; As the above-mentioned leader~sequences of the invention are all -. specific for sugar beet plants, these leader sequences may in another aspect of the invention be functionally connected to a DNA sequence different from the DNA sequences being part of the invention, and which DNA sequence is to be used in a transformation of a sugar beet plant. Such a DNA sequence may in particular be a DNA sequence which :: is not naturally present in sugar beet plant. The use of a leader :~: sequence normally presen. in the sugar beet may be an advantage in a transformation of a sugar beet plant as such a leader sequence is 3; known to function in a sugar beet. A leader sequence of the invention may thus serve to direct the polvpeptide expressed from the W O 92/17~91 2 ~ ~ ~ 3 ~3 ~ PCT/DK92/0010~

nucieotide sequence ,o speciîic loca~ions o-^ the cell or organism in ~hich i~ is produced.

.~no~her in~eres.i..- subsequence in ~his aspec, of ~he in~en.ion is ~he proline rich domain of .he chi.inase l snown in SFO ID ~O.:1~
_onsis~ing or 13~ amino acias. I- is con;emplaced ~hac .he ~roline rich domain mav be involved in the anchoring of the cni,inase 1 protein to the cell wall after modification of the prolines ~o glvcosylated hydroxyprolines, as in extensines. Thus. the subsequence containing the proline rich domain mav be used when directing and obtaining a polypeptide at a desired location in the cell and/or organism in which the polvpeptide is produced.
.
Furthermore. it ma~ be advantageous that ar least one of the DNA
sequences of the genetic construct of the invention further comprises a C-terminal sequence encoding a signal peptide capable of directing l; the polypeptide encoded by the DNA sequence to a part of an organism in which it is to be deposited, e.g. Ln the vacuole. Thus, the same DNA sequence may be present with and without a C-terminal sequence in the same genetic construct. The C-terminal sequence may be the C-terminal extension normaLly associated with the DNA sequence, if any, or may be derived from the host in which the genetic construct is to be expressed or may be of another origin. This is especially relevant in connection with the chitinase 4 DNA sequence and the DNA sequence of the basic su~ar beet ~-1.3-glucanase 4 and the acidic chitinase SE
all of which lack a C-terminal extension. In DNA sequences which normally comprises C-terminal extension, the natural C-terminal sequence can be replaced with another sequence.

Non-limiting examples C-terminal sequences to be included in a gene-tic construct of the invention are C-terminal sequences selected from the following sequences:

~he C-terminal sequence of sugar beet chitinase l. the amino acid OI
which is shown in SEQ ID NO.:12. encoding Ehe following polvpeptide consisting of the amino acids ~o's 4l3-439 N L D G 'i R Q T ~ r D 'h G L R ~' L 0 G .~ R E S ; S S S

;- ' ' ' . '` ~; , .. - .: . . . . ..
,:
:

.
.

W O 92/17591 21 ~ 6 3 ~ 9 PCT/D~92/0010X

, The C-terminal end or the sugar bee. chitinase encodin~ the rol-lowing polypep~ide consisting of the amino acids !;o's 251-264 of S~
ID N0.:~

N L P~ C

; 5 the C-terminal sequence of a bean chitinase (PHA) encoding the foLlowing polvpeptide shown in SEQ ID NO.:13 N L D C ~ S Q T P F G ~ S L L L S D L V T S Q -^

the C-terminal sequence of a basic tobacco chi.inase encodins the following polvpeptide shown in SEO ID N0.:14 N L D C G N Q R S F G N G L L V D T M *

the C-terminal sequence of an acidic tobacco chitinase encoding the following polypeptide shown in SEQ ID NO.:15 N L D C Y N Q R N C F A G *

the C-terminal sequence of the barley chitinase CH26 encoding the following polypeptide shown in SEQ ID NO.:16 ::
:`~
N L D C Y S Q R P F A *, or the C-terminal sequence of a basic ~-1,3-Glucanase from tobacco encoding the following polypeptide shown in SEQ ID N0.:17 G V S G G V W D S S V E T N A T A S L V S E M

The choice of whether a C-terminal sequence is to be added to one or more of the DNA sequences of the genetic construct will be determin-ed, e.g. on the basis of to which plant compartment the polypeptide - e~pressed from the sequence is to be direc~ed. Thus. when.it is desirable to control a phvtopathogenic fungus mainl. present in the 2j intercellular space of .he plan~. i; may be desirable to avoid ~he . .
~ .

.: . , W O 92/17~91 PCT/DK92/0010~
~63~9 3~
use of a C-.erminal sequence. ~hen a phytoDathogenic rungus mainly present in.racellularly is to be controlled it mav be desirable that most of or all of the D~A sequences of ;he genetic construct are provided wi~h a C-,erminal sequence caDabl- .o --ansDort the polyDep-5 tides e~pressed from ~he D~A sequences to the ~acuole.

As it will be apparent from the abo~e explanation i. is important to obtain a sufficient e~pression of the polvpeptides encoded by the geneeic construct in planes containing sai~ construct in order to allow the polvpeptides to e~ert their intended function. i.e. to e~ert their antifungal activity. One essen~ial element in obtaining a sufficient e~pression is to provide a satisfactory regulation of the transcription and e~pression of the DNA sequence or gene from which the polypeptide is expressed.

The e~pression of each of the DNA sequences of the genetic construct of the invention or of a gene comprising such DNA sequences are accomplished by means of a regulatory sequence functionally connected to the DNA sequence or gene so as to obtain expression of said se-quence or gene under the control of the inserted regulatory sequence.
; Typically, the regulatory sequence is a promoter which may be consti-tutive or regulatable.
~; .
The term "promoter" is intended to mean a short DNA sequence to which RNA polymerase and/or other transcription initiation factors bind prior to transcription of the DNA to which the promoter is function-ally connected, allowing transcription to take place. The promoter is usually situated upstream (5') of the coding sequence. In its broader scope, the term "promoter" includes the RNA polymerase binding site as well as regulatorv sequence elements located within several hundreds of base pairs, occasionally even further away, from the transcription start site. ~uch regulatory sequences are. e.g. se-quences which are involved in the binding of protein factors whichcontrol the effectiveness of transcription initiation in response to physiological conditions.

A "consticutive promoter" is a promoter which is subjected to sub-stantially no regula~ion such as induction or repression. but which .
' ' : ' ' . :, W 0 92/17~91 2 ~ i~ 6 ~ ~ ~ PCT/DK92/0010~
3~
allows for a steady and substantiallv unchanved transcription of the :;DNA sequence to which i. i5 functionall~ bound in all active cells o .he organiSm provided tha. other requiremenes for the transcription to take place is fulfilled. The cons~icu.ive promoter ma~ be enhanced.

.~ "regulatable promo~er" is a promoter ~he lunction of which is regulated by one or more factors. These factors may either be such which by their presence ensure expression of the relevant DNA se-quence or may, alternatively, be such which suppress the expression -10 of the DNA sequence so that their absence causes the DNA sequence to be expressed. Thus, the promoeer and optionally its associated re-gulatory sequence may be activated bv the presence or absence of one or more factors to affec. transcription of each of the D~A sequences of the genetic construct of the invention.

Other types of regulatory sequences are upscream and downstream ~equences involved in control of termination of transcription ~trans-cription terminators) and removal of introns, as well as sequences responsible for polyadenylation, and for initiation of translation.
When the regulatory sequence is to function in a plant, it Ls preferably of plant origin.

Factors regulating promoter activity may vary depending, i~cer alia, on the kind of promoter employed as well as on the organism in which it is to function. Tissue specific regulation may be regulated by certain intrinsic factors which ensure that genes encoding proteins specific to a given tissue are expressed. Examples of tissue specific promoters are leaf specific promoters such as the chlorophyll a/b promoter and the AHAS promoter, and further root specific, stem specific. seed specific and petal specific promoters. Also factors such as pathogenic attack or certain biological factors have been shown to re~ulate promoters. Furthermore, heat-response promoters and promoters involved in the developmental regulation of plants may be found to be of interest.

In the present con~ext. a suitable constitu;ive promoeer is selected ,: .
... .

W O 92/l759l P~T/DK92/OOlOX
3~ 3~
from the group consis,ing of plant promoters. fungal promo~ers.
bacterial promo~ers, or plant virus promoters.

A prererred group of plant .~irus promo~ers are promo~ers ~hich ma~ be derived from a cauliflower mosaic virus (Ca.~Tj. Sucn promoters are normall; s.ron~ cons~itu~ e promoters. E~amples OL a preIerred Ca~S~.
promoter is a Ca.~7 l9S promoter and a CaMV 35S promo~er (Odell et al., 1985).

Other promoters may be derived from the Ti-plasmid such as the occo-pine synthase promoter, the nopaline svnthase promoter (Herrera-Estrella et al., 1983), the mannopine synthase promo~er, and promo-ters from other open reading frames in the T-DNA such as ORF7.
Further examples of suitable promo~ers are MAS~355 (Janssen and Gardner, 1989), MAS dual Tr 1,2 (Velten et al., 1984) and a T-2 DNA
gene 5 promoter (Konz and Schell, 1986).

The regulatory sequence may be a chitinase promoter, i.e. a promoter which is naturally found in connection with chitinase genes and involved in the transcription thereof. A chitinase promoter may be obtained from an isolated chitinase gene, e.g. an already known chitinase gene or a gene which may be identified and isolated e.g.
by the methods disclosed herein. Typically, the chitinase promoter should be obtained from a plant which has been shown to have a fast response to pathogen challenge. In this connection, fast responses have been observed in pea and barley and it is contemplated that chitinase promoters from these plants may be useful for the present purpose. An example of such promoters is the chitinase promoter of pea (K. Vad, 1991). An example of another promoter which is contem-plated to be useful in the present context is the sugar beet chiti-nase 1 promoter (SEQ ID NO:11) and the sugar beet acetohydroxyacid synthase promoter (AHAS) ~P. Stougard and K. Bojsen, Danisco A/S, Denmar~, personal communication). Furthermore, the sugar beet promo~ers from the acidic chitinase SE, chitinase 1, chitinase 76 and chitinase 4 or ~-1,3-glucanase 4 may also be useful.

Optionally, and if desired. the natural promoter mav be modified for che purpose. e.g. by modifications of the promo~er nucleotide se-.
'' : - ' ;' ' . :, .
. , ' ' W 0 92/17~91 21 a ~ 3 g 9 PCT/DK92/OOlOX
3a quence so as co obcain a promoter functioning in another manner tnan ~he natural promo~er. preferabl~ activa~ing the c~anscrip~ion of ~ne gene earlier af~er ~he challenge wi-h a ~a~ho~en or bein~ stronge~;.

As seated above. each of the coding DNA sequences of the genetic construct of the invention is functionall~ connected to a transcr~ -tion terminator. The transcription terminator ser.~es to terminate the transcription of the DNA into RNA and is preferablv selected from the group consisting of plant transcription terminator sequences, bac-terial transcription terminaeor sequences and plant virus terminator sequences.

Specific examples of suitable transcription terminators are a NOS and OCS transcription terminator sequence of the opine synthase genes of Agrobaccerium (Herrera-Estrella et al., 1983). a 35S transcription terminator sequence of the cauliflower mosaic virus (Paszkowski et al., 1984), a PADG4 transcripcion terminator to the DNA gene 4 (Wing et al., 1989), and a PADG7 transcription terminator to the T DNA gene

7.

One or more of the DNA sequences of the genetic construct of the invention may advantageously be functionally connected to an enhancer sequence which results in an increased transcription and expression of the DNA sequence(s). Suitable enhancer sequences and means for : obtaining an increased transcription and expression are known in the art.

The specific promoters and the specific terminators, respectively, to be connected with each of the DNA sequences of the genetic construcc may be the same or different. It may be an advantage to use different promoters and terminators, respectively, because then the risk of recombinational events, which may lead to excision of parts of or the entire genetic construct, are avoided.
:
~-30 In a further aspect, the present invention relates to a vector which is capable of replicating in a host organism and which carries a DNA
-~`sequence of the invention comprising a chitinase ~ DNA sequence substantiall~ as shown in SEO ID NO:l or an analogue or subsequence W O 9~/17~91 ~ 3 ~ PCT/DK92/0010 ,0 thereof, or a genetic cons~ruct of che invention. The vector may either be one which is capable of autonomous replication~ such as a plasmid, or one which 1S replicated with the hos. chromosome, such as a bacteriophage or integrated into a plan~ genome via ,he border 5 sequences of Ti vectors, For production purposes. che vector is ar.
expression vector capable of expressin~ the DN.~ sequences in the organism chosen for the production. Thus, the expression vector is a vector which carries the regulatory sequences necessary for e~-pression such as the promoter, an initiation signal and a termination signal, etc. These regulatory sequPnces mav be the ones carried by the genetic cons.ruct of the invention. The vec.or may also be one used for identification and optionallv isolation of chi~inase genes or messengers from other organisms, e.g. other plants, for which purpose expression is not required. This may be done. e.g.. as described below.

In a still further aspect, the present invention relates to an organ-ism which carries and which is capable of replicating or expressing an inserted DNA sequence as defined above, i.e. a chitinase 4 DNA
sequence comprising a nucleotide sequence substantially as shown in SEQ ID NO:l or an analogue thereof or a chitinase gene or pseudogene comprising said DNA sequence.

The term "inserted" indicates that the DNA sequence (or subsequence or analogue, or gene or pseudo-gene) has been inserted into the organism or an ancestor thereof by means of genetic manipulation, in other words, the organism may be one which did not naturally or inherently contain such a DNA sequence in its genome, or it may be one which naturally or inherently contains such a DNA sequence, but in a lower number so that the organis~ with the inserted DNA sequence or the inserted genetic construct has a higher number of such sequences than its naturally occurring counterparts.

The DNA sequence carried by the organism may be part of the genome of the organism, or may be carried on a vector as defined above which is harboured in the organism. The DNA sequence mav be present in the genome or expression vector as defined above in frame wi,h one or wo 92/17~91 2 ~ CT/DK92/0010~

more second DNA sequences encodin~ a second poi-peptide o. ?ar~
thereof so as ~o encode a rusion protein ~.g. as definec above.

Ihe organism may be a higher organism such as a plan.. or - iower organism such as a microorganism. ~. lower organism sucn as a bac-; terium, e.g. a gram-nega~ e bac~erium such as a bac~erium of ~he genus Escherichia, e.g. E. coll~ or of the g~enus Pseudomonas, e g. P.
putida and P. fluorescens, or a gram-positiv~e bacterium such as of the genus Bacillus, e.g. 3 . subtilis, or a y,east such as of the genus SaccharomYces or a fungus. e.g. of the genus Aspergillus, is useful for producing a recombinant polypeptide as defined above. ~s many organisms inherently produce chitinase, the insertion of a DNA se-quence or a genetic construc~ according to the present invention mav lead to a considerably increased chitinase and op~ionall~ ~-1,3-glucanase expression and a correspondingly increased antifungal activity. The recombinant production may be performed bv use of conventional techniques, e.g. as described by Sambrook et al., 1989.

As it will be discussed in further detail below, a microorganism producing chitinase may be used in combating soil plant pathogens, i.e. pathogens present in the soil and responsible for retarded ; 20 growth or death of the plant. Examples of such plant pathogens are i soil fungi present in e.g. the rhieosphere.
:
Also, the organism may be a cell line, e.g. a plant cell line. Most preferably, the organism is a plant, i.e. a genetically modified . plant such as will be discussed in further detail below.

As mentioned above, the genetic construct is preferably to be used in modifying a plant. Accordingly, ehe present invention also relates to a genetically transformed plant comprising in its genome a genetic :.: construc~ as defined above. The geneticallv transformed plant has an increased antifungal activitv compared to a plant which does not harbour a genetic construct of the invention, e.g. an untransformed or nacural plant or a planz which has been geneticallv ~ransformed.
but not with a genetic construc~ of the invention. Normallv a cons~i-tutive e~pression of the polvpe~tides encoded bv the genecic con-struct is desirable. but in certain cases i; may be in~eres.ing ~o SUBST~TUTE 5HEET
ISA/EP

W O 9~/17~91 . PCT/DK92/O010~
3 ~ 9 have tne expression OL the poivpeptides encoded by the genecic con-struct regulated b~ various factors. for example ~ fac,ors such as temperature pathogens and bioloPicai fac~ors.

Chitinase genes have been found in monoco~yiedonous as weli as di-co~yledonous planes and have there been found ,o be e~pressed in.o chitinase active in destroving the cell walls or ph~topathogenic fungi.

Accordingl~, the plant to be transformed by the genetic construct of the invention mav be a monoc.otyledonous as well as a dicot~ledonous plant, since the genetic construct is expec~ed to be active in such classes of plants. Non-limiting examples of monocotvledonous plants which mav be transformed are corn. oa,, wheat. rve. rice. barle~ and sorghum.

Non-limiting examples of dicotyledonous plants which may be geneti-lS cally transformed are alfa].fa, tobacco, cotton, sugar beet, fodder beet, sunflower, carrot, canola, tomato, potato, soybean, oil seed rape, cabbage, pepper, lettuce, bean and pea.

It will be apparent from the above disclosure, that the genetically ~: transformed plant according to the invention has an increased re-sistance to chitin-containing plant pathogens such as phytopthogenic fungi and nematodes as compared to plants which have not been geneti-cally transformed according to the invention or as compared to plants : which do not harbour the genetic construct as defined above.

The most important chitin-containing plant pathogens to be controlled according to the invention are represented by phvtopathogenic fungi.
Phytopathogenic fungi differ in the way which they interac~ with their host plant during infection. Some species invade the plant via natural openings or wounded tissue and grow in between the plant cells, in the intercellular space, during the entire infection cycle.
The fungal hyphae excrete toxins or enzYmes that weaken or destrov the plant cells and thereby provide the fungus with cell constituents leaking out of the plant cells. Other fungal pathogens immediately W 0 92/17S91 2 ~ ~ ~ 3 ~ ~ PCT/DK9~/OOlOX
~3 destroy ~he hos. cells b~ penetra.ing the cell wall of health; hos.
cells and disintegra;e ~heir protoplasts.

Below are given some e~ampies o~ chitin and glucar. containing phy~o-paLhogenic fungi ~ith difrerent hose interacting s~rategies. all o~
s which are contemplaced to be sensiti~e to the transgenic plan.s o the invention.
cercospora spp is a fungus the growth of which is restricted to the intercellular space. Conidia (i.e. spores) from the fungus germinate on the leaf surface and penetrate through the stomata of the leaves.
Inside the leaf the plant cells close to the hyphae growing in the intercellular space are severely affected by the toxins e~creted from the fungus. The to~ins cause the plasma membrane co degrade. whereby the cell content leaks out into the intercellular space. Later in che infection cycle the plant cells collapse and necrotic areas containing dead plant cells and fungal mycelia emerge.

Vercicilliu~ alboacru~ is a root pathogen which propagates in the intercellular space, but which penetrates through the openings made by the emergence of lateral roots, through mechanically injured areas or by direct penetration of hyphae through the tender root tissue in the regions of cell elongation or meristemic activity. The fungus de-stroys the parenchymatous cells and the tracery elements are mechani-cally plugged.

Other plant pathogenic fungi with an intercellular infection cycle include: Sclerotinia sclerotiorum. ~hizoctonia solanl. Phytophtora megasperma and Helmintosporium spp.

Colletotricum lindemuthianum causes "Bean anthracnose". Conidia from this fungus germinate in a film of wacer in the infection court and the produced germ tube penetrates the cuticula and grows into the epidermal cells of bean leaves and pods. During the following infec-tion, the fungus acts as a parasitic pathogen. penetrating livingcells and causing disintegration of the protoplas~s.

W O 92/17591 PCT/DK92/OOlO~
3 ~ -~ 4:_1 Fusariu~l sPp. is a typical soilborne fungus infeccing ~he plants through the roots. where the hyphae penetrate the epidermal cells of young roo~s and invades the ~vle~ of roots and stems. The vessels become plugged with granular material and surrounding cells of the a outer phloem and corte~ are destroved.

Puccinia graminis causes "Stem rust" of wheac. Ihe sporidia germinate on a film of water on the surface of the plant and the germ tubes penetrate the cuticula. The growing mycelia produce haustoria that penetrate the walls of the host cells and invaginate their proto-plasts.

Us~ilago mavdis is a fungus with mainly intercellular growth~ butoccasionally penetrates the cell wall of host cells.

In a further aspect, the present invention relates to seeds. seed-lings or plant parts obtained by growing the genetically transformed plant as described above. It will be understood that any plant part or cell derivable from the genetically transformed plant of the invention is to be considered within the scope of the present inven-tion.

In recent years, a great effort has been focused on developing useful methods for constructing novel plants or plant cells having specific and desirable properties by transferring new genetic information encoding the desirable properties to the plant, and a number of such methods based on recombinant~DNA technology and suitable plant trans-formation systems are now available. Usually, the genetic information is introduced into the plant by use of a vector system or by direct . introduction, e.g. by use of the methods given by Herrera-Estrella et al., 1988, Rogers et al., 1988, Saul et al, 1988. An et al., 1988.
Hooykaas, 1988, Horsch et al., 1988, Reynaerts et al., 1988, and Tomes et al.. 1990.

3Q Thus, in another aspect. the present invention relates to a transfor-mation svstem comprising at least one vector which carries a genetic construct as defined above and which is capable of introducing ~he genetic construc. into the genome of a plant sucn as a plant of ~he .,~ .
,.~;
.. .. ".

WO 92/17591 21 ~ ~ 3 ~ 3 PCrIDK92/0010X
.
ramii~ Chienopodiaceae. in particular or the genus Be~a. especiall;
~ eca vulgaris ':
Normallv, pian. transîorma.ion s~seems are based on the use of plasmids or plasmid derivatives of .he bac~eria Agrobac~eri~m. The two bes~ ~nown Agrobac~eria are .4grooacceriu~ tumeraciens and ~gro-~ bacterium r.~izogenes (plasmids thereof are in the following .ermed pTi and pRi, respectively). The use of such plant transformationsystems is based on the ability of the bacteria Agrobacoerium to transfer a specific piece of DNA (T-DNA) to a plant cell in a wounded area. In nature, the T-DNA is located bet~een specific border DNA
sequences on the pTi or pRi which further carries virulence genes necessary for the transfer of the T-DNA to the plant. The Agrobac-cerium transformation system mediates the transfer of-anv DNA se-quence located between the "borders" and thus, it is possible to exchange the wild type Agrobaccerium T-DNA with any desirable piece :; of DNA to be introduced into a plant.

Preferably, the plant transformation system of the invention is based on disarmed Agrobacteria harbouring derivatives of the pTi or pRi from which the wild type T-DNA has been removed.

Normally, the vector system with which the plant is transformed , comprises one or two plasmids. In the one-plasmid system (also termeda co-integrate vector system~, the T-DNA of pTi or pRi has been removed and replaced by the DNA to be transferred into the plant cell by use of homologous recombin~ation. In the two-plasmid system (also termed a binary vector system) both the T-DNA and the borders have been removed from the pTi or pRi. Introduction in the disarmed Agro-bacterium of a small plasmid containing the DNA to be transferred between pTi or pRi identical borders and a suitable origin of repli-cation, results in a vector system where the virulence functions are located on the disarmed pRi or pTi and the T-DNA and borders are located on another plasmid.

An example of a suitable plant transformation vector is pBI121 and ~; derivatives thereof, e.g. as described by Jefferson 1987.

W O 92~17~91 PCT/D~92/00108 ~d~ ~3a9 46 Suitably. ~he ~ec~or ~o be used is ~roviàed with sui;abie mar~ers.
eucarvotic as well as procarvo~ic C r genes encoding antibio;ic resis;ance or herbiciàe resis~ance or ~iucoronidase (GUS) hvgromvcin or o;her ~nown markers. r, ~, rhe ~.arkers disciosed 'Dy Lindsey~ 1989 and Revnaerts eL al.. 1988. The marKer is co De presen, so as to be able to determine whesher he DNA inser~ has been inser~-ed in the desired position in the plasmid and to be able to select plant cells transformed with the vector.

The use of more than one vector in one transformation event will according to the presently known plant cransformation cechniques normally require that different selective genes are present on each vector in order to be able to follow the success of the plant transformation.

In the construction of a transgenic plant using a plasmid such as a pTi or pRi or derivative thereof it is preferred that ehe genetic construct to be inserted in the plant is first constructed in a mi~roorganism in which the plasmid can replicate and which is easy to manipulate. An example of a useful microorganism is E. coli, but other microorganisms having the above properties may be used. When a plasmid of a vector system as defined above has been constructed in E. coli, it is transferred, if necessary, into a suitable Agrobac-teriùm strain, e.g. Agrobacterium tumeraciens.

The plasnid harboring the genetic construct of the invention is thus preferably transferred into a suitable Agrobaccerium strain, e.g. A.
eumefaciens, so as to obtain an Agrobacterium cell harboring thegenetic construct of the in~ention, the DNA of which is subsequently transferred into the plant cell to be ~odified. This transformation may be performed in a number of ways, e.g. as described in An et al.
(1988).

Direct infection of plant tissues bv Agrobac~erium is a simple tech-nique which has been widely emploved and which is described in Bu;-cher et al. (1980). Tvpically, a plan; to be inrec~ed is wounded, ; e.g. bv cu~ting the plan; with a razor blade or punc.urin~ ~he plan~
~ with a needle or rubbing the plan; ~i;h an abrasi~e or brusning ~he , . .
:~ SUBSTiTlJTE SHEET
~` ISAIEP

.

W O 92/17~91 21~ ~ 3 t~ 9 PCT/DK92/0010~

plant wi~h a s~eel brusn ~e.- ~s described in E~ample l~). The wound is then inoculased ~ h the A~-roDac~erium, e.g. in a suspension .`l,erna,i.el~. ~he infec~ioe or^ a plan. ~a~ be done on a cer,ain par~
or ~issue or ~he piane. i.-. on a par. or a lea~. ~ roo,, a stem o-ano~her pars of the pian.. lhe inocula~ed plan~ or plans par. is ~hen subjected ~o selec~ion and regenera,ion and grown on a suitabie cul~ure mediu~ and allowed to develop into mature plants. This is accomplished by use of methods known in ~he art.

Other verv suitable methods for transforming the plant is bv use of sonication. electroporation (Joersbo. 1990) or particle gun methods, e.g. as described by Klein et al., 1989.

'~hen genetically transformed plant cells are produced these cells may be grown and maintained in accordance with well-known tissue culturing methods such as by culturing the cells in a suitable cul-lS ture medium supplied with the necessary growth factors such as aminoacids, plant hormones, vitamins, etc. Regeneration of the transformed cells into genetically modified plants may be accomplished using known methods for the regeneration of plants from cell or tissue cultures, for example by selecting transformed shoots using an anti-biotic and by subculturing the shoots on a medium containing theappropriate nutrients, plant hormones, etc.

In accordance with well-known plant breeding techniques it will be understood that the production of a genetically transformed plant may be perfor~ed as a double transformation event (introducing the gene-tic construct in two transformation cycles) or may be associatedwith use of conventional breeding techniques. Thus, two genetically modified plants according to the present invention may be cross breeded in order to obtain a plant which contains the genetic con-struct of each of its parent plants.

As will be understood from the introductory part of the presen~
specification. the chitinase 4 DNA sequence of the present invention or an analogue thereof mav be used for dlagnostic purposes, whlch will be further e~plained in the following.

W ~ 92/17~91 PCT/DK92/0~10~
2 ~ 48 Various ~vpes or dia~nosis mav be perrormed by use or .he chi~_nase DNA sequence or the in~ention. in a given example. chitinase mes-senger ~NA's .ranscribed from a gene belonging ~o ~he chi~inase ~
gene famil~ mav be qualita.ivelv as ~eli as quan~i.ativei~ ae~ermined 5 bv hvbridiza~ion ~o ~he DNA sequence of .he inven~ion comprising ~he chitinase 4 DNA sequence or an analogue or subsequence thereor under conditions suitable for said hybridization. Furthermore, genes be-longing to the chitinase 4 gene family and present in an organism such as a plant may be identified and isolated by use of the DNA
sequence of the invention, e.g. by screening a gene library of such an organism.

When the DNA sequence comprising the chitinase 4 DNA sequence or an analogue or subsequence ~hereor is to be employed for diagnostic purposes, it will often be useful to provide it with a label which may be used for detection. Useful labels are known in the art and is, e.g. a fluorophore, a radioactive isotope, an isotope or a complexing agent such as biotin.

Also, the DNA sequence of the invention comprising the chitinase 4 DNA sequence or an analogue or subsequence thereof may be used in a method of isolating a gene or messenger belonging to or derived from the chitinase 4 gene fa~ily from an organism, e.g. a plant, in parti-cular a disotyledon, the method comprising hybridizing a nucleic acid containing sample obtained from a gene library or cDNA library from the organism with the DNA sequence of the invention comprising the chitinase 4 DNA sequence or an analogue or subsequence thereof, optionally in a labelled form, in a denatured form or an RNA copy thereof under conditions favorable to hybridization between the DNA
sequence or RNA copy and the nucleic acid of the sample, and recover-ing the hybridized clone so as to obtain a gene or cDNA belonging to the chitinase 4 gene familv of the organism.

The identification and isolaeion of a gene or cDNA clone in a sample belonging to the chitinase 4 gene familv by use of the chitinase ~
;DNA sequence of the invention or an analogue thereof, in particular a subsequence thereof. mav be based on standard procedures. e.g. as '5 described bv Sambrook et al.. 1989. ~-or instance, to cnaracteri_e :: SUE~STITlJTE 5~1EET
~ ISA/EP

.

O 92/t7~9l 2 ~ E~ ~ PCT/DK92/~010~

chitinase ~ related genes in other plants. i- is preferred .o emplo~-standard Southern techniques.

The chitinase 4 D~A sequence o~ the in~en.ion or an analogue or subsequence thereo~ ma~ also be used in a method of quantif~ing the amoun. OI a chitinase 4 related messenger present in differen~
tissues in an organism, e.g. a plant. the method comprising hvbridi7-ing a nucleic acid containing sample obtained from the organism with the chitinase 4 DNA sequence of the invention comprising a nucleotide sequence substantially as shown SEQ ID NO:1 or an analogue thereof.
especiallv a subsequence thereof. optionallv in labelled form. in denatured form or an RNA copy chereof under conditions favorable to hybridization between the denatured DNA sequence or RNA cop~ and the RNA of the sample and determining the amount of hvbridized nucleic acid ~Barkardottir et al., 1987).

1~ The hybridization should be carried out in accordance with conven-tional hybridization mechods under suitable conditions with respect to e.g. stringency, incubation time, temperature, the ratio between the DNA sequence of the invention co~prising the chitinase 4 DNA
sequence or an analogue or subsequence thereof to be used for the identification and the sample to be analyzed, buffer and salt concen-tration or other conditions of importance for the hybridization. The choice of conditions will, inter alia, depend on the degree of com-plementarity between the fragments to be.hybridized, i.e. a high degree of complementarity requires more stringent conditions such as low salt concentrations, low~ionic strength of the buffer and higher temperatures, whereas a low degree of complementarity requires less stringent conditions, e.g. higher salt concentration, higher ionic strength of the buffer or lower temperatures, for the hybridization to take place.

The support to which DNA or RNA fragments of the sample to be analvz-ed are bound in denatured form is preferably a solid support and may be any of the supports con~entionallv used in DNA and RNA analvsis.

The DNA sequence used for detecting the presence of the chitinase 4 related gene is prererabl; labelled. e.g. as e.~:plained abo~e.. and the :
".

W O 92/1?~l PCT/DK9~/OOlOX
f~ J ~ ~ ~0 presence of h~-bridized D~A is deeermined bv aueoradioEraph.. scin-tillation coun.ing. luminescence or cnemical reaction.

Another approach Lor deeec.in~ the presence oI a specific cbi~inase -.
relaLed gene. e.g introduced b: the genetic me.nods described pre ~:iously, or a par. .hereof n an organism, e.~. a pian.. e particu-lar a dicotvledon, is to emplo~ the principles OL the well-~nown polymerase chain reaction. e.g. as described in che ".~laterials and Methods" section below.

The sample to be analyzed for the presence of a chitinase ~ related gene or part thereof in accordance with che methods outlined above mav be taken from the group of plant parts consisting o~ leaves.
stems, tubers. flowers. roo~s. sprouts. shoots and seeds.

The same principles as described above may be used in the isolation of DNA sequences to be used in the preparation of a genetic construct of the invention, e.g. DNA sequences encoding a polypeptide having chitinase or ~-1,3-glucanase activity.

Restriction fragment length polymorphisms (RFLP) are increasingly used to follow specific alleles of genes in various organisms. The alleles are either themselves followed or they are used as markers (unlinked or linked) in crosses involving other characteristics~ e.g.
pathogen resistance and morphological characteristics such as tuber ~: colour. So far, the method has primarily been employed in humans~ but : it has also been employed in ~plants. It is contemplated that the chitinase 4 DNA sequence of the invention or a analogue thereof maY
be useful in RFLP-analysis of chitinase 4 related genes, especiallv in sugar beet.

In a ~urther aspect the present invention relates to an antifungal :;' composition comprising a polvpeptide encoded bv a DNA sequence com-prising the chitinase 4 DNA sequence.shown in SEQ ID N0:1 or an ana-logue or subsequence ,hereof as defined above~ or bv a genetic con-struct of the invention as defined above and a suitable vehicle. In another embodiment~ the presenc invencion relates to an ancifun~al composition comprising a microorEanism capable oi e.~:pressin. a pol~-W O 92/17~91 21 ~ 6 3 ~ 9 PCT/DK92/001~

peptide encoded b~. the D~;r. sequence comprisin~ the chitinase ~. D~r.sequence shown in SEO lD ~0 :1 or an analogue or subsequence thereor as derined abo~e. or b. a Eene~ic construct of .he inven~ion defined above and a sui~abl- venicie .~1icrooranisms sui,able as cons~ituen.s ; in an antiiungal composition are men~ioned above.

The antifungal composition according to the present invention may be ; prepared bv a method comprising culturing a microorganism harbouring and being capable of expressing a DNA sequence of the invention comprising the chitinase 4 DNA sequence shown in SEQ ID NO:l or an analogue or subsequence thereof or a genetic construct of the inven-tion in an appropriate medium and under conditions which result in the e~pression of one or more aneifungal polypeptides encoded by the D~'A sequences, optionallv rupturing che microorganisms so as to release their content of expressed antifungal polypeptide(s) into the medium, removing cell debris from the medium. and optionally subject-ing the medium containing the polypeptide(s) to freeæe-drying or spray-dryin~ thereby obtaining an antifungal composition comprising the antifungal polypeptide(s). Alternatively, the antifungal proteins may be excreted to the medium, and optionally after removal of the microorganisms by conventional methods or after purification of the proteins by conventional methods or after purification of the prolines by conventional methods, the medium may be used directly or after freeze drying.
:
The antifungal composition according to the invention may be used in combating or inhibiting the germination and/or growth of a phytopa-thogenic fungus in or on a plant or in any other material in which the presence of fungi is undesirable. This will be further discussed below.

The antif~mgal composition of the invention shall, of course, be adapted to its intended purpose, both with respect to the vehicle to be used and with respect to the form. in which the antifungal agen~
is present. Bv the term ~an~ifungal agent" is meant the active con-stituent of the antifungal composition responsible for or involvea in providing the antifungai activitv. By the term "antifungal poly-3~ peptide" is meant a polvpeDeide encoded bv the chitinase i D~ se-W 0 92/17;~ 3 ~ ~ ~ PCT/DK92/OOlOX

quence of the inven~ion or an analogue thereof or a gene~ic constructof the invention havin~ antifungal activity, i.e. chitinase acti~.~itv and optionally B-l.3-glucanase activity as defined above.

The an~ifun al composition may in addition to the polvpeptide encoded by the chi~inase 4 D~'A sequence of the invention or an analogue thereof or a genetic construct of the invention having antifungal activity, i.e. chitinase activity and optionally ~-1.3-glucanase activity as defined above, contain one or several chemicals, e.g.
fungicides, conventionally used in the combatting of fungi either therapeutically or prophylactically.

Normallv, the antifungal agent is in itself a microorganism or will be prepared by a microorganism. In most cases, the most easv and inexpensive way of preparing the antifungal composition will be to use the microorganism as such or the medium in which it is grown as ~5 the antifungal agent. The antifungal polypeptide(s) expressed from the microorganisms may be secreted into the medium, e.g. as a conse-quence of the action of a suitable signal peptide capable of direct-ing the polypeptide out into the medium, or may be released from the microorganism by well known mechanical or chemical means. Before use, it may be advantageous to remove the microorganisms or any cell debris from the medium.
, The medium may, in principle, serve as the vehicle for the antifungal agent, but it is preferred to add a further vehicle sùited for the particular intended use.

A culture of the microorganisms expressing the antifungal polypep~
tide(s) may be obtained as described above using methods known in the art. As mentioned above, it may be necessary or advantageous to subject the microorganism culture to a further treatment so as to release the content of the antifungal polypeptide(s) into the medium or to increase the amount released bv secretion.
'', .
The medium comprising a substantial amount of the antifungal polvpep-- tide~s) may be directlv applied ~o the soil in which the plants are ` present or in which the plants are to be grown. or to the plants or :., . - ' ~
~ , ' . .

~'~ 92117~91 2 i ~ ~ 3 ~ ~ PCT/DK~2/0010~

piant parcs or _o .he isriga.ion wa~es. .~l~ernativelv~ seeas ma~ be ~reated with ~ne mediu~.. op~ionaiiv in combination wi~h a conven~ion-al seed coaeing com?osi~ior..

The microorganisms expressing the an.ifungal polvpeptide(s`) can be applied in various forrnula~ions containing agronomicall~ acceptable vehicle5, i.e. adjuvants or carriers, in dosages and concentrations chosen to maximize the beneficial effect of the microorganism. How-ever, the microorganisms may also be distributed as such under cir-cumstances allowing the microorganisms to establish themselves in the material to be treated. ~en the microorganism is a microorganism conventionally found in the soil, e.g. a rhizobacterium, it will generallv be desirable that the transformed microorganism establishes ieself in the soil so that it continuously mav secrete the antifunyal polypeptide(s) out into the soil surrounding the plant.

l; It may be advantageous to add the microorganisms or the medium com-prising the antifungal polypeptide(s) to pre-mixes, e.g. artificial growth media or other soil mixes used in the cultivation of the plane in question. For such purposes it is convenient that the microorgan-isms or the medium is in a solid form, e.g. in a powdery form or in the form of a granule. The powdery form may be obtained by conven-tional means, e.g. by applying the microorganism on a particulate carrier by sprav-drying or an equivalent method.
~, .
When the microorganism expressing the antifungal polypeptide(s) is to ~:- be used in a humid state it m~ay be in the form of a suspension or dispersion, e.g. as an aqueous suspension.

In order to induce the chitinase activity of the transformed microor-ganism it may be advantageous to add a small amount of chitin to the medium in which the transformed microorganism is present.

In accordance with the above, the present invention further relates to a method of inhibiting the germination and/or growth of a chitin containing plan~ pathogen. such as phvtopathogenic fungus. in or on a plant. which method comprises W O 92/17~91 PCT/DK9~/OOlOX
21~6~
i) transrorming the plane or a par~ .hereof with a genetic cons~ruc, as defined above and regenerating the resultin~ trans~ormed ~lan. or plar.~ par~ into â Eene~icall~ transror~ed pian-. and/or '\ treating he plan~ or a par. ~hereof a seecling or seec ^ro~.
~hich the plan~ is to be propagated. or the medi~ on whicr ~e is grown with an antifungal composition as defined above.

~hile genetic transrormation of plants is for most purposes are the preferred method, it mav be an advantage to combine transformation with treatment of ~he plant with an antifungal composition of the invention. Since the genetic transformation is a time-consuming and in certain aspects difficul~ process it mav be an advantage to use a biologicallY based composition instead of or in addition to the conventionally used and from an environmental point of view undesir-able chemical fungicides.

In most cases the material to be treated with the antifungal composi-tion of the invention is a plant. However, a number of chitin con-taining fungi exist which infect other materials than plants, e.g.
food products such as bread or bread products, milk products cheese, ; meat, vegetables, cereals, in which the presence and growth of fungi are undesirable. It is contemplated that an antifungal composition according to the present invention may be used to control or combat such fungi. In this respect. it is contemplated that also beverages : and containers tany part thereof) used for food products or beverages may be treated with an antifungal composition of the invention either : 25 as a prophylactic treatment or a combating treatment.

The present invention is further illustrated in the following se-quences, examples and accompanving drawings, but no~ limited hereto.

The drawing:

Fig. l describes the purification of sugar beet chitinase 2. 3 and 4 by Mono-S cation exchange chromatographv at pH 4.j. Elution of the proteins was performed with a linear grcldient of NaCl. The absorbance was recorded at 280 ~m.

W O 92/17~9l PCT/DK92/0010~
3 ~

F~ descr bes .:~e DolypeD,ide Dac~ern of suEar beet chitinase :.
and 4 aL-er puririca.ior. or. a ~ono-S FPLe colum~.. Lanes contain 50 of ~he foliowin5 proteins. Lanes a and b. chi.inase 4 lanes d and e chitinase 3: lanes f and _. chi~inase 2; and lanes c and h. molecuiar 5 weigh~ markers. Ihe proteins were s~alned with silver.

Fig. 3 shows the analysis of the water-soluble products released from 3H-chitin bv chitinase 4. 3H-chitin was incubated with 4 ~g chitinase 4 at 37C for 0.25, 0.5, 3 and 24 hours. As a control 3H-chitin was incubated without enzyme at 37C for 24 hours. The chito-oligosaccharides released were separa~ed by TLC and identified b.comparing their migration with that of N-acetylglucosamine (monomer) ~Fig. 3A), chitobiose (dimer) (Fig. 3B), chito~riose (trimer) (Fig.
3C) and chitotetraose (tetramer) (Fig. 3D) standards. The radioactivity representing the chitooligosaccharides was determined by scintillation counting after cutting the TLC plate inCo pieces.
... .
Fig. 4 shows the lysozyme activity of chitinase 4. 1 ~g of the enzyme ; was incubated with cell walls from Microc~ccus Iysodeikticus and the decrease in absorbance at 450 nm was recorded at specified time . intervals. 1 ~g of SE ("Sure Ellen") was used as a control, and (50 ng and 5~g) lysozy~e (lys) was used as standards.
, Fig. 5 shows the inhibition of the growth of Cercospora by a combina-tion of chitinase 4, acidic chitinase SE and ~-1,3-glucanase h using the microscope slide bioassay. After 48 hours of incubation the -~ cultures were stained with Calcofluor White and investigated under 2; fluorescent light.

Fig. 5A shows the growth of the fungus when 20 ~g of each of the enzvmes chitinase 4, acidic chitinase SE and B-1.3-glucanase 4 were added to the culture at time 0.

W O 92/17~1 PCT/DK92/0010~
2~ 6 3 0 9 ~

Fig. ~ shows ~he growtn or a con~rol culture ~nere no an~i-fungal proteins have been added.

~ig. 6 shows the inhibi~ion o~ growth of Cercospora b~ chitinases using the microtiter plate bioassa;. The time course curves (absor-5 bance at 620 nm) describe the growth of the fungus during the first92 hours of incubation. The absorbance (an inclication of the growth) was measured at 8 to 16 hours time intervals and each measurement is an average of 5 replicates. Curve A is a control curve showing the growth of Cercospora when no growth inhibitors were added to the culture. Curve B shows the growth of the fungus when 20 ~l of a chitinase containing fraction from the chitin-column was added a~
time 0. In curve C 20 ~g of purified chitinase was added to the : culture at time 0.

Fig. 7 is an autoradiography showing the effect of chitinase 4 on : 15 chitin in the apex of Cercospora hyphae. Incorporation of 3H-labelled N-acetylglucosamine into the hyphae of Cercospora becicola was per-formed by growing the fungus for 20 minutes on growth medium con-taining radioactive monomer of chitin. Incorporation of ~-acetylglu-: coseamine into the cell wall in the apex of the fungal hyphae is seen '20 as black dots.

:Fig. 7A shows the hyphae before treatment with purified chiti-nase 4.

Fig. 7B shows the hyphae after the radioactive incorporation followed by treatment with purified chitinase 4 for 24 hours.

Fig. 8 shows the separation of tryptic peptides of chitinase 4 b;
reverse phase HPLC on a Vvdac RP-18 column. The peptides were eluted with a linear gradient from 10% to 45% acetonitrile from 25 to 75 minutes. Buffer A was water whereas B was acetonitrile. Both sol-ven~s contained 0.1~. trifluoroacetic acid. The flow rate was 0.7 ml/minute.

W O 92/17~91 PCT/DK92/~OlOX
~ 21~3~3 Fig. a shows .he se~a~a;ion of three acidic SE chitinase iso~mes on an anion e~chang~ colu~n (~lono P) b~ ,he FPLC svs~em. The proteins were eluted wi.h a linear sodiu~. chloride gradien- in a 25 m~ Bis-Iris bufrer a~ p~ ,Ø

Fig. 10 describes the two different serological classes of sugar beet, the chitinase 2 and chi~inase 4 class. 5 ~g of both chitinase 2 (32 k~) and 4 (26 ~D) were blotted on to the ni~rocellulose membrane before reaction with antibody to sugar beet chitinase 2 ~Fig. lOA) or antibody to sugar beet chitinase 4 (Fig. lOB).

Fig. Ll. Hybridi~.aeion of different chitinase genes with a chitinase 4 cDNA probe under specific hybridizacion conditions. The different - chitinase genes were spotted on Hybond N-nylon membranes as 1 ~1 probes of a plasmid preparation coneaining the chitinase sequences.

1 a chitinase 1 clone from sugar beet ~` 15 2 a chitinase 4 clone form sugar beet 3 a chitinase 76 clone form sugar beet 4 a chitinase clone from pea 5 an acidic chitinase SE clone from sugar beet . 6 a chitinase clone 1 from tobacco 20 7 a chitinase clone 2 from tobacco

8 a chitinase clone 3 from tobacco

9 a chitinase cl,one from bean

10 a chitinase 4 like clone from rape seed.

The hybridization was carried out over night at 55C in the following hybridization buffer: 2 x SSC, 0.1% SDS. lO x Denhardt's. 50 ~g/ml Salmon sperm DNA and a chitinase 4 cDNA sequence as probe and under washing conditions of 55C. 2xSSC. 0.1% SDS in two times 15 minutes followed by two times 15 minutes lxSSC, 0~1% SDS, 55C.

W O 92/]?591 ~ ~ a 9 PCT/DK~t/OOlOX

Fig. i` aescribes ne induc.ion of chitinase and ~-1.3-glucanase in sugar bee leaves a ~er ir.fecsion with Cercos?ora be. coia. Plan.s werê inocula.ed wl ;~ a sus?ension of lun~ai spores. Leaves ~ere harves.ed af.er spec~fied .ime in~ervals and c-ude e~trac.s were ?repared. ~nzyme ac~ivi.ies o~ cr,itinase (Pic l~A) and D-1.3-glu-canase ~FiC 12B) were measured using cne radio.racer assa;s with 'H-chitin and 3H-laminarin as the subs~rate. respectivel~.

Fig. 13 describes the immuno-detection of su~ar beet chitinase 2 and and ~-1.3-glucanase 3 in pro~ein extracts of Cercospora infected . 10 sugar beet leaves. Lanes I and c contain protein extracts from in- .
fected and control plants. respectivelv. Antibodies raised agains~
chi~inase ) ~left). chitinase 4 (centre) and D-1.3-glucanase ' (right) were employed.

Fig, 14. Site directed mutagenesis of amino acids contemplaced to form part of the active site of the chitinase 4 enzyme by the use of the PCR technique described in "Materials and Methods". SD0 is used : as S' primers for all the suggested PCR-reactions. The sequence is indicated by the arrow and is chosen S' to the unique BamHI site. The sequences for the SDl, SD2, SD3, SD4 and SD5 primers are indicated bv :, 20 arrows. For these 3' primers the complementary sequence with the :; indicated substitutions are used. The primers can be used for the following substitutions with reference to the genomic chitinase DMA
sequence ~SEQ ID N0.:3) encoding the amino acid sequence shown in SEQ
ID NO. :4. Numbers in brackets denote the number of the corresponding amino acid encoded from the chitinase 4 cDNA (SEQ ID NO. :2) SDl: Trpl70-T~r ~169) TGG-TAC
SD2: Glul90~Gln (189) G M-CAA
SD3: Aspl84-Asn (183! GAT- MT
SD4: Trp207-Tvr (206) TGG~TAC
30 SD5: Trp205-T-r (204) TGG-TAC

The PCR products are digested with the relevant restric~ion enzvmes wo 92/1?~91 2 ~ ~ 6 3 ~ ~ PCT/DK92/OOlO~
~c and e~changed wi~h .he corresponding sequence in the cnitinase 4 gene. Fig. 14A and Fig. 1~ should be considered as one figure.

Fig. 1_. Cons;ruc~ion ot a n~-brid 3-l.3-glucanase gene cons~ruc~
~ith a C-terminal e~.ension from ~obacco Fig. liA. A sugar beet cDNA ~-1,3-glucanase clone with an under-lined tobacco C-terminal extension.
. .
Fig. 1jB and Fig. 15C. PCR primers which can be used to change the stop codon and to in~roduce a part of the C-terminal extension, a DraI site is created at the 3' end. The arrows indicate the PCR primers: for the j' primer the sequence underneath the arrow is used, for the 3' primer the complementary sequence with the indicated substitutions is used.
Fig. 15B and Fig. 15C should be considered as one figure.

Fig. 15D. Four annealed synthetic oligonucleotides containing the last part of the C-terminal extension, a stop codon, a SmaI
site and an BglII site.
' ~
The fused gene product can be made by digesting the glucanase gene with XbaI and EcoRI and ligating it with the PCR product digested with XbaI and DraI and the annealed synthetic oligonucleotides di-gested with SmaI and BglII.

Fig. 16. Construction of a hybrid chitinase 4 gene construct with a C-terminal extension Fig. 16A. Chitinase 4 with an underlined tobacco C-terminal extension.

Fig. 16B and Fig. 16C. PCR primers which can be used to introduce a SmaI site near the stop codon in the chitinase gene. The arrows indicate the PCR primers: for the S' primer the sequence underneath the arrow is used, for the ~' primer the ~,..
.

W O 9 /17591 PCT/DK9~/0010~
2~33~
8?
complementar~ sequence with ene indica~ed subs~i~u~ions is used.
Fig. 16B and Fi_. 16C should be considered as one fi~ure.
;' Fig. !6D. Four annealea s~n.hetic oligon~cleotides coneaining the sequence for the C-terminal e~censi3n. a changed seop codon.
a SmaI site and an EcoRI site.
;-The fused gene product can be made bv digesting the chitinase 4 gene with BamHI and EcoRI and ligating it with the PCR produce digested ; with BamHI and Smal and the annealed svnthetic oligonucleotides . :' digested wi~h SmaI and EcoRI.
, . .
`'' 10 Fig. 17. Construction of the plant transformation vector pBKL4K4containing the chitinase 4 DNA sequence shown in SEQ ID NO:l. The boxed sequences indicate the B15 chitinase 4 cDNA, the enhanced 35S
: promoter and the 35S terminator sequences used for the construct.
; pB15K4.1 is pBluescript carrying the 966 bp EcoRI fragment encoding ' 15 the chLtinase 4. The hatched boxes indicate the coding regions con-~ tained in the final product. Kb3 (-KB3) and Kb4 (-KB4) are synthetic `~ oligonucleotides acting as primers in the polymerase chain reaction (PCR) using pB15K4.1 DNA as template. The DNA sequences of KB3 and KB4, respectively, are given in Example`18 and shown in SEQ ID NO:49 20 and SEQ ID NO:50. Plasmid pPS48 carries a conventional 35S enhanced promoter and a conventional 35S terminator separated by a polylinker containing unique cloning sites. The plant transformation vector pBKL4 (a modification of pBin 19 Bevon, 1984) carries a right and a left T-DNA border sequence from the Agrobacterium Ti plasmid pTiT37, a GUS gene with a 35S promoter and a conventional NOS cerminator, a conventional NPTII gene with a 355 promoter and a conventional OCS
~ terminator. A polylinker containing several unique cloning sites is .~ situated between the GUS and the NPTII genes. Fig. 17A and Fig. 17B
should be considered as one figure.

Fig. 18. Construction of the plant transformation vector pBKL4K4KSEl containing the DNA sequences encoding chitinase ~ and acidic chitinase SE. respec.ivel.~ shown in SEQ ID NO:l and SEQ ID ~0 8. Ihe ,~
: ' :

W O 92/17~91 2 ~ ~ 6 3 ~ 9 PCT/DK92/OOlOX

bo~ed sequenceS indica~c ~he acidic chi.inase 5~ cD`;~ .he ennancea 35S promoter and .he 3~5 ~erminator sequences also used in connec~ior.
~;i,h the cons.ruc~ sno~-'. in Fig. ~~. ?Sur! is pBluescri?~ carr.in_ ~he 5' end or the SE gen~. pSE21 is i~kewise ~Bluescri?. carr;ir._ almos. .he en.ire S_ cD~A. The ha-cned bo~es indicare the coding regions con.ained in .he r,nal produc;. - AGcTGTA~ is an adap.or used for the KpnI-HindIII ligation. pPS48 is men~ioned in connection with Fig. 17. The construction of the plant transformation ~ector harboring the chitinase 4 sequence (pBKL4K4) is described in Fig. 17.
: 10 Fig. 18A and Fig. 18B should be considered as one figure.

Fig. 19. Construction of the plan~ transformation ~ector pBKL~K76 containing the genomic chitinase 76 gene. the sequence of ~hich is shown in SEQ ID NO:5. The boxed sequences indicate the chitinase 76 gene, the enhanced 35S promoter and the 35S termina;or sequences.
pK76.1 is pUCl9 carrying ~he HindlII-~coRI fragmen. encoding chiti-nase 76 in the HindIII/EcoRI site of the pUCl9 polylinker. The hatched boxes indicate the coding regions contained in the final product. KB3 and 340 are synthetic oligonucleotides acting as primers in the polymerase chain reaction (PCR) using pK76.1 as template. The 20 DNA sequences of KB3 and 340, respectively, are shown in Example 18 and shown in SEQ ID NO:49 and SEQ ID NO:51. Plasmid pPS48 was used in connection with Fig. 17. The plant transformation vector pBKL4 is described in Fig. 17. Fig. 19A and Fig. l9B should be considered as one figure.

Fig. 20. PCR amplification of a part of the acidic chitinase SE cDNAusing mRNA as a template. mRNA ~as reverse transcribed using a primer consisting of oligo-dT linked to two restriction sites (270) (see Example 7). Amplification was carried out using a gene specific mixed oligonucleotide linked to a restriction site (XbaI-KB7) as the ;' primer and 270 as the 3' primer. A second round of amplification was then carried out using another gene specific mixed oligonucleotide linked to a restriction site (Ba~HI-KB9~ as the 5' primer and 270 as the 3' primer. The DNA sequence of 270 is shown in E~ample 7 and SEO ID NO:30.

W ~ 9~/1?~91 PCT/DK92/nOlOX
~6309 ri~. 21 desc.ibes ~h_ separa~ion of surar bee~ ~-'.3-~iucanas-s ' _.
, and 4 b! .~tono-S cation e~change cnromatoEraprl. ~ pH i,~ Elu~ior.
was performed with a linear gradien~ oî `;aCl. The aosorbance was measured a~ 280 nm.

5 Fig. 22 describes the construction of the plant transformation vector pBKL4K4KSElGl containing the DNA sequences encoding chitinase 4.
acidic chitinase SE and ~-1.3-glucanase, respecti~el~, and shown in SEQ ID N0:1, SEQ ID NO:7 and SEQ ID N0:9. The bo~ed sequences indicate the ~-1.3-glucanase cDNA. .he enhanced 3~S promoter and the 355 terminator. pGluc 1 is pBluescript carrying the 1249 bp EcoP~I
fragment encoding the ~-1,3-glucanase. The hatched box indicates the coding region. Plasmid pPS48M is the same as pPS48 described in connection with the conseruct shown in Fig. 17, except that the plasmid is supplemented with two additiona} restriction sites (EcoRI
and KpnI) at each site of the E35S-35St box. The construction of the plant transformation vector harboring the chitinase 4 and SE
sequences is described in Fig. 17 and Fig. 18. Fig. 22A and Fig. 22B
should be considered as one figure.

Fig. 23 describes the immuno-detection of sugar beet chitinase 4 and the acidic chitinase in protein e~tracts from transgenic N. ben-tnaminana using the antibody ~raised against sugar beet chitinase 4.
C = Control plants containing the GUS and NPT gene construct.
SE - The acidic chitinase.
K76 - The genomic chitinase (see Fig. 19).
K4 - Chitinase 4 (see Fig. 17).
K4+SE = Chitinase 4 and the acidic chitinase (SE) (see Fig. 18).
Std. = 10 pg of purified sugar beet chitinase 4.

Fig. 24. A comparison between the DNA sequence of the chitinase 4 cDN.~ sequence shown in SE0 ID N0.:1 and the genomic clone chitinase -6 sno~n in SEQ ID ?;0.:~. The position o~ the chitinase 76 in.ror. is W 0 92/17~91 2 ~iJ ~ 3.~ PCT/DK92/0010~

easily seen a~ pos.~lon 8,5 .o 126~. The nomoiogy of .he sequences is abou~ '3~. Ihe figures Fig. 2~ B. ~i_. 2'~C. Fig. ~'ID. Fi~.
anà Fi~ F shouid be considered as one îigure.

: indica~es iden,icai nucleo.ides.
.~
,:~ 5 Fig. 25. A comparison betwêen the amino acid sequence of the chitinase 4 cDNA sequence shown in SEQ ID NO.:2 and chi~inase 76 shown in SEQ ID NO.:6. A homology of about 80X is seen. The ex.ra 3 amino acids in chitinase /6 are the amino acids (Ser, Thr, Proj in position 62-64. Fig. 25A and Fig. 25B should be considered as one figure.
, ~ .
: indicates identical amino acids.

Fig. 26. A comparison between the non-coding 5' sequences of the chitinase 4 and chitinase 76 genomic sequences shown in SEQ ID NO.:3 and SEQ ID NO.:5, respectively. 8 boxes of strong homology is observed in the non-coding 5' sequence. It is contemplated that some of these boxes may be of regulatory importance. Fig. 26A and Fig. 26B
should be considered as one figure.

,:~

~ ~ .

, ; ` ~ ; . , W O 92/1~91 PCT/DK92/0010X
~ ~ l) 6 ~

SEQUENCE LISTING

SEQ ID `O ! .he chi.inase cD~;A sequence ~haroored i ~he cD`;i sugar bee~ chitinase 4 clone Bl~`

.
SEQ ID NO ' the chi.inase , amino acid sequence ~harDored ir, ~he cDNA sugar beet chitinase 4 clone 815) SEQ ID NO 3 the partial DNA sequence of the genomic chitinase 4 ; clone :' SEQ ID NO 4 the par~ial amino acid sequence oE the genomic chitinase 4 clone SEQ ID NO 5 the DNA sequence of the genomic clone chitinase 76 SEQ ID NO 6 the deduced amino acid sequence of the genomic clone chitinase 76 SEQ ID NO 7 the cDNA sequence of the acidic sugar beet chitinase SE

SEQ ID NO 8 the deduced amino acid sequence of the acidic sugar beet chitinase SE
' SEQ ID NO, 9 the cDNA sequence of the basic sugar beet ~-1,3-glucanase SEQ ID NO, lO the deduced amino acid sequence of the basic sugar beet ~-1,3-glucanase SEQ ID NO, ll The DNA sequence of the entire sugar beet chitinase l gene including introns, promoter and leader sequence, and the amino acid sequence deduced from the coding ; region of the chitinase 1 gene :;
;' 25 SEQ ID NO i~ The amino acid sequence deduced from the coding region of the chi~inase 1 gene ~ W O 92/17591 2 1 i3 ~ 3 13 3 PCT/DK92/0010~

, . .

SEQ ID N0 13 r ~erminal amino acid sequence o~ a bean chi~inase : P l l .~, .
.
SEQ I3 `Ø~ ,erminai amino ac~c sequence oî a basic ~ObâccO
chi~inase.

; 5 SEQ ID N0. :15: C-terminal amino acid sequence of an acidic tobacco chitinase.
' ' SEQ ID N0.:16: C-terminal amino acid sequence of ,he barle.
chitinase CH26.

SE0 ID N0.:17: C-terminal amino acid sequence of a basic a-1.3 glucanase from tobacco.

SEQ ID N0. :18: Amino acid sequence of a cryptic peptide of a chitinase 3 from sugar beet.

SEQ ID NO.:l9: Amino acid sequence of a tryptic peptide of a chitinase 3 from sugar beet.

: 15 SEQ ID NO.:l9: Amino acid sequence of a tryptic peptide of a chitinase 3 from sugar beet.

SEQ ID N0.:20: Amino acid sequence of a tryptic peptide of a chitinase 3 from sugar beet.

SEQ ID N0. :21: Amino acid sequence of a tryptic peptide of a chitinase 3 from sugar beet.

SEQ ID N0. :22: Amino acid sequence of a trvptic peptide of a chitinase 3 from sugar beet.

SEQ ID N0.:23: N-terminal amino acid sequence of an amino acid sequence of a chitin bindi'ng protein from ~GA-A
~Triricucl 2es~iu~).

:~

:' . , :, - ~, . . .
' ' :' ' . : ' .

W O 92/17~91 PCT/D~92/OOlOR
2~ ~3~
:
SEQ ID N0.:'4: N-~erminal amino acià sequence of an amino ~cid sequence o~ a chi.in Dinaing protein from hevein .le-~ea D -as__ ens s SEQ ID N0.~ ;-terminai amino acic sequence of Lhe amino aeid sequence of a chi~inase from bean (?aaseo~a vulgaris).

SEQ ID N0.:26: N-terminal amino acid sequence of the amino acid sequence of a chi~inase from tobacco (~'ico~lana tabac~m).

lQ SEQ ID N0.:~7: N-terminal amino acid sequence of the amino acid sequence from chitinase ' from sugar bee..

SEQ ID N0.:28: DNA primer named KB-7 constructed partly from the polypeptide sequence of the acidic chitinase from sugar beet (SEQ ID N0.:9).

SEQ ID N0.:29: Complementary DNA primer named KB-9 constructed partly from the polypeptide sequence of the acidic chitinase : from sugar beet (SEQ ID N0.:9).

SEQ ID N0.:30: Complementary DNA primer named Oligo-dT constructed from the general knowledge of polyA mRNA's SEQ ID N0.:31: Amino acid sequence of a lysozyme/chitinase from cucumber (Cucu~is sarivus).

SEQ ID N0.:32: Amino acid sequence of a lysozyme/chitinase from Arabidopsis thaliana.
, ::
` SEQ ID N0.:33: Amino acid subsequence 3-lS of the amino acid sequence of a B-1,3-glucanase from sugar beet.

SEQ ID N0.:34: The amino acid subsequence 3-17 of the amino acid sequence of a ~-l.3-glucanase from sugar bee~.

~ .

' W O 92/17~91 21 ~ i~ 3 ~ ~ PCT/DK92/OOlOX
, _ :
SEQ ID N0.~ he amino acid subsequence 3-1~ or ~he amino acia sequence of a G-1.3-~lucanase from sugar bee~

SEa ID ~G.:3~: 3~A ~'primer named OliPio TG-l c~r.s~ructed from .hc-amino acid sequence or a ~-1.3-_iucanase Irom su~ar , bee SEQ ID N0.:37: DNA ~'primer named Oligo TG-2 constructed from the amino acid sequence of a ~-1,3-glucanase from sugar beet.

SEQ ID N0.:38: DNA 3'primer named Oligo TG-3 constructed from the amino acid sequences of a glucanase from tobacco and barle~.

SEQ ID N0.:39: Amino acid subsequence from the amino acid sequence or a glucanase from barley used to construct the primer Oligo TG-3.

SEQ ID N0.:40: Amino acid subsequence from the amino acid sequence of a glucanase from tobacco used to construct the primer Oligo TG-3.

SEQ ID N0.:41: N-terminal amino acid sequence of the amino acid sequence from Pea chitinase B.

SEQ ID N0.:42: N-terminal amino acid sequence of the amino acid sequence from pea chitinase Al.

SEQ ID N0.:43: N-terminal amino acid sequence of the amino acid sequence from pea chitinase A2.

SEQ ID N0.:44: N-terminal amino acid sequence of the amino acid 2i sequence from barley chitinase ~.
:
SE0 ID NO.:4~: N-terminal amino acid sequence of the amino acid sequence rrom barley chitinase ~`.

W O 92/1759l ~ PCT/DK92/OOlO~
21~`3 3 ~ ~ 68 SEQ ID NO.:46: Amino acid subsequence of the active site of ~he amino - acid sequence from a chitinase from tobacco.

SEO ID NO.:47: Amino acid subsequence of the ac.ive si~e of .he polvpep.ide from a chi.inase from _obacco.

5 SEQ ID NO.:48: Amino acid sequence of the active site of the polypeptide from a chitinase from tobacco.

: SEQ ID NO.:49: DNA 5'primer named KB-3 constructed partly from nucleotides No's. 1-15 of SEQ ID NO.:1 and nucleocides No's. 471-485 from SEQ ID NO.:5.

SEQ ID NO.:50: Complementary DNA 3'primer named KB-4 constructed from nucleotides No's. 261-241 of SEQ ID NO.:1.

, SEQ ID NO.~ Complementary DNA primer named 340 constructed partly from the nucleotide nu~bers 341-323 of SEQ ID NO.:1.

W O 92/17~91 ~ 1 ~ S 3 ~ 9 PCT/DK92/0010~

A ~ .

DETAILED E~;PLi;iATIO`; 0~ T!lE SEQI~E~CES SEQ ID l`iO' S

SEO ID ~0. :1 and S~O '5 `;O.:

The D~A sequence (SE? I~ `;0:1) and àeduced amino acic sequence ~SE~
ID NO:2) of the B15 chi~inase 4 cD~A clone isola~ed from a sugar bee~
~ZAP cDNA librarv The sequence is 966 bp long and encodes a protein having 264 amino acid residues in the polypeptide chain. The leader sequence consis~s of 23 amino acid residues followed bv a hevein domain of 35 amino acid residues and a functional domain of 206 amino acid residues.
After the stop codon. the cDNA has a 158 bp 3' flanking region with a putative polyadenylation signal at position 847 and a poly A tail.

For comparison, the chitinase 4 gene, the partial nucleotide sequence of which is shown in SEQ ID NO:3, encodes a proCein having 265 amino acid residues shown in SEQ ID NO.:4. The leader sequence encoded by the gene consists of 24 amino acid residues. Thus, the SEQ ID NO:1 are missing the nucleotide A and T and the first amino acid Met is not present in the polypeptide sequence encoded by the chitinase 4 cDNA.

SEQ ID NO:3 and SEQ ID NO:4 The partial DNA sequence ~SEQ ID NO:3) and deduced amino acid sequence (SEQ TD NO:4) of a genomic clone encoding the chitinase 4 gene isolated from a sugar beet EMBL3 genomic library The sequence is 691 bp long and encodes the first 112 of the 265 amino acids of the chitinase 4 polypeptide chain. The leader sequence consists of 24 amino acid residues followed bv a hevein domain of 35 amino acids. The partially sequenced clone has a 5' non-coding region of 355 bp with a TATA-bo~ sequence (TATAAA) located at position 285.
which is 70 bp upstream of the ATG start codon.

.
'.: ' .

.

W O 92/17591 PC~IDK92/0010~
21~ C~3~3 `-SEQ ID ~0:~ and SE0 ID ~:0:6 The D~.`. sequenc- (SE? ID N0:,) and deduced a~.ino acid sequence ,S~0 ID NO:5J or a enomic clone encoding ~he chi.inase I6 gene isoiaeed fro~. a sugar bee E'~BL3 genomic librar.

The sequence is 1838 bp long and encodes a protein having 268 amino acid residues in the polvpeptide chain. The leader sequence consists of 24 amino acid residues followed by a hevein domain of 35 and a functional domain of 209 amino acid residues. The gene contains one intron which is loca;ed in position 875 to 1262. The e~act loca.ion of this ineron is based on an alignment wi~h the B15 chit 4 cDNA
(Eig. 24). The intron borders contain the consensus GT/AG sequences.
A TATA-box sequence (TATMA) is located at posieion 378. which is 90 bp upstream of the ATG star~ codon. A putative poly-A signal ( M TAAA) is locaeed at position 1725.

SEQ ID N0:7 and SEQ ID N0:8 The DNA sequence (SEQ ID N0:7) and deduced amino acid sequence (SEQ
ID N0:8) of the acidic chitinase SE cDNA clone isolated from a sugar beet ~ZAP cDNA library ;,'`, The sequence is 1106 bp long and encodes a protein having 293 amino acid residues in the polypeptide chain. The leader sequence consists of 25 amino acid residues and the functional domain of 268 amino acid residues. The cDNA clone has a 5' non-coding region of 17 bp and a 3' flanking region of 202 bp.

SEQ ID N0:9 and SEQ ID NO:lQ

The DNA sequence (SEQ ID N0.:9) and the deduced amino acid sequence (SEQ ID N0.:10) of a ~-1,3-glucanase 4 cDNA clone isolated from a sugar beet ~ZAP cDNA library The sequence is 1249 bp long and encodes a protein having 336 amino acid residues in the polvpep~ide chain. The cDNA clone has a ;' non-: 30 coding region of 33 bp and a 182 bp 3' flanking region containing a W 0 92/17~91 21 a ~ PCT/DK92/OOlOX

, .
pu~ative polvaden~lation signai a. position 115 and a poly A ~ail.

SEQ ID ~O:L1 and SEO ID ~0:1' The D~A sequence (SEQ ID ~0.:11) and deduced amino acid sequence (8EG
ID ~0.:12) of a genomic clone encoding the chi~inase l gene isoia.ed from a sugar beet EMBG 3 genomic librar~.

The sequence is about 6.3 ~b lang and encodes a protein having 439 amino acid residues in the polvpeptide chain. The leader sequence is deduced to consist of 26 amino acid residues followed bv a hevein domain of 20, a proline rich domain of 132 and a functional domain of 10 238 amino acid residues. The protein has a C-terminal e~tension of 23 amino acid residues which probabl~ direct the pro~ein to the vacuole.

The sequence contains two introns at position 2170-4618 and 4776-5406. The intron borders contain the consensus GT/AG sequences. A
TATA box sequence (TATAM ) is located at posieion 1355-1360 which is about 70 bp upstream of the ATG start codon. A putative poly A
signal (M TAAA) is located at position 6032.

W O 92/]7591 PCT/DK92/0010X
2~ ~63~

REFERENCES

An G. ee al.. 1986. Plant Phvsiol. '-ol. _1. ?P ~01-305 An G. et al. 1988~ Plan~ Molecular Biologv Manual .-~.3. '~ ;lu~er Academic Publishers, Dordrecht Barkardottir et al., 1987, Developmeneal Genet:ics, Vol. 8, pp. 495-Barkholt et al., 1989, Anal. Biochem.. Vol. 117 (2), pp. 318-322 Benton W. D.. 1977, Science, Vol 196, pp. 180-182 ~.
10 Be~an, 1984, Nuc. Acid. Res. 12, p. 8711 Bohlmann H. et al., Leaf specific thionins of barley - a novel class of cell wall proteins toxic to plant-pathogenic fungi and possibly i involved in ehe defence mechanism of plants, The EMBO Journal, Vol.
7, No. 6, pp. 1559-1565 `!
Bol J. F. et al., Plant pathogenesis-related proteins induced by virus infection, 1990, Annu. Rev. Phytopathol., Vol. 28, pp. 113-38 Bol~er T., Ethylene and the regulation of antifungal hydrolases in plants, 1988, Oxford Survey of Plant Molecular & Cell Biology, Vol.
: 5, pp. 145-174 Butcher D. N. et al., Tissue Culture Methods for Plant Pathologists, 1980, eds.; D. S. Ingrams and J. P. Helgeson, pp. 203-208 Chirgwin et al., 1978, Biochemistry, Vol. 18, pp. 5294-5299 - Feistner et al., Charting of rat pi~uitary peptides by plasma desorp-tion and elec~rospray mass spectrometry, Proceedings of the Nato Advanced Research workshop on Methods and Mechanisms for Producing Ions from Large Molecules, Minaki, June 1990 SUE~STlTlJTE SHET
ISA/EP

,, ..:

W O 9~/17591 PCT/DK92iO010X
73 210~9 Fincher G. B. et al.. Vrimar~: s.ruc~ure or .he ~-3.1-4l-s-D-Eiucan I-giucohvdrolase rrom barle~ aleurone. 1986. ?roc. ~atl. .~cad. Sci.
~SA ~'ol. 83. pp. 2081-2085 Fraley R. T. e~ al.. Expression of baccerial genes in plant ceils.
1983, Proc. ~atl. ~cad. Sci. ~SA. ~rol. 80. pp. ~803-~807 Fri~sch E. F., Molecular Cloning, ~ laboratory manual, 1989, 2nd edi;ion, Cold Spring.~arbor Labora~ory Press Herrera-Estrella L. et al., Expression of chimaeric genes ~ransferred into plant cells using a Ti-plasmid-dPrived vector~ 198~. Na~ure, 0 Vol. 303, pp. 209-213 Herrera-Estrella L. et al., Use of reporter genes to study ~ene expression in plant cells, 1988, Plant Molecular Biology Manual B1, 1-~2 Hoekema A. et al., 1983, Nature, Vol. 303, p. 179-180 Hooykaas P.J.J., Agrobacterium ~olecular genetics, 1988, Plant Molecular Biology Manual A4, 1-13 Horsch R. B et al., 1985, Science. Vol. 227, pp. 1229-1231 Horsch R. B. et al., 1988, Leaf disc transformation, Plant Molecular Biology Manual A9, 1-16 Jacobsen S. et al., 1990, Physiol. Plantarum, Vol. 79, p. 554 Janssen B.-J. et al., Localized transient expression of GUS in leaf ~: discs followin~ cocultivation with Agrobacteriu~, 1989, Plant Molecu-~- lar Biology, Vol. 14, pp. 61-72 ~ Javnes J., Peptides ~o the rescue. 16 December 1989. ~ew Scien~is~.
: 25 pp. 42-44 SUBSTITUTE SHEET
ISAJEP

, , .
. ~,~ , ~ , -, ..

W O 92/17~91 PCT/DK92/OOlOX

2~0~33~

Jefrerson ~.A., 1987. ?lane .~olecuiar ~ioiog; Reporeer '.~ol. . `;o.
4, pp. ~S/-~O~

Jefferson e. al.. 1987. EM~OJ.. ~.ioi. ~. ~o. ~. 3901-390/

Joersbo M. e~ al.~ Direct gene transrer ~o plant protoplasts bv electroporation by alternating, rectangular and exponentially decay-ing pulses, 1990, Plant Cell Reports. Vol. 8, pp. 701-705 Joersbo M. et al., Direct gene transrer to plan~ protoplasts by mild sonication, 1990, Plant Cell Reports. Vol. 9. pp. 207-210 Kay R. et al., Duplication of CaMV 35S Promoter Sequences Creates a 10 Strong Enhancer for Plant Genes, 1987, Science, Vol. 236, pp.

Klein T. M. et al., Advallces in Dire.t Gene Transfer into Cereals, 1989, Genetic Engineering Principles and Methods, Vol. ll, Plenum Press, New York, pp. 13-31 Koncz C. et al,, The promoter of TL-DNA gene 5 controls the tissue-speci.fic expression of chimaeric genes carried by a novel ~ype of Agrobacterium binary vector, 1986, Mol Gen Genet, Vol, 204, pp.

,~
Kragh K. M. et al., 1990, Plant Science, Vol. 71, p. 55 20 Kragh K. M., 1991, Chitinases and ~-1,3-glucanases in barley ~ordeum vulgar L.)I Plant Biology Section, Ris0 National Laboratory, Ros-kilde, Denmark Kyhse-Andersen J., 1984, J. ~iochem. Biophvs. Methods 10, pp. 203-209 Leah et al., 1987, Carlsberg Res. Commun. Vol. 52, pp. 31-37 SlJBSTITUTE SH EET
ISA~EP

VVO 92/17591 2 ~ 3 S 3 ~ 9 PCT/DK92/0010~
7;

Lindsey, K. and ,M, G. K. Jones. Selec~ion of transrormed cells, ~n Plan~ Cell Line Selec~ion, P~ocedures and Applica~ions~ edi~ed by ?hilip J. Di.~:, ','C'~. 1990 van Loon L. C. e~ al., Iden~ifica~ion. purifica~ion. and charac~e i_-S a~ion of pathogenesis-rela~ed proteins from virus-infec~ed Samsun NN
tobacco leaves, 1987, Plant Molecular Biology, Vol. 9, pp. 593~609 Marcussen J. e~ al., ~ Nondestructive Method for Peptide Bond Conjuga~ion of Antigenic Haptens to a Diphtheria Toxoid Carrier, Exe~plified by Two Antisera Specific to Acetolac~a~e Synth~se~ 1991, Anal.Biochem., Vol. 198, pp. 318-323 McNeil M. et al., Structure and function of the primary cell walls of plants, 1984, Ann. Rev. Biochem., Vol. 53, pp. 625-663 Meeraux J.-P. et al., 1989. Proc. Natl. Acad. Sci. USA, Vol. 86, pp.

Mornon J. P. ~t al., Hydrophobic cluseer analysis: an efficient new way to compare and analyze amino acid sequences, 1987, Elsevier Science Publishers B.V. (Biomedical Devision), Vol. 224, No. 1 ,:
Murashige T. e~ ai., A revised mediu~ ~or rapid grow~h and bioassay with tobacco cultures., 1962, Physiol Plant, Vol. 15, pp. 473-497 .
Myers ee al., 1988, CABIOS, Vol. 4, pp. 11-17 Neuhaus J. M. et al., 1990, 5th Int. Symp. of The Mol. Genetic of Plant-Microbe Interaction, Interlaken, Switzerland, p. 218 , Odell J. T. et al., Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter, 1985, Nature, 25 . VoI. 313 (5005), pp.810-812 Ooms G. et al., 1982, Plasmid no. 7, pp. 15-29 SUBSTITUTE SHEET
ISA/EP

. . ` :

., .
, ~1 Q 6 ~ ~ ~

Paszkows~i J. e~ ai.. Direc~ ~ene .ansler -o pian.s. '984. -he ~MB0 Journal. ~'ol ,. No. i'. ?P - ;~

Revnaerts A. ~t al.. '988. Seiec~aDle ana screenaoie ~.ar~ers. ?lan_ Molecular Biologi Manual A9, L - L6 Rogers S.G. e~ al., Use of cointegrating Ti plasmid vectors, 1988.
Plant Molecular Biology Manual A2, 1-12 Samac et al., 1990. Plant Physiol.. Vol. 93, pp. 907-914 Sambrook J. et al., Molecular Cloning, A laboratorv manual, 1989, 2nd edition. Cold Spring Harbor Laboratorv Press Saul M.W. et al., Direc~ DNA ~ransfer ~o protoplasts with and without electroporation, 1988, Plant Molecular ~iology Manual Al, 1-16 Schagger et al., Anal. Biochem., 1987, Vol. 166, pp. 368-379 Selstes M. E. et al., 1980, Anal. Biochem, Vol. 109, pp. 67-70 Shinshi H. et al., Agric. Biol. Chem. 47. 1455-1460, 1983 . 15 Shinshi H. et al., Evidence for N- and C-terminal processing of a plant defense-related enzyme: Primary structure of tobacco prepro-~-1,3-glucanase, 1988, Proc. Natl. Acad. Sci. USA, Vol. 85, pp.

Shinshi H. et al., Structure of a tobacco endochitinase gene:
evidence that different chitinase genes can arise bv transposition of sequences encoding a cysteine-rich domain, 1990, Plant Molecular Biology, Vol. 14, pp. 357-368 . . .
Sierks M. R. et al., Catalvtic mechanism of fungal glucoamvlase as defined by mutagenesis of Aspl76, Glu179 and Glu180 in the enzYme from Aspergillus awamo i, 1990, Pro~ein Engineering. ~'ol. 3. No. 3.
pp. 193-198 SUBSTITUT SHET
ISA/EP

W O 92/17591 ~ 1 Q 6 3 `~ ~ PCT/DK92/0010X

Stougaard J. e~ âl ., '' ?86. `;a~ure, VO;. '2'. ?? 6o~-o7' Tomes D.T. e~ al., Direc~ DN.~ cransfer into intac~ plan~ cells anc recove~y of transgenic plan~s via mic~oDrojecc le Dombardmen. !90.
Plan~ Molecular 3iology P'anuai A13, 1-22 vad K. e~ al., 1991, Planta, 184, In Press Velten J. et al., Isolation of a dual plant promoter fragment from the Ti plasmid of Agrobacterium cumefaciens, 1984, The EMBO Journal, Vol. 3, No. 12, pp. 2723-2730 Viegers, A. J. et al., 1991, Mol. Plan~. Microbe In~erac~ion. vol , pp. 315-323, Waldron C. et al., Resistance to hygromycin B - A new marker for plant eransfor~ation scudies, 1985, Plan~ Molecular Biology. Vol, 5, pp, 103-108 Wing D. et. al., Conserved funceion in Nicociana cabr~cum of a single Drosophila hsp 70 pro~oter heat shock element when fused to a minimal T-DNA promoter, 1989, Mol Gen Gene~, Vol. 219, pp. 9-16 Wood W. I. et al., 1985, PNAS, Vol. 82, p. 1585 , SlJBSTlTUTE SHEET
IS.~'EP

W O 92/17591 PCT/DK92/OOlOX
2~063~ -s MATERIALS AND METHODS

Biological material - Plarcs Seeds of Beta vulgaris, cv. "Monova", were sown in clav mixed peat ("Cycas~) and placed in growth chamber with 11/13 hours day~night cycles, 25/18C (day/night) and 70% rh.-Light intensitv was approxi-mately 25000 lu~ ("Osram HQI-T", 40~ W/DH). Three weeks after sowing the seedlings were replanted singly in 12 cm plas~ic pors containing the same growth medium. Twice a dav che plants were supplied with water containing 0.1% fertilizer: "Stjerne" universal fertilizer, '1:1:4 (N:P:K). Si~ weeks after sowing the plants were ready for infection experiments with Cercospora beticola.

Nicociana cabacum and N. benthamiana plants were obtained as describ-ed above.

Fungi An isolate of the fungus Cercospora beticola was used for infection experiments. The isolate, "F573", was obtained from United States Department of Agriculture. Agricultural Research Division, Fort Collins, Colorado, USA.

20 An isolate of the fungus C. nicocianae (ATCC 18366) was obtained from the American Type Culture Collection.

. . . .
Grow~h of Cercospora specl es The fungus was grown on solid growth medium in Petri dishes. Sterile "Potato Dextrose Agar" ("Difco", 39 g/l) was used as growth medium.
2; A plug of mycelia was placed in the center of the Petri dish and the culture was incubated at room temperature for ~ weeks. Mycelia for spore induction was "harvested" by cutting off the whole mvcelia "mat" including some agar.

W O ~2/17591 ~ 3 ~ 3 PCT/DK92/0~10X
-G
SDoruiacion o~ Ce~cosDora s?ecies celia ~as ~.ixed wi.h dis illed ~ater (1:~) in a S0 ml s,erile _iâSS
tuoe and homogenized usin- a "~l.ra Turra:; T25" ~i~er opera.ed a 8000 rpm ~or 2 minuees.

1 ml of the homogenate was transferred to a Petri dish containing solid sporulation medium. "~-8" was used as medium. It contained 200 : ml ~V-8~ juice tCambells, Italy), 800 ml water, 3 g CaC03 and 20 g agar.

The suspension was allowed to settle for 1 hour. After airdrying the culture (approximatelv 1 hour) the Petri dish was closed~ sealed and placed in an incubation cnamber ae 13C and 24 hours li~ht (cool white).

After 7 days of incubation the spores were harvested by pouring lO ml distilled water onto the Petri dish and firmly brushing the surface of the culture with a sterile brush.

The resulting spore suspension contained approximately lO0,000 spores/ml.

Infection with Cercospora species For inoculation, 12.500 spores were suspended in l ml of water con-taining 20 ~g of Tween-20. ~sing a chromatographic atomizer the suspension was applied to the upper leaf surface of six-week old sugar beet or Nicotiana plants until "run off". Immediately after inoculation the plants were placed in a "mist chamber" kept at 30C, 100% rh and 24 hours light (cool white). After S days of incubation the plants were moved to a growth chamber kept at 30C. 80% rh and 24 hours light. ApproximatelY lO davs after inoculation necrotic spots developed on mature leaves showing that an infection with Cercospora had been established. After inoculation~ the sugar bee~ plants were harvested at specific time intervals for W O 92/17~91 ~ PCT/DK92/OOlOX

i) small scale purification ol chitinase 4. .he acidic chi.inase SE and B-1.3-glucanase~ and ii) a time course study to determine .he e~:pression level of ~o.al enzvme activity using radiochemical assavs and immunoblot-in_.
iii) de~ermination of the expression le~ei of eacn of the enz~mes ir.
transgenic plants using the above (~ij .echni.ques.
vi) isolation of mRNA for use in che construction of a cDNA librarv.
:
Infection of Nicotiana plancs wi~h the root pathogen Rhizoctonia solani An isolate of R. solani was obtained from Dr. K. T7avella-Klonavi (Saloniki, Greece).

An inoculum of R. solani was prepared on barley grains soaked twice in 1% of potato de~trose broth and autoclaved. The grains were inocu-lated with agar disks of a growing culture of the fungus and incubat-ed for two weeks, after which they were airdried.

Alternatively, disks of R. solani growing on potato dextrose agar can ` be used directly as inoculum.

The inoculum was mixed into potting soil in different concentrations, and the transgenic plantlets which had been rooted for 14 days, were ; 20 transplanted into the infected soil. The percentage of surviving plants may be recorded after 1, 2 and 3 weeks, respectively, and after 3 weeks the surviving`plants are assessed for root damage~
Alternatively, seeds from transgenic plants were sown directly in the infected soil.

Extraction of protei~ from 1 g of sugar beet leaf material More specifically, the small scale purification was carried out as follows. 1 g of leaf material was homogenized by a Ultra-Turrax homo-genizer in citrate buffer (0.1 M, pH 5. 2 ml/g tissue), containing 1 mM of both benzamidine. dithiothreitol and phenylmethYlsuphonyl fluo-ride. Particulate matters were removed bv centrifugation at 15.000 .;

WO 9~/17~91 ~ r~ 9 PCT/DK92/0010X
~1 g for 15 minutes. The superna~ane comprising the en vmes was trans-ferred to another Lest tube before the cen~rifugation was repeaced.

Large scaie e.~ ac.lol1 ol proceins .~om sugar beec ieaf macerial To determine ehe antifungai po~ential and ,he amino acid sequence OL
the enzymes, large quantities of pure enzymes are required. To obtain sufficient quantities, i.e. mg quantities, a large scale purification of chitinase ~, the acidic chitinase SE and ~-1,3-glucanase was carried out from 2 ~g of leaf material from naturally infected sugar beet plan~s, cv. "Monova". Naturally infected leaves carrying ;O or more necrotic lesions were picked in the field at a breeding station in Italy (Maribo-Italy, Bologna) and stored at 4C until the e~:trac-tion of chitinase 4 was carried out.

Preparation of a chitin column 30 g of chitosan (from Protan; Sea Cure P, No. 709, Norway) was dis-solved in 600 ml of 10% acetic acid. After 30 minutes, 600 ml of methanol was slowly added while mixing. The cloudy viscous solution was filtered twice to remove particulate materials; first with glass wool and then with a sintered glass funnel. The filtrate was trans-ferred to a beaker on a magnetic stirrer, and 40 ml of acetic anhy-dride was slowly added with extensive stirring. After approximatelv 2 minutes, the solution turned into a gel. The reaction was allowed to proceed for 10 minutes before the gel was cut into pieces with a spatula. The gel pieces w~re` transferred to a Warring blender, co-vered with methanol, and homogenized for 2 minutes at full power.
2S Methanol, acetic acid and unreacted acetic anhydride were removed by filtration in a Buchner funnel using Whatman No. 1 filter paper. The filtrate was transferred to a beaker, 1 l of 1 M Na2C03 was added and the p~ was adjusted to 9 with 6 N NaOH. 50 ~l of acetic anhydride was slowly added and the pH adjusted to 9. The reaction was allowed to take place for 1 hour before the final product was collec~ed by fil-tering on a Buchner funnel. After e~tensive washing with water, the product was equilibrated in a 10 mM Tris buffer at pH 8.0 before storing at 4C. The Yield was 700 ~l of regenerated chitin. A chitin :: .

`

~'0 92/17591 PCT/D~92/0010~
21~6309 &~ .
column was prepared from ~he regenerated chitin bv ~se of the conven-tional procedure according ec Pharmacia.

?reDaracion o~ radioacci~-e colloidal c.~i~ n 2 g of chitosan was ace~vlated with 3~-labelled acecic anh~dride as ; described for the synthesis of unlabelled chitin (see above). After extensive washing of the 3H-labelled chitin on a Buchner funnel, it was transferred to a beaker. 50 ml of concentrated ice-cold HCl was added, and the chitin was dissolved by stirring for 5 minutes at 0C.
: The syrupy liquid was filtered through a sintered glass funnel and slowly poured into vigorously stirred 50% aqueous ethanol to precipi-tate the chitin in a highlv dispersed state. The residue was sedi-mented by centrifugation and resuspended in water several times to remove excess acid and ethanol. Finally the colloidal chitin was suspended in 200 ml of water and sonicated for 5 x 1 minute at full power. The 3H-labelled chitin was stored at 4C before use.
.

: Preparation of a Laminarin col~nn Divinylsulfone activated agarose (Mini-leak high, K~-EN-TEC, Den-mark) was employed to immobilize laminarin (~-1,3-glucan) (from Laminaria digitata, Sigma). 50 g Mini-leak High was dispensed in 200 20 ml 1 M potassium phosphate (K-P) at pH 11, and 750 mg laminarin dissolved in 5 ml H20 was added. The reaction was allowed to proceed for 16 hours at 25C on a shaking table. Unreacted divinylsulfone groups were blocked by incubàtion with a solution of 5% mercapto-ethanol in 1 M K-P-buffer at pH 9.5. The reaction time was 16 hours at 25C. Residual rnercaptoethanol was removed by excessive washing of the gel on a Buchner funnel. The Laminarin-Agarose was suspended in 20 mM Tris-buffer at pH 8.0, and stored a~ 4C. A laminarin column was prepared from the Laminarin-Agarose using the conventional proce-dure according tO Pharmacia.

; 30 Svnthesis or 3~-labelled laminarin Laminarin was labelled with radioac~ivity by reduction with 3H-label-ied ~aB3H~. ;00 mg laminarin (from L2minaria di~ic2ca Sigma~ was ,~ .

W ~ 92/17591 2 ~ J ~ 3 -~ ~ PcT/DKg2/o~lnx S' dissolved in 2 ml H~O. and purified bv precipita~iorl by addition or 800 ~1 ~aC1 (0.2 g/ml) followed b~ 8 ml absolu~e e~hanol. The preci-pitate was collected b. cen.rifugation for ~ min. at 15.000 ~. The supernatan- was discarded and ,he pelle, containing the laminarin ~as dissolved in 4 ml of 0.1 `~ ~aOH. This solution was transferred ~o a reac-ion wessel containing ~ mCi of NaB3H~ fter stirring for 90 min. at 25C, 600 ~1 of 1 M HCl was added to destroy unreacted NaB3H4. The reaction mixture was divided into 500 ~1 aliquots and 200 ~1 of NaCl and 2 ml of absolute ethanol was added to each test tube After storage for 10 min. a~ 0C, the precipitate was collected bv centrifugation for 5 min. at 15.000 x g. The 3H-labelled laminarin was dissolved in 500 ~1 of H2O and the precipitation was repeated until the background level in the supernatant was less than 100 cpm ; per 20 ~1. The labelled solution of laminarin was stored at -20~C.
Before use in the ~-1,3-glucanase-assay, the solution was diluted 20-fold wi~.h water, Reverse Phaso-UPLC

A Kontron AG (Z~rich, Switzerland) instrument consisting of 2 model 420 pumps and a solvent mixer was used. Gradient control and data acquisition was performed by a Kontron model 450-MT Data system according to the manufacturers instructions. Proteins eluted from the Mono S column (see below) were subjected to RP-HPLC on either V~DAC
RP4 (0.46 x 15 cm; 10 ~m particle size; The Separations Group, He-speria, California) column or a Poly F (Du Pont de Nemours) column.
The mobile system used for RP-HPLC was buffer A: 0.1% TFA in water and buffer B: 0.1% TFA in acetonitrile.

SDS-PAGE

SDS-PAGE of crude plants extracts or partly purified chitinases were performed on an Easy-4 apparatus (Kem-En-Tec, Denmark) using the Tricine SDS-PAGE system described by Schagger and von Jagow (1987). .
total of 25 ~g of protein was applied to each lane. Pure chitinase isoenzymes were analyzed on the Phast-System (Pharmacia) in accor-dance with the manufacturers instructions.

, .
'; ' ~

' W O 92/17591 P~T/DK92/OOlOX
21~3~9 ~1 Enzyme assays ~he -aaiocne~ica~ chLclnase assa-Chitinase ac.l~i.; was de~ermined radiochemicall~ with 3H-chitin as a substrace.

S The specific activitv of the 3H-chitin was 460 cpm/nmol N-acetvl-glucosamine (GlcNAc) equivalent (or 2,3 x 106 cpm/mg 3H-chitin). It was determined bY scintillation counting and colorimetric determina-tion of GlcNAc after total hydrolysis of 3H-chitin by crude chitinase preparations from sugar beet leaves and exochitinase from serratia marcescens or S~reDcomvces griseus.

The assay mixture contained in a total volume of 200 ~1 of enzyme solution, 50 ~1 of 3H-chitin suspension (containing 100.000 cpm) and 10 ~mol of sodium citrate (pH 5,0). After mixing, the enzymatic hydrolysis of 3H-chitin was allowed to take place at 40C for 15 min.
before addition of 300 ~1 of 10 % (w/v) TCA. In order to decrease the background reading, 100 ~l of bovine serum albumin (10 mg/ml~ were added before the insoluble 3H-chitin was removed by centrifugation at 15.000 x g for 5 min. The radioactivity in 300 ~1 supernatant was determined by scintillation counting.

The radioche~ical ~-1,3-glucanase assay ~-1,3-glucanase activity was` determined radiochemically with 3H-labelled laminarin as substrate.

The assay mixture consisted of 50 ~l of enzyme extract, 50 ~l of 0,1 ~ Na-citrate pH 5,0 and 10 ~l of 3H-labelled laminarin (192.000 cpm).
Incubation was carried out for 15 min. at 40C. To terminate the reaction, 1000 ~l of abs. Ethanol and 50 /~1 of a saturated NaCl-solution was added. After 10 min. at 0C, unreacted laminarin was removed bv centrifugation at 10.000 x g for 5 min. An aliquo~ of 400 : ~1 of supernatant was transferred to a scintillation vial. 5 ml of PICO-FLUOR-40 were added and the amount of radioactivity was deter-mined by â liquid scin,illation counting.
, W O 92/17~91 21~ 3 ~ PCT/DK92/0010~

LYSOZYme assay The lvso7yme ac~i~.is: of chl inase _ ~as desermined b~ the me~nod described b~ Selsces et ai. (1980). '~ore specificall~ l~soz~me ac~i~it~ was measured in microciter pla.es. Eacn well con.ains ceil ; walls from Micrococcus lvsodeik~icus suspended in a 20 ~ sodi~m phosphate buffer, pH 7.4, containing 1 mg/ml of BSA. The initial absorbency at 450 nm was adjusted to 0.6 before addition of egg-white lvsozyme or plant chitinase 4. The reaction was followed bv measuring the decrease in absorbance a~ 5 min. intervals for 50 min.

10 ~-glucu~onidase (GUS)-ASSaY

When GUS is employed as a reporter gene in connection with the con-struction of the genetically transformed plants according to the present invention, ehe success of the transformation may be deter-mined by use of the following GUS-assay described by Jefferson, 1987.
Leaf tips were sliced into thin sections (<0.5 ~m) and incubated in a 2 mM solution of x-gluc. (5-bromo-4-chloro-3-indolyl-~-glucuronide) dissolved in 0.1 M sodium phosphate buffer pH 7.0 cont~ining 0.5 mM
potassium ferri cyanide and 10 mM EDTA. The leaf sections were trea-ted for 2-4 hours at 37C, rinsed with water and the staining inten-sitY recorded by visual inspection by microscopy.

:

' W O 9~/17591 PCT/D~92/0010~
2 ~
Purification or chitinase 2 3 and 4. acidie chitinase SE and ~-l,3-glucanase isoenz~mes Acidic anà basic cni.inase isoenz~mes were puri- ec ~o~e~:ner wi~h J-!.3-giucanases fro~ su~ar Dee~ leaves aa snown .. ~he -oliowin_ -low - diagram.

2 kg of sugar bee~ leaves O.l M Na-citrate ' ~ DTT ~omogeniza~ion 1 mM B~'~. pH 5.0 Centrifuga~ion : lO Heat treatment, 50C, 20 min.
90% (;~H/I ) 2SO~
DialYsis 10 ~ Tris.
~ pH 8.0 FF-Sepharose Q
Chit n column Roff FPLC, Mono-S FF Sepharose Q
FF-Sepharose S RP-HPLC Chromato-focusing Laminarin-Agarose chitinase 2,3, and 4 FPLC, Mono P
acidic chitinase SE
FPLC, Mono-S
: RP-HPLC
~ B-1,3- glucanase 3 and 4 : The sugar beet leaves were obtained in Italv (large scale. see "Bio-~` logical ~aterial"). In the following each of the purification steps outlined below will be explained. The equipment and procedure used for each step are carried out as described below.

W 0 92/17591 2 ~ PCT/DK92/OOlOX

Ex~raction of protein from CerCOSDOra becicoia infected sugar beet leaves .~11 s.eps were perrormed â~ -~C. Cenerifu~a.ion WdS carried o-l~ a, 20000 x ~ for 20 minutes in a Cenerikon model H-401B centrifuge.
throughoue the purification procedure.

Preparation of cellfree-extraccs 2 kg of Cercorspora infected leaves were homogenized in 4 1 ~a-ci-trace buffer pH ~.0 concaining 1 mM DTT (Dithiothreitol), 1 mM B.~l (Benzamidine) (starting buffer) and 200 g Dowex lx2 (100 ~m~mesh size. The homogenate was squeezed through a double laver of 31 ~m mesh nylon gauze, before centrifugation.

Precipitacion wich heat and Ammoniumsulface The supernatant fraction obtained after the centrifuga~ion was heated at 50C for 20 minutes and after cooling to 4C, the precipitate was collected by centrifugation. Solid ammoniumsulfate was added to the supernatant until a 90% saturation was achieved. After centrifuga-~; tion, the precipitated proteins were dissolved in starting buffer; 1ml of buffer/10 g of starting material.Purification of chitinase 2, 3 and 4, acidic chitinase SE and ~-1,3-glucanase by column chromatography Chitinase and ~-1,3-glucanase isoenzymes were purified from the am-monium sulfate precipitated protein fraction. After solubilization, the protein solution was dialyzed against 10 mM Tris pH 8.0 contain-~- ing 1 mM DTT and 1 mM BAM. Denatured proteins were removed bv centri-fugation and the supernatant was loaded on the above outlined two columns e.g. i) a 50 ml Fast Flow Sepharose Q (Pharmacia) and ii) a 100 ml Chitin column (prepared as described above), the columns being connected in series. The columns were equilibrated with the Tris buffer, before 281 ml of the sample were loaded. ~nbound proteins in-cluding ~-1.3-glucanase were removed bv extensive washing with the starting buffer. After disconnec~in~ ;he Fast Flow Sepharose O co-wo 92"7591 2 ~ & ~ 3 ~ ~ PCT/DK92/OOlOX
8&
lumn. the chitinase was eluted from tne chitin column with ~0 ~acetic acid. pH ~.~ containing 1 ~M DTT. Thê acidic chitinase SE was eluted from .he Fas Flow Sepharose Q column with the Tris-ourrer con~aining G~ M haCi.

Purification of G-1.3-glucanase Separation of B-1.3-glucanase on Cacion Exchange Ch~007atograrJh-Proteins which were not adsorbed on either the Fast Flow Sepharose Q
nor the chitin column were collected, and concentrated co 60 ml bv pressure dialysis with an Amicon PM-10 filter (Danver, MA, U.S.A.).
After dialvsis overnight against 20 mM Na-acetate buffer at pH 4.2 containing l mM DTT and 1 mM BAM, the protein solution was loaded on to a 50 ml Fast Flow Sepharose S column (Pharmacia) equilibrated in the dialysis buffer. Unadsorbed proteins were removed by washing with the equilibration buffer. Bound proteins were eluted with a 600 ml linear gradient from 0 to 0.5 M NaCl in the starting buffer.

Three major peaks A, B and C of a-1,3-glucanase activity were ob-served. Peak B was further fractionated by affinity column chromatog-raphy on Laminarin-Agarose. Peaks A and C were not further purified.
,, - Purification of ~-1,3-glucanase on Laminarin-Agarose ~' , .
~ 20 A 28 ml column of Laminarin-Agarose was equilibrated with a 10 mM
; Tris buffer pH 8.0 containing l mM of both DTT and BAM. The protein fractions from peak B was combined, concentrated by pressure dialysis to 15 ml and dialyzed against the Tris buffer. After loading of the sample on the Laminarin-Agarose column. the flow through the column was stopped for 20 minutes to allow the ,B-1,3-glucanase to bind to the affinity ligand. Vnabsorbed protein was removed by washing with Tris buffer. ~-1.3-glucanase was eluted with 1 M NaCl in Tris buffer.

: Pu~ification or 4 B-1.3-glucanase isoenzv~es br FPLC

, Fractions from the Laminarin-A~arose column with B-1.3-glucanase -~ '0 activit. were combineci. concentrated and dialyzêcl overnigh. agains. a W O 9~/17~91 ~ ~ ~ 6 ~ 3 ~ PCT/DK92/OOlOX

20 mM aceta,e bur.er pH ~.;. The proeeins were separa,ed on a ca~ion e~change column (Mono S) (Pharmacia) on the FPLC svstem usin~ a linear ~aC' gradier.,. rour major protein pea~s were observed Isee Fi~. 21). They al: four h~drolv~ed ,he 3H-laDelied laminarin suDs ra-5 ,e in ,he radiochemical assa~ for ~-1.3-glucanase (see abov Puririca~Lon of ~ne ~-1.3-glucanase o~ Reverse Phase ~PIC

Thê purification was achieved by injeccing the FPLC-purified B-1.3-glucanase into the above described Poly F reverse phase HPLC column.
Non-adsorbed materials (buffers, salt e~c.~ were removed by washing with 10% acetonitrile in O.lX TFA (trifluoro acetic acid). Proteins were eluted by emploving a linear gradient of acetonitrile from 10 to 70%.

After this desalting/purification step, pea~ 3 and 4 were ready for i) N-terminal am.ino acid sequencing, ii) amino acid composition analysis (see Example 8), iii) tryptic digestion to achieve peptides and iv) injecting into rabbits to produce polyclonal antibodies.

Purification of chitinase 2, 3 and 4 Elution of the chitin column with 20 mM acetic acid, pH 3.2, yielded 40 fractions (10 ml/fraction) with chitinase activity. The fractions were combined, adjusted to pH 4.5, concentrated to 15 ml and dialyzed against a 20 mM Na-acetate buffer at pH 4.5.
.
2 ml aliquots were loaded onto the above mentioned cation exchange column (Mono-S) by the FPLC system (Pharmacia). Non-adsorbed mate-rials were removed by washing with the acetate buffer. Elution of the chitinase isoenzymes was achieved with a linear gradient from O to 1 M NaCl in the acetate buffer. The elution profile is shown in Fig.
1. For further purifiration, the reverse phase VYDAC RP4 HPLC column was employed. The conditions were similar tO those described above in connec,ion with the purification of ~-1.3-glucanase.

. .

W O ~2/17591 PCT/~K92/OOlOX
3 ~ o Purification of acidic chitinase SE

PUritiCa~iol? of .he acidic cr2icinase 5~ on ar~ion-eh-chan~e c,~?~oma~o~,-ra ?h ~

The acidic chi~inase SE was eluted rrom the abo~e described Fas;
Flow Sepharose Q column with the Tris buffer containing 0.5 M NaC1 as shown in the purification scheme. The proteins were dialyzed against 10 mM Tris-HCl, pH 8.0, and loaded onto a 40 ml "Fast Flow Sepharose Q" column equilibrated with the same buffer. The proteins were elu~ed with a 800 ml linear sodium chloride gradient from 0 to 0,~ ~M NaCl.
Fractions containing chitinase activity as determined by the radio-chemical chitinase assay descrlbed above were pooled.

Purification of acidic chitinase SE on Chromatorocusing The protein fractions were dialyzed against 25 mM Bis-Tris, adjusted to pH 7.0 with iminodiacetic acid. A 15 ml "polybuffer Exchanger"
column (Pharmacia; PBE 74) was equilibrated with the same buffer and 50 ml of the sample was loaded. Unabsorbed proteins were removed by washing with the Bis-Tris buffer.

Application of "Polybuffer 74" adjusted to pH 3.6, created a linear . ~ pH gradient from 7 to 3.6 and gave desorption of several proteins.The acidic chitinase SE was still retained on the column at this pH, but it was desorbed by addition of 0.3 M NaC1 to the "Polybuffer 74"

Purification of acidic chitinase SE by FPLC
' : Protein fraction with high chitinase activitv as determined bv the ~ . 25 radiochemical chitinase assay described above were pooled and dialy-.. zed against 25 mM Bis-Tris at pH 7Ø The proteins were resolved on ~: a Mono-P FPLC column tPharmacia) equilibrated with the Bis-Tris buffer. After an initial wash with the starti~g buffer, three isoen-zvmes of acidic chitinase SE was separated using a linear sal~
gradient from 0 to 0.3 M NaCl (Fig. 3).

W O 92/17~91 2 ~ 9 P~TlDK92/OOlOX
G, Analysis of the enzymatic cleavage pattern of sugar beet chitinase 4 40 ~1 or 3Y.-labelled cr,i-ir. (~o~ooo cpm) ~as incu~ated ~i,h ~ ~g o-^
cni,inase 4 ~purified as described a~ot~e~ ir. a O . 1 ~ ci,rate bufr-~-a~ pH ~.;. The ~o~al ~olume ~as 300 ~ .fcer a speci~ied ,ime (', min.. 30 min.. 1 hour and 2~ ho~rs~ ~he reaction was stopped by .he addition of 300 ~l of 10% (w/v) TCA. The unreacted polymer of 3H-labelled chitin was removed, and an aliquot (300 ~l) of the super-natant was applied tO a thin layer chromatographv (TLC) plate tSilica gel 60 H. Merck). The mobile phase was n-propanol/H20/NH3 (70/30/1:
v/v/v).

A standard of N-acetylglucosamine-derived oligosaccharides was pro-duced by acid hydrolYsis of chitin (Ruplev, 1964). This standard was used to localize the products from the enzymatic cleavage on the TLC
plate. Zones of interest on the TLC place were removed by scraping with a razor blade, and the silica gel containing the 3H-labelled oligosaccharides was transferred to a scintillation vial. 10 ml of scintillation liquid Dimilume (Packard Instruments) were added and the radioactivity was determined by a liquid scintillation spectro-photometer.

~;~ Antifungal acti~ity An inhibitory effect of sugar beet chitinase 4 has been observed onthe growth of both Cercospora beticola and Trichoderma reesei either alone or in combination with'the acidic chitinase SE and the basic ~-1,3~glucanase 3. Germination of spores and/or growth of hyphae from phytopathogenic fungi, e.g. Cercospora, in the presence of antifungal proteins may be analyzed with three different methods.

Method I is carried out on microscope slides covered with a thin film of medium and incubated with either buffer (control) or ~g quantities of the antifungal proteins. Germina~ion of spores or growth of the mycelium is followed by staining with Calcofluor W~ite before analy-sis by a fluorescent microscope.

W O 92/17591 PCT/DK92/OOlOX
3 ~3 ~ ~
.~lechod I T is carried ou, in microti~er plates containing growth media. 10 or 100 spores from Ce~cospora, buffer ~control) or ~he an.ifungal proteins. The pla~es are incubated a, 2jC before Lhe opticai densit~ (a, 620 n~.) is determined a- specified time in,er-mals.

In mechod III, radiotracer techniques in combination with autora-diographv are used to demonstrate that chitin and ~-1,3-glucan are important cell wall components in Cercospora and that chitinase 4 can remove radioactivity deposited in the hyphae tip of cercosDora~

.lO .~echod I: MicroscopY Slide Bioassa~

The microscopy slides wsre covered with a thin laver of potato de~:-trose agar (PDA) and stored for 6 hours on moistened filter paper in petri dishes. 10 ~l of a spore suspension (10.000 spores/ml) was placed in the center of the slide. 10 ~l of a lO mM Tris-buffer, pH
8.0 or 10 ~l of a preparation containing 20 ~8 of the antifungal protein to be tested was applied to the spore suspension. The an-tifungal protein was dissolved in the Tris-buffer and filtered through a 0,22 ~m filter before mixing with the spore suspension. The petridish was sealed with taps and incubated for 24-48 hours at 30C
and full light. At the time for evaluation, the culture was stained with the fluorescent dye Calcofluor White (0.05% (w/v) in water) for lO min. Calcofluor White binds primarily to cell walls containing nascent structures of chitin, and the fluorescent dye may therefore serve as a marker for differèntiation and growth of the hyphae cell wall.

Method II: Microcicer Place BioassaY

100 ~l of potato dextrose broth (PDB) liquid growth medium was placed in each well of a microtiter plate. A spore suspension of Cercospora (100,000/ml) was filtered twice through 4 layers of sterile gaze to remove small amounts of mvcelia fragments. The spore suspension was diluted l:lO0 and l:lO00 with sterile water, before aliquots of lO0 ~l was transferred to the microtiter wells. The antifungal proteins were dissolved in the same buffeT and treated as described abo~e ior W O 92/17591 ~ P~TtDK92/001 q3 mechod I. The bioassa~s were carried ou~ with ~ repea~s ~or each dilution of ~he fungal spores. The microtiter pla~e was sealed wi,h tape to avoid evapora~ion and con~a~.ina~ion. Afte~; incuba, on a, roo~.
~emperature on an agitator operated ~i,h ~0 rpm. .he ;ape ~as removea and rwice a da~. the absorbance ~as measured a- 520 nm. The germina-_ion and growth of the fungus ~as followed for _ davs b~ measuring the absorbance. For each combination of antifungal protein and spore dilution the absorbance vs. time was plotted.

Me ~h od I I I - Au c ora d i ogra Dh --Cercospora cultures were grown on a microscope slide as described in method I. Liquid grow~h medium (PDB) containing 3H-labelled ~-ace-tylglucosamine was distributed uniformly over a one daY old culture.
After incubation for 20 min. (pulse labelling), the reaction ~growth-/incorporation) was stopped by dipping the microscope slide in 6%
(w/v) of TCA. The preparation was dehydrated in an ethanol gradient (70-100%) and dried.

After the pulse labelling, 50-lO0 ~l of a fraction containing chiti-nase 4 in lO mM Tris-buffer at pH 8.0 was distributed over one half of the fixed and dehydrated culture. The microscope slide was placed on moistened filter paper in a petridish. After sealing the petri-~, dish, the preparation was incubated at 30C for 20 hours. The enzymetreatment was stopped by dipping the slide in 6% TCA and the prepara-tion was dehydrated in ethanol as described above.
' .

The microscope slide was coated with an autoradiographic emulsion (Ilford K 5). After drying the emulsion extensively with a "fan dryer" the slide was placed in the dark for 7 days at 7~C and low relative humidity for exposure. The emulsion was developed by placing the slide in Kodak D-19 developer for 10 minutes followed by fixation for 2 minutes and washed in running water for lO minutes. After drving the preparation was readv for a microscope analvsis of the hvphae of the fungus.
.

W O 92/17591 PCTiDK92/0010X
3 a ~ q '!
Production of antibodies for use in serological analysis P~oduc~ion or ?ol~clonal an,ibodies to c.~itinase 2. 3. and 4 Freezedried purified chi.inase 2, 3 and 4 (oo~ained as described above) were dissolved in Tris buffer (lO ~, pH 8,0) and dilu~ed 1:1 with Freunds incomplete adjuvant. Polyclonal antibodies were raised in rabbits according to conventional methods by Dakopatts (Denmark).

Proauction of monospecific polyclonal antibodies to chitinase 4 peptides The procedure was carried out as described in detail for the produc-tion of monospecific antibodies to AHAS peptides (~arcussen and Poulsen, l99l). Based on computer analysis of the amino acid sequence for chitinase 4, four peptides were selected on the criteria of hydrophilicity and variability between chitinase 4 and other basic ~chitinases. Peptides were custom synthesized by Cambridge Research ; 15 Biochemicals (UK). The struotures were verified by mass spectroscopy and amino acid analysis to estimate purity.

Before immunization the peptides were conjugated to diphtheria toxo-id. The carrier, diphtheria toxoid was converted to the toxoid-sul-:fosuccinyl-ester derivative by reaction with carbodiimide (EDC) followed by N-hydroxy sulfosuccinimide. After the coupling, the four different peptide-diphtheria toxoid conjugates were purified by gel filtration on a Sephacryl S-300 column. The high molecular weight fractions were collected, freeze-dried and dissolved in water. Im-munization in rabbits were performed as described above for the production of polyclonal antibodies to chitinase 2 and 4.

SDS-PAGE and immunoblocting For immunoblotting, proteins were transferred by semi-dry blotting onto a 0.45 ~m nitrocellulose msmbrane (Schleicher and Schuell, FGR) after separa~ion bv SDS-PAGE. The anti~ens were probed with primary polYclonal rabbit antibodies raised against chitinase 2 and 4 (see above) and subsequentlv visualized using alcaline phosphatase con-W O 92/l7591 2 ~ ~ $ ~ ~ ~ PCT/DK9~/0010X
a~
juga~ed secondar. antiDodie~ (Dakopa~,s. Denmark) accordi.n~ to r~hse-Andersen (1984!.

To determine ;ne e~pression level in transgenic ~obacco. s;~e ~~~
~enhanced che~i.luminescence ! from Amersham was used. .~fter extrac-lon , of the leaf ~aeerials, 1 ~ pro~ein was aDplied to each iane of ,he SDS-PAGE gel. After blotting, the nitrocellulose membrane was treated according to Amershams prococol. In brief, the nitrocellulose membrane was initially treated with 10% BSA, before the primarv antibodies to sugar beet chitinase 4 diluted 1:1000 was added. The antigen was detected with horse-radish peroxidase conjugated secondary antibodies. Detection reagent was added and after 2 minutes the protein bands are visualized on a Hyperfilm-ECL.

Analysis of the amino acid composition of the purified chitinase iso-enzymes 2,3 and 4 and ~-1,3-glucanase 3 and 4 After freeze-drying, the purified chitinase isoenzymes 2.3 and 4 and ~-1,3-glucanase 3 and 4 were subjected to amino acid analysis as described by Barkholt and Jensen (1989). An aliquot (4.2 ~g) of each of the chitinase isoenzymes and the ~-1,3-glucanase respectively were .~ incubated with 3,3-dithiopropionic acid to derivatize che cysteine residues before acid hydrolysis. The determination was repeated : twice.

Preparation and amino acid sequence analysis of tryptic peptides of sugar beet chitinase 3 and `4, SE and ~-1,3-glucanase 3 and 4 TrYptic digestion After RP-HPLC as described above and freeze-drying, 100 ~g of pro-teins were redissolved in 200 ~1 of 0.2 M Tris-HCl (pH 8.4) contain-ing 7 M guanidine hydrochloride. 20 mM dithiothreitol was added and the protein was reduced at 37C for 4 hours under nitrogen. 30 ~
iodoacetamide was added and the reaction was allowed to proceed in the dark for 40 minutes at 25C under nitrogen. ~nreacted iodoacet-amide was inactivated bv addition of 5 ~l of 9-mercaptoethanol fol-lowed b~ incubation for l; minutes a_ 2;C in the darr~. The protein W O 92/17~91 PCT/DK92/OOlOX
2 1 3 ~ 3 3 ~
soiution was dialvzed a~ains. 0.2 M ammonium carbona~e ~DH ~.O) for 24 hours at 4C in ~he dar~ using Eppendorf tes. ~ubes wie:~ dialvsis ,ubing (10 ~Da cu~ orf: Ser~apore Ser~:a. FRG) inser~ed ~?.d_rnea~r. a Dunctured lid. Thereafeer, precipieaced protein was pelle e~ b.
centrifuga.ion ~for ~ minu~es a. 10.000 ~ g and the suDerna,an~ was ~ransferred to ano~her test tube. The pro~ein pellee was partiall:
solubilized by addition of a few particles of guanidine hvdrochloride and incubated with 4 ~g TPCK-treated trypsin in 20 ~1 of ammonium carbonate (pH 8.0) at 40C for 30 minutes. Finally the supernatant and 6 ~g of TPCK-treated trypsin were added. The digestion was al-, lowed to take place at 40C for 4 hours and stopped by addition of 20 ~1 of TFA. The peptide solution was subjected to RP-HPLC on a VYDAC
: C18 column (0.46 ~ 1~ cm; 10 ~m particle size: The Separations Group.
California) using the mobile svstem described above for RP-HPLC of proteins (see Fig. 4). Collected peptides were diluted 3 times with buffer A and rechromatographed on a Develosil CLg column (0.4 ~ 10 cm; 5 ~m particle size; Dr. O Schou, Novo-Nordis~, Denmark) using the mobile system described above. Selected peptides were subjected to amino acid sequence analysis.

Amino acid sequencing Amino acid sequencing of the peptides was done with a Pulced Liquid Phase Protein/Peptide Sequencer model 477 and a HPLC On-line PTH-Amino Acid Analyzer model 120 A from Applied Biosystems (CA, USA), according to the manufacturers instructions.

~acterial strains and enzymes Restriction enzymes, Klenow polymerase and T4 DNA ligase were suppli-ed by Boehringer Mannheim and used in accordance with the manufac-surers instructions.

pBluescript was supplied bv Stratag~ne (USA).

pUC19 was supplied bv Boehringer Mannheim.

.
:

W 0 92/17~91 ~ 3 ~ 9 PCT/DK92/OOlOX
q7 For subcloning in ~. coi_ ~ransfer of D~A ~-as carried ou. usin, DH5 E. coii cells (from BRL) according to the manufacturers instruczions.

-~ Isola~ion of RNA from sugar beet leaves Isola.ion o; RNA was carried out as described bv Chir,win et a'.
(1976), Purif~cation of poly-A RNA
, The RNA with a poly-.~ tail was purified bv affinitv chromatograph~
through an oligo-dT cellulose column. 0.5 g of oligo-dT cellulose was mixed in 5 ml of 0.; M NaOH for 5 minuces (1 g of oligo-dT cellulose binds 1.2 mg of polv-A RNA). The resulting mixture was neutralized with 10 mM Tris pH 7.5 until pH reached 7.5. An 1 cm column with a diameter of 1 cm was made and equilibrated with 20 ml of column buffer ~500 mM NaCl, 10 mM Tris pH 7.5, 1 mM EDTA), The RNA was denatured at 65C for 5 minutes, and 5 volumes of column bufEer were added to the RNA before chromatography through the column. The "run-through" was collected and subjected to chromatography again. The column was washed with column buffer until OD260 reached 0.01 or less. The poly-A RNA was eluted with TE buffer in 1 ml fractions. and the RNA concentration for each of the fractions was determined at OD260. The poly-A RNA-containing fractions were pooled and adjusted to 100 mM NaCl and the RNA was precipitated overnight with 2.5 vo-lumes of 96% ethanol at -20C. The poly-A RNA was spun and dissolved in ~2 at a concentration of 1 ~g/~l and stored at -20C. The yield was about 1-2% of total RNA applied to the column.
,:
Isolation of genomic DNA from sugar beet leaves Genomic DNA was isolated from sugar beet leaves (of the varietv 60.159.838-131-4) (Dellaporta ec al., 1983).

2 g of Cercospora infected sugar beet leaves obtained as described above were ground in liquid N2 and frozen, and the frozen material was transferred to a 40 ml pol~ethYlene cen~rifuge tube. 15 ml of e~traction buffer (100 ~hl Tris pH 8Ø 50 ~ EDTA and 500 mM NaC:~

210~3a~3 were added ~oge~her wi.h ! ~.i OL ~0// S~S and ar.er mi~ing. -he mi~-.ure was incubateà a~ 6~C for 20 min. ~ mi of 3 .~ po~assium acetate were added. ;he solution ~as mixed (~.or,e~) and incubated for 20 mir..
on ice. Subsequencly, ~he mi~ure ~as cen~ri~uga~ed for 20 min. a.
~ ,'C. ~s,000 ~ g. The superna.ant was -iltered through i-2 layers of : miracloth into a new centrifuge ~ube, 15 mi iso-propanol ~as added and the mixture was incubated for 30 min. at -20C. After another centrifugation at 20,000 x g for 15 min. a~ 4C, the pellet was ` washed with 70Z ethanol and thereafter dried brieflv before beingl0 resuspended in 0.7 ml of X-TE buffer (50 mM Tris, pH 8.0 and l0 mM
EDTA). The suspension was transferred to an eppendorf tube and cen-trifugated for 5 min. The supernatant was extracted twice with phe-nol/chloroform. The DNA was precipitated by adding 75 ~l of 3 M Na-ace~ate and 500 ~l of iso-propanol, mixing and spinning for 30 se-: lS conds. Afterwards, ehe pellet was dissolved in 400 ul of H2O, and the suspension was adjusted to l00 mM NaCl and precipitated with 1 ml of 96X ethanol, The suspension was centrifugated for 5 min. and the supernatant removed, The pellet was dried briefly, and ehe DNA dis-solved in 200 ~l o f TE buffer. The DNA concentration was determinated 20 using the absorbance at OD260, where 0D26o~1-50 ~g DNA/ml. The DNA
was stored at -20C until use.

Construction of a sugar beet cDNA library On the basis of sugar beet mRNA isolated as described above a ~ZAP
cDNA library was constructed by Stratagene Cloning Svstems.
.
Construct~on of a sugar beet genomic DNA library On the basis of genomic sugar beet DNA obtained as described above, which had been partially digested wich SAU 3A, a genomic sugar beet library was constructsd bv cloning the genomic DNA in the BamHI site of the vector EMBL3. The library was constructed by Clontech.

Plating libraries for screening for relevant DNA sequences The titer of the library ~either of ehe cDNA or the genomic librarv was determined according eo Sambroo~ e a_. (1989). anc abou. l06 SUBSTlTlJTE SHET
ISA/EP

, 0 92/17591 21 ~ PCT/DK92/0010X
oa phages were used ror each screening. For each 2l.~ x 2~.5 mm pla~es.
2.~ ~ 105 phages were rnixed with 3 ml of the E. coli strain XL l-Blue (in case of a sugar bee. ~ZAP cDNA library) or L_392 (in case of the sugar beee genomic librar~ (EMBL3)) and growTI ir. LB medium with 10 mM
MgS04 and 0.2;' maltose to an OD600=1. The mixture was allowed to stand at 37'C for 20-30 minutes.

Subsequently, 30 ml of top agar (0.7X agarose in LB medium with 10 ~M
MgS04 and 0.2% maltose) (48C) were added and the resulting mixture plated onto 24.5 x 24.5 mm plates containing 200 ml of LB agar and allowed to grow overnight at 37C.

Transfer of plaques to nitrocellulose filter in situ The screening of ~ZAP recombinant clones by hybridization to single plaques in si~u was done as follows.

After growth overnight at 37C, the plates were cooled for about 15 minutes at 5C. Phages and DNA were transferred to a hybond-N nylon membrane (Amersham) by placing the dry filter on the lawn of cells.
Phages were allowed to adsorb to the filter for l to 5 minutes.
During adsorption it was con~enient to mark the filter and plaee with a needle for orientation. If replicate filters were made, the marks on the plate were filled with ink, and it was then possible to mark the replicate filters with similar marks.

The filters were then placed with the "plaque side" upwards on What-man 3MM filter paper sheets soaked with 0.5 M NaOH, l.5 M NaCl for 30 seconds. They were then washed for 30 seconds in each of the follow-25 ing solutions: l) 0.5 M NaOH. 1.5 M NaCl, 2) 0.5 M Tris, pH 7.5, 1.5 M NaCl. 3) 2 x SSC tmodified Benton, 1977). The filters were air dried and illuminated with W for 3 minu~es with the phage side upwards.

W O 92/17591 PCTtDK92/OOlOX
~g3,a9 100 Preparation of radioactive probes ror use in screening ror sugar bee~
chitinase 4 in sugar beet cDNA libraries Relevant oligonucleotides were iaDeiled b. pnosor.or:ia.ior. ~i h Dac-teriophage T4 polvnucleotide kinase according ~o ;.~e method described in Sambrook e~ ai. (1989). .~ore specificall~;. ~he olivonucieo~ides were svnthesized without a phosphate group at their 5' termini ends and were labelled with ~ 32p from i~-32P]ATP using the enzyme bacteriophage T4 polynucleotide kinase.

Purification of radiolabelled oligonucleotides by precipitation with ethanol After inactivation of the bacteriophage T4 pol~nucleotide kinase b~
heat, 40 yl of H20 was added to the tube, the content of which was subjected to thorough mixing. Then 240 ~1 of a 5 M solution of am-monium acetate and 1 ~g of herring sperm DNA were added. The result-15 in8 mixture was mixed well, and 750 ~1 of ice-cold ethanol were added. Again, thorough mixing was performed, and the resulting mix-ture was stored for 30 minuees at 0C.

The radiolabelled oligonucleotide was recovered by centrifugation at 12,000 x g for 20 minutes at 4C in a microfuge. Using an automatic pipette device equipped with a disposable tip, all of the supernatant fluid (which contained most of the unincorporated (y-32P]ATP~ and any free 32p generated during the phosphorylation reaction were carefully removed. The resulting residue was redissolved in 100 ~1 of H20 and 10 ~1 of 3M sodium acetate and thereafter 250 ~1 of 96X ethanol were added. The mixture was subjected eo centrifugation for 20 minutes at 4C, dried and redissolved in 200 ~1 of H20.

Oligonucleotide hybrid~zation of chitinase 4 DNA by filter hybridlza-t~on .

The oligonucleotide hybridization procedure used eliminates ~he preferential melting of A-T versus G-C base pairs. allowing the stringencv of the hvbridization to be controlleà as a function of probe length onl~. The hvbridization was carried ou~ essentiall~ as SlJBSTITlJTE SHEET
ISA/EP

W 0 92/l759l 2 1 S63CI~ PCT/DK92/00108 described bv Wood ec ~ . '98~'. Ihe nitroceiiuiose r i.ers ob~aineà
as described above were wee~eà on che surrace with 2~SSC ana subse-quentlv prehvbridizea ir. n~Dridi-a,ion bufîer (~SSC. !,' ~S.~.. '':
Ficoll 4000, lX P~.~P. ;1~ ~/ml or hea~ dena~ura,ed saimon sDerm D~A.
50 mM sodium phospnate. pH 6.8). The hvbridiea~ion was per~crmed at 37C for 4 hours in a plastic bag with snakin~. lhe filter was hvbri-dized overnight in the same solution plus the radioactive oligonucle-otide probe (the 23-mer chit 4 probe) at 37C with shaking. A lx1O6 cpm/ml solution of the hybridization buffer was used. The filter was rinsed three times in 6xSSC at 4C and thereafter washed twice for 30 min. at 4C in 6xSSC. Further, the filter was washed three cimes in T~AC--buffer (3 M Tetramethylammonium chloride, 50 mM Tris pH 8,0, 2 mM EDTA, 0,lZ SDS) for 5 min. at 37C. (The tetrame~hvlammonium chloride is made in a 5 M stock solution. Since TMAC is hvdroscopic, the actual molar concentration (c) must be determined from the refra-ctive index (n) by the for~ula c-(n-1,331)/0,018). The filter was then washed twice for 20 min, in TMAC~buffer at 55C.

The filters were dried in the air at room temperature. Inkmarks on . the filters serving to align the autoradiographs with the filters and the a~ar plates were marked with an autoradiography marker (Ultermit, Du Pont de Nemours). The filters were covered with Saran Wrap and an X-ray film (AGFA CURIX RP2) were exposed to the filters for 16-70 hours at -70C with an intensifying scrçen. The films were developed and positive plagues were identified by aligning the dots on the film with ~hose on the agar plates.

Plcking plaques Agar fragments containing positive plagues were picked from the agar plate using mild suction and placed in 500 ~1 of SM phagebuffer (Sambrook ec al., 1989) and 1 drop of chloroform contained in an ; eppendorf tube. The eppendorf tubes were allowed to stand for 1-2 hours at room temperature so as to allow the phage particles to diffuse out of the agar. About 106-107 phages per plaque were ob-tained.
' ' SUB5TlTlJTE SHEET
ISA/EP

W O 9~/17~91 PCT/DK92/0010X

~ ~ ~63~ U
.he pnages were ~hen diluted in S'd onaee Duffer and mixed wi~h 200 ~i or XLl blue cells (OD,oo = l). lhe mix~ure was allowed .o stand ror ~0 minutes a. 37C and 2.5 mi o~ .op a~arose (48~C) was added. The mix.ure was poured onto ~ cm Petr dishes and filter prints were made -or rescreening.

A single well-isolated positive plague useful for making a phage stock to be used in the in vivo excision was picked from ~he agar plates according to the method described by Sambrook e~ al. (1989) using several steps of replating and rescreening.

A phage stock was prepared according to the method of Sambrook et al.
(1989).

In vivo e~cislon In vivo excision of plaques was performed as described in "It~ vivo excision Pro~ocol" in the Instruction Manual (CAT# 236201, August 15 30, l988) for undigested Lambda ZAP II Clonin~ Kit, Stratagene Clon-ing Systems.

Prep~ration of plasmid DNA

Preparation of plasmid DNA was modified according to the method of Sambrook ec al. (1989), and was performed as follows:

Bacterial strains (DH5~ and XLl-Blue) harboring the plasmids were grown overnight in 5 ml of LB medium supplied with the relevant antibiotics and 5 ml of the overnight culture was harvested by cen-trifugation for l0 minutes at 3000 x g. The pellet was resuspended 25 in 200 ~l of Solution I (50 mM glucose, 25 mM Tris pH 8.0, l0 mM
EDTA) in 1.5 ml tubes. 400 ~l of Solution II (0.2 N NaOH, 1% SDS) was : added, the mixture subjected to gentle mixing and placed on ice for 5minutes. 300 ~l of 5 M KOAc pH 4.8 was added and subjected to tho-rou~h mixing. The resulting mixture was placed on ice for l0 minutes 30 and subsequently subjected to centrifugation at 15,000 ~ g for l0 minutes at 4C.

IS~EP

. ,. ;' W O 92/1759l ~ i ~ 6 3 3 3 PCT/D~92/0~l0 The supernatan. (900 ~1) was transferred to new tubes and 0.6 voiume (j40 ~1) of icecoid isopropanol was added. The resulting mixture was allowed to s.and for '~ minu,es a. room temperature. The mi~ture was again subiected tO centrirugation a. 1~.000 ~ g and 4'C for 10 minu-tes and the supernatan. ~as removed.
:
The pellet was dissolved in 100 ~1 of TE and lO0 ~1 of ; M LiCl waS
added. The mixture was allowed to stand on ice for ~ minutes and subjected to centrifugation at 15,000 x g and 4C for 10 minutes.

The supernatant was transferred tO new tubes and 500 ~1 of 96% etha-nol was added. The tubes were centrifugated at 15,000 x g and 4C for 30 minutes and the supernatant was removed. The pellet was washed with 70% ethanol (about 100 ~1) and dried. The dried pelle~ was redissolved in 50 ~1 of TE.

DNA sequencing The plasmid DNA (double-stranded template) to be sequenced was puri-fied by the above described method. Sequencing was performed as fol-lows:
A mixture comprising about 2 ~g of the relevant plasmid. 1 ~1 of 2 M
NaOH, 2 mM EDTA, 1 ~1 of primer (100 ~g/ml) and H20 up to 10 ~1 was incubated at 85C for 5 minutes and subsequently put on ice.

The mixture was neutralized by adding 1 ~1 of 5 M NH4AC and then precipitated by adding 20 ml of 96% ethanol. The resulting mixture was spun for 30 minutes ac 4C and resuspended in 6 ~1 of H2O. 1.5 ~1 of 5 x conc. sequenase buffer was added. The mixture was placed at 37C for 5 minutes.

; 4 ~1 of sequetide (Biotechnology Systems NEN~ Research Products, Du Pont de Nemours) and 2 ~l.of sequenase (United States Biochemical) ; were added, resulting in a total volume of the mixture of 13.5 ~1.
~ The mixture was placed at room temperature for ; minutes.
,.~
3.1 ~1 of the labelling reaction was transferred to each termination tube (G~ ... T and C) containin 2.~ ~1 or the d~TP terminatin mi~:-W ~ 92/17591 ~ ~ ~16 3 ~ ~ PCTfDK92/0010~
iO-ture. The mixtures in each or the tubes were allowed to reac~ for minutes a~ 3'C and 4 ~l of stop solu,ion was added. The mixtures were then hea~ed to 85C and 2 ul of ;he heated mi:;~ure was appliec onco a 6% sequencing gel (Gel-mi~ ~ from BRL). ~ne ~el ~as vacuum ; dried and e~posed .o an ~-ra; .ilm.

Labelling of sugar beet SE DNA probes DNA probes to be used in the isolation of ehe sugar beet acidic chitinase SE was labelled bv use of the Stratagene oligolabelling kit prime IT, (Random Primer Kit) according to ~he manufacturers instructions. More specifically, the following procedure was used:

A sample comprising 25 ng (1-23 ~lj of the DNA tempiate to be labe-led, 0-22 ~l of H2O and lO ~l of random oligonucleotide primers (con-stituting a total volume of 33 ~l) were added tO ~he boctom of a clean microcentrifuge tube. The reaction eubes were heated to 95-lS 100C in a boiling water bath for 5 minutes and ehen centrifuged briefly at room temperature to collect the liquid, which may have condensed on the cap of the tubes. The reaction tube containing the DNA sample in LMT agarose was placed at 37C and the following re-agents were added to the reaction tubes:

lO ~l of SX primer buffer containing dATP, dGTP and dTTP.

S ~l of labeled nucleotide ~-32PdCTP (3000 Ci/m~) (Amersham), and 2 ~l of diluted T7 DNA Polymerase. The T7 DNA Polymerase was diluted in ice cold Enzyme Dilution Buffer immediately before use to a final concentration of l U/~l. The reaction components were mixed with the tip of a pipette.

The tubes were incubated at 37-40C for between 2 and lO minutes and subsequentlv, the reaction was stopped bv the addition of 2 ~l of Stop Mix. The probes with the 32P-labeled DNA were further purified using the Elutip~-D column svstem (Schleicher & Schuell).

W O 92/17591 ~ 3 ~ ~ PCT/DK92/0010X
10~
Then. the proDe D~A was made ready for hybridiza.ion b~ mixing ;ne proper amoun~ of radioac,ive probe ~ith 200 ~1 or 10 mg/ml salmon sperm DNA. The mixture was hea.ed .o 9~-100C in a boil r.g water ~a.~.
for i minutes and cooled on ic~. The resulting probe was stored a~ -i 20 C for up to one wee~ and heated .o 9~-100C in a boi'ing water bath for i minutes and cooled on ice before use.

Hybridization o~ SE-DNA

Filter prints obtained as described above under "Oligonucleotide -:~ hybridization'~ of the sugar beet ~-ZAP cDNA librarv were subjec,ed to prehybridization for 2 hours at 67C under conventional prehybridi-zation condi~ions using a prehvbridizing solution comprising 2 ~ SSC.
10 x Denhardt's. O. 17/~ SDS and i0 ~g~ml salmon sperm DNA.

Hybridization was carried out overnight using a hvbridization solu-tion identical to the prehybridization solution except for the fac;
that a radioactive DNA probe prepared as described above had been added.

After hybriàization, a washing procedure was carried out in accor-dance with the following scheme:

2 x 15 min. in 2 x SSC and 0.1-/. SDS, and 2 x 1; min. in 1 x SSC and 0.1% SDS.

The positive plaques were identiEied as described under "Oligonucleo-tide hybridization of chitinase 4 DNA in filter hybridization".

W 0 92~17591 ~ 1 ~ 6 ~ ~ ~ PCT/DK92/O~lOX

Identificatlon or DNA belonging to the chitinase 4 gene familv To identify DN~ belonging to the chitinase 4 gene family, hybridiza-,ion of the DNA in question with a chitinase 4 probe was carried out usin~ tne h~bridi ation procedure disclosed in "hvbridization of SE-DNA" e~cept for the fact that .he hvbridization is carried out a~ a temperature of 55C. The chitinase 4 probe may be the chitinase ~
DNA sequence shown in SEQ ID NO.:l. It is contempla~ed that a probe prepared on the basis of a characteristic part or a specific subsequence of the chitinase 4 DNA sequence as disclosed herein, e.g.
a probe prepared on the basis of the peptide 4-26 may also be useful.
To identify a DNA sequence hybridizing to a specific subsequence of the chitinase 4 DNA sequence and encoding a specific part of the chitinase 4 enzvme, the nucleotide probe is advantageously prepared on ehe basis of the amino acid sequence of said specific part or a subsequence thereof.

Excision of DNA from agarose gels DNA fragments to be used, e.g. in the construction of genetic con-structs according to the invention were isolated as foll~ws.
;' The DNA was run on LMT (Low Melting Temperature) a~arose (Sea Plaque-20 ~ GTG, FMC) in T~E (0.04 M Tris-acetate, 0.002 M EDTA) buffer. The DNA band was excised with a Pasteur pipette. To the excised DNA, l vol 200 mM NaCl, lO mM EDTA was added. The gel was melted at 68C for 10 min. and re-equilibrated to 37C. Subsequently, 2U/lOO ~l o~
agarase (free of DNase, from Calbiochem) was added. The mixture was allowed to stand overnight at 37C and was subsequently extracted twice with phenol and twice with chloroform, subjected to EtOH preci-pitation and finally resolubilized in H20.

PCR used for the amplification of cDNA encoding SE, ~-l,3-glucanase and chit 76 on the basis of sugar beet mRNA

The preparation of a partial cDNA molecule was done bv use of the Gene Amp~ RNA A~plification Rea~ent Kit (Perkin Elmer Cetus. USA).
The PCR was performed in accoràance with the manufacturer~s instruc-WO 92/17~91 ~ ~ U ~ r~ u ~ PCT/DK92tOOlOX
iO, tion with a rew modifications. Ihe reverse transcription pro,ocol was followed using the concentrations in ,he scheme below.

Component voiume Final conc.
-MgCl~ solution 4 ~1 5 mM
10 ~ PCR buffer II 2 ~1 1 mM
dGTP 2 ~1 1 ~M
dATP 2 ~1 1 mM
dTTP 2 ~1 1 mM
10 dCTP 2 ~1 1 mM
RNase Inhibitor 1 ~1 1 U/~l Reverse Transcriptase 1 ~1 2.5 ~
primer 270 0.4 ~1 2.5 ~M
mRNA 3.6 ~1 Total volume per sample 20 ~1 ., In the step cycle the following procedure was used.

Segment 1: 42C for 2 hours Segment 2: 99C for 5 minutes Segment 3: 5C for 5 minutes ~:
The PCR protocol was followed except that the Taq polymerase was added later (see PCR cycles) and the temperature cycling was changed to the following:

:

:

W O 92/17591 PCT/DK92/OOlOX
2~ ~3~33 lo~ `
PCR c-cies:

no. o cycles ^ ;ime ~mir 9 ,~
t, addition of Taq polymerase and oil 3, 2 ~0 l 72 20 PCR used in the construction of gençtic constructs of the invention ~: and in site-directed mutagenesis on the basis of cloned DNA templates Ihe preparation of the relevant DNA molecule was done by use of the Gene Amp~ DNA Amplification Reagent Kit (Perkin Elmer Cetus~ USA) and in accordance with the manufactures instructions except for the temperature cycling. Here the following procedure was used:

PCR cycles 25 no. of cycles ~C time (min.) 3; 94 1 1/2 1 l/2 W O 92/17~ 3 ~ PCT/DK92/O01~X
10~ ' ' E~PLE 1 PURIFICATIO~ A~D CHARACTERIZATIO.~ OF C~ITI~ASE ~.3 ~D

The method used for ~he synthesis OI regenera~ed chi.in has been specifically developed in order ~o make i, possible ~o ob~ain a nigh vield of active chitinase 4. A high yield of active and pure chitin-ase is required in order to have sufficient protein material for i) determining the antifungal potential~
ii) preparing and analyzing tryptic peptides which makes i-possible to prepare an oligonucleotide probe suitable for isolation of DNA encoding a chitinase.
iii) producing monoclonal and polyclonal antibodies thereto.

~ The isolation and characterization of the DNA encoding the chitinase; is necessary when the DNA is to be used for the construction of genetically modified plants having an increased chitinase activity.
Also, a high amount oE pure chitinase is required to make it possible to elucidate and characterize the important parts of the enzyme such as the active site.

The regenerated chitin was obtained by acetylating the free amino groups at low as well as at high pH as described above (as compared to the conventional method in which this synthesis is performed only at low pH). The new combined method was easier, faster and gave a much higher yield and a more stable product than the conventional method in which acetylation is carried out only at low pH.

The de8ree of purity of the enzymes was examined throughout the purification steps by SDS-PAGE on the Phast-System as described in "Materials and Methods". After separation on the Mono S FPLC column (Fig. l) only a single silver stained band for each chitinase iso-. zvmes 2.3 and 4 could be observed on the SDS-gel (Fig. 2). Further ~` analysis by reverse phase HPLC on a V~'DAC RP4 column gave onlv one protein peak for each of the isozymes. This is further evidence for a homogeneous protein preparation for each of the basic chitinase isozymes.

W O 92/1~;91 PCT/DK92/OOlOX

The molecular weights determined bv SDS-PAGE for chitinase '. 3 and 4 are 32. ~7 and ~6 ~Da. respectivel~ (Fig. 2). ~y isoelec~ric focus-ing. che isoelectric points for.chitinase '. 3 and 4 were determined .o 8.3, a o and 9.l. respectively. ~sing the radiochemical chitinase assay described above, all three isoenzvmes was found .o have a broad pH optimum with maximum activitv around 4.5. The specific activity for chitinase 4 is 480 nkat/mg protein, whereas that for chitinase 3 and 2 are 208 and 164 nkat/mg protein, respectively.

In order to determine whether chitinase 4 is an endochitinase produc-ing chitooligosaccharides or an exochitinase liberating onlv N-ace-tylglucosamine from the non-reducing end of chitin or chitooligosac-charides, the pattern of reaction products liberated by chitinase 4 from 3H-chitin was analyzed by TLC (Fig. 3). Irrespective of dura-tion of incubation, N-acetylglucosamine was only a very minor reac-tion product, whereas chitobiose, chitotriose and chitotetraose werethe major product. This strongly implies that chitinase 4 is an endochitinase.

: In addition to the catalytic activity exerted on 3H-chitin, chiti-nase 4 was also capable of hydrolyzing the cell walls of Micrococus lysodeicticus using the lysozyme assay described in "Materials and Methods" (see Fig. 4). This demonstrate, that chitinase 4 is a bi-functional enzyme having both chitinase and lysozyme activity.

ANTIFUNGAL ACTIVITY OF PURIFIED CHITINASE AND ~-l,3-GLUCANASE ISOEN-ZYMES FROM SUGAR BEET LEAVES

~: Three different bioassays were conducted to ascertain the in vitro antifungal activitv of chitinase and ~-1,3-glucanase isoenzymes on the germination and growth of Cercospora beticola. In the same manner the antifungal activitv of chitinases and ~-l.3-glucanases from other sources or other isozvmes ~rom sugar beets mav be determinated using ei,her purifiea enzvmes or e~trac~s containing the enzvmes. Also. the , W 0 92/l759l 2 1 ~ 6 3 ~ ~ PCT/DK92/OOlOX

assays mav be used tO de~ermine wheeher a given transEenic plant is within the scope of ~he presen. inven~io~.

.~etnoa - ,~,'ic-osco?e siiae 3ioassa;

Spore cultures of cercospora germinate and grow well on a thin I' 1~.
; of PDA on a microscope slide. The growth can be followed bv light microscopic investigations of ~.he number of germinating spores and : the total/average mycelial growth. Furthermore, at any specific time the growth activitv can be visualised by staining the culture with Cal,cofluor white followed by microscopic investigation under fluores-cent light. The number of hyphae with fluorescent tips and the exten-sion of the staining a. the individual tip reflect the growth ac-tivity in the culture.

When proteins with strong antifungal activity are added, the number of germinating spores are decreased, and the growth rate of the hyphae is drastically reduced. In Fig. 5 is shown the results when a combination of chitinase 4, acidic chitinase SE and ~-1,3-glucanase 3 is applied to the culture. 60 ~1 of protein solution containing 20 : ~g of each antifungal proteins were applied to each microscope slide.When chitinase 4 was used alone or in combination with either ~-1,3-glucanase 3 or SE alone, the inhibitory effect was less pronounced.
Neither ~-1,3-glucanase 3 nor SE had any significant inhibitory effect alone or when combined. However, as seen from Fig. 5 when all 3 enzymes were used together, a very strong inhibitory effect was seen indicating a synergistic èffect between chitinase 4 SE and ~-1,3-glucanase.

~1ethod II - ~licroti cer plate Bio~ssaY

The germination of spores and growth of the mycelium can be followed in a microtiter plate bv measuring the absorbance (620 nm) a; speci-. ~ fied time intervals. In the control experiments, the growth of cer-cospora is initiated after an appro~:. 40 hours lag period and in-creases almost linearly for the next 40-50 hours (curve A in Fig.
6). ~'hen pure chitinase 4 (5 ~g per well) is included. the inial lag period is increased tO, 5 hours and the growth rate is aecreasea as W O 92~17591 PCT/DK92/OOlOX
21~3~3 11 compared to the control ~curve C in Fi~ The eluate fro~ the chitin column is shown as a comparison.

.Yecnod I T .4utoraaiog~a?.~.

In the chird bioassa~ ~he chitin in the h~phae cell wail ~as labei-led with 3H-labelled N-acetylglucosamine. After a short pulse. the - radioactivity was deposited in the tip of the fungal hyphae (see Fi~.
7). When chitinase 4 alone or in combination with SE and ~-l,3-glucanase was added after the pulse labelin~ the radioactivitv deposited in the hyphae tip was effectively removed. The amo~nts of enzymes is similar to that described in Method I (see above). This strongly indicates that the mode of action of chitinase 4 on the ceil wall of Cercospora is specifically to hydrolvze the chitin fibers in the hyphae tip and thereby inhibit cell wall synthesis.

The following conclusions can be made on the bases of the above experiments:

It is possible to inhibit the growth of Cercospora in spore cultures by addition of chitinase fractions from sugar beet leaves.

The inhibition is primarily seen as a lag time for germination. the length of which depends of the strength and concentration of the growth inhibitor.

Fractions which contain both chitinase and ~ 1,3-glucanase have a stronger inhibiting effect than chitinase alone.

Chitinase/glucanase fractions from Cercospora infected sugar beet plants have a stronger inhibiting effect than fractions purified in the same manner from control plants.

~ ' W O 92tl759l 2 'i v ~ PCTtDK92/OOlOX

AMINO ACID COMPOSITIO`~ AND P.~RTIAL ~`1I?;O ACID SEQUENCES OF THE PERI-FIED CHITI~ASE ISOENZ~MES ~, 3 .~'D ~

After freeze-drving~ the amino acid composi~ion of pure sugar bee.
5 chitinases 2, 3 and 4 were determined (see "Materials and Methods").

The results are shown in Table I. For comparison, the amino acid composition of chi~inase from barlev, wheat and bean (Leah e~ al..
1987) are included in the Table. The amino acid composition of chiti-nase 2 is similar to that of bean chitinase in a number of amino acid residues. e.g. aspartic acid, proline, glycine, leucine. tyrosine~
phenylalanine, valine and lysine. In contrast, chitinase 3 and 4 have a significant different amino acid composition than any of the other chitinases.

Furthermore, the amino acid composition derived from the cDNA se-15. quence encoding the sugar beet chitinase 4 without signal peptide is also shown. The cDNA sequence was obtained as described in Example 5 below.

.
"

W O 92/1759l PCT/DK92/OOlOX

21~ ~ 3 ~ 3 TABLE I
Amino acid c~mposition of barley, wheat, bean and sugar beet chitinases 2, 3 and 4 S A~ino acid Barley Wheat Bean S.B.2 S.B.3 S.B.4 cDNA
-Aspartic acid 23 28 29 34.4 24.7 24.4 22 Threonine13.8 22 22 16.2 13.0 12.8 12 Serine 17.7 24 26 21.0 24.8 24.8 24 10 Glutamic acid 18 20 22 24.9 22.1 21 0 18 Proline 17 15 20 17.1 10.3 10.2 9 Glycine 30.7 52 37 39.7 30.6 30.4 27 Alanine 37.3 27 26 28.0 28.2 28.5 26 Cysteine 7.2 12 16 16.9 16.8 16.9 15 15 Valine 12.5 14 10 8.6 14.4 14.3 14 Methionine 1.6 3 2 1.8 1.1 1.1 Isoleucine 10.8 9 11 11.9 10.9 11.0 11 Leucine 11.3 13 17 16.2 9.0 9.0 8 Tyrosine11.9 14 15 17.3 12.7 12.7 12 20 Phenylalanine12.7 14 13 11.5 18.3 18.1 17 Histidine4.9 4 3 4 4 4.7 5.4 4 Lysine 6.9 8 8 8.7 4.3 3.1 3 Arginine15.2 14 16 11.3 14.2 16.1 15 Tryptophane 3.2 7 4 nd nd nd 3 MW (KD) 27 29 32 30.6 27.6 27.7 25.9 S.B.2 - sugar beet chitinase 2 ~S.B.3 - sugar beet chitinsse 3 - 30 S.B.4 ~ sugar beet chitinase 4 cDNA ~ amino acid composition derived from the cDNA sequence encoding the mature protein, chitinase 4 nd ~ not determined.

REpLAcEMENtsHEET

': :
' : .
~, , W 0 92/17591 ~ 3 ~ 3 PCT/DK92/OOlOX
!
r-?cic digestion or sugar DeeC chi~inase 3 anb ~

Analvsis or the pure chi~inase 4 enzvme has revealed ,ha. .he ~;-.erminal part of the enzvme is bloc~ed. Thus. D'~- anal~sis o~ .ne mature chitinase 4 it was not direc.lY possibie ~o determine ics _ amino acid sequence, and in order to ge~ sufficien~ informa~ion abou.
the enzyme with the eventual aim of being able to isolate and charac-terize the DNA by which it is encoded, it was chosen to subject the mature enzyme to tryptic digestion in order to obtain protein frag-ments (peptides) susceptible to amino acid sequencing.

The tryptic digestion of the purified chitinase enzymes was carried out as described in "Materials and Methods" above. The trvptic pep-tides were separated by reverse phase-HPLC on the Vydac RP-18 column mentioned above under the conditions specified in "Materials and Me-thods" see ~Fig. 8). Peptides representing large peaks at an absor-L5 bance of 214 nm and displaying a high retention tlme (indicating longpolypeptide chains) were selected for further purification on a Develosil RP-18 column.

The purified peptides were subjected to amino acid sequence analysis as described above in "Materials and Methods" and the amino acid se-quence of each of the peptides is shown below in Table II.

When comparing.the amino acid sequences of each of the peptides withthe amino acid sequences of known chitinases (not of sugar beet origin) a low degree of homology was found.

One of the tryptic peptides proved to be very advantageous to form the basis for the construction of an oligonucleotide probe. Thus. by analysis of the amino acid sequence of the tryptic peptide 4-26 it was found that use of this sequence in the construction of an oligo-nucleotide probe would require only few codon choices. Thus, this peptide was chosen to form the basis of the construction of an oligo-nucleotide probe to be used in the isolation of DNA encoding chiti-nase 4 (see E~ample 4 below).

W O 92/17~91 PCT/DK92~0010X
~ ~$3~3 11~
TABLE II
Irvp~ic peptides of chi,inase 3 and Chi~inase ':
3-10.3 S-T-;'-C-Q-S-`i-.i-~-F-P-P-N-P-S-~
3-16.L A-C-;'-T-H-E-T-G-H-F-C-~r-I-E-E-I-A-~
3-16.2 V-G-~'-Y-T-Q-~'-C-Q-Q
3-22.3 G-P-L-Q-I-T-W
3-23.3 S-I-G-F-D-G-L-N-A-P-E-T-V-A-N-N-A-V-T-A-F-R

Chitinase 4:
4-4.2 V-G-~ '-T-Q-~' 4-19.3 G-P-L-Q-I-T-~' 4-22 S-I-G-F-D-G-L-~-A-P-E-T-V-A-N-N-A-V-T-A-F-R

. . . _ 3-10.3: shown in SEQ ID NO.:18 3-16.1: shown in SEQ ID NO.:19 3-16.2: shown in SEQ ID NO.:20 3-22.3: shown in SEQ ID No.:2i 3-23.3: shown in SEQ ID NO.:22 4-4.2: consisting of amino acids No's 244-250 of SEQ ID NO.:2 4-19.3: consisting of amino acids No's 163-169 4-22: No's 179-200 4-23: No's 37-52 4-24: No's 58-75 4-26: No's 201-224 lSOLATION AND CHARACTERIZATION OF THE cDNA GENE FOR CHITINASE 4 Fro~ the amino acid sequence obtained for peptide 4-26 (see Table II
in E~ample 3), the following ~erv specific oligonucleotide gene probe was svnthesi ed using a DNA svnthesizer 381 .i (Applied Bios~stems).

W 0 92/17~91 21 v ~ 3 ~ ~ PCT/DK92/OOlOX

~epeide ~-2~

Phe Irp Phe .r? .~e. Asn Asn TTT TGG TTT TGG ATG MT AAT GT
C C C C

Using this gene probe. the eY~preSSion cDNA library ~ZAP was screened using the procedure given in ".~aterials and Methods" above. 8 cDNA
clones were obtained from ~ZAP. and one or ~he clones was fullv sequenced while the o~hers ~ere onl~ par.!~ sequenced. The sequenc n_ was performea as described in "Materials and Methods'' above. An almos~ full leng~h cDNA clone, chi; 4-B15, was obtained from the ~ZAP
library and the DNA sequence thereof is shown in SEQ ID NO.:1.

On the basis of the cDNA sequence, a deduced amino acid sequence of chitinase 4 was obtained SEQ ID NO.:2. The deduced amino acid sequen-ce was aligned with the partial sequence obtained from the chitinase 4 protein (as described in Example 3 above) and an almost 100%
identitv was observed. This demonstrates that the isolated cDNA clone codes for ~he chitinase 4 polvpeptides purified by the chromatographic procedure described above. The chit 4-315 cDNA clone is 966 bp long and encodes a protein having 264 amino acid residues in the polypeptide chain out of~the 265 amino acids predicted for the chitinase 4 genomic DNA. The leader sequence consist probably of 23 amino acid residues (out of 24 amino acid residues as determined for the genomic chitinase 4 DNA, see below), followed by a hevein domain of 35 and a func~ional domain of 206 amino acid residues. After the stop codon the cDNA has a 158 bp 3' noncoding region.

As mentioned in E~ample 3 above, it has not been possible to sequence ~he ~-terminal amino acid sequence of chitinase 4 directl:. because the ~-terminal is blocked. ~owever comparison with whea~ _erm a -glutinin (~;GA-A) and potato chitinase lead to the guess of che -irs amino acid bein Glr.. rereaf,er ~he rese o he amino acic seauenc W O 92/l759l PCT/DK92/OOl~X
2 1 ~ 6 3 a 3 118 or ~he chi~inase 4 N-~erminal ~as deduced from che DNA sequence ,o be Gln-Asn-~ys-Gly-Cys The N-cerminal sequence of chitinase 4 was fur.her e~amined b de-termining che molecular weigh~ (M~') of che ma~ure chi~inase 4 bv 5 electrospray mass spec~rome~ry as described b~ G J Feis~ner e. al , 1990 A MW of 25893 6 +/- 10 was observed On .he basis of ~he amino acid sequence, a M~ of 25923 can be calcula~ed Given ~hat the mature chitinase 4 contains 7 S-S-bridges (loss of 14 protons) and ehat the first amino acid residue Gln is converted eo the pyroglutamyl deriva-tive (loss of - NH2 - 15 MW), the calcula~ed MW OL ~he mature chiti-nase 4 is 25894 This is in agreemen~ with the data observed by the electrospray mass spec~rome~ric analysis and confirms ~he deduced N-terminal amino acid sequence given above for ~he mature chitinase 4 The N-terminal amino acid sequence could be decermined for chitinase 2 and the following ter~inal amino acid sequence was found in chiti-nase 2 Glu-Leu-Cys-Gly-Asn-Gln-Ala SlJBSTlTUTE SHEET
ISA/EP

W O 92/17591 2 i a f3 ~ 3 ~ PCT/DK92/0010 TABLE III

Comparison of the N-cerminal amino acid seq~ence between differen.
chitin binding pro~eins:
_ WGA-A: QRCGEQGSNMECPNNLCCSQY-GYCGMGGDYCGKG--CQNGAC~TS
Hevein: EQ**R*AGGKL*********W-*W**STDE**SPDHN**SN-*KD
Chit. Bean: EQ**R*AGGAL**GGN****F-*~**STT****P*--**SQ-*GG
Chit. Tob.: EQ**S*AGGAR*ASG****KF-*W**NTN****P*-N**SQ-*PG
Chit. SB 2: EL**N*AGGAL***G******-*W**NTNP***N
Chit. SB 4: *N**C-A**LC*SRFGF*GSTDA***E*CREGP----*RS-----* - amino acid r~sidues identical to WGA-A
WGA-A: shown in SEQ ID NO.:23 Hevein: shown in SEQ ID N0.:24 Chit. Bean: shown in SEQ ID N0.:25 Chit. Tob.: shown in SEQ ID N0.:26 Chit. SB 2: shown in SEQ ID N0.:27 Chit. SB 4: consisting of amino acids No's 24-54 of SEO ID N0.:2 ISOLATION AND CHARACTERIZATION OF THE SUGAR BEET GENOMIC CLONES CHIT

Screening of 500,000 clones from ehe amplified EMBL3 library contain-ing genomic sugar beet inserts from a partial Sau3A digestion, resul-ted in the isolation of three clones with the chitinase 4 cDNA as ; 25 probe.

The three hybridizing clones were characterized by restriction frag-ment analysis and sequencing. These analysis showed. that one of the clones contained a chitinase gene, now called chitinase 76. the sequence of which is shown in SEQ ID NO.:5. Sequencing of this gene was initiated with the primer used for screening of the ~ZAP library WO 92/1?5~1 PCr/DK92/~)~)lOX
~; J ~ ) J
1~0 (see Examp1e 4), and continued with o~her primers compiemenear~ .o sequences inside the chi. 76 gene.

The chi. /D gene codes for a 26& a~ino acid 'on~ chi,inase ~hicn has 80,' ho~olog~ .o the chicinase ~ amino acid sequence (~-ide SEQ ID
5 N0.:1) bu. onl~ 34~O homolog; to ;he en~ire chitinase 1 pro.ein (~ide SEQ ID N0.:11). The gene contains one intron which is located in position 875 to 1262. The exact location of this intron is based on an alignment with the chitinase 4 cDNA SEQ ID N0.:1 (Fig. 24). The intron borders contain the consensus GT/AG sequences, The chi- 76 intron is loca~ed exactly a. the same position as the second in~ron in the chitinase 1 gene, when the amino acid sequences of chitinase 1 and chit /6 are aligned.

A TATA-box sequence (TATAAA) is located at position 378, which is 90 bp upstream for ~he ATG start codon for translation. A polY-A signal 15 ( MTAAA) is located at position 1725 in SEQ I~ N0.:5.

In a similar way a genomic clone encoding chitinase 4 was isolated.
The DNA has been partially sequenced and about 350 nucleotides of the 5' noncoding region has been elucidated. About 340 nucleotides of the coding region has been sequenced. The sequence appear from the SEQ ID
N0. 3.

Alignment of the 5' noncoding regions from the two genomic genes show boxes of homology (e.g. chitinase 4 nucleotides 14-49, 60-122, 123-135, 159-173, 174-207 and 277:328, (Fig. 26).

Based on knowledge of ehe chit 4 B15 cDNA sequence and the partially sequenced genomic chitinase 4 gene, the rest of the gene can easily : be sequenced. It is contemplated that the chitinase 4 gene co~prises at least 1 intron, probably only 1 corresponding to tha~ given in the same position as that of the chitinase 76 sequence.

` .

W O 92/17591 2 i ~ ~ 3 `~ 9 PCl/DK92/0010X
1~1 EX~PLE 6 C~RACTERIZATION OF THE ACIDIC CHITIN.~SE ISOENZ~'ME SE ~D DETER-~INATION OF PARTIAL .~INO ACID SEQ~E~CE

The acidic chi~inase SE was pu~ified as described in "Materials and ; Methods" above.

After the final purification on the Mono P FPLC column three isozymes of SE could be resolved (see Fig. 9). ~y analysis on SDS-PAGE only a sin~le prosein band for each of the isozymes could be demonstrated.
:: The same molecular weight of 29 kD was determined by SDS-PAGE. Analy-sis by isoelectric focusing an isoelectric point of approximatelY 3.0 was determined for the three isozymes of SE. This corresponds well to the theoretical isoelectric point which has been estima~ed to 3.87.

In contrast to the basic chitinases 2, 3 and 4, the acidic chitinase L5 SE was not retained on the chitin-affinity column eieher at the usual condition, at pH 8 (see "Materials and Methods") nor at hi~her or lower pH. SE did, however, readily degrade the 3H-labelled chitin. The major product of the enzymatic hydrolysis was the hexamers of chitin or higher homologous of chitin oligo saccharides.
Since the major product for chitinase 4 was the dimer, a different mode of action for SE is inferred. No lysozyme activity could be determined for SE at pH 4-9.
' .
The purified enzyme. was subjected to tryptic digestion as described in "Materials and Methods" and in Example 3 above for chitinase 4 and 6 peptides were selected. The peptides were subjected to further purification in the same manner as the tryptic peptides of chitinase 4 d~scribed in Example 3 above and the amino acid sequence of the 6 peptides were determined. The peptides were selected using the same cri~eria as the ones used in connection with chitinase 4. The amino acid sequence of these peptides are shown in Table IV. In addition.
the N-terminal amino acid sequence was also determined as shown in the Table I~.

.:

W O 92/17591 PCT/DK92/0010~
2~3~3 122 TABLE IV

.~-terminal: S-Q-I-V-I-~ -G-Q-N-G-D-E-G-5-L-~-D-T-C-`;
SE 22.5: V-L-L-S-I-G-G-G-A-G-G-~
S SE 23.0 A-D-~'-L-W-N-T-'i SE 25.1 N-N-P-P-C-Q-Y-D-T-S-A-D-N-L-L-S-S
SE 26.1 Y-G-G-V-M-L-W
SE 30.4 S-L-S-S-T-D-D-X-N-T-F-X-D-~'-L-W-N-T-~' SE 31.1 T-T-V-Q-A-N-Q-I-F-L-G-L-P-A-S-T-D-A-A-G-S-G-F-I

N-terminal: consistin~ of amino acids No's 26-46 of SEQ ID NO.:8 SE 22.5: consisting of amino acids No's 98-109 of SEQ ID NO. :8 SE 23.0: consisting of amino acids No's 121-128 of SEQ ID NO.:8 SE 25.1: consisting of amino acids No's 208-224 of SEQ ID N0.:8 SE 26.1: consisting of amino acids No's 271-277 of SEQ ID NO. :8 SE 30.4: consisting of amino acids No's 110-128 of SEQ ID N0.:8 SE 31.1: consisting of amino acids No's 229-252 of SEQ ID NO.:~

ISOLATION AND CHARACTERIZATION OF THE cDNA FOR THE ACIDIC CHITINASE
ISOENZYME SE

On the basis of the amino acid sequence of the tryptic peptides listed in Table IV two subseqùences from the peptides SE 25.1 and SE
31.1 (Table IV) were selected for the synthesis of mixed oligonucleo-tides as they had the best codons. The PCR primers KB 7 (SE 25.1) shown in SEQ ID NO.:28, KB-9 (SE 31.1) shown in SEQ ID NO.:29, and the oligo-dT primer (270) shown in SEQ ID NO.: 30, were prepared in the same manner as described in Example 4 in relation to chitinase 4.
The nucleotide sequence of the gene probes are shown in Table V.

~, .
:

:

W O 92/17591 2 i ~ ~ 3 ~ ~ PCT/DK92/0010 TABLE V

N P P C O ï D T
KB-7. ;'-GACTCTAG.~ CCGCCGTG~CAGTA~GA~AC-3' Q A ~ Q I F
KB-9. ~'-GGAGGATCCCAGGCGM ~CAGATATT-3' ~: T T

270. 5'-CCAAGCTTGAATTCTTTTTTTTTTTTTTTTTTTT-3' K3-7: shown in SEQ ID N0.:2 K8-9: shown in SEQ ID N0.:29 270: shown in SEQ ID N0.:30 A partial cDNA molecule was prepared in two steps uslng the PCR-technique and mRNA, the first step using the above mentioned primers KB7 and 270. The PCR-technique was performed as described above in "~aterials and Methods". The cDNA synthesized was isolated on LTM
agarose gel and the agarose was remo~ed with agarase. For the subse-quent PCR reaction the primers KB9 and 270 were used. The method isillustrated in Fig. 20. The product from the second PCR reaction was cloned in pUC 19 (Boehringer Mannheim) and sequenced.

The DNA sequence obtained for the partial cDNA molecule constituted by nucleotides 711-962 of the DNA sequence shown in SEQ ID N0.:7.
This cDNA was used to screen the ~-ZAP cDNA library described in "Materials and Methods" and 23 cDNA clones were obtained. The longest cDMA clone was sequenced using the method described in "Materials and ~; Methods" above and was found to be 1070 bp long. The sequence is constituted by nucleotides 37-1106 of the DNA sequence shown in SEQ
ID N0.:7. As normally observed in connection with the isolation of cDNA. the entire cDNA was found to be difficult to isolate. Rescreen-ing of the 12AP library with a 122 bp EcoRI-KpnI from the ~' end of the longest cDNA clone (SE22), gave a sequence containing the entire ~' end. The clones were ligated using tne KpnI site. The s.ructural W O 92/17~91 PCT/~K92/0010~
21 ~ 63 ~
gene has a ~' noncoding region of 17 bp. a leader sequence of 25 amino acid residues, a functional domain oi 26~ amino acid residues and a 3' noncoding region of 202 bp after ;he s;op codor.. The cDNA
sequence and ~he amino acid sequence are showr. ir. SE? I3 `;0.:, and SEQ ID N0.:~. respec.ively.

When the amino acid sequence obtained from the N-terminal and the 6 tryptic peptides (107 residues) were compared an almost 100% agree-ment to the cDNA derived sequence were observed. This demonstrates that the isolated cDNA clone codes for the SE polypeptides puriEied by the chroma~ographic procedure described above. The cDNA contains the N-terminal as well as the C-terminal end of the mature protein.
The N-terminal of the mature SE is apparen; from Table I~1.

WO 92/17591 2 1 ~ ~ 3 ~ ~ PCl~VK~2/001Q~

TABLE ~I

~D O U ~D O ~ ~D O u~ f`; O rl o o o ~ a~
N N N N N N N ~ ~
O . .
Z ~ ~ ~ ~ ~ ~ X -- U~ ~ ~ . X X
~ u u; <: a ~1: 4 a a ~
O Ul U~ ~ J J ~ L CL ~ <C U~
a (n c . o x a . ~ . J ~ 4 ~
.. J J ._1 ~~ Ul a . a e a . ~ O
Ul Ul Z . X Z X . 1~ J L ~ L . t~ U L~
a ~ o . L L ~ ~a a a ~ o Y ~
a 2 Z . Ul a ~ . ~L L L ~ Ul O I 1 4 U t:~ ~ U) tl'l 1~ h . < f- <: . a a a Z Z Z l I ~ h . Ul a ~n . o L IL ~ O L ~ . :~' h 3 O O O ~11 h I U~ U U U ~ ~ h ~1 t: ~: h 2 ~ f- . O O X . o a o I I ~n x x x :~ ~ 3 U U U ~ U tl. L L ~ 1-- < ~ . Ul Z ~' Z ~ < 10 . 3 ~ 3 ~ J ~ J ~
~ Z 1 ~ ~ h . IJ1 U~ i- . O O X . ~ ~ C C ~ E
, 4 I-- ~JZl z;~ I ~ ~ Z Z 2 ~ ~ ~ U ~
, I ~ a z z . 3 ~ 3 ~ U U
u u u ~ I x ~ u~ a . ;~
Ul 'C Ul T T X ~>' h >~ .X I ~ I h X 2 X
a :~: a . o I ~
t C ~ 2 2 2 tn ~/) U) ~' Lll U~ 1 ~ h :~ ~ Z O 3: . 4 4 0 . ~ C X
Ll tl~ L .2 2 Z i-- a :~ z u ~ . ~ ~ . x x x ~
X _I J _1 ~~ X X . S h h U~ 2 2 . 1~ 1 J .
h h U) a~ lC ~ 2 Y I I ~ 1~
(.11 ~ I L L L ~ a a a ~ e Y u~ ~ a ~n . L L L ~' a a ~ l l a <~
h tn l_) o Cl a ~ ~ h I h h . 1~ U (O ~ J ~ L L L ~
U) h h h h h ~ (11 U) U) ~a ~ a D~ ~ Q. J J J ~
~ )-I J . ~ Ul X . ~ Q ~ Z 2 ~
_~ Ul h <~ .3 3 3 ~' 2 2 ~ ~ a a a ~
h I ~ ~ J J . 1~ h h ~ ~ 'C L .
h h h ~ 0 Cl . h h ~ ~ o Q. D_ -t-- > . ¢ ~J 1.~ U L O O O o ~ ~ ~ o ~ N N
a tn u~ . ~ ~ ~ . h h ~' . ~ ~ O
X 1-1 Z Z ~ 1~ 3 > ~ > > > ~
-1 J . ~ h ~ O 1~ J J O :- Ul :~ ~ U~ Cl .
~ x ~ L~ Ll <e . ~ ~ ~ ~ ~ ~ ~ a a a - x ~ . a c~ z . L~ h ~ ~ e ~c < 2 ~2 ~2~ X X > ah a a u u x c~

_I L L I ~: L I tl: tL ` J L L ~ ~1: L ~ 4 ~ L L
r W O r ~ o r ~ o r U o :~ ~ O I: W O ~ hl o ~ m a ~ m a ~ m a ~e m a ~: m a e m a ~c m a N ~ m N ~ m N ~ m N ~ m ~ ~ m N ~ m N ~ InN U ~1: N U <: N U `e N U ~C N l) : N U C N U ~:
Ul U ~ ~) U lC Lll U ~ U ~ U : Il) O ~ U) U <1:
SE22SAML: shown in SEQ ID NO.:8 Cucumber: shown in SEQ ID NO.:31 : 5 Arabidopsis: shown in SEQ ID NO.:32 Table VI shows an alignment of the amino acid sequence corresponding to the structural gene for the acidic chitinase SE and the c~mino acid sequence of a cucumber lvsozyme/chitinase (EP O 392 225 and Métraux, REPLACEMENTSHEET

W O 92/l759l 21~ 6 3 ~ 9 PCr/D~92/00l0~

et 2i, 1989j and an Arabidopsis lvsozvme/chitinase (Samac et al..
1990)..It appears from this that there is a homology of about 45%
when all tree se~ment Ire compared. When SE is compared with the cucumber lysozyme/chitinase a homology of about 60% was observed.

5 EXA~IPLE 8 CHARACTERIZATION AND DETERMINATION OF THE PARTIAL AMINO ACID SEQUENCE
FOR THE SUGAR BEET ~-1,3-GLUCANASES 3 AND 4 The sugar beet 3-1~3-glucanases 3 and 4 were isolated from cercospora in~ected sugar beet leaves as described in the above "Materials and Methods". They are basic proteins having a strong affinity for ~-1,3-glucan. The amino acid composition of the sugar beet ~-1,3-glucanase 3 and 4 isoenzymes are similar to the one given for ~ 3-glucanases from tobacco and barley as shown in Table VII.

":
;
., .

REPLACEMENTSHEET

W 0 92/17591 ~ ? a ~ 3 ~ ~ PCT/DK~2/OOlOX

1 _, TABLE ':II

A~lino acid co~osition or tobacco and sugar beet B-1.3-vlucanases .~mino acia lobaccoa) augar beec 8 Suga~ beec 4 3arle~- Gsj) Aspartic A.35 46.4 53 4 39 Threonine 10 12.6 12.1 14 Serine 23 25.0 27.4 23 Glutamic A.20 23.4 26.7 20 Proline 19 18.4 21.7 1;
Glycine 26 27.8 32.2 31 Alanine 20 31.; 35.1 43 Cysteine 1 0 0 0.7 Valine 18 21.3 25.6 18 Methionine 7 5.1 6.6 4.8 Isoleucine 17 15.9 19.2 14.9 Leucine 23 22.7 27.0 22.1 Tyrosine 16 13.5 15.4 15.4 Phenylalanine 13 12.8 14.6 12.9 Histidine 5 3.1 1.9 1.2 Lysine 13 12.9 16.2 9.7 Arginine 12 12.7 15.0 12.9 Tryptophane 4 ND . ND ND

MW (KD) 32 32.8 37.6 32 pI 9.9 9.5 9.5 9.8 a) Data taken from Shinshi H. et al., 1983 b) From Kragh et al., 1991 YVO 92/~7591 PCT/DK92/OOlOX
~ 6 ~i3 ~ 12 SD~-PAG~ of o-1.3-g ucanase The apparen~ molecular weigh, of 3-!.3-glucanase 3 and 4 determined on a 10-15i, graaien_ SDS-gel (Phast-Svste~. ?harmaciaj were 33 and 3~
~Da, respectivelv. ~he isoelec~ric poin, was grea~er .han or equal to 9.5. ~hen analy~ed by thin laver chromatograpn~, ~he major reaction products liberated from laminarin after 24 hours of incubation with the two ~-1,3-glucanase isoenzymes 3 and 4 were the dimer, laminari-biose. This strongly suggests that the ~-1,3-glucanase 3 and 4 iso-zymes are endoglucanases.

10 Amino acid sequencing or !3-1.3-glucanase 3 and 4 The purified B-1,3-glucanases 3 and 4 were subjected to trvptic digestion using the method described in the above "Materials and Methods" and selected peptides were further purified and sequenced as described in "Materials and Methods" and in Example 3 above. The L5 peptides were selected on the basis of the same criteria as the ones used in connection with the selection of the tryptic peptides of chitinase 4 (see Example 3). The amino acid sequence of the peptides are shown in Table VIII, ::
,:

W O 97/17~9l 21 jJ 6 3 ~3 ~i~ PCr/DK92/0010~
1~9 IABLE VIII
-.~mino acid seq~ences fo~ B-1.3-glucanase 3 and 4 isolaced from sugar beet leaves ~ Peptide 3-l; W-V-Q-N-N-V-V-P-Y

: Pepti~e 3-17 (A)-G-A-P-N-V-P-I-V-V-S-E-S-G-W-P-S-A-G-G

Peptide 3-16 L-Q-G-K-V-S

Peptide 4-25.1 L-G-N-N-L-P-S-E-E-D-V-V-S-L-Y
. .
Peptide 4-26.3 L-D-Y-A-L-F

Peptide 4-27.1 Y-I-A-V-G-N-E-I-M-P-N-D-A-E-A-G-S-I-V-P-A-M-Q-N-V
(Q)-(Q)-(A)-~P)-(R) Peptide 4-28.2 W-V-Q-N-N-V-V-P-Y

Peptide 4-40.1 G-A-P-N-V-P-I-V-V-S-E-S-G-X-P-S-A-G-G-N-A-A-S-F
_ _ _ _ Pep. 3-15: shown in SEQ ID N0.:33 Pep. 3-17: shown in SEQ ID N0.:34 Pep. 3-16: shown in SEQ ID N0.:35 Pep. 4-25.1: consisting of amino acids No's 37-51 of SEQ ID N0.:10 20 Pep. 4-26.3: consisting of amino acids No's 211-216 oE SEQ ID N0.:10 Pep. 4-27.1: consisting of amino acids No's 115-139 of SEQ ID N0.:10 Pep. 4-28.2: consisting of amino acids No's 101-109 of SEQ ID N0.:10 Pep. 4-40.1: consisting of amino acids No's 249-272 of SEQ ID N0.:10 W O 92/17~91 PCTtDK9~/0010~
2~ ~3~ 130 ISOLATIO~ AND CHAR~CTERIZATION OF THE cD~;A FOR d-1.3-GL7CC~`~ASE 3 .~D

In the same manner as described above in connec~ion with S~ oli6o-nucleotide probes corresponding to peptides from the ~-1.3-glucanase 3 and 4 polypeptides were synthesized. As 5'primer was used the fol-lowing two sequences in the first round of PCR for isolation of ~-1,3-glucanase 4:

Pep. 3-15: W, ~', Q, N, N, (V)...
G
Oligoseq. TG-l: 5'TGGGTTCA~ M TCAACGT 3' (sho7~n in SEQ ID NO.:36) In the second round of PCR the following sequence was used as 5'pri-mer peptide 4-27.1 consisting of amino acids No's 120-125 of SEQ ID
NO.:10 Pep. 4-27.1: ...... N, E, I, M, P, N
Oligoseq. TG-2: 5' M TGAAATM TGCCACM ~sho7~n in SEQ ID NO.:37) T T

By comparing the amino acid sequences from ~-1,3-glucanases in barley (Fincher, 1986) and tobacco (Shinshi et al.,l988), a consensus se-quence was selected and used for construction of a 3'primer with the following consensus sequence:

Pep. seq: F,A,M,F,D/N.E.
Oligoseq. TG-3: 5'TCAT~GAM CATAGC~M (shoh7n in SEQ ID NO.:38) This sequence was used in the second PCR round whereas the 270 primer used for cloning of SE ~7as used in the first round. To isolate a 3-1.3-glucanase 3 clone~ the TG-l primer was used since peptide 4-28.2 - peptide 3-15 (see Table 7~7II in Example 8). This primer was used as the ;' primer for both ,ne PCR reac~ions. As the 3' primer. the TG-' W O 92/17591 2 ~ PCT/DK9~/0010 and 270 oligonucleotides were used ror the firs. and second round oI
PCR. respectivelv.

The resultinv PCR products were emplo!ed to screen ~he above descri-bed sugar beee cDNA ~-Z.~P library to isolace clones harboring cDNA
encoding ~-1,3-glucanases 3 and 4, respectivel~. The cDNA sequences and the deduced amino acid sequence of ~-1,3-glucanase 4 are shown in SEQ LD NO.:9 and SEQ ID NO.:L0, respectively.
.

SEROLOGICAL CHARACTERIZATION OF S~GAR BEET CHITINASES 2 AND 4 The serological relationship between chitinase 2 and 4 was analyzed by immunoblotting. When a protein sample containing both chitinase 2 (MW 32 kDa) and 4 (MW 26 kDa) was separated by SDS-PAGE before im-munoblotting the following results were observed (see Fig. 10).
Chitinase 4 antibodies detect only an approximately 26 kDa protein (chitinase 4), but not the 32 kDa protein (chitinase 2 isozyme) although it is also present on the same nitrocellulose membrane. In contrast chitinase 2 antibody recognizes only a 32 kDa protein (chitinase 2), but not the 26 kD protein of chitinase 4. This strongly demonstrates the presence of two serological different groups of chitinases. This observation is further substantiated with the immunoblotting analysis of the pure chitinase 2 and 4 antigens.
Antibodies to chitinase 4 detèct only chitinase 4, whereas antibodies directed against chitinase 2 only recognize chitinase 2 and no cross-reactivity at all was observed. The above results suggest that sugar beet contain two different classes of basic chitinases. This observation is also supported by the information obtained from the a~ino acid sequencing and the amino acid composition (see Table I in Example 3 above) of the basic chitinases 2 and 4. The difference indicates that the genes coding for chitinase 2 and 4 constitute two distinct gene families.

~`

W O 92/17591 PCT/DK92/0010~
21~3~
As far as the presen~ invencors are awarê. ;he fac, eha. two dif-feren. classes of basic sugar beet chitinases e~:is, has hither,o no~
been reported in the litera,ure.

Definition of sugar bee~ chitinase 2 class 5 When the ~-terminal amino acid sequence of sugar beet chitinase 2 was : aligned with the following chitinases from bean. tobacco, pea Al, pea A2, pea B (Vad ec al., 1991j, barley T (Jacobsen ee al., 1990), and barlev K (Kragh ee al.. 1990). a strong homology between ~hese basic chitinases were observed (see Table IXj. This suggests that these chitinases belong to the same chitinase class. This was further substantiated by serolo~ical cross reactivitv carried out with an-~ibodies raised agains~ sugar bee~ chitinase 2. This antibody recog-nized not only sugar beet chitinase 2, but in addition also chitinase P (27.j kD), Q (28.5 kD), Ch. 32 and Ch. 34 from tobacco (Bol and Linthorst, 1990), chitinases T, K and C from barley and chitinase Al, A2 and B from Pea. When antibodies raised against barley chitinase K
or wheat germ chitinase were employed, similar serological cross reactivities were observed. Therefore the chitinases described above were defined as belonging to a chitinase class serologically related to sugar beet chitinases 2, e.g. a sugar beet chitinase 2 class chitinase.

wo g2/l7s9~ 3 ~ PCT/DK92/OOlOX

T.~BLE I'~

~-terminal amino acid sequence oî chi~inase isozvmes belonFin~ ~o the sugar bee~ chi.inase 2 class:

Chitinase 2 ELCGNQAGGALCPNGLCCSQYGWCGNTNP'YCGN
Bean EQCGRQAGGALCPGGNCCSQFGWCGSTTD'YCGP
Tobacco EQCGSQAGGARCASGLCCSKFGW
Pea B EQCGRQAGGATCPNNLCCSQYG~' 10 Pea Al EQCGNQ~GGXVPPNG
Pea A2 EQCGTQAGGALCPGGL
Barley K EQXGSQAGGATCPNXLCCSRFG
Barley T XQQGSQAGGATCPNXLCCSXEGW

Chieinase 2: shown in SEQ ID NO.:27 Bean: consisting of the amino acids No's L-33 of SEQ ID NO.:25 Tobacco: consisting of the amino acids No's 1~23 of SEQ ID NO.:26 Pea B: shown in SEQ ID NO.:41 Pea Al: shown in SEQ ID NO.:42 Pea A2: shown in SEQ ID NO.:43 Barley K:: shown in SEQ ID NO.:44 Barley T: shown in SEQ ID NO.:45 Definition of a sugar beet chitinase 4 class When antibodies raised against sugar beet chitinase 4 was employed, ncne of the chitinases from the chitinase 2 class described above could be recognized. Chitinase 4 from sugar beets thus belongs to a new chitinase class so far not detecsed in other plant species than sugar beets. However, recent studies have indicated that chitinases belonging to the same new class exist in rape seed. Thus, protein extracts of rape seed obtained by a method similar to the one out-lined above for sugar beet chitinases were shown to react with the above mentioned polyclonal antibodies directed against chitinase 4 from sugar beets (see Rasmussen et al.. 1992 : ' ' ' ~ ; ' '' ' :' W O 92/17591 PCT/DK9~/OOlOX
~ ~ ~ 6~ 3 l EX~IINATIO~ OF T~E HO.~OLOG~ BETWEE`l TH_ CHITI`;ASE 4 cD~ OTHER
CHITINASES USING THE H~BRIDIZATIO~ TECH~IQEE

Besides examining the homology between the mature enzymes, the homol-ogy between the cDNA encoding the chitinase 4 enzyme and DNA encoding other chitinase enzymes was examined using the hybridization techni-que described in the above "Materials.and Methods" under the heading "Identification of DNA belonging to the chitinase 4 gene family".

It appears from Fig. 11 that there is a very low de~ree of homoIogy examined at 55C between the cDNA encoding the sugar beet chitinase 4 enzymes and DNA encoding chitinases from other plants such as pea, tobacco and beans as well as DNA form sugar beet encoding the chiti-nase 1 and SE enzymes. These results therefore further indicate that the chitinase 4 enzyme belongs to a new class of chitinases, The high degree of homology between the cD~A encoding the chitinase 4 enzyme and the DNA encoding the chitinase from rape seed chitinase shown by the high degree of DNA hybridization further indicates that the genes encoding chitinase 4 in sugar beets and the genes encoding the chitinases in rape seed are significantly homologous and thus belong to the same gene class, This is supported by the results disclosed in Example 10 showing a high degree of serological homology between the mature enzymes from the two plants.

TRANSFORMATION OF BACTERIA CELLS

2~ Agrobacterium tumefaciens (the strain LBA 4404, Ooms et al., 1982) was transformed with the plant transformation vector, pBKL4K4. the preparation of which is described in Example 18. using a freeze/thaw method essentially as described by An et ai, (1988). For the freez-e/thaw method the bacteria ~o be trans~ormed were cultiva.e~ in LB-W 0 92/17591 ~ ~ ~ 6 3 ~ ~ PCT/D~92/OOlOX

medium, pH 7.4, overnight at 28C, 280 rpm. The next day the bacteria ; were subcultivated in 50 ml of LB-medium. pH 7.~. and grown for aboub4 hours until OD 600 (OD600) was 0.~-1Ø The cul~ure was cooled on ice and cenerifuged for ~ minutes a~ 10.000 ~: g a 4C. The superna-tant was removed and the bacteria were carefull~ suspended in 1 ml of icecold 20 mM CaCl2. 0.1 ml of the bacteria suspension was pipetced off in icecold crvo tubes and the bacteria were frozen in liquid nitrogen and maintained at -80C.

For transformation of the bacteria 1 ~g of plasmid DNA was first added to a cryo tube with the frozen bacteria. The bacteria were incubated in a 37C water bath for ~ minutes, 1 ml of LB-medium, pH
7,4, was added to the cryo tube, and the mixture was incubated for 4 hours at room temperature using mild agitation (agitation table, lOO
x rpm). The cryo tube was centrifuged for 30 sec. at lO.OOO x g, 4C.
The supernatant was rernoved and the hacteria were resuspended in 0.1 ml of LB-medium, p~ 7,4. The bacteria were plated on to a YMB^dish with 50 mg/} kanamycin and incubated for 2 to 4 days at 28C until colonies appeared. The presence of a proper plasmids in the bacteria are verified by restriction analysis of the extracted plasmid prior to the use of the bacteria in the transformation of the plants.

In a similar manner, bacterial transformation with other genetic constructs of the invention may be performed, e.g. as shown in Figs.
17, 18, 19, and 22 and explained in Example 18.

PREPARATION OF GENETICALL~' TRANSFORMED TOBACCO (~icotiana benthamiana and N. tabacum) PLANTS

Plant material Leaves from plan~s to be geneticall~ cransformed were obtained from plants grown in vitro or in vivo. In the latter case, the leaves were sterilized prior to transformation. Sterilization was performed bv placin~ the ieaves ior 20 min. in a solution of J7/. Ca-hvpochlori;e W O 92/17591 PCT/DK92/OOlOX
2~ ~3~9 , containing 0.1 ml Tween 80 per l îollowed by washing ~ ~imes in sterile water. In vicro plants were grown in containers on 1/2 shoot inducing medium (1/2 MS) (Murashige & Skoo~, 1962).

The leaves were placed one a~ a time in a 14 cm Petri dish. Thev were then cut into squares of abouc 1 cm . all 'l sides consis.ing of tissue which had been cut. Any cut tissue which had been bleached by hypochlorite sterilization was removed.
' Cultivation of bactèria 24 hours before transformation a suspension of Agrobacteria transfor-med as described above was started bv inoculating 2-3 ml media with appropriate antibiotics wi~h the transformed Agrobacteria. The bac-teria are grown at 28C with agitation (300 x rpm).

Transf ormacion Transformation of the plant was done essentially as described by R.B. Horsch et al. (1985). The bacteria culture was diluted 50x with 1~10 MS immediately before transformation. Approximately 10 ml of the diluted bacteria suspension was poured into a 9 cm Petri dish, and the leaf pieces were dipped in this suspension for about 15 min. The leaf pieces were then removed and excess bacteria suspension was removed with sterile filter paper.

Co - cul tivacion The day before transformation co-cultivacion Petri dishes containing 1/10 MS mediu~ were coated wieh acetosyringone (200 ~M). On the day of transformation a piece of sterile filter paper was placed on the co-cultivation dishes, and the leaf pieces which had been dipped in ~; the bacceria suspension were placed upside down on the filter paper.The leaf pieces were incubated in a growth chamber in weak light, e.g. 12 hours of light and 12 hours of darkness for 2-3 days.

SU~STITUTE SIIEET
ISA/EP

W O 92/17~91 21 v ~ 3 ~ 9 PCT/DK92/0010X
1~7 ~election/regeneration The leaf pieces were transferred to Petri dishes containin~ shoo.-inducing MS-medium with 300 mg/l of kanamvcin and 800 mg/l of carbe-~ nicillin and sub-cultivated every 4 weeks tD the same medium.

; 5 Shoots which appear on shoot-inducing MS-medium 300 k/c dishes were transferred to containers with 1/2 ~SO 300 k/c. The-shoots were sub-cultivated when needed. After approximately 2 weeks, the expression of the B-glucoronidase activity using the GUS-assay (see "Materials and Methods") was performed on the leaf tips of green shoots.

Planting ouc Genetically transformed shoots formed roots and the resulcing plants which were GUS-positive were planted out in a growth chamber in water soaked compost. They were then covered wi.th plastic bags and grown for about 1 week, after which the two corners of the plastic bags were cut off. After another week the plastic bags were removed.

PREPARATION OF GENETICALLY TRANSFORMED SUGAR BEETS PLANTS BY MEANS OF
TRANSFORMATION WITH BACTERIA

Transformation was carried out using cotyledonary explants as de-scribed below. Seeds were germinated for ~ days in darkness on a substrate containing 0,7 g/l of agarose and 2 g/l of sucrose. The seedlings were then transferred to a Nunc container, containing 1/2 - MS substrate and cultured for 3 days in the light. The cotvledons were re~oved from the seedling, and the cotvledon explants were then brushed on the petiole with a small brush containing a suspension (OD
660-1,0) of Agrobacterium transformsd as described above in Example 12. Ihe cotyledons were chen co-cultivated for 4 davs on a substrate containing 1/10 MS substrate. The transfor~ed explant were trans-ferred to a MS subs~rate supplemented with 0,2j mg/l of BAD. 400 mg/l of ~anamvcin. 800 mg/l of carbenicillin and 500 mgjml of cero-. . .

W O 92/17~91 PCT/DK92/OOlOX
2~ ~3`~ 138 taxime and the e~plan~s were incubated for 14 davs on this substrate.
The regenerated shoots were then transferred to containers with MS
containing 0.2; mg/l of BAP. 400 mg/l of kanamvcin, and 800 mg/l or : carbenicillin as the substrate. The isolated shoots were transferred to fresh substrates with 4 weeks intervals ror selection and multi-plication. Selected shoots were rooted on 1/2 MS substrate containing l mg/l IBA.

Tissue from tobacco have been transformed with a genetic construct containing either chitinase 1, chitinase 4, chitinase 76 and acidic chitinase SE and the selective markers, NPT-II and GUS. Selection of the callus and shoots on kanamycin has proved that the obtained tissue expresses the GUS marker and thus that the transformation has occurred.

ANALYSIS OF CHITINASE AND ~-1,3-GLUCANASE IN TRANSGENIC PLANTS

The expression levels for chitinase and ~-1,3-glucanase isoenzymes can be evaluated either by measuring the total enzyme activity by the two radiochemical assays, by measuring the antifungal activity using the biological methods I-III or by measuring the level of the dif-ferent isoenzymes by immunoblotting using specific antibodies, all ofthe methods being described above in "Materials and Methods". The final test of the resulting transgenic plants is the analysis of eheir degree of resistance to phytopathogenic fungi using the infec-tion system described in "Materials and Methods".
.; . ' ' .
Using the biological methods I-III, the antifungal activity of the enzymes in the genetically transformed plants can be determined. A
retarded growth of the fungi hyphae shows that the transformation has resulted in a plant having an improved tolerance i.e. an increa-sed antifungal activitY to the phytopatogenic fungi compared to a ~ 30 non-transformed plant.
:

W 0 92~1759l 21 7U ~ ~ ~ 3 PCT/DK92/0010 In the radiochemical assavs. 3H-chitin or 3H-laminarin are used as substrates for either chi~inase or B-1,3-glucanase, respectively.
Using standard curves of producc formation vs. enzyme amount, the activit~ for both chitinase and ~-1,3-glucanase in crude plan~ e~-tracts can be determined. This is illustrated further in a time course experiment where the level of either chi.~inase (Fig. 12a upper part) or ~-1,3-glucanase (Fig. 12b lower part) is quantified in sugar beet leaves at specified time intervals after infection with C.
beticola . Although the enzyme level of both the chieinase and the ~-1,3-glucanase is very low in the control plant it is readily determined by the very sensitive radiochemical techniques. In the infected plants, an enhanced production of both enzymes was first observed 8-9 days after the infection with the fungal pathogen.

With these techniques, the constitutive level of chitinase as well as ~-1,3-glucanase in transgenic plants can easily be recorded.

These techniques, however, do not differentiate between the various chitinase and ~-1,3-glucanase isozymes. Only the total enzyme ac-tivities for all the chieinase or all the ~-1,3-glucanase isoenzymes are determined. However, the presence of the various chitinase and ~-1,3-glucanase isoenzymes can easily be detected separately by analyz-ing the crude protein extracts by immunoblotting after separation by SDS-PAGE.

The antibody to ~-1,3-glucanase 3 recognized only one single protein in the Cercospora infected leaf material (Fig. 13). In contrast, no antigen was detected in the control leaves. This is in agreement with the low constitutive level of expression observed in control plants for ~-1,3-glucanase using the radiochemical assay. When antibodies raised against either chitinase 2 or 4 were employed, two major protein bands were induced in the infected leaf tissues. Chitinase 2 antibodies detect a 26 and a 32 kDa band, whereas two proteins having molecular weights of 29 and 26 kDa were observed with the chitinase 4 antibody. When purified chitinases were analyzed by SDS-PAGE and immunoblotting, the protein bands recognized bv chitinase 2 antibod-ies were chitinase 1 (26 ~Da) and chitinase 2 (32 kDa), respectivel~.
3~ Similarly, the antibody .o chitinase 4 detec~ed the authentic chi_in-W O 92/17591 PCT/DK92/OOlOX
3~3 1l~
ase antigen (26 kDa), but in addition also the SE antigen (2~ kDa).This was unexpected since no amino acid sequence homolog~ between chitinase ~ and SE has been observed (see SEO ID ~TO, 2 and SEO ID
NO.:8). The "3-D" scruc~ure or chicinase ~ and SE on the nitrocel-lulose membrane mav crea,e sufficien. epitope recognition .o allo~
the antigen-antibod~ interaction between the SE antigen and ~he chitinase 4 antibody. The reaction between the SE antigen and the chitinase 4 antibodv was onlv pronounced when the antibodv solution is diluted l:lOO or l:200. A much weaker reaction was observed when the antibodv is diluted l:oOOO or l:lO.OOO.

Transgenic tobacco plants (Nicotiana cabacum and/or N. benchamianaj were transformed with either chitinase 4, chitinase ~6. the acidic chitinase or chitinase 4 + the acidic chitinase. After selection on kanamycin and regeneration, the transformed plants were examined with respect of i) GUS activity, II) expression of chitinase genes, and iii) degree of resistance agains~ C. nicociana or R. solani. The transgenic plants expressed GUS-activity in variable amounts. Only plants with high GUS-activity were subjected to further analysis. The expression of the chitinase gene products were analysed by immunoblotting using the ECL-system described in "Materials and Methods" and the antibody raised against chitinase 4. In leaf extract from N. benchamiana, transformed with only NPT and GUS, no protein band could be detected by this antibody (see Fig. 23, lane "C").
Transgenic plants containing the constructs, the acidic chitinase, the genomic chitinase 76, chitinase 4, and the double gene construct chitinase 4 + the acidic chitinase, showed a strong positive reaction (see lanes SE, K76, K4, K4 + SE, respectivelv). To evaluate the level of expression lO pg of chitinase 4 isolated from sugar beet was included, lane Std in Fig. 23.

~ broad protein band was observed in extracts from transgenic plants with the chitinase 4 or chitinase 76 gene constructs. When smaller amounts of proteins were applied to the various lanes of the SDS-PAGE, this band could be resolved into three distinct protein bands.
having MW of 29, 26 and 25 kD, respectivelv. The reasons for the triple bands are not known at present. It is. however, contemplated ~ha~ chi, nase is i`! no. crocessed given rise ~o a crotei~.

. .

W O 92/17~91 21~ ~ 3 ~ 3 PCT/DK92/~010~
1'11 maintaining the signal pepcide = ~he 29 ~D band. ii) cleaved a. ~ne normal processing site at the amino acid sequence Leu Val ~al Ala -Gln Asn C~s in chicinase 4 (amino acid position 23-2~ in SEO ID
NO.:2) given rise to the 26 kD pro~ein band. and iii) a second ; putative tobacco processing site is localized a; .he amino acid sequence Ala Ser Ala Ser - Cys Ala (posi~ion 85-86 in SEQ ID NO.:',.
This cleavage site may give rise to the 25 kD polypeptide band. In addition to malfunctinal processing of sugar beet chitinase 4 in transgenic tobacco, the translocation of chitinase 4 was inhibited.
In sugar beet~ this basic chitinase 4 is deposited in the extracellular space. In transgenic tobacco, cvtochemical analvsis~
demonstrate clearlv that sugar beet chitinase 4 is localized intracellularlv.

Preliminary experiments to examine the degree of resistance of eransgenic tobacco planCs against R. solani and C. nico~iana have been performed, The cransgenic plants with the chir,inase 4 (10 plants) and chitinase 4 + the acidic chitinase (4 plants) showed less disease symptoms, whereas the control plants (10 plants) containing the GUS and NPT genes were severely infected with C. nicoeiana.

When seeds of ~. tabacum containing the chitinase ~ gene construct were germinated in R. solani infected soil, the survival and growth were improved as compared to the seed from non-transgenic plan~s.

SIS

Site directed mutagenesis on a DNA sequence encoding the sugar bee.
chitinase ~, e.g. the chitinase 4 gene~ mav be carried out bv use of PCR reactions (described in "Materials and Methods" under the heading "PCR used in the cons~ruction of genetic constructs of the invention and in site-directed mutagenesis on the basis of cloned DNA templa-tes") using specific 3' and 5' primers for each site directed mutage-nesis. The cnoice of the specific ~' and ,' primers ~o 'De used aepenc W O 92/17~91 PCT/DK92/0010~
21~63~9 1,2 on the position in the DNA sequence in which the modification is to be carried out.

Tvpically, suitable amino acids ~o be modified. either bv subs i,u-tion, deletion or insertion are selec~ed on the basis of an analvsis of the amino acid sPquence of the mature chitinase 4 enzyme, op-tionally in combination with an analysis of the enzyme's 3-D struc-ture. Especially amino acids forming part of the active site of the enzyme or of epitopes thereof as well as amino acids of importance for substrate specificitv and substrate binding are of interest in this connection.

The active si~e or sugar beec chitinase 4 The position of the essential amino acid residues included in the active site of chitinase 4 have been tentatively identified by the following observations. Firstly, recent investigations with barlev chitinase C demonstrated that chemLcal modification with carbodiimide and N-bromosuccinimide (NBS) completely inhibits the enzymatic acti-vity (results not shown). Similar experiments carried out with gluco-amylase from Aspergillus niger ~Sierks ee al.,1990) have elucidated `~ the mode of action by which carbodiimide and NBS inactivates this enzyme. Carbodiimide is covalently linked to the three essential acidic groups (glutamic and aspartic acid residues) constituting the catalytic site of &lucoamylase. NBS oxidizes Trp residues important in either stabilizing the transition state intermediate of the cata-lysis or Trp residues involved in substrate binding at a distance from the catalytic site. The experiments with chitinase C indicate that three acidic and two Trp-residues are very important constitu-ents of the active site. Secondly, by comparison co the active sites of other enzymes which hydrolyze oligosaccharide chains includin& the glucoamylase described above, the active site of chitinase 4 is contemplated to be constituted by amino acid residue 183 (Asp) and 189 (Glu) in SEQ ID ~O.:l (corresponding to amino acid residue 184 and 190 in the amino acid sequence encoded by the genomic chitinase amino acid sequence. The number given below in brackets deno~es the number of the amino acid from the correspondin& amino acid sequence 3~ encoded b; ,he genomic chi,inase _!. In con~ras~. chi.inase C from W O 92/17591 2 ~ ~ ~ 3 ~ 3 PCT/DK92/0010~
1 '1 3 barley and 2il other plan; chitinases of the same serological class (the sugar bee~ chitinase 2 class~ have three aspartic acid residues ("corresponding to amino acid residues 183 18a and 19'1 o~ chitinase 'I (SEQ ID ~0:2)~ in the ac~ive si,e (184. !~0 and 19~. respecci.el~
The positio~ o~ ~he ~wo impor~an~ Trp residues invoived in the ac.i:e site of chitinase C have not been elucidated. Since chi~inase 4 onl.
contain three Trp residues in contrast to the 6 present in chitinase C, the important Trp residues may be more easilv identified in chiti-nase 4.

10 The two acidic residues 183 Asp and 189 Glu of SEQ ID ~0:2 (1&4 and 190, respectively) forming the active site of chitinase 4 is contained in the peptide ~-22: SIGFDGLNAPETVANNAVTAFR. Important Trp-residues of the active si~es mav be contained in peptide 4 - 19 . 3:
~PLQITW and peptide 4-26: TAFWFWMNNVHSVIVNGQGFGASI.

The active site of the chitinase 4 differs froM the active sites of other plant chitinases, e.g. tobacco, which has the following corre-: sponding amino acid sequences AIGVDLLNNPDLVATDPV shown in SEQ ID
NO.:46, GPIQIS~ shown in SEQ ID N0.:47 and SALWFWMTPQSP shown in SEQ
ID NO.:48 ~Shinshi et al., 1987~, and it would be interesting to look at the specific amino acids residues of chitinase 4 which differ from the corresponding amino acids residues of tobacco in order to obtain further information about the active site and possibly identify suitable modifications resulting in improved properties of the modified enzyme. The acidic amino acid residues and the Trp residues are contemplated to be particularly interesting in this respect.

Accordingly, an interesting modification is one in which the glutamic acid in position 189 (190) is substituted with aspargine and/or the aspartic acid in position 183 (184) are substituted with glutamine.
Changing the carboxyl groups Asp 183 (184) to Asn and for Glu 189 (190) to Gln in chitinase 4 are in itself expected to have a negative influence on the enzymatic activity. but is contemplated to result in further knowledge of the mode of action of the chitinase enzyme.

W O 92/1759l . PcT/~K92/OOlOX
l44 2~3~
The substitution of Trp in pOSi~ions 169. 204 and 206 ,1,0 '05 and 207. respectivelY) to Tvr mav change ~he binding of the substrate (chitin) to the catalvtic site and perhaps the substrate specificit~. The scheduled substi~u~ion given above is oniv snown as examples~ and numerous changes is inferred to achieve a more potent antifungal chitinase. This mav be accomplished b~ site-airected mutagenesis e.g. using the method outlined below.

Site directed mutagenesis For all the PCR reactions suggested here primers are chosen either themselves containing restriction sites or being located near re-striction sites in a manner creating the possibility or e~changing the PCR product with a corresponding sequence in the gene bv restric-tion enz~me digestion followed bv ligacion of the relevan~ fragments.

The 5' primer to be used in the following examples i5 termed SD 0 (see FLg. 14). The number in brackets denotes the number of the corresponding amino acid residue encoded by the genomic chitinase 4 DNA sequence.
:.
When Trpl69(170) of the chitinase 4 amino acid sequence is to be substituted by the amino acid Tyr. the following procedure mav be carried out:

For the PCR reaction the 3' primer SD1 is used (see Fig. 14).

The resulting PCR product (from bp 301 to 538) is digested wich BamHI
and PvuII and interchanged with the corresponding fragment of the chitinase 4 gene by conventional methods (Sambrook e~ al., 1989).

When Glu189(190) is to be substituted with the amino acid Gln. the 3' primer SD2 is used (Fig. 1~

When Aspl83(184) is to be substituted with the amino acid Asn. the '' primer SD3 is used (Fig 14).

SUBSTITUTE SHEET

W O 92/1759l ~ 1 ~ 6 ~ ~3 ~ PCT/DK92/~OlOX

Ihe PCR products are digeseed with BamHI and BspMII and ineercnanged with the BamHI-BspMII fragment of the chitinase 4 gene in a similar manner as described àbove for e~change of Trpl69(170).

When Trp206(207~ is to be subs~i.uted with the amino acid T~r. ~he ~' 5 primer SD4 is used (Fig. 14).

When Trp204(205) is to be substituted with the amino acid Tvr~ the 3' primer SD5 is used (Fig~ 14)~

PCR products are digested with BamHI and BalI and interchanged with the BamHI-BalI fragment in the chitinase 4 gene as described above.

In a similar manner. other desirable modifications mav be carried out.

~ CONSTRUCTIONS OF GENETIC CONSTRUCTS WITH SUITABLE C-TERMINAL EXTEN-: SION

}5 C-terminal amino acid sequences found in connection with various plant chitinases and glucanases are exemplified in the specification and are believed to prove useful in modification of one or more of the antifungal enzymes encoded by the genetic constructs according to the present invention which do not comprise a C-terminal e~tension so as to allow these enzymes to be translocated to the vacuole~

The C-terminal e~tension may be introduced in the DNA sequences encoding one or more of the antifungal proteins of the invention bv anv suitable technique such as PCR~

Fig. 15a illustrates the sugar beet ~-1,3-glucanase cDNA with a 2~ tobacco C-ter~inal e~tension which is underlined in the figure.

"' ' ' , : ' :, ' .
:. ' " - ' .

W O 92/17~91 PCT/DK92fOUlOX
2~ 'J 146 Fig. 15b illustra~es PCR primers wnich can be useà .o cnange ~he stop codon and tO introduce a par, or the C-~erminal exaension. a DraI site i5 created at ~he 3' end.

Fig. 15c illustra~es 4 annealed svnthetic oli~onucleotides con~aining the last part of the C-terminal extension. a saop codon. a SmaI site and an EcoRI site.

: The C-terminal extension can be introduced by exchanging the XbaI-EcoRI fragment in the ~-1,3-glucanase gene with the PCR product digested with XbaI and DraI and the annealed synthetic oligonucleo-tides digested with SmaI and EcoRI using con~entional meGhods (Sam-brook ec al., 1989).

Fig 16a illustrates the chitinase 4 gene with a eobacco C-cerminal extension (the underlined sequence in the figure).

Fig 16b illustrates PCR primers which can be used to introduce a SmaI
~ 15 site near the stop codon in the chitinase 4 gene.

Fig 16c illustrates four annealed synthetic oligonucleotides contain-ing the sequence for the C-terminal extension, a changed stop codon, a SmaI site and a EcoRI site.

- The C-terminal extension can be introduced by exchanging the BamtlI-EcoRI fragment with the PCR product digested with BamHI and SmaI and the annealed synthetic oligonucleotides digested with SmaI and EcoRI
likewise using conventional methods.

Likewise other C-terminal sequences like the ones exemplified in the description can be added to the chitinase 76, chitinase 4. SE and B-1.3-glucanase sequences. The N-terminal sequence mav in a similar manner be exchanged with other N-terminal sequences. Of particular interest mav be the N-terminal sequence of chitinase 1 showm in the SEQ ID NO.:12, the N-terminal sequence of the acidic chitinase SE
shown in SEQ ID N0.:8, the N-terminal sequence of chi~inase 4 shown in SEQ ID N0.:~. the N-~erminal seauence or chitinase /~ sho~m in SEQ
ID N0.:6. and the N-~erminai sequence o. ~ lucanase sno~m. in SEQ
SUBSTITUTE SHEET
. ISA/EP

W O 92/17591 ~ J ~ 3 s3 ~ PCT/DK~/0010 ID NO.:10. Other interesting ~-terminal sequences o~ the mature protein may be the ones shown in Table III. or in Table IX. or the proline rich region from ehe sugar beet chitinase l shown in SEQ`ID
NO.:l.

Genetic constructs The excised recombinant pBluescript containing the chi~inase 4 cDNA
gene (B15 chitinase 4) was subcloned in order to supply the gene with an enhanced 35S promoter and a 35S terminator. This construct was transferred to the plant transformation vector pBKL4 containing a NPTII and a GUS gene. pBKL4 is a derivative of the A. tumefaciens Ti-plasmid pBIl21 ~Bevan et al., 1984), in which the genes between the left and right borders have been replaced with the following genes~ -glucoronidase (GUS) from E. coli equipped wieh a CaMV 35S
promoter and a Nopaline Synthase terminator (NOS) and 2) Neomycin phosphotransferase (NPT) from E. coli equipped with a CaMV 35S
promoter and an Octopine Synthase (OCS) terminator.

More specifically, a PCR amplification reaction was performed in order to introduce the ATG site, a ribosome binding site and two restriction sites (HindIII and BglII) 5' to the cDNA sequence.

The oligonucleotide KB3 (shown in SEQ ID N0.:49):
(5 CCG M GCTTAGATCT M AC M C M CATGTCTTCT(TC~T(Tc)GGACC3 ) containing the two restriction sites, a ribosome binding site. the ATG (underlined) and the first 15 nucleotides of the Bl5 chit 4 clone (nucleo~ide 8 and l0 were mixed (TC) nucleotides due to the fact that the KB3 primer was used for the chit 76 clone as well) was used as the 5' PCR primer and the oligonucleotide KB4 ,~.

W O 92/17591 P~TiDK92t00l0X
2 ~ , 148 The oligonucleo~ide KB4 (shown in SEQ ID NO.:50):
(; GCACACGTAGCGCTAGCTTGG3 ) ~-x 261 ~heI 241 was used as the 3' PCR primer (nucleotide 255 and ~56 was interchan-ged in order to destroy the second NheI site).

The PCR product was extracted twice with phenol and twice with chlo-roform and EtOH precipitated. After resuspension in H2O the DNA was digested with HindIII and NheI. The HindIII-NheI fragment from pB15 chit 4 was exchanged with the HindIII-NheI PCR fragment (Fig. 17).

The construct was sequenced with the T7 sequencing primer (correspon-ding to the pBluescript T7 promoter) and primer 340 (shown in SEQ ID
NO..51):

340:(CATCGGAGGATCCACTACC) 1 l and it was confirmed that the entire exchanged sequence was correct.
Furthermore, in the 5' sequence the original nucleotide 8 was a T and nucleotide 10 was a C as in the pB15 chit 4 clone and both the NheI
20 sites at position 24S and 251 were still present.

The construct was digested with EcoRI and a fill in reaction was performed with Klenow enzyme in the presence of dATP and TTP, the construct was further digested with BglII after removal of the Klenow enzyme. The DNA fragment BglII-EcoRI containing the entire chitinase 4 sequence was cloned into the vector pPS48 containing an enhanced 35S promoter and a 355 terminator. The chitinase 4 gene was inserted in the correct orientation by digesting the pPS48 vector with BamHI- ~
SmaI (Fig. 17). The chitinase 4 gene with the enhanced 355 promoter and 3;5 terminator was transferred to the plant transformation vector 30 pBKL4 (Fig. 17) as a HindIII fragment (Fig. 17). The resulting vec-tor, pBKL4K4, harboured in an E. coli DH5u has been deposited with the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH.
Mascheroder Weg lb. D-3300 Braunschweir (DSM) on 30 July. 1991 under W O 92/t7591 21~ 5 3 `3 ~ PCT/DK92/001~X

the provisions of the Budapest Treaev under the accession number DSM

The SE gene was then introduced into the constnlct pBKL4K4 (Fig.
17). A lull length SE gene was constructed by combining the 5' end ; of the gene from the pSurl clone (EcoRI-KpnI) with the rest of the gene from pSE22 (KpnI-HindIII) in the cloning vector pUCl9 (Fig.
18). The SE gene was subcloned in the SmaI site of pPS48 as a EcoRI-HindlII fragment filled in with Klenow polymerase in the presence of all four nucleotides. The orientation of the gene with respect to the enhanced 35S promoter and 35S terminator was examined by restriction enzyme analysis and further confirmed by sequence analvsis.

The SE gene with the enhanced 35S promoter and 35S terminator was cloned in the KpnI site of pBKL4K4 as a HindIII fragment in the presence of a HindIII-KpnI adapter (Fig. 18). The HindIII fragment was furthermore cloned in the HindIII site of pBKL4.

Similarly to the chitinase 4, the chitinase 76 gene was cloned in ~ pBK~4 (Fig. l9).

;~ In a similar manner, the glucanase gene can be introduced into the construct pBKL4, pBKL4K4, pBKL4KSE, or pBKLKK4KSE (Fig. 22).

The full length cDNA clone (SEQ ID N0.:9) was digested with EcoRI and BglII, the sticky ends were filled in with Klenow polymerase in the presence of all four dNTP's. The glucanase gene is then subcloned in the SmaI site of pPS48Mod. The orientation of the gene with respect to the enhanced 35S promoter and the 35S terminator, respectively, may be examined by restriction enzyme analysis and further confirmed by sequence analysis.

The glucanase gene with the enhanced 35S promo~er and the 35S termi-nator is cloned in ~he EcoRI site of pBKL4, pBKL4K4, pBKL4KSE.
pBKL4K4KSE.

WO 92/17591 PCl /DK92/0010X

21~ S 31~ ~ Sl~Ul~NOE LISr~

(1) GENE~ ~FO~0N:
(i) APPLl:C~Nr: Dalgaard MiXkelsen, Joe~n Bojsen, ~
Nielsen, Klaus K.
~erglund, Lars (ii) ll~E OF INV1~110N: A plant chitinase ger~ and use thereof (iii) N~ER OF SEQUI~CES: 21 (iv) OO~DENCE AD{~RESS:
(A) ADDR~;SEE: Pla~ra~ & Vir~toft (B) ~ ct Annae Plads 11 (C) crrY: Cc~hagen (E) C~RY: D~rnnark (F) ZIP: DK-1021 (A) MEDIt~I IYPE: Floppy disX
(B) ~: I:~M PC cc~atible (C) OPERArING SYSTEM: PC-DOS/MS-DOS
(D) SOFIW~RE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT AEPIICAIqON DAIA:
(A) APPIIC~IION N1~3ER:
(B) FILING D~IE:
:' (C) CL~S~CAllO~a:
;

: (A) N~ME: Plougmann, Ole (C) REFERENOE/D0CKET NUMBER: 32975IMK~/SPK
( ix) IE IEI CMYL NICAIION INFORM~IION:
(A) TELEP~oMB: 45 33 11 05 66 (B) TELEF~X: 45 33 11 18 87 (C) TELEX: 18333 (2) INFORM~IION FOR SEQ ID N~
(i) S~OE: CHP~AC~R[ST~CS:
(A) LENGI~: ~66 ~ase pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: d~uble (D) TOPOLDGY: linear (ii) 210LBaLE TYPE:: ~ (gen~mic) (vi) ORIG~L SO~OE:
(A) ORGANISM: Beta vulgaris ~B) SrRAlN: nova (F) llSSUE TYPE: leaf (vii) ~ SO~:

REPLACEMENTSHEET

2~ ~3;a9 (A) LIE~ARY: sugar beet laIr~da Z~P cD~ li~rary (B) CI~ B15 chitinase 4 cDNA clone (ix) E~II~E:
(A) N~ME/KEy: CDS
(B) ~ON: 2 . . 793 (xi) SE:Q~OE DE~CRIPIION: SE2 ID NO:1:
G TCr I~r ITC GGA CCA ArC lTr GCC A~ CI~ AIG GCA CTr G~ ~ 46 Ser Ser Phe Gly E~o Ile Phe Ala Ile Leu r~et Ala ~u Ala C~s A~ IY~ AGC ACC C~A GIT G~G GCT CA~ AAC 1~ GGA 1~ GCC 1~ A~r 94 Met Ser Ser Ihr TPU Val Val Ala Gln Asn Cys Gly Cys Ala Ser Asn TrA ~;T TGr AGC CGA TIT GGT T~C T~r GGC TCC AC~ GAC GCC TAC TGC 142 Leu Cys Cys Ser Arg Phe Gly Phe Cys Gly Ser mr Asp Ala Tyr Cys GGC GAG GGG T~C AGA GAA GGI c~r T~r AGA ~ CCG TCT AGT GGT GGr 190 Gly Glu Gly Cys Arg Glu Gly Pro Cys Arg Ser Pro Ser Ser Gly Gly GGI TCC GI~; TCG AGT 'Il~; GTG ACC GAT GCG ITC m AAT AGG ATC AIT 238 Gly Ser Val Ser Ser Leu Val Thr Asp Ala Phe Phe Asn Arg Ile Ile AAC C~A GCr AGC Gt T Al;C TGr ~r GGr A~G A~ TrC TAC ACC A~;G G T ~ 286 Asn Gln Ala Ser Ala Ser Cys Ala Gly Lys Arg Phe Tyr Thr Arg Ala GCC TIT 11~ A~T GCT CTC AGA m TAT CCC CAG m GGT AGT GG~ TCC 334 Ala Phe Leu Ser Ala Leu Arg Phe Tyr Pro Gln Phe Gly Ser Gly 5er TCC GA~ GTC GrT AGG CGr G~ GTr GCr GCA TrC m GCC CA~ GTC ACC 382 Ser Asp Val Val Arg Arg Glu Val Ala Ala Phe Phe Ala His Val Thr C~T GAA ACr GGA CAr TTT T&C TAC ATA GAGa G~G ATT GCA A~G TC~ ACC 430 His Glu ~rhr Gly His E~e Cys Tyr Ile Glu Glu Ile Ala LYS SEr Thr TAT I~I' CAGa TC~ A~ Gl 2!~ m CCA ~GC AAC CC?~ ~ AAG CAA TAC 478 Tyr Cys Gln Ser S~r Ala Ala ~e Pro Cys Asn P.ro ser Lys Gln Iy.r ~45 150 155 TAC GG~ AGG GGG ccr ~T CAG A~C ACA TGG AP~ ~r AAC ~C A~ CCA 526 Ty.r Gly Arg Gly P.ro Leu Gln Ile Thr Trp Asn Tyr Asn T~r Ile Pro G~r GGr OG~ AGC AIT GGA m GP~ GG~ CIG AP~T GC~ CC~ G~ ACA GIT 574 Ala Gly Arg Ser Ile Gly Phe Asp Gly L~U Asn Ala P.ro Glu Ihr Val GCC AAC AAI' GCC GIra' A~I' GC~ ITC CG(a ACA GCC TrC l~a m q~G Alra 622 REPLAcEMENrsHEET

W O 92/17~91 ~ 9 152 PCT/DK92/0010X

Ala Asn Asn Ala Val Thr Ala Phe Arg Thr Ala Phe Trp Phe Trp Met Asn Asn Val His Ser Val Ile Val Asn Gly Gln Gly Phe Gly Ala Ser ATT CGA GCT ATC AAT GGA ATC GAA IGT AAT GGT GGT A~C TCT GCI GCT 718 : Ile Arg Ala Ile Asn Gly Ile Glu Cys Asn Gly Gly Asn Ser Ala Ala GIr ACT GCT OGT GTT GGG TAC IAT ACT CAG TAT TGT C~A C~G CIT GGC 766 Val Thr Ala Arg Val Gly Tyr Tyr Thr Gln Tyr Cys Gln Gln Leu Gly 240 2~5 25~ 255 GTT TCG CCA GGG AAT AAC CTC O~T T~C ~PGTCPPAr~ GCqGGTTTTC 813 Val Ser Pro Gly Asn Asn Leu Arg Cys CrGGTCAGAA TTCACAAGGC T~AÇTCaAPa GAAAAIAAAG AGA~ITATGT AAACTGTTCA 873 TTTCTCATGT A~CTTGCTAC TTTGGACAAG CATTA~GTTG GTTAOGAGGC Trr~ICC~IA 933 AAGGAATGAA AAATAIIATT TAP~aaaaaa AAA 966 (2) INFORMAIION FOR SEQ ID NO:2:
: ~i) SEQUENCE C~ARA~l~KlSTICS:
: (A) LENarH: 264 amino acids (B) T~PE: amino acid (D) TOPOLOGY: Iinear (ii) M~LECULE TYPE: prote m (xi) SEQ~ENCE DESCRIPTICN: SEQ ID NO:2:
Ser Ser P~e Gly Pro Ile Phe Ala Ile Leu Met Ala Leu Ala Cys Met Ser Ser Thr Leu Val Val Ala Gln Asn Cys Gly Cys Ala Ser Asn Leu Cys Cys Ser Arg P~e Gly Phe Cys Gly Ser Thr Asp Ala Tyr Cys Gly Glu Gly Cys Arg Glu Gly Pro Cys Arq Ser Pro Ser Ser Gly Gly Gly Ser Val Ser Ser Leu Val Thr Asp Ala Phe Phe Asn Arg Ile Ile Asn Gln Ala Ser Ala Ser Cys Ala Gly Lys Arg Phe Tyr Thr Arg Ala Ala Phe Leu Ser Ala Leu Arg Phe Tyr Pro Gln Phe Gly Ser Gly Ser Ser : Asp Val Val Arg Arg Glu Val Ala Ala Phe Phe Ala His Val Thr His REpLAcEMENTsHEET

"t 21~339 Glu Thr Gly His Phe Cys Iyr Ile Glu Glu Ile Ala Lys Ser Thr Tyr 130 135 1~0 Cys Gln Ser Ser Ala Ala Phe Pro Cys Asn Pro ser Lys Gln Tyr Tyr Gly Arg Gly Pro Leu Gln Ile Thr Trp Asn Tyr Asn Tyr Ile Pro Ala Gly Arg Ser Ile Gly Phe Asp Gly Leu Asn Ala Pro Glu Thr Val Ala Asn Asn Ala Val Thr Ala Phe Ary Thr Ala Phe Trp Phe Trp Met Asn Asn Val His Ser Val Ile Val Asn Gly Gln Gly Phe Gly Ala Ser Ile Arg Ala Ile Asn Gly Ile Glu Cys Asn Gly Gly Asn Ser Ala Ala Val 225 230 235 2~0 Thr Ala Arg Val Gly Tyr Tyr Thr Gln Tyr Cys Gln Gln Leu Gly Val Sbr Pro Gly Asn Asn Leu Arg Cys (2) INFORM~ION F~R SEQ ID NO:3:
~i) S ~ OE Cff~R~CTERISTICS:
(A) LENGTH: 691 ~ase pairs ~B) TYPE: nucleic acid (C) SIRANDEDNESS: dcuble ~D~ qOPOL0GY: linear (ii) M~LECULE IYPE: DN~ (genomic) (vi) ORIGIN~L 90URCE:
(A) ORGANISM: Beta vulgaris (B) SIRAIN: monova (F) TISSUE IYPE: leaf (vii) IMMEDIAIE SOURCE:
(A) LIaRARY: sug~r beet EMBL3 genomic library (B) CL0NE: gencmic chit ~ 4 clone (ix) ~E:
(A) N~ME/KEY: CDS
: (B~ L0C~IION: 356. 691 (Xi) SE~UEN OE DESCRIPIION: SEQ ID NO:3:
AAGCTT~IIG lccpAalAaT TTTAC~I~AC AAGTT~AGTG AACGGAGA~G AIAACIAICC 60 AI~I~rATAA CPAAE3TTIC TTCCTTTC~ TTTCCTTGAA CAA~TCoA~C IAr~IAC~CC 120 REPLACE~ENTSHEET

: . . ; :

W 0 92/17591 ~ 3 ~ y 154 PCT/DK92/OOlOX
A~ArC~rI3r CC~AAATAAA AT~A~IGT~ T~GGCr~A~T CAAAllTGaA CAC ~ 180 T&TATCIAAA ATATCTCCAT TCCC~rCTTA I5AA~IAYAA TACAAGIAA~ CAAGIAGCCA 240 AACIAGTAAA CAIITCCTCA AAGlACCACC CTTAIAAIrT TCrAIAIAA~ CCC~IArACA 300 AGTGrCTAGr TlCCTCATCC CATACATIAT ATTCrTCGC~ AC~IACT CCAPAAr~TC 360 TTCTTICGC-A CCAATCITTG CCATACTC~T GGCACTIGCT TGTA'r~ICA~ GCACCCTAGT 420 ~GIGGCICPA AACTGTGGAT GIGCCTCIAA IITP~GIIGT AGCOE ArTTG GTITCTGrGG 480 CTCCACAGAC GCCIACrGCG GCGAGGGGTG CPGaE~AGGT CCTTGr~GAr CACCGTCIAG 540 T3GI~GT TCC3~TCGA GrrrGGTGAC CGAI~ITC ll~ATAGG~ I ~ ITAACCA 600 AGCIAGCGCT AGCrGTGCrG GTAAG~AIT CTACACCAl~G GcrG~[TlT TGAGTGCI~T 660 CAGATrrraT CCCC~GmG OEAGrCC-aTC C 691 (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACrERISTlCS:
(A) LE~H: 112 am~no acids (B) TYPE: am~no acid (D) IOPO~)GY: linear ~ii) M~LECULE TXPE: peptide (xi) SE~UENOE DESCRIPIION: SEQ ID NO:4:
Met Ser Ser Phe Gly Pro Ile P~e Ala Ile Leu Met Ala Leu Ala C~ys Met Ser Ser Ihr Leu Val Val Ala Gln Asn Cys Gly Cys Ala Ser Asn Leu Cys Cys Ser An~ Phe Gly Phe Cys Gly Ser Thr Asp Ala Tyr Cys Gly Glu Gly Cys Ar~ Glu Gly ~o Cys Arg Ser Pro Ser Ser Gly Gly Gly Ser Val Ser Ser Leu Val Ihr A~p Ala Phe Ehe Asn Arg Ile Ile Asn Gln Ala Ser Ala Ser Cys Ala Gly Lys Arg Ehe Iyr mr Ar~ Ala Ala Phe Leu Ser Ala Leu Arg Phe Tyr Pro Gln Phe Gly Ser Gly Ser lOO 105 llO

(2) INF~RM~IION FOR SEO ID NO:5:
(i) SEÇUENOE C~RACTERISTICS:

~EpLAcEMENTs~EET

W 0 92/17591 ~'~ 3 ~ ~ PCT/DK92/OOlOX

(A) LENGTff: 1838 ~ase pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: 1 ~
(ii) MOLECULE TYPE: DNA (genomuc) (vi) ORIGINAL SOURCE:
(A) ORGANISM: Beta vulgaris (B) STRAIN: ~onova (F) TISSUE TYPE: leaf ~vii) ~DL~ S~:
(A) LI~RARY: sugar beet EMBL3 gencmic library (B) CLDNE: genomic clone chitinase 76 (~x) F~E:
(A) N~ME/KEY: CD6 (B) L~CAIION: join(469..874, 1263..1660) (Xl) SEQUEN OE DESCRIPIION: SEQ ID NO:5:
ACIAI~IATA AATTGArC~r A~5PAIIrqA AATTGFrGGr Ir~A~rGDG TTAAIGCCTC 60 TTGAGTCTTG ATACAACIIA AAAACGGAGC CEGnTGGG~A AC ~ C P~GA~PAETT 120 CA~TqAACGA A~AACCGqAA T~GACCC~I~ TAC~ACAAAA TA~YCGrCGr TTCAIIITCC 180 TTG~CAA~;T cAaAc~rA ACACG7'.P~ Tl ~ Tt;AC~ ~a~ 240 TCAACTOG~N ~]~Y:~4hi~ AC;~CGaGrC PAP~GTCA~C AIITIAAACG TATCAAACA~ 300 IPAIrCrPIr C~C~ICCC~C TATACA~CTA GCTAACTOGT AAECTTCITC crr~aarc~c 360 CIPTCIIIC~ Illnn~C~T AAA ~ TCaAE~GI~I'AGTTrCCACA AC~CACICAr 420 IGC~ICAAAA ~ X~rhC T~GICT~Cr~ IC~ITGIACr CCTCCaAA~T GTCIICTCTr 480 GGACCTTTTT T ~ ATACT IATAGCAaTT GCCIGIArGr CIAGC~C~CT GGITGIGGCT 540 CAAAACIGTG GCDGTGCCTC 51XIIIPTGC IGTAGC~GAr AIGGrIACTG C~GCACCACA 600 GCTGCCTACT GCGGCACTGG GIGCCAGCAA GGDCCrD TT CCICAAC~CC AICCACCCCG 660 AG5~G~GIG ITTCGGrCCC AAGTrDGGlG ACCGAIGCaT TCTTTAATGG P~aTTAAC 720 CAAGCAAGCT CIAGCD3~GC TGGTAAGAGC TTCTA QCTA OEIXTGCqTT CTD~aG5GCT 780 C5CAGTTCTT A5YX~DGK~rr IGr~PCIGGA 5~XIYCG~5G AGGTTA~C~ 5~2~EIqGCT 840 GCCTT5 m G CTCAIGCGAC GC~IGAAACT GGAOGI~AGT GTIAAC~ITA TTAATGCCDC 900 C5T5GaTAGA A5'X~YLAICG AATAAAATCT 5XII~XX~GC TCA m GCGC GCACTTAGCT 960 ATTCAGCI~A 5~qI~IIGTT TTATGTCAAT CATTCD~rCT ~AATIATqTT 5~C~E5TGA 1020 GAATTGTGIC TAAATCIATT A~E~GGAIqG C~AACCAA'TA ATATTGaG5G ACGT~IAE5G 1080 REPLA~EMENTSHEET

W O 92~17~91 PCT/~92/0010X
2~ 0~3~ 156 G'rAAAA~A~A TGAEPGCaAA AGPrTI3hAA TTA ~ A Cq~GTTTTr~ GIIlGCq~Lr 1140 TAAAACIGAT TTAATTC~TA TTATIAIGIT P~GTlG2~rT AAGOGAI~CC ~APalC~h~G 1200 GGAAT~CA~r GAGTTACAGA AAAAIArAIA CTCPGClG~r cAArIGAAcr IGTGIGTlGr 1260 AGATTTTTGC TACATP~AGG AGATrGCCAA AICAACCTAT TGTCAGICC-A GCACA~CAIG 1320 GCCATGCACC ACAAATAAGC AArACTACGG ACGTGG3CCT CTCCAAA~Ca C~IGGAACrA 1380 CAACr~CGGA CCaGCAG3IC GaAGCBTIG3 A~IIGAIGGT TIGAP~CAC CTGAAACAGT 1440 IGCCAarGAT GCIGTIErOG CCTTr~AGAC AGCrTTCTGG TTTTGC~IGA ACAAI6TCC~ 1500 CrCrCGal~T GrCT~rCGCA AAG~GTTIGG cTccAcc~r CGAGCr~TCA ATaGa5GI6A 1560 ATC~GGrGGC GGGAACACAC CG~CrGICAA CGCrCGrCIT AGGI~CIAIA Cr~a3qarIG 1620 CAAIC~GCrr GGrGrITCaC CIGGG~A~AA ccrcrcr GC TA~TCACATA ATO~AAEIGT 1680 TrCCAIGGTC ACAAIITACA AGTCTTAGAC TCrrAGTAIA AGGAh~AA AAAIACAATC 1740 AAGGGAACTG ACrrGlIlTC TrA60CA6Ia AG66AAEr~T GCAICACTIT GTP/~lF.G~IA 1800 TATATTTCAT AGTCITAOGG CCrATrAATA GGGATACG 1838 (2) INFORMAIION ~OR SE~ ID NO:6:
(i) SE~UENCE CH~RACI~RI.STICS:
(A) LENGIH: 268 am mo acids (B) IYPE: amdno acid (D) TOPO$0GY: lLnear (ii) M~LECULE TYPE: peptide (vi) ORIGrN~L SCURfE:
(A) O ~ SM: Beta vulgaris (B) S ~ : monova (F) TISS~E TYPE: leaf (vii) IMMEDIArE SOURCE:
(A) LI9RARY: sugar beet EMEL3 genonic library (B) CLONE: chitmase 76 gencmic clone (x~) SEQUE~OE DE~ON: Sl~ ID NO:6:
Met Ser Ser Leu Gly Pro Phe Leu Ala Ile Leu Ile Ala Val Ala Cys l 5 10 15 Met Ser Ser Thr Leu Val Val Ala Gln Asn Cys Gly Cys Ala Ser Gly Leu Cys Cys Ser Arg Tyr Gly Tyr Cys Gly Thr Thr Ala Ala Tyr Cys Gly Thr Gly Cys Gln Gln Gly Pro Cys Ser Ser Thr Pro Ser Thx Pro REPLACE~E~TSHEET

W O 92/17591 21 ~ ~ 3 ~ 3 PCT/DK92/OOIOX

ser Gly Gly Val Ser Val Pro Ser Leu Val Ihr Asp Ala Phe Phe Asn Gly Ile Ile Asn Gln Ala Ser Ser Ser Cys Ala Gly Lys Ser Phe Tyr 9o 95 Thr Arg Ser Ala Phe Leu Ser Ala Leu Ser Ser Tyr Pro Gln Phe Gly Ser Gly Ser ser Asp Glu Val Lys Arg Glu Val Ala Ala Phe Phe Ala His Ala Thr His Glu Thr Glu His Phe Cys Tyr Ile Glu Glu Ile Ala Lys Ser Thr Tyr Cys Gln Ser Ser Thr Thr l~p Pro Cys Thr Thr Asn Lys Gln Tyr Tyr Gly Arg Gly Pro Leu Gln Ile Thr Trp Asn Tyr Asn Tyr Gly Pro Ala Gly Arg Ser Ile Gly Phe Asp Gly Leu Asn Ala Pro 180 185 l90 Glu Thr Val Ala Asn Asp Ala Val Ile Ala Phe Lys Thr Ala Phe Trp Phe Trp Met Asn Asn Val His Ser Arg Ile Val Ser Gly Lys Gly Phe Gly Ser Ihr Ile Arg Ala Ile ~sn Gly Gly Glu Cys Gly Gly Gly Asn Thr Pro Ala Val Asn Ala Arg Val Arg T~r Tyr Thr Gln Tyr Cys Asn Gln Leu Gly Val Ser Pro Gly Asn Asn Leu Ser Cys (2) INFORM~TION FOR SEQ ID N0:7:
(i) SEQUEN OE CH~RACIERISTICS:
(A) LENGIH: 1106 base F~airs (B) TYPE: nucleic acid (C) STRANDECNESS: dGuble : (D) T~POLDGY: linear (ii) M~LECLLE TYPE: DN~ (gencmic) :
(vi) ORIGIN~L SOURCE:
~: (A) ORGANISM: Beta vulgaris (B) STRAIN: monova (F) IISSUE TYPE: leaf (vii) IMMEDIArE SOUROE:
~A) LIæR~RY: sugar beet lampda-Z~P cDNA library (B) CLONE: "SE" cDNA clone ~`

REpLAcEMENTsHEEl WO 9~/1759l PCr/DK92/0010~
2.1~3~3 158 (ix) ~TURE:
(A) N~ME/KEy: CDS
(B) Il~CATION: 18 . . 896 (xi) S~QUENCE DESCRIPrION: Sl~ ID NO:7:
ACGTACCCAA AACA~GC A~; GCA GCC AAA ATA GTG ~:A Grr CTA TrC CI~; 50 Met Ala Ala Lys Ile Val Ser Val Leu Phe Leu ATr TCT CTC TrA ATC m GCT TCA T~C GAG TCC TCT C~T GGC ~C C~A 98 Ile Ser keu Leu Ile Phe Ala Ser Phe Glu Ser Ser His Gly Ser Gln ATT GTC ATA TAC I~G GGC CAA A~T GCT GAT GAA GGA AGT CIT GCr GAC 146 Ile Val Ile Tyr Trp Gly Gln Asn Gly Asp Glu Gly Ser Leu Ala Asp ACT T~;T AAC TCC GGA AAC TAC GGT ACC G~; ATC CTA GCT llC G~A GCT 194 Thr Cys Asn Ser Gly Asn Tyr Gly Thr Val Ile Leu Ala Phe Val Ala ACC TIT GGT AAC GGG CAA ACC CCG GCG CTG AAC TTA GCT GGG CAC I~T 242 Thr Phe Gly Asn Gly Gln Thr Pro Ala Leu Asn Leu Ala Gly His Cys Asp Pro Ala Thr Asn Cys Asn Ser Leu Ser Ser Asp Ile Lys Ihr Cys 8G 85 gO
CPA C~AG GCA GGC AIT AAG GTA C~C crc TCI' ATA G&A GGT OEr ~C GGA 338 Gln Gln Ala Gly Ile Lys Val Leu Leu Ser Ile Gly Gly Gly Ala Gly GGC q~ T~r CTT ~C ~ ACC GAT G~T GCA A~C ACA TIT GCT G~T TAC 386 Gly Tyr Ser Leu Ser Ser Thr ~sp Asp Ala Asn Ihr Phe Ala Asp Tyr Leu Trp Asn Thr Tyr Leu Gly Gly Gln Ser Ser Thr Arg Pro Leu Gly G~T GCA GTT TTG G~r GGT AIr GAT TTC GA~ ATC G~ AGT GGT G~T G~C 482 Asp Ala Val Leu Asp Gly Ile Asp Phe Asp Ile Glu Ser Gly Asp Gly AGA TTT IGG GAT GAC CTA G~T AGA GC~ TTG GCA GGT C~ AAC AAr GGT 530 Arg Phe Trp Asp Asp Leu Ala Arg Ala Leu Ala Gly His Asn Asn Gly CAG AAA ACA GTG TAC TTA TCA GC~ GCT CCT C~A TGT CCC TTG CCA GAT 578 Gln Lys Ihr Val Tyr Leu Ser Ala Ala Pro Gln Cys Pro Leu Pro Asp GCC AGC TTA AGC ACT GCC A~A GCC ACA GGC CrA TIC GAC IAT GrA TGG 626 Ala Ser Leu Ser Thr Ala Ile Ala Thr Gly I~u Phe A';p ~r Val Trp . .

5~EpLAcEhllENT~cL~

W O 92/17~91 21~ 6 3 ~ 9 PCT/DK92/OOlO~

GIT CAG TTC TAC A~T AAC CCC CCT r~GT CAA rrAT GAT ACC AGC GCT GAT 674 Val Gln Phe Tyr Asn Asn Pro Pro Cys Gln Tyr Asp Thr Ser Ala Asp AAT crc TrrG AGC rrCG rrGG AAC CAG rrGG ACC ACA GTA G~ GCT AAC CAG 722 ~sn Leu Leu Ser S~r rrrp Asn Gln Trp Thr rrhr Val Gln Ala Asn Gln Ile Phe Leu Gly Leu Pro Ala Ser Thr Asp Ala Ala Gly Ser Gly Phe AIT CCA GCA GAT GCT CrT ACA TCT CAA OE C CIT CCC ACT AIC AAG GGT 818 Ile Pro Ala Asp Ala Leu Thr Ser Gln Val L~u Pro Thr Ile Lys Gly TCT GCT AAA TAT GGA GGA GrrC AIG CTA T;G rrCA A~ GCA r~AT GAC AGT 866 Ser Ala Lys Tyr Gly Gly Val Met Leu Trp Ser Lys Ala rryr Asp Ser GGG TAC AGC A~r GCT A~r A~A AGC AGT GIT IP~IlrAA~r IACIAGqGTA 916 Gly Tyr Ser Ser Ala Ile Lys Ser Ser Val ~CCPA~EATA TAGATACAAA A~AAGTqAI~ GAGArACATC AAAAAACCAT CTlAG~rTA 976 AP~ AT GCACChCAAA hGcqnarAAT ACrAArAIAC ~AIIAICATA PPsGCcTqA~r 1036 ~GCCqOQCrA TATTTTGGIG ~TrAT~PlaT ACACAGTTAC AACIICGC~A TrA~CCGaGr 1096 CTTICrAAAA 1106 (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUEN OE CH~R~CTERISIICS:
(A) LENGTH: 293 amuno acids (B) TYPE. amino acid (D) T~POLCGY: linear (ii) MOLECULE TYPE: prote m (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Met Ala Ala Lys Ile Val Ser Val Leu Phe Leu Ile Ser Leu Leu Ile Phe Ala Ser Phe Glu Ser Ser His Gly Ser Gln Ile Val Ile Tyr Trp Gly Gln Asn Gly Asp Glu &ly Ser Leu Ala Asp Thr Cys Asn Ser Gly Asn Tyr Gly Ihr Val Ile Leu Ala Phe Val Ala Thr Phe Gly Asn Gly Gln Thr Pro Ala Leu Asn Leu Ala Gly His Cys Asp Pro Ala Thr ~sn REpLAcEMENT SI~IEET

~.

W O 92/17~91 2 L ~ ~ 3 ~ ~ 160 PCr/DK9Z/0010 Cys Asn Ser Leu Ser Ser Asp Ile Lys Thr Cys Gln Gln Ala Gly Ile Lys Val Leu Leu Ser Ile Gly Gly Gly Ala Gly Gly Tyr Ser Leu Ser Ser Thr Asp Asp Ala Asn Thr Phe Ala Asp Tyr Leu Trp Asn Thr Tyr ; 115 120 125 Leu Gly Gly Gln Ser Ser Thr Arg Pro Leu Gly Asp Ala Val Leu Asp Gly Ile Asp Phe Asp Ile Glu Ser Gly Asp Gly Ar~ Phe Trp Asp Asp Leu Ala Arg Ala Leu Ala Gly His Asn Asn Gly Gln Lys Thr Val Tyr Leu Ser Ala Ala Pro Gln Cys Pro Leu Pro Asp Ala Ser Leu Ser Thr Ala Ile Ala Thr Gly Leu Phe Asp Tyr Val Trp Val Gln Phe Tyr Asn Asn Pro Pro Cys Gln Tyr Asp Thr Ser Ala Asp Asn Leu Leu Ser Ser Trp Asn Gln Trp Thr Thr Val Gln Ala Asn Gln Ile Phe Leu Gly Leu Pro Ala Ser Thr Asp Ala Ala Gly Ser Gly Phe Ile Pro Ala Asp Ala Leu Thr Ser Gln Val Leu Pro Thr Ile Lys Gly Ser Ala Lys Tyr Gly Gly Val ~et Leu Trp Ser Lys Ala Iyr Asp Ser Gly Tyr Ser Ser Ala Ile Lys Ser Ser Val (2) INF0RM~TION F0R SEQ m NO:9:
(i) SEQUENCE CH~RACTERISTICS:
(A) LENGrH: 1249 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: lLnear (ii) M~LECULE TYPE: DNA (gencmic) (vi) ORIGIM~L S0URCE:
(A) ORGANIS~: Beta vulgaris (B) STR~IN: ~oncva (F) TISSUE TYPE: leaf (A) LI~RARY: sugar beet lampda-ZAP cDNA likrary REPLACEMENTS~IEET

2~ ~3~3 W O 92/17591 PCT/DK92/OOlOX

(B) CLONE: beta-1,3-g1ucanase cDNA clone (ix) ~IURE:
(A) NAME/KEY: CDS
(B) LOCATION: 341041 (xi) SEQUEN OE DESCRIPTION: SEQ ID NO:9:
AATTTTGTTT ATTCITAGAG IIAIrTCqrC ACA ATG AGG CT~ ATT AGC ACA ACT 54 Met Arg Leu Ile Ser Thr Thr TCT GC~ GTT GCT ACT IIG CTG TTT CTT GIA GTA ATT CIA CCT AGT AIT 102 Ser Ala Val Ala Thr Leu Leu Phe leu Val Val Ile Leu Pro Ser Ile CAA CTG ACA GAG GCA C~A ATT GGC GIA TGT AAC GGG AGA CIA GGC AAC 150 Gln Leu Thr Glu Ala Gln Ile Gly Val Cys Asn Gly Arg Leu Gly Asn AAC TTA CCT TCC GAG GAA GAT GTT GTA A~C TTG TAC AAG TCG AGG GGA 198 Asn Leu Pro Ser Glu Glu Asp Val Val Ser Leu Tyr Lys Ser Arg Gly ATA ACG AGG ATG hGA ATC TAr GAC CCT AAC CAA CGG ACC CTC CAA GCG 246 Ile Thr Arg Met Arg Ile Tyr Asp Pro Asn Gln Arg Thr L~u Gln Ala GTT AGA GGA TCG A~T A~A GGG CTA AIC GTC GAT GTC CCT A~G oGT G~C 294 Val Arg Gly Ser Asn Ile Gly Leu Ile Val Asp Val Pro Lys Arg Asp CTA A~G TCA CTC GGC TCC GAr GCT GGG GCT GCG TCT CGT TGG GTC CAA 342 : Leu Arg Ser Leu Gly Ser Asp Ala Gly Ala Ala Ser Arg Trp Val Gln AAC AA'T GTA GTC CCT TAC GCG TCT A~T AIT OGA TAC ATA GC~ GTT GGT 390 Asn Asn Val Val Pro Tyr Ala Ser Asn Ile Arg Tyr Ile Ala Val Gly AAr GA~ ATA ATG CCT AAT GAT GCC GAG GCA G~G TC~ ATT GTC CCG GCC 438 Asn Glu Ile Met Pro Asn Asp Ala Glu Ala Gly Ser Ile Val Pro Ala ATG CA~ A~T G'rC CAA A~r GCC CIT CGA ICA GCT AAr TIA Gcr GGT AGA 486 Met Gln Asn Val Gln Asn Ala Leu Arg Ser Ala Asn Leu Ala Gly Arg ~; 140 145 150 - AIT AAA GTC TCT ACC GCG AIA AAA AGT G~C crc GTr Gcr AAC TTC CCT 534 Ile Lys Val Ser Ihr Ala Ile ~ys Ser Asp Leu Val ~la Asn Phe Pro CCC TCT AAA GGT GTT TTT ACr ICT TCA TCA TAC AIG AA~ CCA AIT GTT 582 Pro Ser Lys Gly Val Phe Thr Ser Ser Ser Tyr Met Asn Pro Ile Val AAC TTC CIT AAA AAT A~C AA~ TCA CCT TTG TTA GCC A~C AIT IAC ccr 630 Asn Phe Leu Lys Asn Asn Asn Ser Pro Leu Leu Ala ~sn Ile Tyr Pro REPLACEMENTS~EET
.

W O 92/1759l PCT/D~92/OOlOX
16~
185 ~ ~ ~ 6 3 ~ ~ 190 195 TAC m TCT TTC AIT GGC ACC CCA AGI AIG CGT CTA GAT ~T GC~ CTC 678 Tyr Phe Ser Phe Ile Gly Thr Pro Ser Met Arg Leu Asp Tyr Ala Leu m ACT TCA CCT AAT GC~ CAA GTT AAT GAT A~T GGT T~A CAA TAC CAA 726 Phe Thr Ser Pro Asn Ala Gln Val Asn A~p Asn Gly Le.u Gln Tyr Gln AAT GTC m GAr GCT TTA GTA G~C ACT OEG TAT GCG GOC TIA GCG AAG 774 Asn Val Phe Asp Ala Leu Val Asp Thr Val Tyr Ala Ala Leu Ala Lys GCC GGT GCC CCC AAT GTG CCG ATT GIT GTG TCC G~G AGT GGG TGG CCT 822 Ala Gly Ala Pro Asn Val Pro Ile Val Val Ser Glu Ser Gly Trp Pro 250 255 ~60 TCG GCT GGT GGT AAT GCT GCT AGT TTT TCT AAC GCG GGG ACT T~T ~AC 870 Ser Ala Gly Gly Asn Ala Ala Ser Phe Ser Asn Ala Gly Thr Tyr Tyr AAG GGC TTA ATT GGT CAT GTA AAG CAA GGA ACT CCC CTG AAG A~A GGA 918 Lys Gly Leu Ile Gly His Val Lys Gln Gly Ihr Pro Leu Lys Lys Gly CAA GCA ATT GAG GCA TAT TI~ m GCT ATG m GAT GAG AAC CAA AAG 966 Gln Ala Ile Glu Ala Tyr Leu Phe Ala Met Phe Asp Glu Asn Gln Lys GGT GGA GGT A~T GAG AAC AAr m GGA CTG m ACT CCC AA~ A~A C~G 1014 Gly Gly Gly Ile Glu Asn Asn Phe Gly Leu Phe Thr Pro Asn Lys Gln CCA A~A TAC CAA crC AAT TTC AAT A~r IGaaAGI~Ir Iq~Ir5CCT 1061 Pro Lys Tyr Gln Leu Asn Phe Asn Asn A~TAIA~rA TArAIAlGCT AaT~GTIG~ A~I~AGTIar GTCAICTACA ~A~aIAArA~ 1121 GTGAA~IC~A ACACCCGAIC A~AGACTAAA ATIGiaaraA AAGalCCTCC IGTIGIAaIA 1181 Il;TCCTaGC TGCAATAATA TTT~CICTTA T~TA~AGATC ~ AAAAAAaAAA 1241 (2) INFORMAIION FOR SEQ ID NO:10:
(i) SEQUENC~ CHhRACTERlSTICS:
(A) LENGTff: 336 amlno acids (B) TYPE: am mo acid (D) IOPOLDGY: l ~ r (ii) MOLECULE TYPE: pro~ein (Xl) SEQUENCE DESCRIPIION: SEQ ID NO:10:
Met Arg Leu Ile Ser Thr Thr Ser Ala Val Ala Thr Leu Leu Phe Leu REpLAcEMENTs~EFr W O 92/17S91 ~ 3 ~ ~ PCT/DK92/0010 Val Val Ile Leu Pro Ser Ile Gln Leu Thr Glu Ala Gln Ile Gly Val Cys Asn Gly Arg Leu Gly Asn Asn Leu Pro Ser Glu Glu Asp Val Val Ser Leu Tyr Lys ~er Arg Gly Ile Ihr Arg Met Arg Ile Tyr Asp Pro Asn Gln Arg Thr Leu Gln Ala Val Arg Gly Ser Asn Ile Gly Leu Ile Val Asp Val Pro Lys Arg Asp Leu Arg Ser Leu Gly Ser Asp Ala Gly Ala Ala ser Arg Trp Val Gln Asn Asn Val Val Pro ~yr hla Ser Asn Ile Arg Tyr Ile Ala Val Gly Asn Glu Ile Met Pro Asn Asp Ala Glu Ala Gly Ser Ile Val Pro Ala Met Gln Asn Val Gln Asn Ala Leu Arg Ser Ala Asn Leu Ala Gly ~rg Ile Lys Val Ser Thr Ala Ile Lys Ser Asp Leu Val Ala Asn Phe Pro Pro Ser Lys Gly Val Phe Thr Ser Ser : 165 170 175 Ser Tyr Met Asn Pro Ile Val hsn Phe Leu Lys Asn Asn Asn Ser Pro :. . 180 1~5 190 ~ Lau Leu Ala Asn Ile Tyr Pro ~yr Phe Ser Phe Ile Gly Thr Pro Ser : 195 200 205 M'~t Arg Leu Asp Tyr Ala Leu Phe Thr Ser Pro Asn Ala Gln Val Asn Asp Asn Gly Leu Gln Tyr Gln Asn Val Phe Asp Ala Leu Val Asp m r Val Tyr Ala Ala Leu Ala Lys Ala Gly Ala Pro Asn Val Pro Ile Val Val Ser Glu Ser Gly Trp Pro Ser Ala Gly Gly Asn Ala Ala Ser Phe 260 ~65 270 Ser Asn Ala Gly Ihr Tyr Tyr Lys Gly Leu Ile Gly His Val Lys Gln 275 2~0 285 Gly Thr Pro Leu Lys Lys Gly Gln Ala Ile Glu Ala Tyr Lu Phe Ala Net Phe Asp Glu Asn Gln Lys Gly Gly Gly Ile Glu Asn Asn Phe Gly PFPI Ar-:FMFNT.C`~

W O 92/17591 21~ ~ 3 9 9 164 PCT/DK92/0010X

Leu Phe Thr Pro Asn Lys Gln Pro Lys Tyr Gln Leu Asn Phe Asn Asn (2) INFORMATION FOR SE~ ID NO~
(i) SEQUEN OE CHARACIERISTICS:
(A) LENGTH: 6313 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLCGY: linear ~ii) MOL~CVLE TYPE: DNA (gencmic) (iii) HhPOnHE~IC~L: NO
(vi) ORIGINAL SOUR OE:
(A) ORGANISM: Beta vulgaris (B) STRAIN: Monova (F) IISSUE TYPE: leaf (vii) IMMEDIATE SOUROE:
(A) LIBRARY: sugar beet EM~L3 gencmic library (B) CLONE: genGmic chitinase 1 clone (LX) FEAIURE:
(A) N~ME/KEY: unsure (B) LOCAIION: 3214..4227 (D) CIHER INFORMAIION: /ncte= "Appro ~ tely 1000 base (~X) ~:
(A) N~ME/KEY: CDS
(B) L0CAIION: joLn(1428..2171, 4621..4776, 5408..5824) (xi) SEQUENCE DESChIPlIQN: SEQ ID NO:ll:
TCI~GaGaGA G~AAAAACAA OE craDGDGA OGGTTGGGGT GGGACAAGTT OGACCrGCqA 60 ATAIIAATGG GCEGalAIGG AC~ACTCTTG A~CCCCTCCC T~GCACCrAG ~GGlGGOE aT 120 GGGCCrGCCC GGCaIaArTT GGGACCGCTC GPGGCrraAC CrGTIaTOCa CTAC~IGGoC 180 GcGGGTcDGr CArGGrCaaG APAP~TIarT G~AACIAAAr AI~AAArTTA TTIAACSGGT 240 AAlqAGTTAA CCDGATCPIT TrrrCrPPAA T~CCTCAAAA l~rATTG~AAc TAA~I~ITAA 300 AI~TPAP~lG AGAaT~rTIT T3TcaAGAGA ATCar G~TA AAAG~aAAAT TDG-.CAAAAA 360 AIIqqIIIIT AC~aGTTC~r TrrTGrGAAA AAAAAccrTA TAAAGCPIIT TrrGoGAAAA 420 C~A~CAAAAA TC~AArTTIT TrrGGGAAAA C~AACCAAAA TCAA~AITAT TrrDGCAAGA 480 TGAAAOC~AA OCACCACTAC CaTGCA~AA TCCCC~ACCC CD~CCTCCAC c-crIoGcGG 540 CACCCACACC CCOCrDC3CC CCrACCC~r CIOCACTCTA TICTICCCIC CrrC~OGoCT 600 CCrCrCDCTC cTcIoccrrc GICCAACCCC CCC XCCCCC AACOGTIGTG CCACTCAGAA 660 R~pLAcEMENIsHEEr WO 92/17~91 2 ~ ~ ~ 3 ~ 9 PCI/DK92/0010X

a~CACCCC~C a~ C~CCC CCA~CCGl~ C~CCC~G AAA.~T 720 ~I~II~IT CGA~A TAGIl~T Tl~[51~ GIC;GIAGI~;G A~GI~C780 Gl~l~l~ a~Gl~l~G GGGF~I~; t~I~ITAI~ C~I~I~;G T~TC 840 AI~II~FrAT GGI~I~ GGIIG ~A GCl~G G~l~ 900 GACI~I~;GIT GG~GGIGG AC~ A~G GGa~ Al~aG~AG 960 GG~GGa~ G~AG~ ~G Gl~ ACCGC~GAG AA~l~G 1020 G~ ~aa:~T ~A~Gl'G 1080 Æ ~ G OEG GI~ AI~;C05 G~A~TI ~ GGI~ACGCC A ~AACG~CA ~ GA~I ~ 1140 TrrCGA~AAA A~AIlrGATC TDGArlrGIT TTTACAAAAA A~PArTr~TA AGA ~ r 1200 CGCAAAAGTG AACTCGTA~A AGTI5TTITA A~ACA~ATTT TCCTAGTIAA AP~xa~FY~Fr 1260 TTCACTTTIr ACTAIGTTAC ATACAlPl~r T113AIAGAT A~CTCTCTTA AAlPAGCTqa 1320 TCA ~ C CTTATCCCAA AGAOCCAAAG CC~rAlAAA TTGGCrAC~A ACTCTOCTCA 1380 CAGTCACACA TGACACAAOG CaAGTrTGAA AGGAAAAACA AYAEG~GA~ PAAAIAAAAA 1440 CC~CTCCqbG TTTTCrACIA GGArTYAr~T GTTT~E Cq CT PG~CCTCCqA CqaGGAGAAa 1500 GTGTA ~ TGGGCGacAA IGCAACACAA CrGA~Cq:A TDGTCTTTCC GGTlGCqCaG 1560 TCGGCCGCCC ATC~OGTC05 ACAOCT2CTC G~lCqCCC~C CCCG~ACCG CCACCTOCIC 1620 GT~CTCCCAC CCCG~GACOG C~AC~ICCTC GTCC~CCTAC OOOGAG~OCA CCACCAC~IA 1680 CACCAAGACC ACCACCTCCT CGTCCrCCTA CCCCGAGACC ACCAOCACCT CCI~CAC~AA 1740 GACCACCACC TCCDO~TCCT CCTAOCOCAA GAC~GCCACC ACCrCCTACA OCA~GACCAC 1800 CACCTCCTCC TACACCAAGA CCACCACCTC CTAaTCCTCC TACC~CTAGA CCAOCACCAC 1860 CACCAO~T0C TAGTCCrCCT AClo3CAAGCC CACC~rCTCC TCCrAGCOCT GAAOCAOCAA 1920 CTCCGCCCGA ACCTAOGCCA CC~ACrCCTA C~OCAOC~AC TCAICTTACT GACAlP~ r 1980 CqGaAGAAAT GTTrAA~GAA TTCCDClqGA ACOGCarTCA GCCAOGTTGT CCTGGTAGAT 2040 GGTTCTACAC TTACCAGGCT TTCAITACIG CAGCTGAAAC CTTCOCTGAG Trr3G~AATA 2100 CTGGGAADCA TG~AATI~GA AAGAGAGAAA TDa qGCIqT C5TTGGAC'~G ACCDCTCATG 2160 AAACCTCTGG TTGArT qTC TACTTCTCAT TCTrCqlTAC TrOO~ArCTG CTTCACTTIA 2220 CI~AC ~ TGlTTrCATA CrATATCGTA TATrrA~AGA TG~ACAAGTA GIAOGTTAlr 2280 AIlIGCTa~aT GCCTACrTCC TAGraTTTaT TCrITaTCAA TCTA~IG~IC TrIAI~GITT 2340 A~X~n~GACA CAAT~AAIIA TATA~ICTrA AO qTAAGTr T~GACG~IAr GAATrAqTrC 2400 REpLAcEMENT SHE~

W 0 92/17591 ~ 1 ~' 6 3'i~ PCT/D~92/OOlOX

TTTTTCAO~r ATCTAOCCTA GTTA~TAIAG GTIGITATIA CC~LIIIIIT TACTTCIACr 2460 AT ~ GACTT TIGACCATAT CGATICTITA IGCATAAGAC ATA~A~AATA TA ~ ATCT 2520 TGrTGlPlr~ TITACTTCGA TAIATAIATT TrGTIGGATr A~GCr~CAAA AI~PGICPAG 2580 TITICCTAAT AGTTATGATT AGn~GC~AlT A~ITAGITAG TGGGITAACA AGIAGIGGTC 2640 TAGATAATGG TCTAGCTAGT GGGATAGCAA GTAAGTAGTA G~CTACATAG T~GACAIGTT 2700 GTI~GTAGrG CrrIGTAT&C CIAIrr~AAG ATGGTTTTGT TrArICAr~A TGT~CArG 2760 A~AAATATAT AaAAPAIGTA GTClTICrAA ~CICITCAAG TTCTCrTCCT CCTCr~AAAA 2820 ITCTAC~IGG TATC~GAGCT CC~GGTIAGA TCCGGGAAAG GGaLAGAGAT GAAGCAAAAA 2880 ~ AGA AAAAAAAGAG AGAGATAGAG APAGaAAGAG AGIPIqAAAA ACAAAArTGA 2940 -GTAAAAAGAA ACAAGCAATG CL3CTI3AIT TCPIrGTTIG T AGCPATqT TrrGTrIGAG 3000 T~aaATTT5T TGTGTTTAAC CAT;-aAaGTA AT~GT~GGT GT~A~G3GlT GTrGG~CTCC 3060 C m TAECCC ATGAAAATGG ATrrrA~rCC TaDGGAAAAA AGGGCATAAA ALErl3rqTG 3120 AGTr;æAGAT OGAGTAATCT TrAO-~AGlGT GT;GAAGTCG TACTCAAO-C AGAGACGAIT 3180 T~CaAi~TG TAGTAGTGGA T=-DG3rCAAA TrrNNNNNNW NNNNNNDNNN NWWWNNNNNN 3240 NWNNWNNWNN NWNWNNNNWN NWWWWNNNNN NWWWNNNNNN NNWNNNNNNN r3;KNNNNNNN 3300 NWNWWWWNNN NWNWNNNNNN NNWWWNNNNN NWWWWNNNWN NNWNNNNWNN NWNWNNNNN~ 33~0 NWNWWNNNNN NWWWN#WWWN NNNWWNNNNN NWWWWWNNNN NWNWWNNNNN NWNNWNNNNN 3420 NWWWWWwNnN NNNNNNNNNN NWNNNNNNNN NWWWWNNNNN NWWNW~WNNN NWWWWWWNNN 3480 : NWNWWNNNNN NWWWNWNNNN NWWNNNNNNN NWWWWNNNNN NWWNNNNNNN NWWWNWNNNN 3540 NWNWWNNNWN NNNWNNNNNN NWWWWNNNNN NWWWWWNNNN NWWNNNWWNN ~ 3840 _ NWWWWNNNNN NWWWWWWWNN NNNNWNNNNN 3900 NNNNNNNN W NNNNN~N~WN NNNNNNN WN NNNNNNNN~W N~WNNNN~WN NNNN~NNN~W 4080 NNNNNNNN~W NNNN~NNWNW NNNNNN~NNN NNNNNNNN~W NNNNN~NW~W NNNNNNNNNN 4140 NNNNNNN~NN NNNNNNN WN NN~NNWN~WN NNNNNNNN~W NNNNNNN~WN NNNNNNNN W 4200 ~EPLAGEMENTS~EET

~ .

W O 92/17591 2 3 !~ PCT/DK92/OOlOX

~NNNNNNNN~ NNNNNNNhNN NNN~NNNTCT AGATIGACTT ~GrPA3Tr~A ACTIACCAAA 4260 TCTIGATATA TAGTAAIITA CAAA~TATAT TATAAGCI~A GTO~;ATGT CICCCTCC~T 4320 CTTTTTTTTA CTACTIGITA CATTTTTCIT AAATGAATGT CrC~rrTTAC ACACTACATT 4380 GCTTTATTTG CATTGGTAAC TAT&ACCCAT CAAAAA~AA CaArAIrC~C Cl~llAIlrIT 4440 CTCATCTTCT TAACTTTAAC TCTCAAATAT TTGIT~TTTT CAACAAAGIT AACTCTCAAA 4500 12IrDGrCAT AATAAT~TGA AATCTrCrGT TGalY2PGqG T~CAAAACAA PA~GIGTC~ 4560 ITT~AAAAGA AhAATGAGAG GACAIAI~IA Cr~AIGGArT TTrG~ArrG~ CP~T2TAG;A 4620 GAACCGACCG CACAACATGG ACCATTIACA TGGGGGTAIT GITTCPIAQA AG~AATTGGA 4680 GCCQ~CCCrC TCAGCCAATA TIGTGCA~CC TCTGTAGAAT Q~CCTIQCAT T3GIGGGAQQ 4740 TIITACTATG GrCGT3GAC~C AGrCCAAClT ACCTGGTAAG TACrXCTCC QTDXAAAAT 4800 ATAQTD'TCA m TCCr m TTC~CAGIAA m AT~CAAG TAQAATATAA QAQ~GraZGT 4860 AAA~AT~ m ITTTTATITA AATAA~T~qT GTATGGGAAA AGATGATTIT AGGAG~AGA 4920 GIGGAGAATA AITAGIGAAA QAQCATDAAT TGIAACArTT TGGrIGAATA AATAAAGGAA 4980 AAAACA,~AIT CAAQAAQCIA AAQTAAIGAQ GGCAC~ÆGTT TTCrAGACAA ATTACGGAAA 5040 AATarQGAAC TAAATATGAA AAIGGGAACT ATAT m GAQ AC~CNCAAAA TAAAAATGQQ 5100 AACr~TATTT T~GGAOGG~G GQ~GIAITAT TAIATIAGCT IACTCCr~IT ACTD CATCQ 5160 CAlGnC~aAA TTTTTATTGT TCATAGAAAA QTCA m rC~ AQ~ArTT13C TATTCG~OGT 5220 CITAAAAT~T m ACrACGC m CDAAqTA CATAT~ m A IAGTGIACIT AIITIAIACC 5280 m CCATr~C TrCD~rF m CCTDX m C CTICACTTAA GTTTIAACTT GAIACAIATA 5340 QCrAQCAAAA TTATCTTAGG TA m TAGCT AATTrAAAAT m TGGrAAT GAIAaATAAT 5400 TTGCa3GAAT TTCAACTAIG GAAAGCAGGT GAAGC~CrTA GGTTTGGACC T~Y~IICA~ 5460 CCCAGACATA GrAGCACAlG ACCCAGrrAT TTCTTTCG:A ACTGCAATrr OE ITTIGGAT 5520 GACTCCIG~A GGA~ACAA~C CTF.-rICCCA TGAAGF~ATA ACr~GGCAAT GGACACCLAC 5580 TCCIGCPGAC ATAGCrCGCA ACAGAITGCC IGGarPlGGT TI~ArCAC~A ATAqlqTTAA 5640 TGGIGCTTTA GAAT~CaGCA CTCAI~G~CC AGAI~AI~GA G~GGAAAATC GAATTCAGTT 5700 TTACCAGAGA TACTGTGAIC TlCTAGArGT ~AGCIaIaGA GAIAACCTTG ATIGCI~CCG 5760 TCAAACTCCC TITGATTGGG Gq~qIAAAAA ACrr~A3GGA GClAGA~aAT CAIGGICGTC 5820 GAGCrAAAAT TATAOGCATG CAIGTAGTCT CrPAGTCCAT ACATTATI~T CF~C~IGCGT 5880 GIAT&ATATT GAGTAAGTTG GTAIGIICAA A~AIATGIGG ~GTCqGAAAA TATGCAAACA 5940 REPLACEMENT SHEE~

U O 92/l?~ v ~ PCT/DK92/OOlOX

GAACCAGCAA TAAGTAATAA Gc~AaGTTTA CTTGCACC~A ATCTGGATCT GTTCTAGIGA 6000 AATI~ITGTA T&ITCGTATT GTAT&GTAAT G~ATAAAGTT IG~I~FnGr~r T~GC~ITATC 6060 T&CACCTTAT TGATATTAAT TTTTCATAIT CPGGCaTTTA CAAIC~TAAG GATI~CTGTA 6120 GGACCATIGA ACATGCAGIT GAGTTAGTcr TIA~TATGGT GTTCPAG~AG AG~AIGGAAA 6180 ATAGAAATGA GGAATG~ACG TACTCIA~AT TATAAGAGAC TACTAGIGIT GTTrhGrcAG 6240 IGCTATI~ll ACACCTAA~A AAGCTCTATG AGPITACATT TAcATc~nGG ~CaAAAEGTC 6300 TTAAT&TCTA CCG 6313 (2) INFORMATION FOR SEQ ID N~:12:
(i) SEQUEN OE C~RACIERISTICS:
(A) LENarff: 439 am mo acids (B) TYPE: amlno acid (D) TOPOLOGY: 1Lnear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE:
(A) ORGANISM: Beta vulgaris ~B) STRAIN: Monova (F) TI5SUE TYPE: leaf (Xl) SE2UEN OE DESCRIPTION: SEQ ID NOol2:
Met Lys Ile Lys Thr Ser Pro Ser Phe Leu Leu Gly Leu Ile Cys Leu Ala Leu Val Leu Leu Leu Gly Glu Gly Val Gln Cys Gly Arg Gln Cys Asn Thr qhr Asp Thr Asn Cys Leu Ser Gly Cys Ser Val Gly Arg Pro Ser Arg Pro Thr Pro Pro Arg Pro Pro Thr Pro Arg Pro Pro Pro Pro Arg Pro Fl-o Thr Pro Arg Pro Pro Pro Pro Arg Pro Pro Thr Pro Arg Pro Pro Pro Pro Thr Pro Arg Pro Pro Pro Pro Arg Pro Pro Thr Pro 9o 95 Arg Pro Pro Pro Pro Pro Thr Pro Axg Pro Pro Pro Pro Arg Pro Pro Thr Pro Arg Pro Pro Pro Pro Pro Thr Pro Arg Pro Pro Pro Fro Pro Thr Fro Arg Fro Pro Pro Pro &r Pro Pro Thr Pro Arg Pro Pro Pro REpLAcEMENTsHEE~

W O 92/17~91 2 ~ ~ 6 ~ PCT/DK92/O~ X

Pro Pro Pro Pro Ser Pro Pro Ihr Pro Ser Pro Pro Ser Pro Pro Ser Pro Glu Pro Pro Thr Pro Pro Glu Pro Thr Pro Pro Thr Pro Thr Pro Pro Thr Hls Leu Thr Asp Ile Ile Ser Glu Glu Met Phe Asn Glu Phe Leu Leu Asn Arg Ile Gln Pro Arg Cys Pro Gly Arg Trp Phe Tyr Thr Tyr Gln Ala Phe Ile Thr Ala Ala Glu m r Phe Pro Glu Phe Gly Asn 210 ~15 220 Thr Gly Asn Asp Glu Ile Arg Lys Arg Glu Ile Ala Ala Phe Phe Gly Gln Thr Ser His Glu Thr Ser Gly Glu Pro Thr Ala ~ln His Gly Pro Phe Thr Trp Gly Tyr Cys Phe Ile Glu Glu Ile Gly Ala Gly Pro Leu Ser Gln Tyr Cys Ala Pro Ser Val Glu Trp Pro Cys Ile Arg Gly Arg Phe Tyr Tyr Gly Arg Gly Pro Val Gln Leu Thr Trp Asn Phe Asn Tyr Gly ~ys Gln Val Lys His Leu Gly keu Asp Leu Leu Phe Asn Pro Asp Ile Val Ala His Asp Pro Val Ile Ser Phe Glu Thr Ala Ile Trp Phe Trp Met Thr Pro Glu Gly Asn Lys Pro Ser Ser His Glu Val Ile m r 340 3~5 350 Gly Gln 'rrp m r Pro Thr Pro Ala Asp Ile Ala Arg Asn Arg Leu Pro Gly Tyr Gly Leu Ile Thr Asn Ile Phe ~sn Gly Ala Leu Glu Cys Gly mr His Gly Pro Asp Asn Arg Gly Glu Asn Arg Ile Gln Phe Tyr Gln Arg Tyr Cys Asp Leu Leu Asp Val Ser Tyr Gly Asp Asn Leu Asp Gly l~r Arg Gln 'rnr Pro Phe Asp l~p Gly Leu Lys IJYS Leu Gln Gly Ala 420 4~5 430 Arg Glu Ser Trp Ser Ser Ser (2) INFORM~TION FOR SE)~ ID NO:13:

REPLACEMENTSHEET

W O 9~/1~91 PCT/DK92/0010X
21~339 170 (i) SEQUENOE CHARACIERISrICS:
(A) LENGIH: 23 2mino acids (B) TYPE: amino acid (D) qOPOL0GY: linear (ii) ~OLECUIE TYPE: peptide (iii) EhF{~WE~lCAL: NO
(v) FRAGMENT TYPE: C-terminal (vi3 ORIGIN~L SOVRCE:
(A) ORGANISM: Phase~lus vulgaris (xi) SEQUEN OE DESCRIPqION: SEQ ID NO:13:
Asn Leu Asp Cys Tyr Ser Gln Thr Pro Phe Gly Asn Ser Leu Leu Leu l 5 l0 15 Ser Asp Leu Val Thr Ser Gln (2) INFORM~TION FOR SEQ ID NO:14:
(i) SEQUEN OE CHARACTERISrICS:
(A) LENGTH: l9 amm o acids (B) TYPE: amlno acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: pepkide (iii) ElyFco~ETqcAL: NO
(iv) ANTI-SENSE: NO
(v) FRAGMENT TYPE: C--terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Nicotiana tabacum (Xi) SE;OUENCE DESCRlPqlON: SEQ ID NO:14:
Asn Leu Asp Cys Gly Asn Gln Arg Ser Phe Gly Asn Gly Leu Leu Val Asp Thr Met (2) INFORM~TION FOR SE~ ID NO:15:
(i) SE~UENCE, ~H~RACTERISTICS:
(A) LENGTH: 13 amm o acids (B) TYPE: amino ~cid (C) STRANDEDNESS: single (D) IOPOL~GY: lin~ar (ii) MOLECULE TYPE: peptide REpLAcEMENTsHEE

2~S3~
W O 9~/17~9l PCT/D~92/0(~

(iii) HYPrTEETICAL: NO
(v) FRAGMENT TYPE: C-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Nicotiana tabacum (xi) SEOUENCE DESCRIPqION: SEO ID NO:15:
Asn Leu Asp Cys Tyr Asn Gln Arg Asn Cys Phe Ala Gly (2~ INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 11 amino acids (B) TYPE: amlno acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOI}EIICAL: NO
~v) FRAGMENr TYPE: C-terminal (vi) ORIGINAL SOUR OE:
(A) OR~ANISM: Hordeum vulgare (xi) SEOUENCE DESCRIPTION: SEO ID NO:16:
Asn Leu Asp Cys Tyr Ser Gln Arg Pro Phe Ala : 1 5 10 (2) INFORM~TION FOR SEO ID NO:17:
(i) SEOUEN OE CHARACIERISIICS:
(A) LENGTH: 23 am mo acids (B) TYPE: am mo acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOqHETIC~L: NO
(v) FRAGMENr TYPE: C-term mal (vi) ORIGINAL SOUROE:
(A) ORGANISM: Nicotiana tabacum (Xl) SEOUENCE DESCRIPqION: S~Q ID NO:17:
Gly Val Ser Gly Gly Val Trp Asp Ser Ser Val Glu Thr Asn Ala Thr Ala Ser Leu Val Ser Glu Met ~EpLAcEMENT sH EET

W O 9~/17~91 , PCT/D~92/0011)~
2 ~ ~ 6 .~ 172 (2) INFORM~TION FOR SEO ID NO:18:
(i) SEQUEN OE CHARACIERISTICS:
(A) LENGTH: 16 am mo acids (B) TYPE: amino acid (D) TOFOL~GY: linear (ii) MOLECULE TYPE: peptide (iii) HhPrnHETICAL: NO
(vi) ORIGINAL SOUROE:
(A) ORGANISM: beta vulgaris (xi) SEQUEN OE DESCRIFqION: SEO ID NO:18:
Ser Thr Tyr Cys Gln Ser Tyr Ala Ala Phe Fro Fro Asn Pro Ser Lys l 5 l0 15 (2) INFORMATION FOR SEO ID NO:l9:
(i) SEOUENCE CHARACqERISTICS:
~A) LENGTH: 18 amino acids tB) TYPE: amlno acid (D) TOPOLOGY: linear (ii) MOLECULE T~PE: peptide ~iii) HhEOnHETICAL: NO
(vi) ORIGIN~L SOUROE:
(A) ORGANISM: beta vulgaris (xi) SEOUENCE DESCRIPqION: SEO ID NO:l9:
Ala Cys Val Thr His Glu Thr Gly His Phe Cys Tyr Ile Glu Glu Ile l 5 l0 15 Ala Lys (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUEN OE CHARACTERISTICS:
(A) LENGTH: lQ amino acids ~B) TYPE: amuno acid (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: peptide (iii) EYFCqHEIICAL: NO
(vi) ORIGINAL SOUR OE:
(A) ORG~NISM: beta vulgaris REpLAcEMENTsl~EEr .

:-W O 92/17591 2 i ~t5 3 ~ ~ CT/D~92/0~

(xi) SEOUENCE DESCRIPqION: SEQ ID NO:20:
Val Gly Tyr Iyr Thr Gln Tyr Cys Gln Gln l 5 l0 (2) INFORM~TION FOR SE~ ID NO:21:
(i) SEOUEN OE CHARACTERISIICS:
(A) LENGTH: 7 am mo acid~s (B) IYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE T~PE: peptide (iii) HYPOrHErICAL: NO
(vi) ORIGINAL SOUR OE:
(A) ORG~NISM: beta vulgaris (xi) SEOUENOE DESCRIPTION: SEQ ID NO:21:
Gly Pro Leu Gln Ile qhr Trp l 5 (2) INFO~M~TION FOR SEQ ID NO:22:
(i) SEQUENOE CHARACIERISIIC5:
(A) LENGTH: 22 amuno acids (B) TYPE: amino acid (D) TOPOLCGY: linear (ii) MOLECULE TYPE: peptide (iii~ HYFCq9ETICAL: NO
(vi) ORIGIN~L SOURCE:
(A) O~GANISM: beta vulgaris (Xi) SEQUENCE DESCRlPqlON: SEQ ID NO:22:
Ser Ile Gly Phe Asp Gly Leu Asn Ala Pro Glu Thr Val Ala Asn Asn l 5 lO 15 . Ala Val Thr Ala Phe Arg (2) INFORM~TION FOR SEQ ID NO:23:
(i) SEQUEN OE CHARA~l~KlSTICS:
(A) LENGIH: 43 amino acids (B) TYPE: am mo acid (D) TOPOLOGY: linear (ii) ~OLECULE TYPE: peptide REpLAcEMENTsHE~

W092/1.'~91 ~6~9 Pcr/DK92/oolox ( iii) HYPar~E,l~IC~L: NO
( iv) ANTI-SENSE: NO
(v) F~RAGMENT TYPE: h-terminal (vi) ORIGINAL SCUROE:
(A) OR~NISM: Triticurn aestiv~

(xi) SEQUEN OE DESCRIPqION: SEQ ID NO:23:
Gln Arg C~vs Gly Glu Gln Gly Ser Asn Met Glu Cys Pro Asn Asn Leu Cys Cys Ser Gln Tyr Gly ~rr Cys Gly Met Gly Gly Asp Iyr Cys Gly Lys Gly Cys Gln Asn Gly Ala Cys Trp Thr Ser (2) INFORM~TION FOR SEQ ID NO:24:
(i) SEOUENOE C~ARACl~ISlICS:
(A) LENGI~I: 43 amino acids (B) TYPE: am~no acid (D) ~POI~ linear (ii) MOLEa~E TYPE: peptide (iii) ~IC~L: NO
(iv) AN~--SENSE: NO
(v) F~ TYPE: N-tf~:mi~l (vi) OKtGINAL SOURCE:
(A) OR(~NISM: Hevea brasiliensis (xi) SEOI~ENCE DESCRI~ION: SE~ ID NO:24:
Glu Gln Cys Gly Arg Gln Ala Gly Gly Lys Leu Cys Pro Asn Asn Leu Cys Cys Se~ Gln Trp Gly ~p Cys Gly Ser mr Asp Glu Iyr Cys Ser ~ro Asp His Asn Cys Gln Sex Asn Cys Lys Asp (2) INFORMAlION FOR SEQ ID NO:25:
(i) SEQUENOE CHARACl~;KI~lICS:
(A) LENGrH: 41 ~nino acids (B) TYPE: amino acid (D) I~POLOGY: l~near (ii) r~OLEC[~IE TYPE: peptide REpL~cEMFNT~ FF
'~ ' .
,:
. `:

2~ ~lo~
0 92/1'~91 PCI /DK92/0t) l ()~

~iii) HYF~l~CAL: NO
- (v) F~RAGMENT TYPE: N-term~nal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Phaseolus vulgaris (xi) SEQUENCE DESCRIPllON: SEQ ID NO:25: -Glu Gln Cys Gly Arg Gln Ala Gly Gly Ala Leu Cys Pro Gly Gly Asn5 10 15 Cys Cys Ser Gln Phe Gly Trp Cys Gly Ser Thr Thr Asp l~rr Cys Gly Pro Gly Cys Gln Ser Gln Cys Gly Gly (2) ~FORM~TION EOR SEO ID NO:26:
(i) SE~UENOE C~RACIERISl'ICS:
(A) LENGTH: 42 am~no acids (B) TYPE: am~no acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (iii) HYEV~LICAL: NO
(v) FR~r TYPE: N-term~nal (vi) ORIG:~ SOUROE:
(A) ORGANISM: Nicotiana tabac~n (xi) SI~QI)~OE DESCRIPIION: SEI;2 ID NO:26:
Glu Gln Cys Gly Ser Gln Ala Gly Gly Ala Arg Cys Ala Ser Gly L~eu Cys Cys Ser Lys Phe Gly Trp Cys Gly Asn Ihr Asn Glu Tyr Cys Gly Pro Asp Asn Cys Gln Ser Gln Cys Pro Gly (2) :~FO~l~ON ~R SOQ ID NO:27:
(i) Sl~UENCE CHP~RACrERISTICS:
(A) LENGlff: 33 am~no acids (B) TYPE: am~no acid (D) I~POLOGY: l.u~ear (ii) ~:)LECULE TYPE: peptide (iii) HY~II~IC~L: NO

REPLACEMENT SHEEl`

~O 92/17~91 ~ ~ ;U ~ 3 ~ ~ 176 PCI/DK92/OOlo~;

(v) FRA~T TYPE: N-terminal (vi) ORIG~AL SOURCE:
(A) ORG~NI~I: Beta vulgaris (xi) SEQUENCE DESCRIPl'ION: SEO ID NO:27:
Glu Leu Cys Gly Asn Gln Ala Gly Gly Ala Leu Cys Pro Asn Gly Leu ~' 5 l0 15 Cys Cys Ser Gln ~r Gly $~p Cys Gly Asn Thr Asn Pro Tyr Cys Gly Asn (2) :~lION F~R S~ ID NO:28:
(i) SEQUENCE CHARACIERISTICS:
(A) LENGTH: 32 base pairs (B) qYPE: nucleic acid (C) STR~NDEDNESS: single (D) I~POLOGY: linear (ii) MOLECULE TYPE: DNA (gencmic) (iii) H~CAL: YES
(iv) ANTI-SENSE: NO
(vi) ORIG~ SWROE:
~A) OR~ NISM: primer (XB-7), constructed frc~m beta vulgaris (xi) S~QUENCE DESCRlPqION: S~Q ID NO:28:
GACI~AGAA AYCCRCCRYG YC~AYGAY AC 32 (2) INF~RM~IION FOR SEQ ID NO:29:
(i) SEQUENOE CH~RACIERISlICS:
(A) LE~GTH: 26 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: sin~le (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYE~IqC~L: Y~S
(iv) ANII-SENSE: No (vi) ORIGINAL SOUR OE:
(A) ORGANISM: primer (KB-9), constructed from Beta vulgaris (xi~ SE~UEN OE DESCRIPTION: SEO ID No:29:

REPLACEMENTSHEET

' ,,, `
': , ':, .

W O 92/17~9l 211~ 6 3 ~ ~ PCT/DK92/0()l0X

GGAGGATCCC ARRCNAAYCA RArrHrT 26 (2) INF0RMATqON FOR SEO ID NO:30:
(i) SEQUEN OE CHARACIEælSTICS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: s mgle (D) 'rOPOLCGY: linear (ii) MOLECNLE 'rYPE: cDNA
(iii) ~YFCnEETICAL: YES
(vi) ORIGINAL SOU~OE:
(A) ORG~NISM: prL~er (270) (xi) SEQUEN OE DESCRIPIION: SEO ID NO:30:
CC~AGCTrGA ATTYITTTTT ITTTTTTITT TrTT 34 (2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUEN OE CHARACTERISTICS:
(A) LENGTH: 292 amino acids (B) TYPE: amino acid (D) TOPOL~GY: lLnear (ii) MOLECULE TYPE: pepkide (iii) EYPCnHETICAL: NO
(iv) ANTI-SENSE: NO
(vi) ORI5INAL SOUR OE:
(A) ORG~NISM: Cucumis sativus (xi) SEQUENOE DESCRIPIION: SEQ ID NO:31:
Met Ala Ala His Lys Ile Thr Thr Thr Leu Ser Ile Phe Phe Leu Leu Ser Ser Ile Pha Arg Ser Ser Asp Ala Ala Gly Ile Ala Ile Tyr Trp Gly Gln Asn Gly Asn Glu Gly Ser keu Ala Ser m r Cys Ala Thr Gly Asn Tyr Glu Phe Val Asn Ile Ala Phe Lau Ser Ser Phe Gly Ser Gly Gln Ala Pro Val Leu Asn Leu Ala Gly His Cys Asn Pro Asp Asn Asn Gly Cys Ala Phe Leu Sar Asp Glu Ile Asn Ser Cys Lys Ser Gln Asn REpLAcEMENTsHEET

W()92/1?~91 PCT/DK92/0010~
~ ~633~ 178 Val Lys Val Leu Leu Ser Ile Gly Gly Gly Ala Gly Ser Tyr Ser Leu Ser Ser Ala Asp Asp Ala Lys Gln Val Ala Asn Phe Ile Trp Asn Ser Tyr Leu Gly Gly Gln Ser Asp Ser Arg Pro Leu Gly Ala Ala Val Leu Asp Gly Val Asp Phe Asp Ile Glu Ser Gly Ser Gly Gln Phe Trp Asp Val Leu Ala Gln Glu Leu Lys Asn Phe Gly Gln Val Ile Leu Ser Ala Ala Pro Gln Cys Pro Ile Pro Asp Ala His Leu Asp Ala Ala Ile Lys Thr Gly Leu Phe Asp Ser Val Trp Val Gln Phe Tyr Asn Asn Pro Pro Cys Met Phe Ala Asp Asn Ala Asp Asn Leu Leu Ser Ser Trp Asn Gln Trp Thr Ala P.he Pro Thr Ser Lys Leu Tyr Met Gly Leu Pro Ala Ala Arg Glu Ala Ala Pro Ser Gly Gly Phe Ile Pro Ala Asp Val Leu Ile 2~5 250 255 Ser Gln Val Leu Pro Thr Ile Lys Ala Ser Ser Asn Tyr Gly Gly Val Met Leu Trp Ser Lys Ala Phe Asp Asn Gly Tyr Ser Asp Ser Ile Lys 275 280 ~85 Gly Ser Ile Gly . 290 (2) INFORM~TION FOR SEQ ID NO:32:
(i) SEQUEN OE CHARACrERISTICS:
(A) LENGTH: 302 amino acids (B) TYPE: amlno acid tD~ TOPOLDGy: linear (ii) MOLECULE TYPE: peptide (iii) HYF~n~DErICAL: NO
(iv) ANII-SENSE: NO
(vi) 3RIGINAL SOUR OE:
(A) ORGANISM: Arabidopsis thaliana (xi) SE~UEN OE DESCRIPTqON: SEQ ID NO:32:
Met Thr Asn Met Thr Leu Arg Lys His Val Ile Tyr Phe keu Phe Phe REpLAcEMENTsHEET

W O 92/1759l ~ ~ ~ 6 3~ PCT!DKg2/0010~

Ile Ser Cys Ser Leu Ser Lys Pro Ser Asp Ala Ser Arg Gly Gly Ile Ala Ile Tyr Trp Gly Gln Asn Gly Asn Glu Gly Asn Leu Ser Ala Thr ~5 Cys Ala mr Gly Arg Tyr Ala Tyr Val Asn Val Ala Phe Leu Val Lys Phe Gly Asn Gly Gln Thr Pro Glu Leu Psn Leu Ala Gly His Cys Asn Pro Ala Ala Asn mr Cys Thr His Phe Gly S~ Gln Val Lys Asp Cys Gln Ser Arg Gly Ile Lys Val Met Leu Ser Leu Gly Gly Gly Ile Gly lOO 105 110 Asn Tyr Ser Ile Gly ,ser Arg Glu Asp Ala Lys Val Ile Ala Asp Tyr Leu Trp Asn Asn Phe Leu Gly Gly Lys Ser Ser Ser Ary Pro Leu Gly Asp Ala Val Leu Asp Gly Ile Asp Phe Asn Ile Glu Leu Gly Ser Pro Gln His Trp Asp Asp Leu Ala Arg Thr Leu Ser Lys Phe Ser His Arg ~ Gly Arg Lys Ile Tyr Leu mr Gly Ala Pro Gln Cys Pro Phe Pro Asp : 180 185 190 Arg Leu Met Gly Ser Ala Leu Asn Thr Lys Arg Phe Asp Tyr Val Trp Ile Gln Phe Tyr Asn Asn Pro Pro Cys Ser Tyr Ser Ser Gly Asn mr Gln Asn Leu Phe Asp Ser Trp Asn Lys Trp Thr Thr Ser Ile Ala Ala Gln Lys Phe Phe Leu Gly Leu Pro Ala Ala Pro Glu Ala Ala Asp Ser Gly Tyr Ile Pro Pro Asp Val Leu mr Ser Gln ~le Leu Pro 'rhr Leu : 260 265 270 Lys Lys Ser Arg Lys Tyr Gly Gly Val Met Leu Trp Ser Lys Phe Trp : 275 280 285 Asp ~sp Lys Asn Gly Tyr Ser Ser Ser Ile Leu Ala Ser Val 2g0 295 300 ~2) INFORM~TION FOR SEQ ID NO:33:
(i) S~UENCE CH~RP.CIERISIIGS:

REplAcEMENTsHEEr U'O 92/1?591 ~ ~ ~ & ~ ~ ~ PCT/VK92/~10 (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) 'rOPOL0GY: linear (ii) MOLECULE TYPE: peptide (iii) HYPOrHE~ICAL: NO
(vl) ORIGINAL SOURCE:
(A) ORGANISM: beta vulgaris (xi) SEQUENOE DESCRlPqION: SEO ID NO:33:
Trp Val Gln Asn Asn Val Val Pro 'ryr l 5 (2) INFO~MATION FOR SEO ID NO:34:
(i) SEQUENCE CHARACIERISTICS:
(A) LENGTff: 20 amino acids (B) TYPE: amino acid (D)'rOPOL~GY: linear (ii) MOLECULE TYPE: peptide (iii) HhFCqHE~lCAL: NO
(vi) ORIGINRL SOURCE:
(A) ORGANISM: Beta vulgaris (xi) SEQUEN OE DESCRIPqlON: SEQ ID NO:34:
Ala Gly Ala Pro Asn Val Pro Ile Val Val Ser Glu Ser Gly 'rrp Pro l 5 l0 15 Ser Ala Gly Gly (2) INFORM~TION FOR SEO ID NO:35:
(i) SEOUENC~ CHARACTERlSTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) 'rOPOLCGY: linear (ii) MOLECULE IYP~: peptide ~iii) HYP{nHETICAL: NO
(vi) ORIGINAL SOUR OE:
(A) ORGANISM: beta vulgaris (xi) SE~UEN OE DESCRIPTION: SEQ ID NO:35:
Leu Gln Gly Lys Val Ser l 5 ~EpLAcEMENIsHEFr W O 92/17~91 2 ~ ~ ~ 3 ~ 3 PCT/DK92/0010~

(2) INFORM~TION FOR S Q ID NO:36:
(i) SEOUEN OE CHARACTERISIICS:
(A) LENGTH: 17 base palrs (B) TYPE: nucleic acid (C) STR~N~FDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPCn}E5ICAL: YES
(vi) ORIGINAL SOURCE:
(A) ORGANISM: primer (TG-l), constructed from beta vulgaris (xi) SEOUEN OE DESCRIPqION: SEQ ID NO:36:

:~ (2) INFORMATION FOR SEQ ID NO:37:
(1) SEOUEN OE CHARACTERISTICS:
(A) LENGTH: 17 ~ase pairs (B) TYPE: nucleic acid (C) STRAMDEDNESS: sLngle (D) TOPOLCGY: l mear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPonHEIICAL: YES
(vi) ORIGINAL SOUR OE:
: (A) ORGANISM: primer (TG-2), construted from beta vulgaris (xi) SEOUEN OE DESCRIPIION: SEQ ID NO:37:

(2) INFORMATION FOR SE~ ID NO:38:
(i) SEOUEN OE CH~RACrERISTlCS:
(A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) SrRANDEDNESS: single (D) TOPOI~GY: linear (ii) MOLECULE TYPE: DNA (genomic) (iii) HYPCq9E~ICAL: YES
(vi) ORI OE N~L SOUROE:
(A) ORGANISM: prLmer (~G-3), constructed from N. tabacum and H. vulgare (xi) SEQUENOE DESCRIPIION: SEO ID NO:38:

REPLACEMENTS~EET
.

W O 92/17~91 PCT/DK92/0010X
~ 1 ~t~ 3 i3 ~ 182 (2) INFORMATION FOR SEO ID NO:39:
(i) SEOUENCE CHARACTERISTICS:
(A) LENGTH: 6 amuno acids (B) TYPE: amlno acid (D) TOPOLOGY: linear (ii) M~LECULE TYPE: peptide (iii) EYPC~}ETICAL: NO
(v) FRAGMENT TYPE: N-termlnal (vi) ORIGINAL SOUR OE:
(A) ORGANISM: Hordeum vulgare (xi) SE~UEN OE DESCRlPqION: SEO ID NO:39:
Phe Ala Met Phe Asp Glu l 5 (2) INF0RMATION FOR SEQ ID NO:4Q:
(i) SEQUENCE CHARACTERISTICS:
tA) LENGTH: 6 am m o acids (B) TYPE: amlno acid (D) TOPOLOGY: l mear (ii) MOLECULE TYPE: peptide (iii) HYPC~9E~ICAL: NO
(vi) ORIGINAL SW R OE:
(A) ORGANISM: Nicotiana tabacum (xi) SEQUENCE DESCRIPIION: SEO ID NO:40:
Phe Ala Met Phe Asn Glu l 5 (2) INFOKMATION FOR SEO ID NO:41:
(i) SEOUEN OE CHARACTERISTICS:
(A) LENGTH: 23 amino acids (B) TYPE: amino acid (D) TOPOLLGY: linear (ii) MOLECULE TYPE: peptide (iii) HYP0nHE~ICAL: NO
(v) FRAGMENT IYPE: N-terminal (vi) ORIGINAL SOUR OE:

REPLAGEMENTSHE~

W O 92/l~S91 2 1 0 ~ 3 a ~ PCT/DK92/OOlOX

(A) ORGANISM: Pisum sativum (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Glu Gln Cys Gly Arg Gln Ala Gly Gly Ala Thr Cys Pro Asn Asn Leu Cys Cys Ser Gln Tyr Gly Tyr (2) INF~RM~TION FOR SEQ ID NO:42:
(i) SEQUEN OE CHARACIERISTICS:
(A) LENGTH: 15 amlno acids . (B) TYPE: amuno acid (D) TOPOL0GY: linear (ii) MOLECULE TYPE: peptide (iii) HYF~n~E~lCAL: NO
(v) FRAGMENr TYPE: N-terminal (vi) ORIGINAL SOUR OE:
(A) ORGANISM: Pisum sativum (xi) SEQUENCE DESCRIPqlON: SEQ ID NO:42:
Glu Gln Cys Gly Asn Gln Ala Gly Gly Xaa Val Pro Pro Asn Gly (2) INFORM~IION FOR SEQ ID NO:43:
(i) S~ENCE C~RACrERl:SrICS:
(A) LENG~I: 16 amlno acids (B) TYPE: amino acid (D) TOPOLLGY: linear (ii) MOLECULE TYPE: peptide (iii) HYFOqHETICAL: NO
(v) F~AGMENr TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Pisum sativum (xi~ SEQUEN Æ DESCRIPTION: SEQ ID NO:43:
Glu Gln Cys Gly Thr Gln Ala Gly Gly Ala Leu Cys Pro Gly Gly Leu l 5 10 15 (2) INFORM~TION FOR SEQ ID NO:44:
(i) SE2UEN OE CHARACTERISTICS:

c ~ n . A .~ T C`U I:~ ~

W O 92/17~91 21 u 6 3 ;J 9 184 PCT/DK92/0~lOX

(A) LENGTH: 22 amino acids (B) TYPE: amino acid (D) TOPOLCGY: linear (ii) MOL~CULE TYPE: peptide (iii) HYPCTEETICAL: NO
(v) FRAGMENT TYPE: N-terminal (vi) ORIGINAL SOURCE:
(A) ORGANISM: Hordeum vulgare - (xi) SEOUEN OE DESCRIPqION: SEO ID NO:44:
Glu Gln Xaa Gly Ser Gln Ala Gly Gly Ala Thr Cys Pro Asn Xaa Leu l 5 l0 . 15 Cys Cys Ser Arg Phe Gly (2) INFO~MATION FCR SEO ID NO:45:
(i) SE~UEN OE C~ARACIERISTICS:
(A) LENGI~: 23 amlno acids (B) TYPE: amuno acid (D) IOPOLDGY: linear (ii) MOLECULE TYPE: peptide (iii) EYPrnHETICAL: NO
(v) FRAGMENT IYPE: N-terminal (vi) ORIGIN~L SOUROE:
(A) ORGANISM: Hordeum vulgare (xi) SEOUENCE DESCRIPqION: SEO ID NO:45:
Xaa Gln Gln Gly ser Gln Ala Gly Gly Ala Thr Cys Pro Asn Xaa Leu l 5 l0 15 Cys Cys Ser Xaa Phe Gly Trp (2) INFORM~TION FOR SEO ID NO:46:
(i) SEOUENC~ CXARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: amino acid ~D) TOPOLOGY: linear ~ii) MOLECULE TYPE: peptide (iii) HYPCTEE~IC'AL: NO
(vi) ORIGINAL SOUR OE:

REpLAcEMENTsHEET

W O 92/1'591 ~ ~ ~ 6 ~ ~ 9 PCT/~92/0010 (A) ORGANISM: Nicotiana tabacum (xi) SEOUENCE DESCRIPIION: SEQ ID NO:46:
Ala Ile Gly Val Asp Leu Leu Asn ~sn Pro Asp Leu Val Ala Thr Asp l 5 l0 15 Pro Val (2) INFORM~TION FGR SEQ ID NO:47:
(i) SEQUEN OE C~RACTERISTICS:
(A) LENGTH: 7 amlno acids (B) TYPE: amino acid : (D) IOPOLLGY: linear (ii) MOLECULE TYPE: peptide (iii) HYFCn}EIICAL: NO
(vi) ORIGINAL SOURCE:
(A) ORGANISM: Nicotiana takacum (xi) SEQUEN OE DESCRlPqION: SEQ ID NO:4'7:
Gly Pro Ile G}n Ile Ser His l 5 (2) INFORM~IION FOR SEQ ID NO:48:
(i) SLQUEN OE CH~RACTERISTICS:
(A) LENGTH: 12 aminD acids (B) TYPE: amino acid (D) qOPOLOGY: linear (ii) M~OLE~NLE TYPE: peptide (iii) HYPOTHEIICAL: NO
(vi) ORIGIN~L SOURCE:
tA) ORG~NISM: Nicotiana tabacum (xi) SEQUEN OE DESCRIPqION: SEQ ID NO:48:
Ser Ala Leu Trp Phe Trp Met Thr Pro Gln Ser Pro l 5 l0 (2) INFORM~TION FOR SEQ ID NO:49:
(i) SE~UENCE CHARACTERISIICS:
(A) LENGTH: 42 kase pairs (~) T~PE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLQGY: l mear WO 92/17~91 PCI/DK92/0010X
~0~3U''Ji 186 (ii) MOLEC[lLE TYPE: DNA (genamic) (vi) ORIGINAL SOURCE:
(A) ORGANISM: primer (~-3), constructed fram beta ~ulgaris (xi) SEQUENOE DESCRIPlION: SEQ ID NO:49:
Ca~AGCllA GAI~AAACA ACA~C~I~C ~GGA CC 42 (2) INF~PMATION EOR SEQ ID NO:50:
(i) SEQUENOE C~ACl~ISllCS:
(A) LE~: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) I~)POLCX;Y: linear (ii) MOLE~[~LE TYPE: DN~ (genomic) (iii) HYPa~EllC~L: YES
(iv) ANll-SEt'JSE: YES
(vi) ORIG:~L SO~CE:
(A) OR~NISM: primer (KB-4), constmcted fram beta vulgaris, chitinase 4 (xi) SEQUENOE DESCRIPlION: SEO ID NO:50:
G~C~:~; ~Cll~ G 21 (2) ~RM~lION EC)R S1~2 ID NO:51:
(i) SE~OE C~RACl~ERISllCS:
(A) LENGrH: 19 base pairs (B) TYPE~ cleic acid (C) S~ANDEDNESS: s~ngle (D) TOPOLCGY: linear (ii) EqOLE~LE TYPE: DNA (gen~nic) (iii) HY}~I~IIC~Lo YES
(iv) ANll-SENSE: YES
(vi) ORIG:~JAL SOURCE:
(A) OR~SM: primer, constructed from beta vulgaris, chitinase ~

(xi) SEQUENOE DESCRIPI:rON: SB2 ID NO:51:
CA~GGAGGA I~CACIACC 19

Claims (26)

1. A DNA sequence comprising the sugar beet chitinase 4 DNA
sequence shown in SEQ ID NO.:1 or an analogue thereof, the analogue being a DNA sequence encoding a polypeptide having the antifungal activity of the said chitinase and i) being a characteristic part of the DNA sequence shown in SEQ ID NO.:1, or ii) hybridizing with the DNA sequence shown in SEQ ID NO.:1, or iii) encoding a polypeptide having the amino acid sequence of the sugar beet chitinase 4 shown in SEQ ID NO.:2, or iv) encoding a polypeptide being reactive with an antibody raised against sugar beet chitinase 4.

2. A DNA sequence according to claim 1, comprising nucleo-tides 71-793 of the chitinase 4 DNA sequence shown in SEQ ID
NO.:1 and encoding the hevein domain and the functional domain of the sugar beet chitinase 4 enzyme, or an analogue of said DNA sequence, or comprising nucleotides 175-793 of the chitinase 4 DNA sequence shown in SEQ ID NO.:1 encoding the functional domain of the sugar beet chitinase 4 enzyme, or an analogue of said DNA sequence.

3. A DNA sequence encoding a chitinase isoenzyme which is at least 60% homologous with the sugar beet chitinase 4 enzyme encoded by the DNA sequence SEQ ID NO.:1 and at the most 40%
homologous with the sugar beet chitinase 1 encoded by the DNA
sequence shown in SEQ ID NO.:11.

4. A modified DNA sequence comprising a DNA sequence as defined in any of claims 1-3, in which at least one nucleo-tide has been deleted, substituted or modified or in which at least one additional nucleotide has been inserted so as to encode a polypeptide having retained the antifungal activity of the sugar beet chitinase 4 or having an increased anti-fungal activity as compared to the sugar beet chitinase 4.

5. A subsequence of the chitinase 4 DNA sequence of SEQ ID
NO.:1 comprising a DNA sequence encoding the following pep-tide S-I-G-F-D-G-L-N-A-P-E-T-V-A-N-N-A-V-T-A-F-R

or the peptide G-P-L-Q-I-T-W
or the peptide T-A-F-W-F-W-M-N-N-V-H-S-V-I-V-N-G-Q-G-F-G-A-S-I

which peptides are involved in the active site of the chiti-nase, or analogues thereof, in which at least one nucleotide has been deleted, substituted or modified or in which at least one additional nucleotide has been inserted, and which have the same catalytic and/or binding activities as that of said peptides.

6. A subsequence of the chitinase 4 DNA sequence SEQ ID NO.:1 encoding the leader peptide of chitinase 4 or an analogue thereof in which at least one nucleotide has been deleted, substituted or modified or in which at least one additional nucleotide has been inserted and which is capable of direct-ing a passenger polypeptide to which it is fused out of the cell in which the fused leader and passenger polypeptide is produced, to be deposited in the extracellular space.

7. A subsequence of the chitinase 4 DNA sequence SEQ ID NO.:1 encoding one or more of the following epitopes of the sugar beet chitinase 4 enzyme Peptide 1: AGKRFYTRA
Peptide 2: CNPSKQYY
Peptide 3: IECNGGNS
Peptide 4: TARVGYYTQYCQ

8. A DNA sequence according to any of the preceding claims which is of plant origin.

9. A polypeptide encoded by a DNA sequence according to any of the preceding claims.

10. A genetic construct comprising 1) a promoter functionally connected to 2) a DNA sequence as defined in any of claims 1-8 comprising a chitinase 4 DNA sequence or an analogue or a subsequence thereof; and 3) a transcription terminator functionally connected to the DNA sequence.

11. A genetic construct comprising one or more copies of a DNA sequence as defined in any of claims 1-8 comprising the chitinase 4 DNA sequence shown in SEQ ID NO.:1 or an analogue or subsequence thereof, one or more copies of a DNA sequence encoding a polypeptide having the activity of a second chitinase different from the sugar beet chitinase 4, and/or one or more copies of a DNA sequence encoding a polypeptide having .beta.-1,3-glucanase activity, each of the DNA sequences being functionally connected to a promoter and a transcription terminator capable of expressing the DNA sequences into functional polypeptides.

12. A genetic construct according to claim 11, which compris-es the DNA sequence of SEQ ID NO.:7 encoding an acidic sugar beet chitinase SE having the amino acid sequence shown in SEQ
ID NO.:8 or an analogue of said DNA sequence encoding an acidic chitinase having a pI of at the most 4.0 and being capable of hydrolysing 3H-chitin into mainly hexamers, and/or the DNA sequence shown in SEQ ID NO.:9 encoding the basic sugar beet .beta.-1,3-glucanase 4 having the amino acid sequence shown in SEQ ID NO.:10 or an analogue thereof encoding a basic .beta.-1,3-glucanase having a pI of at least 9.0 and being capable of hydrolysing 3H-laminarin into mainly dimers of .beta.-1,3-glucans.

13. A genetic construct according to any of claims 11-12, in which an N-terminal leader sequence is selected from the group consisting of the coding regions of the sugar beet chitinase 1, the sequence of which appears from SEQ ID
NO.:11, the sugar beet chitinase 4, the sequence of which appears from SEQ ID NO.:1, the sugar beet .beta.-1,3-glucanase, the sequence of which appears from SEQ ID NO.:9, the sugar beet chitinase 76, the sequence of which is shown in SEQ ID
NO.:5, and the acidic chitinase SE from sugar beet, the se-quence of which appears from SEQ ID NO.:7.

14. A vector which is capable of replicating in a host organ-ism and which carries a DNA sequence as defined in any of claims 1-8, or a genetic construct as defined in any of claims 11-13.

15. A host organism harboring a vector as defined in claim 14.

16. A genetically transformed plant comprising in its genome a genetic construct according to any of claims 11-13.

17. A genetically transformed plant according to claim 16, which is selected from the group of monocotyledonous plants consisting of corn, oat, wheat, rice, barley, rye and sorghum, or the group of dicotyledonous plants consisting of alfalfa, tobacco, cotton, sugar beet, fodder beet, sunflower, carrot, chenille, tomato, potato, soybean, oil seed rape, cabbage, pepper, lettuce and pea.

18. A genetically transformed plant according to any of claims 16 or 17, having an increased resistance to a chitin containing plant pathogen as compared to a plant which does not harbour the genetic construct as defined in any of claims 11-13.

19. Seeds, seedlings or plant parts obtained by growing the genetically transformed plant according to any of claims 16-18.

20. A transformation system comprising at least one vector which carries a genetic construct according to any of claims 11-13 and which is capable of introducing the genetic con-struct into the genome of a plant.

21. The transformation system according to claim 20 which comprises a binary or a co-integrate vector system.

22. A method of producing a genetically transformed plant having increased resistance to chitin containing plant patho-gens such as phytopathogenic fungi as compared to a natural plant, comprising transferring a genetic construct according to any of claims 11-13 into the genome of the plant so as to obtain a genetic material comprising the construct, and subsequently regenerating the genetic material into a gene-tically transformed plant.

23. An antifungal composition comprising a polypeptide en-coded by the DNA sequence as defined in any of claims 1-8, or by a genetic construct as defined in any of claims 11-13 and a suitable vehicle.

24. A method of preparing an antifungal composition compris-ing culturing a microorganism according to claim 15 in an appropriate medium and under conditions which result in the expression of one or more polypeptides encoded by the DNA
sequence according to any of claims 1-8, or the genetic con-struct according to any of claims 11-13, optionally rupturing the microorganisms so as to release their content of express-ed polypeptide(s) into the medium, removing cell debris from the medium, and optionally subjecting the medium containing the polypeptide(s) to freeze-drying or spray-drying thereby obtaining an antifungal composition comprising the polypep-tide(s) encoded by said DNA sequence or said genetic con-struct.

25. A method of inhibiting the germination and/or growth of a chitin containing plant pathogen such as a phytopathogenic fungus in a plant which method comprises 1) transforming the plant or a part thereof with a genetic construct as defined in any of claims 11-13 and regenerating the resulting transformed plant or plant part into a gene-tically transformed plant; and/or 2) treating the plant or a part thereof, a seedling or seed from which the plant is to be propagated, or the medium on which the plant is grown with a composition as defined in claim 23.

26. The plant transformation vector pBKL4K4 harbored in the E. coli strain DH5.alpha. deposited with Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSM) on 30 July, 1991 under the provisions of the Budapest Treaty under accession number DSM 6635.