CA1340861C - Cysteine-depleted muteins of biologically active proteins - Google Patents

Abstract

Muteins of biologically active proteins such as IFN-.beta. and IL-2 in which cysteine residues that are not essential to biological activity have been replaced with other amino acids, or in the case of IFN-.beta. deleted or replaced with other amino acids, to eliminate sites for intermolecular crosslinking or incorrect intramolecular disulfide bridge formation. These muteins are made via bacterial expression of mutant genes that encode the muteins that have been synthesized from the genes for the parent proteins by oligonucleotide-directed mutagenesis.

Description

13~~~~1 -1_ CYSTEINE-DEPLETED 1lIJTEINS
OF BIOLOGICALLY ACTIVE PROTEINS
Description Technical Field This invention is in the general area of recombinant DNA technology.
More specifically it relates to mutationally altered biologically active proteins that differ from their parent analogs by one or more substitutions of cysteine residues, or in the case of interferon-S one or more substitutions/deletions of cysteine residues. .
10. Background Art Biologically active proteins that are microbially produced via recombinant DNA (rDNA) technology may contain cysteine residues that are nonessential to their activity but are free to form undesirable inter-molecular or intramolecular links. One such protein is microbially produced human beta interferon (IFN-Sw ). In the course of the preparation of IFN-S
by rDNA techniques, it has been observed that dimers and oligomers of microbially produced IFN-y are formed in E.coli extracts containing high concentrations of IFN-g- . This multimer formation renders purification and separation of IFN-S-very laborious and time-consuming and necessitates 20. several additional steps in purification and isolation procedures such as reducing the protein during purification and reoxidizing it to restore it to its original conformation, thereby increasing the possibility of incorrect disulfide bond formation. Furthermore, microbially produced IFN-~ has also been found to exhibit consistently low specific activity due perhaps to the formation of multimers or of random intramolecular disulfide 13~8b1 bridges. It would be desirable, therefore, to be able to alter microbially produced biologically active pro-teins such as IFN-ti in a manner that does not affect their activity adversely but reduces or eliminates their ability to form intermolecular crosslinks or intramolecular bonds that cause the protein to adopt an undesirable tertiary structure (eg, a conformation that reduces the activity of the protein).
The present invention is directed to produ-cing by directed mutagenesis techniques mutationally altered biologically active proteins (such proteins are called "muteins", Glossary of Genetics and Cytogenetics, 4th Ed, p 381, Springer-Verlag (1976)) that retain the activity of their parent analogs but lack the ability to form intermolecular links or undesirable intramolecular disulfide bonds. In this regard Shepard, H.M., et al, Nature (1981) 294:563-565 describe a mutein of IFN-r3 in which the cysteine at position 141 of its amino acid sequence (there are three cysteines in native human IFN-ri at positions 17, 31, anc7 141, Gene (1980) 10:11-15 and Nature (1980) 285:542-547) is replaced by tyrosine. This mutein was made by bacterial expression of a hybrid gene con-structed from a partial IFN-fi cDNA clone having a G >A transition at nucleotide 485 of the IFN-f3 gene. The mutein lacked the biological activity of native IFN-ti leading the authors to conclude that the replaced cysteine was essential to activity.
Directed mutagenesis techniques are well known and have been reviewed by Lather, R.F. and Lecoq, J.P. in Genetic Engineering Academic Press (1983) pp 31-50. Oligonucleotide-directed mutagenesis is specifically reviewed by Smith, M. and Gillam, S.
in Genetic Engineering: principles and Methods, 30 Plenum Press (1981) 3:1-32.

.. i34~8~i Disclosure of the Invention One aspect of the invention is a synthetic mutein of a biologically active protein having at least one cysteine residue that is free to form a disulfide link and is nonessential to said biological activity, characterized in that the mutein has at least one of said cysteine residues replaced by another amino acid, or in the case of interferon-s deleted or replaced with another amino acid.
Another aspect of the invention, are synthetic structural genes having DNA sequences that have been specifically designed ("designer genes") to encode the above described synthetic muteins. Sub-aspects of this aspect are expression vectors that include such structural designee genes, host cells or organisms transformed with such vectors, and processes for making the synthetic mutein by culturing such transformants or their progeny and recovering the mutein from the culture. In the case of muteins that have therapeutic utility, therapeutic compositions that contain thereapeutically effective amounts of the muteins are another aspect of the invention.
Another aspect of the invention is a method of preventing a protein having one or more cysteine residues that is free to form an undesirable disulfide link from forming such a link characterized in that the protein is mutationally altered by replacing the cysteine residues with other amino acids, or in the case of interferon-~ deleting them or replacing them with other amino acids.
Still another aspect of the invention is a method for making the above described synthetic structural gene by oligonucleotide-directed mutagenesis characterized by the following steps:

1~,~$s~
-a-(a) hybridizing single-stranded DNA comprising a strand of a structural gene that encodes the parent protein with a mutant oligonucleotide primer that is complementary to a region of the strand that includes the colon for the cysteine to be replaced, or in the case of interferon- ~ deleted or replaced, or the antisense triplet paired with the colon, as the case may be, except for a mismatch with that colon or antisense triplet, as the case may be, that defines a deletion of the colon or a triplet that encodes said other amino acid;
(b) extending the primer with DNA polymerase to form a mutational heteroduplex; and (c) replicating the mutational heteroduplex.
the mutant oligonucleotide primers used in this process are another aspect of the invention.
The invention also provides recombinant human interleukin-2 mutein, wherein the cysteine at position 125, numbered in accordance with native human interleukin-2, is replaced by a neutral amino acid and said mutein exhibits the biological activity of native human interleukin-2.
Another aspect of the invention relates to a formulation for the diagnosis of therapeutic treatment (local or systemic) of bacterial, viral, parasitic, protozoan and fungal infections; for augmenting cell-mediated cytoxicity; for stimulating lymphokine activated killer cell activity; for mediating recovery of immune function of lymphocytes; for augmenting allo-antigen responsiveness; for facilitating recovery of immune function in acquired immune deficient states; for reconstitution of normal immunofunction in aged humans and animals; in the development of diagnostic assays such as those employing enzyme amplification, radiolabelling, radio-imaging; for monitoring interleukin-2 levels in the diseased state; and for the production of T cell growth 4a in vitro for therapeutic and diagnostic purposes for blocking receptor sites for lymphokines; comprising;
Ca) an effective amount of a recombinant human interleukin-2 mutein, wherein the cysteine residue at position 125, numbered in accordance with native human interleukin-2, is ~ replaced by a neutral amino acid and said mutein exhibits the biological activity of native, human interleukin-2; and (b) an inert, non-allergenic, pharmaceutically compatible carrier medium.
Brief Description of the Drawings Figure 1 is a diagram of the amino acid sequence of IFN-3.
Figure 2 is a schematic illustration showing the preparation of a mutant IFN-f3 gene by oligonucleo-tide-directed mutagenesis.
Figure 3 shows a diagram of plasmid pf3ltrp including the IFN-f3 gene.
Figure 4 is a diagram of the cloning vector M13mp8 phage.
Figure 5 shows the restriction map of clone M13-f31.
Figure 6 shows the sequencing gel pattern of the mutant IF~1-Rserl7 gene showing a single base change in the coding region.
Figure 7 is a diagram of the expression plasmid pTrp3.

~~~-o~~~

Figure 8a shows the HinfI restriction pattern of clone pSY2501 and Figure 8b shows the resulting two 169bp and 28bp fragments thereof.
Figure 9 is a restriction map of clone pSY2501.
Figure 10 shows the coding DNA sequence for the mutein IFN-s serl7 with the corresponding amino acid sequence therefor.
Figure 11 shows the single 18,000 dalton protein band corresponding to IFN-S in the extracts of clones pSY2501 and Psltrp.
serl7 Figure 12 is a diagram of the plasmid pLWl which contains the human interleukin-2 (IL-2) gene under the control of the E.coli trp promoter.
Figure 13 is a restriction map of phage clone M13-IL2.
Figure 14 is a restriction map of the plasmid pLW46.
Figures 15a and 15b show, respectively, the nucleotide sequence of the coding strand of the clone pLW46 and the corresponding amino acid sequence of the IL-2 mutein designated IL-2ser125 Modes for Carrying Out the Invention The present invention provides: muteins of biologically active proteins in which cysteine residues that are not essential to biological activity have been deliberately replaced with other amino acids, or in the case of interferon-R. deleted or replaced with other amino acids, to eliminate sites for intermolecular crosslinking or incorrect intramolecular disulfide bond formation; mutant genes coding for such muteins; and means for making such muteins.
Proteins that may be mutationally altered according to this invention may be identified from . ~t~~.oss~

available information regarding the cysteine content of biologically active proteins and the roles played by the cysteine residues with respect to activity and tertiary structure. For proteins for which such information is not available in the literature this information may be determined by systematically altering each of the cysteine residues of the protein by the procedures described herein and testing the biological activity of the resulting muteins and their proclivity to form undesirable intermolecular or intramolecular disulfide bonds. Accordingly, while the invention is specifically described and exempli-fied below as regards muteins of IFN-R and IL-2 it will be appreciated that the following teachings apply to any other biologically active protein that contains a functionally nonessential cysteine residue that makes the protein susceptible to undesirable disulfide bond formation. Examples of proteins other than IFN-f3 and IL-2 that are candidates for mutational alteration according to the invention are tumor necrosis factor and colony stimulating factor-1, and IFN-al. Candidate proteins will usually have an odd number of cysteine residues.
In the case of IFN-fi it has been reported in the literature and that both the glycosylated and unglycosylated IFNs show qualitatively similar speci-fic activities and that, therefore, the glycosyl moieties are not involved in and do not contribute to the biological activity of IFN-R. However, bacter-Tally produced IFN-f3 which is unglycosylated consis-tently exhibits quantitatively lower specific activity than native IFN-f3 which is glycosylated. IFN-t3 is known to have three cysteine residues at positions 17, 31 and 141. Cysteine 141 has been demonstrated by ~s~.~ss1 Shepard, et al, supra, to be essential for biological activity. In IFN-a, which contains four cysteine residues, there are two intramolecular -S-S- bonds:
one between cys 29 and cys 138 and another between cys 1 and cys 98. Based on the homology between IFN-f3 and IFN-as cys 141 of IFN-f3 could be involved in an intramolecular -S-S- bond with cys 31, leaving cys 17 free to form intermolecular crosslinks. By either deleting cys 17 or substituting it by a different amino acid, one can determine whether cys 17 is essen-tial to biological activity, and its role in -SS- bond formation. If cys 17 is not essential for the biolog-ical activity of the protein, the resulting cys 17-deleted or cys 17-substituted protein might exhibit specific activity close to that of native IFN-l3 and would possibly also facilitate isolation and purification of the protein.
By the use of the oligonucleotide-directed mutagenesis proce:~ure with a synthetic oligonucleotide primer that is complementary to the region of the IFN-f3 gene at the colon for cys 17 but which contains single or multiple base changes in that colon, a designer gene may be produced that results in cys 17 being replaced with any other amino acid of choice.
When deletion is desired the oligonucleotide primer lacks the colon for cys 17. Conversion of cys 17 to neutral amino acids such as glycine, valine, alanine, leucine, isoleucine, tyrosine, phenylalanine, histi-dine, tryptophan, serine, threonine and methionine is the preferred approach. Serine and threonine are the most preferred replacements because of their chemical analogy to cysteine. When the cysteine is deleted, the mature mutein is one amino acid shorter than the native parent protein or the microbially produced IFN-R.

~3~-assn Human IL-2 is reported to have three cys-teine residues located at positions 58, 105, and 125 of the protein. As in the case of IFN-!3, IL-2 is in an aggregated oligomeric form when isolated from bacterial cells and has to be reduced with reducing agents in order to obtain a good yield from bacterial extracts. In addition, the purified reduced IL-2 protein is unstable and readily reoxidized upon stor-age to an oligomeric inactive form. The presence of three cysteines means that upon reoxidation, the protein may randomly form one of three possible intramolecular disulfide bridges, with only one of those being the correct bridge as found in the native molecule. Since the disulfide structure of the native IL-2 protein is not known, it is possible to use the present invention to create mutations at codons 58, 105 and 125 of the IL-2 gene and identify which cys-teine residues are necessary for activity and there-fore most likely to be involved in native disulfide bridge formation. In the same vein, the cysteine residue that is not necessary for activity can be moc9ified so as to prevent the formation of incorrect intramolecular disulfide bridges and minimize the chance of intermolecular disulfide bridges by u~l.-.~ replacement of the free cysteine residue.

The size of the oligonucleotide primer is determined by the requirement for stable hybric9ization of the primer to the region of the gene in which the mutation is to be inc~ucec~, and by the limitations of the currently available methods for synthesizing oligonucleotides. The factors to be considered in designing oligonucleotides for use in oligonucleotide-directed mutagenesis (eg, overall size, size of por-tions flanking the mutation site) are described by 13~-0861 _g_ Smith, M. and Gillam S., supra. In general the overall length of the oligonucleotide will be such as to optimize stable, unique hybridization at the muta-tion site with the 5' and 3' extensions from the muta-tion site being of sufficient size to avoid editing of the mutation by the exonuclease activity of the DNA
polymerase. Oligonucleotides used for mutagenesis in accordance with the present invention usually contain from about 12 to about 24 bases, preferably from about 14 to about 20 bases and still more preferably from about 15 to about 18 bases. They will usually contain at least about three bases 3' of the altered or missing colon.
The method for preparing the modified IFN-t3 gene broadly involves inducing a site-specific muta-genesis in the IFN-f3 gene at colon 17 (TGT) using a synthetic nucleotide primer which omits the colon or alters it so that it codes for another amino acid.
When threonine replaces the cysteine and the primer is hybridized to the antisense strand of the IFN-f3 gene, the preferred nucleotide primer is GCAATTTTCACTCAG
(underlining denotes the altered colon). When it is desirable to delete cysteine, the preferred primer is AGCAATTTTCAGCAGAAGCTCCTG, which omits the TGT colon for cys. When cysteine is replaced by serine, a 17-nucleotide primer, GCAATTTTCAGAC TCAG, which includes an AGT colon for serine is the primer of choice. The T->A transition of the first base in the cys 17 colon results in changing cysteine to serine.
It must be recognized that when deletions are intro-duced, the proper reading frame for the DNA sequence must be maintained for expression of the desired protein.
., ~~~.~8~

The primer is hybridized to single-stranded phage such as M13, fd, or X174 into which a strand of the IFN-ti gene has been cloned. It will be appreci-ated that the phage may carry either the sense strand or antisense strand of the gene. When the phage car-ries the antisense strand the primer is identical to the region of the sense strand that contains the colon to be mutated except for a mismatch with that colon that defines a deletion'of the colon or a triplet that codes for another amino acid. When the phage carries the sense strand the primer is complementary to the region of the sense strand that contains the colon to be mutated except for an appropriate mismatch in the triplet that is paired with the colon to be deleted.
Conditions that may be used in the hybridization are described by Smith, M. and Gillam, S., supra. The temperature will usually range between about 0°C and 70°C, more usually about 10°C to 50°C. After the hybridization, the primer is extended on the phage DNA
by reaction with DNA polymerise I, T4 DNA polymerise, reverse transcriptase or other suitable DNA polymer-ise. The resulting dsDNA is converted to closed circular dsDNA by treatment with a DNA lipase such as T4 DNA lipase. DNA molecules containing single-stranded regions may be destroyed by S1 endonuclease treatment.
Oligonucleotic7e-directed mutagenesis may be similarly employed to make a mutant IL-2 gene that encodes a mutein having IL-2 activity but having cys 125 changed to serine 125. The preferred oligo-nucleotide primer used in making this mutant IL-2 gene when the phage carries the sense strand of the gene is GATGATGCTTCTGAGAAAAGGTAATC. This oligonucleotide has a C >G change at the middle base on the triplet that is paired with colon 125 of the IL-2 gene.

i3~8~~

The resulting mutational heteroduplex is then used to transform a competent host organism or cell. Replication of the heteroduplex by the host provides progeny from both strands. Following repli-cation the mutant gene may be isolated from progeny of the mutant strand, inserted into an appropriate expression vector, and the vector used to transform a suitable host organism or cell. Preferred vectors are pla smids pBR322, pCRl, and variants thereof, synthetic vectors and the like. Suitable host organisms are E.coli, Pseudomonas, Bacillus subtilis, Bacillus thuringiensis, various strains of yeast, Bacillus thermophilus, animal cells such as mice, rat or Chinese hamster ovary (CHO) cells, plant cells, animal and plant hosts and the like. It must be recognized that when a host of choice is transformed with the vector, appropriate promoter-operator sequences are also introduced in order for the mutein to be expres-sed. Hosts may be prokaryotic or eukaryotic (proces-ses for inserting DNA into eukaryotic cells are des-cribed in PCT applications nos US81/00239 and US81/00240 published 3 September 1981). E.coli and CHO cells are the preferred hosts. The muteins obtained in accordance with the present invention may be glycosylated or unglycosylated depending on the glycosylation occurring in the native parent protein and the host organism used to produce the mutein. If desired, unglycosylated mutein obtained when E.coli or a Bacillus is the host organism, may be optionally glycosylated in vitro by chemical, enzymatic and other types of modifications known in the art.
In the preferred embodiment of the subject invention respecting IFN-fi, the cysteine residue at position 17 in the amino acid sequence of IFN-13, as 1~~8si shown in Figure 1, is changed to serine by a T >A
transition of the first base of codon 17 of the sense strand of the DNA sequence which codes for the mature IFN-l3. The site-specific mutagenesis is induced using a synthetic 17-nucleotide primer GCAATTTTCAGAGTCAG
which is identical to a seventeen nucleotide sequence on the sense strand of IFN-13 in the region of codon 17 except for a single base mismatch at the first base of codon 17. The mismatch is at nucleotide 12 in the primer. It must be recognized that the genetic code is degenerate and that many of the amino acids may be encoded by more than one codon. The base code for serine, for example, is six-way degenerate such that the codons, TCT, TCG, TCC, TCA, AGT, and ACG all code for serine. The AGT codon was chosen for the prefer-red embodiment for convenience. Similarly, threonine is encoded by any one of codons ACT, ACA, ACC and ACG. It is intended that when one codon is specified for a particular amino acid, it includes all degen-erate codons which encode that amino acid. The 17-mer is hybridized to single-stranded M13 phage DNA which carries the antisense strand of the IFN-l3 gene. The oligonucleotide primer is then extended on the DNA
using DNA polymerase I Klenow fragment and the resul-ting dsDNA is converted to closed circular DNA with T4 ligase. Replication of the resulting mutational heteroduplex yiel~3s clones from the DNA strand con-taining the mismatch. Mutant clones may be identified and screened by the appearance or disappearance of specific restriction sites, antibiotic resistance or sensitivity, or by other methods known in the art.
When cysteine is substituted with serine, the T->A
transition, shown in Figure 2, results in the creation of a new HinfI restriction site in the structural 1.34-~8~1 gene. The mutant clone is identified by using the oligonucleotide primer as a probe in a hybridization screening of the mutated phage plaques. The primer will have a single mismatch when hybridized to the parent but will have a perfect match when hybridized to the mutated phage DNA, as indicated in Figure 2.
Hybridization conditions can then be devised where the oligonucleotide primer will preferentially hybridize to the mutated DNA but not to the parent DNA. The newly generated HinfI site also serves as a means of confirming the single base mutation in the IFN-ti gene.
The M13 phage DNA carrying the mutated gene is isolated and spliced into an appropriate expression vector, such as plasmid pTrp3, and E.coli strain MM294 is transformed with the vector. Suitable growth media for culturing the transformants and their progeny are known to those skilled in the art. The expressed mute in of IFN-f3 is isolated, purified and characterized.
The following examples are presented to help in the better understanding of the subject invention and for purposes of illustration only. They are not to be construed as limiting the scope of the invention in any manner. Examples 1-9 describe the preparation of a mutein of IFN-fi. Examples 10-15 describe the preparation of a mutein of IL-2.
Example 1 Cloning of the IFN-fi Gene Into M13 Vector:
The use of M13 phage vector as a source of single-stranded DNA template has been demonstrated by G.F. Temple et al, Nature (1982) 296:537-540. Plasmid pBltrp (Figure 3) containing the IFN-f3 gene under control of E.coli trp promoter, was digested with the restriction enzymes HindIII and XhoII. The M13mp8 -(J. Messing, "Third Cleveland Symposium on Macromolecules: Recombinant DNA," Ed. A Walton, Elsevier Press, 143-153 (1981)) replicative form (RF) DNA (Figure 4) was digested with restriction enzymes HindIII and BamHI, and mixed with the pRltrp DNA which had previously been digested with HindIII and XhoII.
The mixture was then ligated with T4 DNA lipase and the ligated DNA transformed into competent cells of E.coli strain JM 103 and plated on Xgal indicator plates (J. Messing, et al, Nucleic Acids Res (1981) 9:309-321). Plaques containing recombinant phage (white plaques) were picked, inoculated into a fresh culture of JM 103 and minipreps of RF molecules prepared from the infected cells (H.D. Birnboim and J.
Doly, Nucleic Acid Res (1979) 7:1513-1523). The RF
molecules were digested with various restriction enzymes to identify the clones containing the IFN-!3 insert. The restriction map of one such clone (M13-fil) is shown in Figure 5. Single-stranded (ss) phage DNA was prepared from clone M13-131 to serve as a template for site-specific mutagenesis using a syn-thetic oligonucleotide.
Example 2 Site-Specific Mutagenesis:
Forty picomoles of the synthetic oligonu-cleotide GCAATTTTCAGAGTCAG (primer) was treated with T4 kinase in the presence of 0.1 mM adenosine triphos-phate (ATP), 50 mM hydroxymethylaminomethane hydro-chloride (iris-HC1) pH 8.0, 10 mM MgCl2, 5 mM dithio-threitol (DTT) and 9 units of T4 kinase, in 50 ~1 at ~. ~ ~-~ 8 ~ 1 37°C for 1 hr. The kinased primer (12 pmole) was hybridized to 5 ug of ss M13-f31 DNA in 50 ul of a mixture containing 50 mM NaCl, 10 mM Tris-HC1, pH 8.0, mM MgCl2 and 10 mM R-mercaptoethanol, by heating at 5 67°C for 5 min and at 42°C for 25 min. The annealed mixture was then chilled on ice and then added to 50 ~1 of a reaction mixture containing 0.5 mM each of deoxynucleoside triphosphate (dNTP), 80 mM Tris-HC1, pH 7.4, 8 mM MgCl2, 100 mM NaCl, 9 units of DNA
10 polymerase I, Klenow fragment, 0.5 mM ATP and 2 units of T4 DNA ligase, incubated at 37°C for 3 hr and at 25°C for 2 hr. The reaction was then terminated by phenol extraction and ethanol precipitation. The DNA
was dissolved in 10 mM Tris-HC1 pH 8.0, 10 mM
ethylenediaminetetraacetic acid (EDTA), 50$ sucrose and 0.05 bromophenylblue and electrophoresed on 0.8$
agarose gel in the presence of 2 ~g/ml of ethidium bromide. The DNA bands corresponding to the RF forms of M13-X31 were eluted from gel slices by the per-chlorate method (R. W. Davis, et al, "Advanced Bacterial Genetics", Cold Spring Harbor Laboratory, N.Y., p. 178-179 (1980)). The eluted DNA was used to transform competent JM 103 cells, grown overnight and ssDNA isolated from the culture supernatant. This ssDNA was used as a template in a second cycle of primer extension, the gel purified RF forms of the DNA
were transformed into competent JM 103 cells, plated onto agar plates and incubated overnight to obtain phage plaques.

13 4-d g ~ j~

Example 3 Site Specific Mutagenesis:
The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is GCAATTTTCAGACTCAG to change codon 17 of the IFN-Li gene from one that codes for cysteine to one that codes for threonine.
Example 4 Site Specific Deletion:
The experiment of Example 2 above is repeated except that the synthetic oligonucleotide primer used is AGCAATTTTCAGCAGAAGCTCCTG to delete codon 17 of the IFN-f3 gene.
Example 5 Screening And Identification of Mutagenized Plaques:
Plates containing mutated X413-r~l plaques (Example 1) as well as two plates containing unmutated M13-~1 phage plaques, were chilled to 4°C and plaques from each plate transferred onto two nitrocellulose filter circles by layering a dry filter on the agar plate for 5 min for the first .filter and 15 min for the second filter. The filters were then placed on thick filter p~ers soaked in 0.2 N NaOH, 1.5 M NaCl and 0.2~ Triton X-100 for 5 min, and neutralized by layering onto filter papers soaked with 0.5 M Tris-HC1, pH 7.5 and 1.5 M NaCl for another 5 min. The filters were washed in a similar fashion twice on filters soaked in 2 x SSC (standard saline citrate), dried and then baked in a vacuum oven at 80°C for 2 ~.T~~..~t~ ~ca ~ k 13~.a86i hr. The duplicate filters were preh ybridized at 55°C
for 4 hr with 10 ml per filter of DNA hybridization buffer (5 x SSC) pH 7.0, 4 x Denhardt's solution (polyvinylpyrrolidine, ficoll and bovine serum albumin, 1 x = 0.02$ of each), 0.1~ sodium dodecyl sulfate (SDS), 50 mM sodium phosphate buffer pH 7.0 and 100 ~g/ml of denatured salmon sperm DNA.
32p-labeled probe was prepared by kinasing the oligonucleotide primer with 32P-labeled ATP. The filters were hybridized to 3.5 x 105 cpm/ml of 32p_labeled primer in 5 ml per filter of DNA hybridi-zation buffer at 55°C for 24 hr. The filters were washed at 55°C for 30 min each in washing buffers containing 0.1~ SDS and decreasing amounts of SSC.
The filters were washed initially with buffer contain-ing 2 x SSC and the control filters containing unmuta-ted M13-31 plaques were checked for the presence of any radioactivity using a Geiger counter. The concen-tration of SSC was lowered stepwise and the filters washed until no detectable radioactivity remained on the control filters with the unmutated M13-f31 plaques.
The lowest concentration of SSC used was 0.1 x SSC.
The filters were air dried and autoradiographed at -70°C for 2-3 days. 480 plaques of mutated M13-fil and 100 unmutated control plaques were screened with the kinased oligonucleotide probe. None of the control plaques hybri~3ized with the probe while 5 mutated M13-f31 plaques hybridized with the probe.
One of the five mutated M13-f31 plaques ( M13-SY2 501 ) wa s picked and inocul ated in to a cul ture of JM 103. ssDNA was prepared from the supernatant and double-stranded (ds) DNA was prepared from the cell pellet. The ssDNA was used as a template for the dideoxy-sequencing of the clone using the M13 univer-1~4.~8~:~

sal primer. The result of the sequence analysis is shown in Figure 6, confirming that the TGT cys codon has been converted to an AGT ser codon.
Example 6 Expression of Mutated IFN-ti in E.coli:
RF DNA from Pil3-SY2501 was digested with restriction enzymes HindIII and XhoII and the 520 by insert fragment purified on a 1~ agarose gel. The plasmid pTrp3 containing the E.coli trp promoter ( rF figure 7 ) was d igested with the enzymes fiinc~II I and BamHI, mixed with the purified M13-SY2501 DNA frag-ment, and ligated in the presence of T4 DNA ligase.
The ligated DNA was transformed into E.coli strain MM294. Ampicillin resistant transformants were screened fo r sensitivity to the drug tetracycline.
Plasmid DNA from five ampicillin resistant, tetra-cylcine sensitive clones were digested with Hinfi to screen for the presence of the M13-SY2501 insert.
Figure 8a shows the HinfI restriction pattern of one of the clones (pSY2501), comparing it with the HinfI
pattern of the original IFN-f3 clone, pf3ltrp. As expected, there is an additional HinfI site in pSY2501, cleaving the 197 by IFN-f3 internal fragment to a 169 by fragment and a 28 by fragment (Figure 8b). A restriction map of the clone pSY2501 is shown in Figure 9. The complete DNA sequence of the mutant IFN-f3 gene is shown in Figure 10 together with the predicted amino acid sequence.
The plasmid designated as clone pSY2501 is on deposit with the Agricultural Research Culture Collection (NRRL), Fermentation Laboratory, Northern Rec3ional Research Center, Science and Education 13~~8~:~

Administration, U.S. Department of Agriculture, 1815 North University Street, Peoria, Illinois 60604 and is assigned accession numbers CMCC No. 1533 and NRRL
No. B-15356.
Cultures of pSY2501 and pr3ltrp, which include progeny thereof, were grown up to an optical density (OD600) of 1Ø Cell free extracts were prepared and the amount of IFN-f3 antiviral activity assayed on GM2767 cells in a microtiter assay.
Extracts of clone pSY2501 exhibited three to ten times higher activity than pBltrp (Table I), indicating that clone pSY2501 was either synthesizing more protein exhibiting IFN-f3 activity or that the protein made had a higher specific activity.
Table I
EXTRACT ANTIVIRAL ACTIVITY (U/ml) pSY2501 6 x 105 pl3ltrp 1 x 105 ptrp3 (control) 30 In order to determine if clone pSY2501 was synthesizing several times more active protein, the extracts of both clones were electrophoresed on a SDS
polyacrylamide gel together with a control extract and the gel stained with coomasie blue to visualize the proteins. As shown in Figure 11, there was only one protein band corresponding to an apparent 18,000 dalton protein that was present in the extracts of clones pSY2501 and pBltrp but not in the control extract of ptrp3. This protein, which has a molecular weight of about 20,000 daltons but shows a gel migra-tion pattern of an 18,000 dalton protein was ~3~-~8~~
-20- ' previously shown to be IFN-t3 by purification of this protein from extracts of pf3ltrp. Since there is less of this protein in extracts of pSY2501 than in extracts of pBltrp, the specific activity of the pro-s tein in extracts of clone pSY2501 was higher than that of clone pBltrp.
Example 7 Purification of IFN-Liserl7' IFN-Rserl7 was recovered from E.coli that had been transformed to produce IFN-f3ser17' The E.coli were grown in the following growth medium to an O D of 10-11 at 680 nm (dry wt 8.4 g/1).
Ingredient Concentration PdH4C1 20 mM

K2S04 16.1 mM

KH2p04 7.8 mM

Na2HP04 12.2 mM

MgS04 '7H20 3 mM

rda3 citrate ' 2H20 1. 5 mM

MnS04 '4H20 30 ~M

ZnS04 ' 7H20 30 ~M

CuS04 '5H2o 3 uM

L-tryptophan 70 mg/1 FeS04 7H20 72 ~M

thiamine 'HC1 20 mg/1 glucose 40 g/1 pH control with NH40H

A 9.9 1 (9.9 kg) harvest of the transformed E.coli was cooled to 20°C and concentrated by passing the harvest through a cross-flow filter at an average ~.'~ ~ 8 ~ ~.

pressure drop of 110 kpa and steady-state filtrate flow rate of 260 ml/min until the filtrate weight was 8.8 kg. The concentrate (approximately one liter) was drained into a vessel and cooled to 15°C. The cells in the concentrate were then disrupted by passing the concentrate through a Manton-Gaulin homogenizes at 5°C, 69,000 kpa. The homogenizes was washed with one liter phosphate buffered saline, pH 7.4 (PBS), and the wash was added to the disruptate to give a final vol-ume of two liters. This volume was continuously cen-trifuged at 12000 x g at a 50 ml/min flow rate. The solid was separated from the supernatant and resus-pended in four liters PBS containing 2~ by wt SDS.
This suspension was stirred at room temperature for 15 min after which there was no visible suspended mater-ial. The solution was then extracted with 2-butanol at a 1:1 2-butanol:solution volume ratio. The extrac-tion was carried out in a liquid-liquid phase separa-tor using a flow rate of 200 ml/min. The organic phase was then separated and evaporated to dryness to yield 21.3 g of protein. This was resuspended in distilled water at a 1:10 volume ratio.
The recovered product was assayed for human IFN-f3 activity using an assay based on protection against viral cytopathic effect (CPE). The assay was made in microtiter plates. Fifty ~1 of minimum essen-tial medium were charged into each well and 25 ul of the sample was placed in the first well and 1:3 volume dilutions were made serially into the following wells.
Virus (vesicular stomatitus), cell (human fibroblast line GD4-2767), and reference IFN-R controls were included on each plate. The reference IFN-f3 used was 100 units per ml. The plates were then irradiated with UV light for 10 min. After irradiation 100 ~1 of i 13~8~i the cell suspension (1.2 x 105 cells/ml) was added to each well and the trays were incubated for 18-24 hr.
A virus solution at one plaque-forming unit per cell was added to each well except the cell control. The trays were then incubated until the virus control showed 100$ CPE. This normally occurred 18-24 hr after adding the virus solution. Assay results were interpreted in relation to the location of the 50$ CPE
well of the reference IFN-fi control. From this point the titer of interferon for all samples on the plate was determined. The specific activity of the recov-ered product was determined to be 5 x 107 U/mg.
Ex ampl a 8 Acid Precipitation And Chromatographic Purification The process of Example 7 was repeated except that after extraction and separation of the aqueous and organic phases and mixing of the organic phase with PBS at a volume ratio of 3:1 the pH of the mix-ture was lowered to about 5 by addition of glacial acetic acid. The resulting precipitate was separated by centrifugation at 10000-17000 x g for 15 min and the pellet was redissolved in 10$ w/v SDS, 10 mM DTT, 50 mM sodium acetate buffer, pH 5.5, and heated to 80°C for 5 min.
The solution was then applied to a Brownlee*
RP-300, 10 uM, "Aquapore"*column using a Beckman gradient system. Buffer A was 0.1$ trifluoroacetic acid (TFA) in H20; buffer B was 0.1$ TFA in acetoni-trile. Detection was by ultraviolet absorbance at 280 nm. The solvent program was linear gradient of 0$
buffer B to 100 buffer B in three hr. Fractions containing highest interferon activities were pooled * TRADE MARK

13~~861 and the specific activity of the pooled interferon preparation was determined to be 9.0 x 107 to 3.8 x 108 international units per mg protein, as compared to about 2 x 108 O/mg for native IFN-B.
Ex ampl a 9 Biochemical Characterization of IFN-f3 Serl7 Amino acid compositions were determined after 24-72 hr timed hydrolysis of 40 ug samples of IFN in 200 ~1 of 5.7 N HC1, 0.1~ phenol, at 108°C.
Proline and cysteine were determined in the same fashion after performic acid oxidation; in this case, phenol was omitted from the hydrolysis. Tryptophan was analyzed after 24 hr hydrolysis of 400 ~1 samples in 5.7 N HC1, 10$ mercaptoacetic acid (no phenol).
Analysis was performed on a Beckman 121MB amino acid analyzer using a single column of AA10 resin.
The amino acid composition calculated from representative 24-,48-, 72-hr acid hydrolyses of purified IFN-f3 Serl7 agrees well with that predicted by the DNA sequence of the clones IFN gene, minus the missing Pd-terminal methionine.
The amino acid sequence of the first 58 residues from the amino acic9 terminus of purified IFN
was determined on a 0.7 mg sample in a Beckman 890C
sequanator with 0.1 M ~uadrol buffer. PTH amino acids were determined by reverse-phase HPLC on an Altex ultrasphere ODS column (4.6 x 250 mm) at 45°C eluted at 1.3 min at 40$ buffer B, and 8.4 min from 40-70$
buffer B, where buffer A was 0.0115 M sodium acetate, 5$ tetrahyd rofuran (THF), pH 5.11 and buffer B was 10$
THF in acetonitrile.

~3~-0~~~

The N-terminal amino acid sequence of IFN-f3 Serl7 determined matches the expected sequence predic-ted from the DNA sequence, except for the absence of N-terminal methionine.
As indicated above, the IFN-f3ser17 Prepara-tion exhibits specific activity levels very close to or better than that of native IFN-f3. IFN-f3ser17 has no free sulfhydryl groups but indicates one -S -S- bond between the only remaining cysteines at positions 31 and 141. The protein does not readily form oligomers and appears to be substantially in the monomeric form.
The IFN-f3ser17 obtained in accordance with this inven-tion may be formulated either as a single product or mixtures of the various forms, into pharmaceutically acceptable preparations in inert, nontoxic, nonaller-genic, physiologically compatible carrier media for clinical and therapeutic uses in cancer therapy or in conditions where interferon therapy is indicated and for viral infections. Such media include but are not limited to distilled water, physiological saline, Ringer's solution, Hank's solution and the like.
Other nontoxic stabilizing and solubilizing additives such as dextose, HSA (human serum albumin) and the like may be optimally included. The therapeutic formulations may he administered orally or paren-terally such as intravenous, intramuscular, intraperi-toneal and subcutaneous administrations. Preparations of the modified IFN-3 of the present invention may also be used for topical applications in appropriate media normally utilized for such purposes.
The principal advantages of the above des-cribed mutein of IFN-fi lie in the elimination of a free sulfhydryl group at position 17 in IFN-R, thereby forcing the protein to form correct disulfide links 13~.08~~, between cys 31 and cys 141 and to assume the confor-mation ostensibly required for full biological activ-ity. The increased specific activity of the IFN-f3ser17 enables the use of smaller dosages in therapeutic uses. By deleting the cysteine at posi-tion 17 and eliminating the free -SH group, the IFN-f3ser17 protein does not form dimers and oligomers so readily as the microbially produced IFN-J3. This facilitates purification of the protein and enhances its stability.
Example 10 The nucleotide sequence for a cDNA clone coding for human IL-2, procedures for preparing IL-2 cDNA libraries, and screening same for IL-2 are des-cribed by Taniguchi, T., et al, Nature (1983) Vol 24, p 305 et seq.
cDNA libraries enriched in potential IL-2 cDNA clones were made from an IL-2 enriched mRNA
fractions obtained from induced peripheral blood lymphocytes (PBL) and Jurkat cells by conventional procedures. The enrichment of the mRNA for IL-2 message was made by fractionating the mRNA and identi-f ying the fraction having IL-2 mRNA activity by injec-ting the fractions in Xenopus laevis oocytes and assaying the oocyte lysates for IL-2 activity on HT-2 cells (J. Watson, J Exp Med (1979) 150:1570-1519 and S. Gillis et al, J Immun (1978) 120:2027-2032.) Example 11 Screening and Identification of IL-2 cDNA Clones The IL-2 cDNA libraries were screened using the colony hybridization procedure. Each microtiter plate was replicated onto duplicate nitrocellulose filter papers (S & S type BA-85) and colonies were allowed to grow at 37°C for 14-16 hr on L agar con-taining 50 ug/ml ampicillin. The colonies were lysed and DNA fixed to the filter by sequential treatment for 5 min with 500 mM NaOH, 1.5 M NaCl, washed twice for 5 min each time with 5 x standard saline citrate (SSC). Filters were air dried and baked at 80°C for 2 hr. The duplicate filters Were pre-hybridized at 42°C
for 6-8 hr with 10 ml per filter of DNA hybridization buffer (50$ formamide, 5 x SSC, pH 7.0, 5 x Denhardt's solution (polyvinylpyrrolidine, plus ficoll and bovine serum albumin; 1 x = 0.2~ of each), 50 mM sodium phos-phate buffer at pH 7.0, 0.2$ SDS, 20 Ng/ml Poly U, and 50 ug/ml denatured salmon sperm DNA.
A 32P-labeled 20-mer oligonucleotide probe was prepared based on the IL-2 gene sequence reported by Taniguchi, T., et al, supra. The nucleotide sequence of the probe was GTGGCCTTCTTGGGCATGTA.
The samples were hybridized at 42°C for 24-36 hr with 5 ml/filter of DNA hybridization buffer containing the 32P cDNA probe. The filters were washed two times for 30 min each time at 50°C with 2 x SSC, 0.1$ SDS, then washed twice with 1 x SSC and 0.1~ SDS at 50°C for 90 min, air dried, and autoradio-graphed at -70°C for 2 to 3 days. Positive clones were identified and rescreened with the probe. Full length clones were identified and confirmed by res-triction enzyme mapping and comparison with the 1~~-~8~1 sequence of the IL-2 cDNA clone reported by Taniguchi, T., et al, supra.
Ex ampl a 12 Cloning of I1-2 Gene into M13 Vector The IL-2 gene was cloned into M13mp9 as described in Example 1 using the plasmid pLWl (Figure 12) containing the IL-2 gene under the control of the E.coli trp promoter. A sample of pLWl was deposited in the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, USA, on 4 August 1983 and has been assigned ATCC num ber 39,405. The restriction map of one clone (desig-nated M13-IL2) containing the IL-2 insert is shown in Figure 13. Single-stranded phage DNA was prepared from clone M13-IL2 to serve as a template for oligonucleotide-directed mutagenesis.
Example 13 Oligonucleotide-directed Mutagenesis As inc7icated previously, IL-2 contains cys-teine residues at amino acid positions 58, 105 and 125. Based on the nucleotide sequences of the por-tions of the IL-2 gene that contain the codons for these three cysteine residues three oligonucleotide primers were designed and synthesized for mutating the codons for these residues to codons for serine. These oligonucleotides have the following sequences.
CTTCTAGAGACTGCAGATGTTTC (DM27) to change cys 58, CATCAGCATACTCAGACATGAATG (DM28) to change cys 105 and GATGATGCTCTGAGAAAAGGTAATC (DM29) to change cys 125.

13~-U~6.~

Forty picomoles of each oligonucleotide were kinased separately in the presence of 0.1 mM ATP, 50 mM Tris-HC1, pH 8.0, 10 mM MgCl2. 5 mM DTT and 9 units of T4 kinase in 50 ~1 at 37°C for 1 hr. Each of the kinased primers (10 pmoles) was hybri~3ized to 2.6 ~g of ss M13-IL2 DNA in 15 girl of a mixture con-taining 100 mM NaCl, 20 mM Tris-HC1, pH 7.9, 20 mM
MgCl2 and 20 rnM f3-mercaptoethanol, by heating at 67°C
for 5 min and 42°C for 25 min. The annealed mixtures were chilled on ice and then adjusted to a final colume of 25 ~1 of a reaction mixture containing 0.5 mM of each dNTP, 17 mM Tris-HC1, pH 7.9, 17 mM
MgCl2, 83 mM NaCl, 17 mM fi-mercaptoethanol, 5 units of DNA polymerase I Klenow fragment, 0.5 mM ATP and 2 units of T4 DNA ligase, incubated at 37°C for 5 hr.
The reactions were terminated by heating to 80°C and the reaction mixtures used to transform competent JM103 cells, plated onto agar plates and incubated overnight to obtain phage placques.
Example 14 Screening and Identification of Mutagenized Phage Placques Plates containing mutagenized M13-IL2 placques as well as 2 plates containing unmutagenized M13-IL2 phage placques, were chilled to 4°C and phage placques from each plate were transferred onto two nitrocellulose filter circles by layering a dry filter on the agar plate for 5 min for the first filter and 15 min for the second filter. The filters were then placed on thick filter papers soaked in 0.2 N NaOH, 1.5 M NaCl and 0.2$ Triton for 5 min, and neutralized 134-~g~6~

by layering onto filter papers soaked with 0.5 M
Tris-HC1, pH 7.5, and 1.5 M NaCl for another 5 min.
The filters were washed in a similar fashion twice on f filters soaked in 2 x SSC, dried and then baked in a vacuum oven at 80°C for 2 hr. The duplicate filters were pre-hybridized at 42°C for 4 hr with 10 ml per filter of DNA hybridization buffer (5 x SSC, pH 7.0, 4 x Denhardts solution (polyvinylpyrrolidine, ficoll and bovin serum albumin, lx = 0.02 of each), 0.1$
SDS, 50 mM sodium phosphate buffer, pH 7.0 and 100 ~g/ml of denatured salmon sperm DNA. 32P-labelled probes were prepared by kinasing the oligonucleotide primers with labelled ATP. The filters were hybri-dized to 0.1 x 105 cpm/ml of 32P-labelled primers in 5 ml per filter of DNA hybridization buffer at 42°C
for 8 hr. The filters were washed twice at 50°C for 30 min each in washing buffers containing 0.1~ SDS and 2 x SSC, and twice at 50°C for 30 min each with 0.1$
SDS and 0.2 x SSC. The filters were air dried and autoradiographed at -70°C for 2-3 days.
Since the oligonucleotide primers DM28 and DM29 were designed to create a new DdeI restriction site in the mutagenized clones (Figure 14), RF-DNA
from a number of the clones which hybridized with each of these kinased primers were digested with the res-triction enzyme DdeI. One of the mutagenized M13-IL2 placques which hybridized with the primer DM28 and has a new DdeI restriction site (M13-LW44) was picked and inoculated into a culture of JM103, ssDNA was prepared from the culture supernatant and dsRF-DNA was prepared from the cell pellet. Similarly, a placque which hybridized with primer DM29 was picked (M13-LW46) and ssDNA and RF-DNA prepared from it. The oligonucleo-tide primer DM27 was designed to create a new PstI

1~~-n8u~

restriction site instead of a DdeI site. Therefore, the placques that hybridized to this primer were screened for the presence of a new PstI site. One such phage placque was identified (M13-LW42) and ssDNA
and RF-DNA prepared from it. The DNA from all three of these clones were sequenced to confirm that the target TGT colons for cysteine had been converted to a TCT colon for serine.
Example 15 Recloning of the Mutagenized IL-2 Gene for Expression ., T~ i.r,'1 ;
RF-DNA from M13-LW42, M13-LW44 and M13-LW46 were each digested with restriction enzymes HindIII
and BanII and the insert fragments purified from a 1~
agarose gel. Similarly, the plasmid pTrp3 (Figure 7) was digested with HindIII and BanII, the large plasmid fragment containing the trp promoter was purified on an agarose gel and then ligated with each of the insert fragments isolated from M13-LW42, M13-LW44 and M13-LW46. The ligated plasmids were transformed into competent E.coli K12 strain MM294. The plasmid DNAs from these trans.formants were analysized by restric-tion enzyme mapping to confirm the presence of the plasmids pLW42, pLW44 and pLW46. Figure 14 is a restriction map of pLW46. When each of these individ-ual clones were grown in the absence of tryptophane to induce the trp promoter and cell free extracts analyzec9 on SDS-polyacrylamide gels, all three clones, pLW42, pLt444 and pLW46, were shown to synthesize a 14.5 kd protein similar to that found in the positive control, pLW2l, which has been demonstrated to syn-thesize a 14.4 kd IL-2 protein. When these same 13~-0861 extracts were subjected to assay for IL-2 activity on mouse HT-2 cells, only clones pLW21 (positive control) and pLW46 had significant amounts of IL-2 activity (Table II below), indicating that cys 58 and cys 105 are necessary for biological activity and changing them to serines (pLW42 and pLW44 respectively) resulted in the loss of biological activity. Cys 125 on the other hand must not be necessary for biological activity because changing it to ser 125 (pLW46) did not affect the biological activity.
T~hlo TT
Clones IL-2 Activity (u/ml) pIL2-7 (negative control) 1 pLW21 (positive control) 113,000 pLW42 660 pLW44 1,990 pLW46 123,000 Figure 15a shows the nucleotide sequence of the coding strand of clone pLW46. As compared to the coding strand of the native human IL-2 gene clone pLW46 has a single base change of G -~ C at nucleo-tide 374. Figure 15b shows the corresponding amino acid sequence of the IL-2 mutein encoded by pLW46.
This mutein is designated IL-2ser125 As compared to native IL-2 the mutein has a serine instead of a cysteine at position 125.
A sample of E.coli K12 strain MM294 trans-formed with pLW46 was deposited in the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, USA on 26 September 1983 and has been assigned ATCC Number 39,452.

13.0861.

Muteins of IL-2 in which the cysteine at position 125 has been deleted or replaced with another amino acid, such as the mutein IL-2ser125 retain IL-2 activity. They may, therefore, be formulated and used in the same manner as native IL-2. Accordingly, such IL-2 muteins are useful in the diagnosis and treatment of bacterial, viral, parasitic, protozoan and fungal infections; in manifestations of lymphokine or immuno-deficiency; for reconstitution of normal immunofunc-tion in aged humans and animals; in the development of diagnostic assays such as those employing enzyme amplification, radiolabelling, radioimaging, and other methods known in the art for monitoring IL-2 levels in the diseased state; for the promotion of T cell growth in vitro for therapeutic and diagnostic purposes for blocking receptor sites for lymphokines; and in various other therapeutic, diagnostic and research applications. The various therapeutic and diagnostic applications of human IL-2 have been investigated and reported in S.A. Rosenberg, E.A. Grimm, et al, A.
Mazumder, et al, and E.A. Grimm and S.A. Rosenberg.
IL-2 muteins may be used by themselves or in combina-tion with other immunologically relevent B or T cells or other therapeutic agents. For therapeutic or diag-nostic applications, they may be formulated in non-toxic, nonallergenic, physiolocally compatable carrier media such as distilled water, Ringer's solution, Hank's solution, physiological saline and the like.
Administrations of the IL-2 muteins to humans or animals may be oral or intraperitoneal or intramus-cular or subcutaneous as deemed appropriate by the physician. Examples of relevant cells are B or T
cells, natural killer cells, and the like and exem-plary therapeutic reagents which may be used in ..

combination with the polypeptides of this invention are the various interferons, especially gamma inter-feron, B cell growth factor, IL-1 and the like.

Claims (80)

1. A synthetic mutein of a biologically active protein having at least one cysteine residue that is free to form a disulfide link and is non-essential to said biological activity, characterized in that said mutein has at least one of said cysteine residues replaced by another amino acid, and in the case of interferon-.beta., the cysteine residue has been deleted or replaced with another amino acid.

2. The synthetic mutein of claim 1 further characterized in that there is only one of said cysteine residues.

3. The synthetic mutein of claim 1, which comprises the (Met-1) form thereof.

4. The synthetic mutein of claim 1 further characterized in that said cysteine residues are replaced by serine, threonine, glycine, alanine, valine, leucine, isoleucine, histidine, tyrosine, phenylalanine, tryptophan, or methionine.

5. The synthetic mutein of claim 4, which comprises the (Met-1) form thereof.

6. The synthetic mutein of claim 1 further characterized in that said cysteine residues are replaced by serine or threonine.

7. The synthetic mutein of claim 1 further characterized in that the mutein is unglycosylated.

8. The synthetic mutein of claim 1 further characterized in that the protein is IFN-.beta., IL-2, tumor necrosis factor, colony stimulating factor-1, or IFN-.alpha. 1.

9. The synthetic mutein of claim 8, which comprises the (Met-1) form thereof.

10. A structural gene characterized in that the gene has a DNA sequence that encodes the synthetic mutein of claim 1.

11. A structural gene characterized in that the gene has a DNA sequence that encodes the synthetic mutein of claim 2 or 3.

12. A structural gene characterized in that the gene has a DNA sequence that encodes the synthetic mutein of claim 4 or 5.

13. A structural gene characterized in that the gene has a DNA sequence that encodes the synthetic mutein of claim 6 or 7.

14. A structural gene characterized in that the gene has a DNA sequence that encodes the synthetic mutein of claim 8 or 9.

15. An expression vector characterized in that the vector includes the structural gene of claim 10 in a position that permits expression thereof.

16. An expression vector characterized in that the vector includes the structural gene of Claim 11 in a position that permits expression thereof.

17. An expression vector characterized in that the vector includes the structural gene of Claim 12 in a position that permits expression thereof.

18. An expression vector characterized in that the vector includes the structural gene of Claim 13 in a position that permits expression thereof.

19. An expression vector characterized in that the vector includes the structural gene of Claim 14 in a position that permits expression thereof.

20. A host cell or microorganism characterized in that the host cell or microorganism is transformed with the expression vector of Claim 15 and progeny thereof.

21. A host cell or microorganism characterized in that the host cell or microorganism is transformed with the expression vector of Claim 16 and progeny thereof.

22. A host cell or microorganism characterized in that the host cell or microorganism is transformed with the expression vector of Claim 17 and progeny thereof.

23. A host cell or microorganism characterized in that the host cell or microorganism is transformed with the expression vector of Claim 18 and progeny thereof.

24. A host cell or microorganism characterized in that the host cell or microorganism is transformed crith the expression vector of Claim 19 and progeny thereof.

25. E.coli characterized in that the E.coli is transformed with the expression vector of Claim 15, 16, or 17 and progeny thereof.

26. E.coli characterized in that the E.coli is transformed with the expression vector of Claim 18 or 19 and progeny thereof.

27. A process for making a synthetic mutein characterized in culturing the host or progeny of Claim 20, 21, or 22 and harvesting the synthetic mutein from the culture.

28. A process for making a synthetic mutein characterized in culturing the host or progeny of claim 23 or 24 and harvesting the synthetic mutein from the culture.

29. A method of preventing a protein having at least one cysteine residue that is free to form a disulfide link from forming said link and is non-essential to said biological activity characterized by mutationally altering the protein by replacing the cysteine residue with another amino acid or by deleting or replacing the cysteine residue when the protein IFN-.beta.

30. The method of claim 29 further characterized in that the protein is biologically active and the cysteine is not essential to said biological activity.

31. The method of claim 29 or 30 further characterized in that the cysteine residue is replaced with serine or threonine.

32. A method for making the gene of claim 10 characterized by:
(a) hybridizing single-stranded DNA comprising a strand of a structural gene that encodes said protein with a mutant oligonucleotide primer that is complementary to a region of said strand that includes the codon for said cysteine residue or the antisense triplet paired with said codon, as the case may be, except for a mismatch with said codon or said antisense triplet that defines a triplet that codes for said other amino acid or defines a deletion of the codon or a triplet that codes for said other amino acid when said protein is IFN-.beta. ;
(b) extending the primer with DNA polymerase to form a mutational heteroduplex; and (c) replicating said mutational heteroduplex.

33. The method of claim 32 further characterized in that the mismatch defines a triplet that codes for serine or threonine.

34. The method of claim 32 further characterized in that the single-stranded DNA is a single-stranded phage that includes said strand and the mutational heteroduplex of step (b) is converted to closed circular heteroduplex.

35. The method of claim 32 further characterized in that said replicating is effected by transforming a cotapetent bacterial host with the closed circular heteroduplex and culturing the resulting transformants.

36. The method of claim 32 further characterized by the additional steps of isolating progeny of the mutant strand of the heteroduplex, isolating DNA
from said progeny, and isolating said gene from the DNA from said progeny.

37. The method of claim 32 further characterized in that the protein is human IFN-.beta., the cysteine residue is at position 17, and the mismatch defines a codon for serine.

38. The method of claim 33 further characterized in that the protein is human IFN-.beta., the cysteine residue is at position 17, and the mismatch defines a codon for serine.

39. The method of claim 34 further characterized in that the protein is human IFN-.beta., the cysteine residue is at position 17, and the mismatch defines a codon for serine.

40. The method of claim 35 further characterized in that the protein is human IFN-.beta., the cysteine residue is at position 17, and the mismatch defines a codon for serine.

41. The method of claim 36 further characterized in that the protein is human IFN-.beta., the cysteine residue is at position 17, and the mismatch defines a codon for serine.

42. The method of claim 37, 38 or 39 further characterized in that the strand is the antisense strand of IFN-.beta. and the mutant oligonucleotide primer is GCAATTTTCAGAGTCAG.

43. The method of claim 40 or 41 further characterized in that the strand is the antisense strand of IFN-.beta. and the mutant oligonucleotide primer is GCAATTTTCAGAGTCAG.

44. The method of claim 32, 33 or 34 further characterized in that the protein is human IL-2, the cysteine residue is at position 125 and the mismatch defines a codon that codes for serine.

45. The method of claim 35 or 36 further characterized in that the protein is human IL-2, the cysteine residue is at position 125 and the mismatch defines a codon that codes for serine.

46. An oligonucletide for use in making the structural gene of claim 10 by oligonucleotide-directed mutagenesis characterized in that the oligonucleotide has a nucleotide sequence that is complementary to a region of the strand of the structural gene that includes the codon for the cysteine residue or the antisense triplet paired with said codon, as the case may be, except for a mismatch with said codon that defines a triplet that codes for said other amino acid, or when the protein is IFN-.beta., defines a deletion of the codon a triplet that codes for said other amino acid.

47. Plasmid pSY2501.

48. Bacteria characterized in that the bacteria are transformed with plasmid pSY2501, and progeny thereof.

49. The bacteria of claim 48 further characterized in that the bacteria are E.coli.

50. Plasmid pLW46.

51. Bacteria characterized in that the bacteria are transformed with plasmid pLW46, and progeny thereof.

52. The bacteria of claim 51 further characterized in that the bacteria are E.coli.

53. Human-like interleukin-2 mutein, wherein the cysteine at position 125, numbered in accordance with native human interleukin-2, is replaced by a neutral amino acid, wherein said mutein exhibits the biological activity of native human interleukin-2.

54. The mutein of claim 53 wherein said neutral amino acid is serine.

55. Human recombinant alanyl-interleukin-2 serine 125 mutein.

56. The mutein of claim 53, 54 or 55, which comprises the (Met-1) form thereof.

57. Human recombinant des-alanyl-interleukin-2 serine 125 mutein.

58. Human recombinant interleukin-2 serine 125 stein which exhibits the biological activity of native human interleukin-2 and which has the deduced amino acid sequence as represented in Figure 15b with and without N-terminal methionine.

59. The mutein of claims 53, 55 and 58 wherein the mutein is unglycosylated.

60. Human-like interferon-.beta. mutein, wherein the cysteine at position 17, numbered in accordance with native interferon-.beta., is deleted or replaced by a neutral amino acid. wherein said mutein exhibits the biological activity of native human interferon-.beta..

61. The synthetic mutein of claim 60 wherein said cysteine residue has been replaced by an amino acid selected from the group consisting of serine, threonine, glycine, alanine, valine, leucine, isoleucine, histidine, tyrosine, phenylalanine, tryptophan or methionine.

62. The synthetic mutein of claim 60 wherein said cysteine residue has been replaced by an amino acid selected from the group consisting of serine or threonine.

63. The synthetic mutein of claim 60 wherein the mutein is unglycosylated.

64. Biologically active human recombinant IFN-.beta. ser 17 mutein.

65. Biologically active recombinant human IFN-.beta. ser 17 mutein represented by the following amino acid sequence:

ATG AGC TAC AAC TTG CTT GGA TTC CTA CAA AGA AGC AGC AAT TTT CAG ~ CAG AAG CTC
met ser tyr asn leu leu gly phe leu gln arg ser ser asn phe gln ~ gln lys leu CTG TGG CAA TTG AAT GGG AGG CTT GAA TAT TGC CTC AAG GAC AGG ATG AAC TTT GAC
ATC
leu trp gln leu asn gly arg leu glu tyr cys leu lys asp arg met asn phe asp ile CCT GAG GAG ATT AAG CAG CTG CAG CAG TTC CAG AAG GAG GAC GCC GCA TTG ACC ATC
TAT
pro glu glu ile lys gln leu gln gln phe gln lys glu asp ala ala leu thr ile tyr GAG ATG CTC CAG AAC ATC TTT GCT ATT TTC AGA CAA GAT TCA TCT AGC ACT GGC TGG
AAT
glu met leu gln asn ile phe ala ile phe arg gln asp ser ser ser thr gly trp asn GAG ACT ATT GTT GAG AAC CTC CTG GCT AAT GTC TAT CAT CAG ATA AAC CAT CTG AAG
ACA
glu thr ile val glu asn leu leu ala asn val tyr his gln ile asn his leu lys thr GTC CTG GAA GAA AAA CTG GAG AAA GAA GAT TTC ACC AGG GGA AAA CTC ATG AGC AGT
CTG
val leu glu glu lys leu glu lys glu asp phe thr arg gly lys leu met ser ser leu CAC CTG AAA AGA TAT TAT GGG AGG ATT CTG CAT TAC CTG AAG GCC AAG GAG TAC AGT
CAC
his leu lys arg tyr tyr gly arg ile leu his tyr leu lys ala lys glu tyr ser his TGT GCC TGG ACC ATA GTC AGA GTG GAA ATC CTA AGG AAC TTT TAC TTC ATT AAC AGA
CTT
cys ala trp thr ile val arg val glu ile leu arg asn phe tyr phe ile asn arg leu ACA GGT TAC CTC CGA AAC TGA AGA TC
thr gly tyr leu arg asn ***

66. The mutein of claim 1 prepared by mutationally altering said protein by replacing the cysteine residue with another amino acid and in the case of interferon-.beta., by deleting the cysteine residue or replacing the cystein1 residue with another amino acid.

67. The mutein of claim 66 prepared by (a) culturing host cells or organisms transformed with an expression vector which is in a position permitting expression thereof and which includes a structural gene having a DNA sequence which encodes the mutein, and (b) harvesting the mutein from the culture.

68. Human-like interleukin-2 mutein, wherein the cysteine at position 125, numbered in accordance with native human interleukin-2, is replaced by a neutral amino acid, wherein said mutein exhibits the biological activity of native human interleukin-2 and wherein said mutein is prepared by mutationally altering native human interleukin-2 by replacing said cysteine residue with said neutral amino acid.

69. The mutein of claim 68 prepared by (a) culturing host cells or organisms transformed with an expression vector which is in a position permitting expression thereof and which includes a structural gene having a DNA sequence which encodes the mutein, and (b) harvesting the mutein from the culture.

70. The mutein of claim 67 wherein the host cells are bacteria and the expression vector is pLW46.

71. The mutein of claim 70 wherein the host cells are E. coli.

72. The mutein of claim 68 wherein said neutral amino acid is selected from the group consisting of serine, threonine, glycine, alanine, valine, leucine, isoleucine, histidine, tyrosine, phenyladanine, tryptophan or methionine.

73, Human-like interferon-.beta. mutein, wherein the cysteine at position 17, numbered in accordance with native,interferon-.beta., is deleted or replaced by a neutral amino acid, wherein said mutein exhibits the biological activity of native human interferon-.beta. and wherein said mutein is prepared by mutationally altering native human interferon-.beta. by deleting said cysteine residue or replacing said cysteine residue with said neutral amino acid.

74. The mutein of claim 73 prepared by (a) culturing host cells or organisms transformed with an expression vector which is in a position permitting expression thereof and which includes a structural gene having a DNA sequence which encodes the mutein, and (b) harvesting the mutein from the culture.

75. The mutein of claim 74 wherein the host cells are bacteria and the expression vector is pSY2501.

76. The mutein of claim 75 wherein the host cells are E. coli.

77. Plasmid pLW1.

78. In a method for diagnosing and monitoring for infectious diseases by enzyme amplification radio labelling or radio imaging, the improvement comprising using the mutein of claim 1, 2 or 3.

79. In a method for diagnosing and monitoring for infectious diseases by enzyme amplification radio labelling or radio imaging, the improvement comprising using the mutein of claim 4, 5 or 6.

80. In a method for diagnosing and monitoring for infectious diseases by enzyme amplification radio labelling or radio imaging, the improvement comprising using the mutein of claim 7, 8, or 9.