AU641816B2 - Expression of biologically active PDGF analogs in eucaryotic cells - Google Patents
Expression of biologically active PDGF analogs in eucaryotic cells Download PDFInfo
- Publication number
- AU641816B2 AU641816B2 AU86957/91A AU8695791A AU641816B2 AU 641816 B2 AU641816 B2 AU 641816B2 AU 86957/91 A AU86957/91 A AU 86957/91A AU 8695791 A AU8695791 A AU 8695791A AU 641816 B2 AU641816 B2 AU 641816B2
- Authority
- AU
- Australia
- Prior art keywords
- chain
- pdgf
- amino acid
- protein
- chains
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
AUSTRALIA
PATENTS ACT 1990 COMPLETE SPECIFICATION FOR A STANDARD PATENT
ORIGINAL
S F Ref: 196560 0O 9.
9 *Og S *54 e S 50 ,e 5*
S
6*eg
SS
S
CS
Name and Address of Applicant: Actual Inventor(s): Address for Service: Invention Title: ZymoGenetics, Inc 4225 Roosevelt Way, N.E.
Seattle Washington 98105 UNITED STATES OF AMERICA Mark 3. Murray and James D. Kelly Spruson Ferguson, Patent Attorneys Level 33 St Martins Tower, 31 Market Street Sydney, New South Wales, 2000, Australia Expression of Biologically Active PDGF Analogs in Eucaryotic Cells *4
S
The following statement is a full description of this invention, including the best method of performing it known to me/us:- Description EXPRESSION OF BIOLOGICALLY ACTIVE PDGF ANALOGS IN EUCARYOTIC CELLS Technical Field The present invention relates to the production of PDGF analogn in general, and more specifically, to the expression of biologically active PDGF analogs in eucaryotes.
Background Art Human platelet-derived growth factor (PDGF) has been shown to be the major mitogenic protein in serum for mesenchymal derived cells. This is well documented by numerous studies of platelet extracts or purified PDGF induction of either cell multiplication or DNA synthesis (a prerequisite for cell division) in cultured smooth muscle cells, fibroblasts and glial cells (Ross et al., PNAS 71: 15 1207, 1974; Kohler and Lipton, Exp. Cell Res. 87: 297,1974; Westermark and Wasteson, Exp. Cell Res. 98: 170, 1976; Heldin et al., J. Cell Physiol. 105: 235, 1980; Raines and Ross, J. Biol. Chem. 257: 5154, 1982). Furthermore, PDGF *e is a potent chemoattractant for cells that are responsive to it as a mitogen (Grotendorst et al., J. Cell Physiol.
113: 261, 1982; Seppa et al., J. Cell Biol. 92: 584, 1982).
It is not generally the case that mitogens also act as chemotactic agents. Due to its mitogenic activity, PDGF is useful as an important component of a defined medium for the growth of mammalian cells in culture, making it a valuable research reagent with multiple applications in the study of animal cell biology.
In vivo, PDGF normally circulates stored in the alpha granules of platelets. Injury to arterial endothelial linings causes platelets, to .adhere the exposed onnective tissue and release thei.r granules. Te' eleasd PDGF is thought Ito achemotactical'attrac;;gibb o-ad smooth muscle cells to the site of injury and to induce their focal proliferation as part of the process of wound repair (Ross and Glomset, N. Eng. J. of Med. 295: 369, 1976).
It has been postulated that as a part of this response to injury, PDGF released by platelets may play a causative role in the development of the proliferative lesions of atherosclerosis (Ross and Glomset, ibid.) which is one of the principal causes of myocardial and cerebral infarction. Strategies for the prophylaxis and treatment of atherogenesis in the past have been narrowly directed toward reducing risk factors for the disease, such as lowering blood pressure in hypertensive subjects and reducing elevated cholesterol. levels in hypercholesterolemic subjects.
Recent studies have shown that at least one of the two protein chains comprising PDGF and the putative transforming protein of simian sarcoma virus (SSV), an acute transforming retrovirus, appear to have arisen from 20 the same or closely related cellular genes. In particular, computer analysis of a partial amino acid sequence of PDGF has revealed extensive homology with the gene product, p28 s i s of SSV (Doolittle et al., Science 221: 275, 1983; Waterfield et al., Nature 304: 35, 1984; and Johnson t 25 et al., EMBO J. 3: 921, 1984). Further, more recent studies have illustrated that p28 s i s and PDGF show antigenic as well as structural similarities (Robbins et al., Nature 305: 605, 1983; Niman, Nature 307: 180, 1984).
Although previous attempts, such as that summa- 30 rized in Devare et al. (Cell 36: 43, 1984), have been made to express the v-sis gene in a transformed microorganism, they have not been successful in producing mitogenic material. More recently, investigators have described the production of p28 s i s in E. coli as a fusion protein tWang et al., J. Biol. Chem. 259: 10645, ,1984) This protein appears to compete with PDGF f.o.r.:bindigg-.fo-::PDGF .recept.r sites. While SSV tranfc)ormed hro vir T s e'eenisho' :nsji n- i..
to exhibit a mitoglnic activity similar to PDGF (Deuel et al., Science 221;: 1348, 1983; Owen et al., Science 225: 54, 1984), it is npt clear that this activity is due to a gene product from SSV p28sis). Furthermore, cells transformed by a variety of viruses other than SSV produce a PDGF-like mitogen into the culture medium (Bowen-Pope et al., PNAS 81: 2396, 1984).
While natural PDGF may be isolated from human plasma or platelets as starting material, it is a complex and expensive process, in part due to the limited availability of the starting material. In addition, it is difficult to purify PDGF with high yield from other serum components due to its extremely low abundance and biochemi- *cal properties. Furthermore, the therapeutic use of products derived from human blood carries the risk of disease transmission due to contamination by, for example, hepatitis virus, cytomegalovirus, or HIV.
s4, In view of PDGF's clinical applicability in the o e treatment of injuries in which healing requires the proliferation of fibroblasts or smooth muscle cells and its value as an important component of a defined medium for the growth of mammalian cells in culture, the production of useful quantities of protein molecules similar to authentic PDGF which possess .mitogenic activity is clearly invaluable.
25 In addition, the ability to produce relatively large amounts of PDGF or PDGF analogs would be a useful tool for elucidating the putative role of the v-sis protein, p28 si s, in the neoplastic process.
Further, since local accumulation of smooth 30 muscle cells in the intamal layer of an arterial wall is central to the development of atherosclerotic lesions (Ross and Glomset, ibid.), one strategy for the prophylaxis and treatment of atherosclerosis would be to suppress smooth muscle cell proliferation. The ability to produce large 3" amounts of PDGF would be useful in developing inhibitors or designing specific approaches-::whiG:hpreYent or .ine fere: i I 4 with the in vivo activity of PDGF in individuals with atherosclerosis.
Disclosure of the Invention Briefly stated, the present invention discloses methods for expressing a variety of biologically active PDGF analogs in eucaryotic cells. For the purpose of the present specification and claims, the term "eucaryotic cells" does not include cells derived from higher multicellular plants.
In general, the methods comprise introducing into a eucaryotic host cell a DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells. The DNA construct contains a transcriptional promoter followed downstream by an appropriate DNA sequence.
In one aspect of the present invention, the DNA sequence encodes a polypeptide which is substantially homologous to the A-chain of PDGF. In another aspect of the present invention, the DNA sequence encodes a polypeptide which is substantially homologous to the B-chain of PDGF. Within a third aspect of the present invention, a portion of the DNA sequence encodes a"polypeptide which is substantially homologous to at least a portion of the A-chain of PDGF, and another portion of said DNA sequence encodes a polypeptide which is substantially homologous to at least a portion of the Bchain of PDGF, these portions of the DNA sequence encoding a protein having substantially the same biological activity as PDGF.
20 In yet another aspect of the present invention, the DNA construct contains a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide chain substantially homologous to the A-chain of PDGF, and a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide chain substantially homologous to the B-chain of PDGF, the chains forming 25 a heterodimer. The-protein products produced by the methods utilizing these and other DNA sequences are also disclosed.
The present invention also discloses a variety of other DNA constructs capable of directing the expression 6 00 00* s oS S 0 4i 0 o 4 0@ 0 0 0* 5 and secretion of biologically active PDGF analogs in eucaryotic cells.
The DNA constructs contain a transcriptional promoter followed downstream by a suitable DNA sequence. As noted above, suitable DNA sequences Include those encoding a protein which Is substantially homologous to the A-chain or B-chain of PDGF. In addition, the DNA sequence may include a portion encoding a polypeptide which is substantially homologous to at least a portion of the A-chain of PDGF, and a portion encoding a polypeptide which is substantially homologous to at least a portion of the B-chain of PDGF. Further, the DNA S 10 construct may contain transcriptional promoters followed downstream by DNA sequences encoding polypeptide chains substantially homologous to a the A- and B-chains of PDGF, the chains forming a heterodimer.
Eucaryotic host cells transformed with DNA constructs, such as those described above, are also disclosed. A preferred aucaryotic host sea S 15 cell in this regard is a yeast cell.
Another aspect of the present invention discloses methods of promoting the growth of mammalian cells, comprising incubating the cells with a biologically active PDGF analog expressed by a eucaryotic host cell transformed with a DNA construct as described above, and a signal 20 sequence capable of directing the secretion of the protein from the eucaryotic cell.
*0.0 In another aspect of the present invention, a protein is disclosed having two polypeptide chains, each of said chains being substantially homologous to the A-chain of PDGF. The polypeptide chains may also be 25 substantially identical to the A-chain of PDGF. For purposes of the present invention, "substantially identical polypeptide chains" are S* those chains that are at least eighty percent homologous to one another at the amino acid level. Within the present invention, the phrase "substantially homologous" refers to those sequences that are at least 30% homologous to one another.
ALB:4694D In yet another aspect of the present invention, a protein is disclosed having two polypeptide chains, one of the chains being a mosaic of amino acid sequences substantially identical to portions of the A- or B-chains of PDGF, the second of the chains being substantially homologous to the A- or B-chain of PDGF, the protein having substantially the same biological activity as PDGF. The polypeptide chains may also be substantially identical to one another. Alternatively, the protein may be composed of two polypeptide chains, each of the chains being a mosaic of amino acid sequences substantially identical to the Aor B-chains of PDGF, the protein having substantially the same biological activity as PDGF.
In addition, proteins comprising polypeptides that are variants and derivatives of the A-chain and B-chain of PDGF are also disclosed. These proteins include both homodimers and heterodimers. These modifications to the A-chain and B-chain fall basically into two broad S, 2 classes, amino acid deletions and amino acid substitutions.
a 20 Preferred amino acid substitutions include the replacement of selected cysteine residues with another c.o* amino acid, as well as the replacement of other amino acids, the substitution of which does not destroy the bioo se logical activity of the resultant molecule. In particular embodiments of the present invention, proteins are disclosed that include the substitution of A-chain cysteine residue at position 10 or B-chain cysteine residue at position 16. Other preferred amino acid substitutions include the replacement of a B-chain phenylalanine residue with a 30 tyrosine residue.
In regard to amino acid deletions, polypeptide S* chains are disclosed that are substantially identical to the A-chain of PDGF from amino acid 9 to amino acid 104; amino acid 23 to amino acid 104; amino acid 9 to amino acid 95; amino acid 23 to amino acid 95; or amino acid 1 to amino acid 95; t-he-A-cha.in -itself co=- 9 sisting of amino acids 1 to'l.4:: -I.eJ aditiOn .tpolypete*.-b.i4. chains are disclosed that are substantially identical to the B-chain of PDGF from amino acid 15 to amino acid 109; amino acid 29 to amino acid 109; amino acid to amino acid 101; amino acid 29 to amino acid 101; or amino acid 1 to amino acid 101, the B-chain itself consisting of amino acids 1 to 109. Removal of aminoand/or carboxy-terminal amino acids as described herein results in smaller biologically active molecules which may have broader therapeutic utility. In addition, the protein described above may have the amino acid sequence of Figure 9, from A-chain amino acid 1 to amino acid 104, or from B-chain amino acid 1 to amino acid 109.
In another aspect of the present invention, a therapeutic composition is disclosed comprising a protein having two substantially identical polypeptide chains, each of said chains being substantially homologous to the A-chain of PDGF, and a physiologically acceptable carrier or diluent. As noted above, the polypeptide chains may also be substantially identical to the A-chain of PDGF. In 20 addition, proteins comprising variants and derivatives of the A-chain of PDGF as described above are also suitable for use in the therapeutic compositions of the present invention.
In still another aspect of the present invention, L 25 a therapeutic composition is disclosed comprising a protein having two polypeptide chains, one of the chains being a ~mosaic of amino acid sequences substantially identical to portions of the A- or B-chains of PDGF, the second of the chains being substantially homologous to the A- or B-chain 30 of PDGF, the protein having substantially the same biological activity as PDGF, and a physiologically acceptable carrier or diluent. Alternatively, the protein may be composed of two polypeptide chains, each of the chains being a mosaic of amino acid sequences substantially identical to the A- or B-chains of PDGF, the protein having substantially the same biological activity a-s- PDGF. .noted above, the polypeptide chains:- *mi, :aIlso be;: .stant.iil: 8 identical to one another. In addition, proteins comprising variants and derivatives of the A-chain and B-chain of PDGF as described above are also suitable for use in the therapeutic compositions of the present invention.
A related aspect of the presen-. invention is directed toward a method for enhancing the wound-healing process in warm-blooded animals. The method generally comprises administering to the animal a therapeutically effective amount of one or more of the proteins described above, and a physiologically acceptable carrier or diluent.
Other aspects of the invention will become evident upon reference to the following detailed description and attached drawings.
Brief Description of the Drawings Figure 1A is a schematic restriction map of the proviral genome of SSV.
•Figure 1B depicts the nucleotide sequence and predicted amino acid sequence encoded by the v-sis region of the SSV genome.
S0 Figure 2 illustrates the construction of a plasmid which contains the MFal promoter and secretory signal sequence upstream of the v-sis gene.
Figure 3 illustrates the construction of plasmid p 192 Figure 4 illustrates the oligonucleotide-directed deletion mutagenesis of the amino terminal 66 v-sis codons.
Figure 5 illustrates the construction of plasmid p270.
30 Figure 6 illustrates the insertion of v-sis ,li: expression units upstream of the TPI1 terminator.
Figure 7 illustrates the construction of plasmid pTVS2aT.
Figure 8 illustrates the construction of a B-chain expression unit VSB and its introduction into the pMPOT2 vector. Figure 9 depicts the amino acid sequences of the mature A- and B-chains of PDGF.
Figure 10 is a dose response curve of PDGF receptor binding by media concentrates from yeast transformants containing plasmids pVSBm and pMPOT2 compared to authentic
PDGF.
Best Mode For Carrying Out the Invention Prior to setting forth the invention, it may be helpful to an understanding thereof to set forth definitions of certain terms to be used hereinafter.
Polypeptide: A polymer of amino acids.
Reading Frame: The arrangement of nucleotide codons which encode an uninterrupted stretch of amino acids.
During translation of an mRNA, the proper reading frame must be maintained. For example, the sequence GCUGGUUGUAAG a may be translated into three reading frames or phases, S '20 depending on whether one star-ts with G, with C, or with U, hg* S and thus may yield three different peptide products. Translation of the template begins with an AUG codon, continues *e with codons for specific amino acids, and terminates with one of the translation termination codons.
S Coding Sequence: DNA sequences which in the ~appropriate reading frame directly code for the amino acids *JO of a protein.
*a 30 Complementary DNA: or cDNA. A DNA molecule or sequence which has been enzymatically synthesized from the sequences present in an mRNA template, or a clone of such a u.e* molecule.
a Secretory Signal Sequence: That portion of a gene or cDNA encoding a, signal .;peptide i,,,-sgnal *pepide, is the amino acid ;lsequece iG a:e o;ry p'tejiihichi signals its transloca.tion into the secretory pathway of the cell. Signal peptides generally occur at the beginning (amino terminus) of the protein and are approximately 20-40 amino acids long with a stretch of about 9-10 hydrophobic amino acids near the center. Very often the signal sequence is proteolytically cleaved from the protein during the process of secretion.
Cell Surface Receptor: A protein molecule at the surface of a cell which specifically interacts with or binds a molecule approaching the cell's surface. Once the 0 receptor has bound the cognate molecule, it effects specific changv.s in the physiology of the cell.
Mitogen: A molecule which stimulates cells to undergo mitosis. Mitosis is asexual somatic cell division leading to two daughter cells, each having the same number of chromosomes as the parent cell.
.20 Transformation: The process of stably and hereditably altering the genotype of a recipient cell or microorganism by the introduction of purified DNA. This is typically detected by a change in the phenotype of the recipient organism.
Transcription: The process of producing a mRNA to««e template from a structural gene.
SExpression: The process, starting with a struc- 30 tural gene or cDNA, of producing its polypeptide, being a combination of transcription and translation. An expression vector is a plasmid-derived construction designed to .ozD enable the expression of a gene or cDNA carried on the vector.
Plasmid: An.. extrachromosomal,! double-stranded.,DNA.. sequence comprising .an' intact, "repli..- ,suh hat, Lth "c.
plasmid is replicated in a host cell. When the plasmid is placed within a unicellular organism, the characteristics of that organism may be changed or transformed as a result of the expression of the DNA sequences of the plasmid. For example, a plasmid carrying the gene for tetracycline resistance (tetR) transforms a cell previously sensitive to tetracycline into one which is resistant to it.
Yeast Promoter: DNA sequences upstream from a yeast gene which promote its transcription.
Biological Activity: Some function or set of activities, performed by a molecule in a biological context in an organism or an in vitro facsimile). In the case of PDGF, these biological activities include the induction of .chemotaxis and/or mitogenesis of responsive cell types, following the binding of PDGF to specific cell surface receptors. Other biological effects of human o° platelet PDGF may include: phospholipase activation; 20 increased phosphatidylinositol turnover and prostaglandin metabolism;- stimulation of both collagen and collagenase synthesis by responsive cells; an indirect proliferative response of cells lacking PDGF receptors; and potent vasoconstrictor activity.
PDGF Analog: A polypeptide which is substantially homologous to at least a portion of the A-chain the B-chain of PDGF, or both, wherein the polypepti.' exhibits biological activity as defined herein.
oo*ooo 0 As noted above, human platelet-derived growth factor (PDGF) has been shown to be a major mitogen in serum.
PDGF, as it is isolated from platelets, is a different molecule from the novel proteins of the present invention.
PDGF is known to be compose.d. of two polypeptide chains, an A-chain and a B-cBalin, which, ar,(e:heid together~ ,by. disulfi.e bonds to form the- biologically :active,.het.e.ordimer; -moieUle.
a.
12 This structure has been confirmed by immunoprecipitation experiments (Hart et al., Heldin et al., unpublished).
These investigators used monoclonal antHbodies directed specifically against the A-chain or the -hain to immunoprecipitate PDGF. Their results indicate that the PDGF can be removed from solution with antibodies which recognize either chain alone. This confirms the structure of PDGF as a heterodimer of two different polypeptide chains. In addition, naturally-occurring PDGF contains carbohydrate (Deuel et al., J. Biol. Chem. 256: 8896-8899, 1981). Following complete chemical reduction, the single polypeptide chains alone do not exhibit any mitogenic activity (Raines and Ross, ibid.), and attempts to reconstitute activity by reoxidation of the reduced polypeptides have not been successful. Recently, the amino acid sequence of the B-chain has been determined and shown to be substantially homologous to a portion of the v-sis gene product, p28 sis (Doolittle et al., ibid.; Waterfield et al., ibid.; and S* Johnson et al., ibid.). The homology between these two :20 proteins strongly suggests that they are derived from the same or closely related cellular genes.
Given the fact that a single reduced A-chain or B-chain polypeptide is not biologically active and that previous attempts directed toward expressing v-sis sequences in E. coli did not yield mitogenic material, it would no: be expected that merely expressing a sequence encoding a PDGF-like molecule in a microorganism would result in a molecule which exhibited biological activity.
The present invention, however, unlike the 30 previous attempts noted above, unexpectedly provides for the expression of DNA sequences encoding PDGF A-chain or B-chain, variants or derivatives of the A- and B-chains, as 0 well as mosaics of portions of the A- and B-chains or their derivatives, in a manner that the expressed molecules exhibit biological activity characteristic of PDGF. Further, the expression system-of the prisent:nve 'n;-in-was..designeO to poduce the gene.,pr.ouct via 1 -c.i9anq:-er.sec fehic 13 way. This enables the expressed polypeptide molecules to be properly processed, correctly folded and assembled into biologically active dimers. Indeed, the present invention, in contrast to previous efforts, results in the secretion of PDGF-like dimers which are biologically active in established assays for PDGF activity, radioreceptor assay (RRA), mitogenesis assay, and chemotaxis assay.
In its biologically active form, PDGF is a heatstable protein composed of heterogeneously sized species ranging between 28,000 and 31,000 Daltons, all of the individual species being active in stimulating DNA synthesis i (Raines and Ross,* ibid.; Deuel et al., J. Biol. Chem. 256: 8896, 1981; Antoniades, PNAS 78: 7314, 1981). Where individual species with molecular sizes of 27,000; 28,500; 29,000; and 31,000 Daltons have been isolated and analyzed, they show extensive tryptic peptide homology and have been found to have comparable mitogenic activity and amino acid composition (Raines and Ross, ibid.). The slight variations in size among the species are most probably due to 20 differences in carbohydrate composition and minor proteolysis.
Through studies of PDGF which has been extensively Spurified from platelet-rich human plasma, it is likely, as noted above, that PDGF is composed of two polypeptide chains, an A-chain (14,000 Daltons) and a B-chain (16,000 S Daltons), which are disulfide bonded together to form the biologically active dimer molecule (Raines and Ross; Deuel et al.; Antoniades, ibid.). The PDGF nomenclature found in S the literature is not consistent (Doolittle et al.; Water- S 30 field et al.; Raines and Ross; Johnsson et al., ibid.).
S The nomenclature of Johnsson et al. (ibid.), wherein the two polypeptides found in pure PDGF are called "A-chain" and "B-chain," is adopted herein. The B-chain is homologous to p28 s i s and was previously called "peptide I" (Waterfield et al., ibid.) or "la" (poolittle et al., ibid.).
The A-chain was previously termeg- "pepji.e. .I'..iater.fji.et-iet al., ibid.) or. (D.ool.X..e.t. i. 'Da..l i- et a b 1 4 11 t, iB derived from a partial amino acid sequence of PDGF indicate that the two polypeptide chains (A-chain ana B-chain) show extensive homology (Doolittle et al., ibid.; Waterfield et al., ibid.; and Johnsson et al., ibid.; Antoniades and Hunkapiller, Science 220: 963, 1983). More specifically, it has been reported that there is 56% amino acid idenrtity between the two chains. In addition, as shown in Figure 9, there are several blocks of perfect homology between the two chains. Further, both of the chains contain eight cysteine residues at identical positions, suggesting that each polypeptide folds into a similar three-dimensional structure.
It appears that these two polypeptides are closely related members of a .small family. The blocks of perfect homology between the A- and B-chains reflect regions of the protein which may contribute to function, while the less .o homologous regions may reflect portions of the protein which are less important to its function. Therefore, as i0. further exemplified by the present invention, certain :20 portions of either the A- or B-chains may be deleted or substituted, while retaining biological activity within the resultant protein.
Based upon the teachings of the present invention, the homology between the A- and B-chains, together with the 25 coincidence of cysteine residues, one skilled in the art can design additional suitable members of this homologous family. For example, one skilled in the art could construc a variety of hybrids between the A- and B-chain genes which would encode proteins in which the homologous 30 domain structures were preserved. It is demonstrated herein that these proteins can be expected to assume a threedimensional structure similar to wild-type A- or B-chains and retain biological activity.
The v-sis gene, as mentioned above, is the transforming gene of simian sarcoma virus (SSV). ,The v-sis gene has been. cloned.. and .its DNA ;~geq.encp 'tde:emined (Dvae et al. ;PNAS 79.: .317.9 .19B2;' e7,Devae .ial. ,.:31 1983). Analysis of this sequence revealed an open reading frame which could encode a 28,000 Dalton protein, designated p28 s i s. Subsequently, such a protein was immunologically identified in SSV-infected cells (Niman, ibid.; Robbins, ibid.). The predicted amino acid sequence of the v-sis gene product, p28 s is was found to have a high degree of homology with the actual amino acid sequence of a portion of the B-chain of PDGF (Johnsson, ibid.). The homology of the PDGF B-chain to the v-sis gene product begins at amino acid 67 of p28 s i s a serine, and continues for 109 amino acids to a threonine residue at amino acid 175. The amino acid sequences preceding and following the B-chain homologous region of p28 s i s are not homologous to either'the A- or B-chains of mature PDGF (Johnsson, ibid.) and represent portions of the B-chain precursor. In addition, PDGF and p28 s i s have been shown to be similar antigenically (Niman, .ibid.; Robbins, ibid.). The v-sis gene product, p28 s i s a protein of approximately 226 amino acids, dimerizes and is proteolytically processed to a *.20 protein of' approximately 20,000 Daltons (p20 s i s in SSV infected cells (Niman, ibid.; Robbins, ibid.). This 20,000 e, g Dalton protein can be immunoprecipitated with antiserum against
PDGF.
The -mature B-chain homologous region of v-sis encodes a 109 amino acid polypeptide which is almost identical to the human B-chain. The four amino acid differences S* between these, two gene products occur at positions 6, 7, 91 and 97. The mature human A-chain sequence is 104 amino acids in length, and is 56 percent homologous to the 30 B-chain, therefore having a degree of homology to the v-sis product similar to its homology to the B-chain.
In contrast to naturally-occurring PDGF, one Sparticular aspect of this present invention discloses protein products that are disulfide-bonded dimers of two a-chain-like polypeptides. ,Qee sh. dimer,. qcomprising chains having complete homolo .gyc:'i the 104. amini acids. Pfoy PDGF A-chain, migeas--.e- on y p a 'yAi ge.:l 16 apparent molecular weight of ca. 31,000 Daltons. When the dimer is chemically reduced, the component chains migrate to a position consistent with a polypeptide of 104 amino acids. The amino acid composition of the pure protein has been determined and the results show that the composition is substantially identical to the A-chain sequence shown in Figure 9. The amino acid sequence of this pure, yeastexpressed protein was determined using a gas-phase sequenator (Applied Biosystems). All of the amino terminal sequence obtained could be accounted for by the sequence information shown for the, A-chain in Figure 9. These results indicate that the proteins of this aspect of the present invention are homodimers consisting of polypeptide chains homologous to the A-chain of PDGF. The amino acid sequence of the A-chain produced in yeast contained no N-linked glycosylation sites. The glycosylation site present in the native human A-chain was purposely omitted from this construction in order to avoid yeast carbohydrate addition. There is no evidence, based on polyacrylamide 20 gel electrophoresis, that the yeast-expressed A-chain contains carbohydrate. The biological activity observed for these unglycosylated PDGF analogs is somewhat surprising in view of the dependence on glycosylation for biological activity associated with several glycoprotein hormones and other growth factors.
As noted above, another aspect of the present S. invention discloses, proteins comprising polypeptides which are variants and derivatives of the A-chain or B-chain of PDGF. These modifications fall basically into two classes: amino acid deletions and amino acid substitutions, including the cysteine and phenylalanine substitutions discussed below.
In regard to the deletion of amino acids, it has been found that the PDGF A-chain and B-chain may be truncated at either or both, the amino- .and .carboxy-terminal ends and will still form .biologicalyal activeimleuJes[' Removal of these amino- 'and/ 6r.,ca.rbo te na; imii...ai s results in smaller biologically active mo' .cules, which may have broader therapeutic utility. Amino acids which may be deleted without destroying the biological activity of the resultant molecule include A-chain residues 1 through 22 and 96 through 104. Particularly preferred truncated A-chain analogs consist of amino acids 1 through 95, 9 through 95, 23 through 95, 9 through 104, and 23 through 104, although it will be evident to those skilled in the art that other polypeptides may also be constructed while still providing a molecule having biological activity.
Further, amino acids.which may be deleted without destroying the biological activity of the resultant B-chain molecule include residues 1 through' 28 and residues. 102 through 109. Particularly preferred truncated B-chain analogs consist of amino acids 1 through 101, 15 through 101, 29 through 101, 15 through 109, and 29 through 109, although it will be evident to those skilled in the art that other polypeptides may also be constructed while still providing a molecule having biological activity.
In addition, a variety of amino acid substitutions are possible. Preferred amino acid substitutions include replacement of selected cysteine residues with another Samino acid, serine, as. well as the replacement of other- amino acids, the substitution of which does not destroy the biological activity of the resultant molecule.
While the dimerization of the proteins of the present invention involves disulfide bonding between the component chains, it has been found that not all of the cysteine S residues participate in the formation of disulfide bonds or are necessary for biological activity. Cysteine residues at positions 43, 54 and 91 of the A-chain are essential for the formation of biologically active molecc.u. Cys 93 may also contribute to proper structure. The cysteine at position 10 may not be required for the formation of biologically active molecules. The remaining cysteines at positions 37, 46 and 47' are not required, for the for.mnation of 'ct-ive- dimers. Th eefej p.rte.:risUlAig am-ino.,.-ac i f i.A-' 18 substitutions at residues 10, 37, 46, 47 or 93 may also be suitable for use within the present invention, such as within a method for enhancing the wound-healing process in warm-blooded animals. Further, A-chain molecules containing more than one cysteine to serine mutation may also be biologically active. Preferred combinations include serine substitutions at positions 37 and 46 or at positions 37 and 47. Combinations of serines at positions 37 and 10 or 93 may also be suitable within the present invention.
Further, cysteine residues at positions 49, and 97 of the B-chain are essential for the formation of active molecules. Cys 99 may also contribute to proper structure. The cysteine at position 16 may not be required for the formation of active dimers. The remaining cysteines at positions 43, 52 and 53 are not required for the formation of active molecules. Therefore, B-chain-like polypeptides having amino acid substitutions at residues 16, 49, 52, 53 or 99 may also be suitable for use within I the present invention, such as within a method for enhanc- 20 ing the wound-healing process in warm-blooded animals.
o Further, B-chain molecules containing more than one cysteine to serine mutation may also be biologically active.
Preferred combinations include serine substitutions at positions 43 and 52 or at positions 43 and 53. Combinations of 25 serine substitutions at positions 43 and 16 or 99 may also be suitable within the present invention.
Other preferred amino acid substitutions include the replacement of a phenylalanine residue in the B-chain with a tyrosine residue. This substitution is useful, for 30 instance, in facilitating the radioactive iodination of the B-chain as a laboratory reagent for use in binding and localization studies. The tyrosine residues are labelled with iodine under mild conditions which do not alter the biological activity of the protein. Preferred tyrosine for phenylalanine substitutions are at positions .23 and 37 of the B-chain. This was accomplished by ol kgpnucleotide- directed mutagenesis foll wing:st s:an3_;drme hypogy1. i: nucleotide ZC1116(5'-AGATCTCGTAAACTTCGG-3') was used to introduce the tyrosine substitution at position 23. Similar substitutions can be made for the other phenylalanine residues in the B-chain.
In addition to the amino acid substitutions described above, certain other amino acid substitutions are also possible, as long as the resultant polypeptide retains substantial homology to the A- or B-chain of PDGF. For example, a DNA sequence derived from the v-sis gene encodes a protein which, although homologous to the human B-chain, differs from the human amino acid sequence at four positions. Biologically active dimers may be made using the v-sis sequence or the authentic human sequence, which may be derived from a human cDNA or 'constructed by altering the v-sis sequence as described herein.
There are a variety of variants and derivatives which may be used within the present invention. For instance, amino acid substitutions may be made in either the A-chain or the B-chain which: modify the three- 20 dimensional structure of. the particular chain without S* significantly effecting its biological activity; modify the three-dimensional structure, resulting in an alteration of the biological activity; or affect biological activity without significantly changing the three-dimensional structure. For example, amino acid number 98 in the B-chain may be changed from lysine to leucine, resulting in a monomer-sized molecule exhibiting biological activity.
Alternatively, biologically active monomers may be obtained by changing cysteine residues involved in interchain disulfide bonds between the polypeptides of the dimer to an amino acid which will not form a disulfide bond. Molecules which are biologically active as monomers may permit Sgreater therapeutic application. Monomer analogs can also be further manipulated without the requirement for the formation of a dimer to obtain biological activity. This will facilitate structural analysis ,..jeading- to .the- ,definitiin; of an active receptor binding site, thereby allowing the design of additional therapeutic analogs.
Further, deletion of one or more amino acids can also result in a modification of the structure of the resultant molecule without significantly altering its biological activity. This can lead to the development of a smaller active molecule which would have broader therapeutic utility. For example, as described herein, one can remove amino terminal amino acids not required for biological activity. Similarly, carboxy terminal amino acids may be removed, while retaining biological activity.
Further, mosaics of portions of the A- and B-chains or their derivatives may also be used within the present invention. The term "mosaic," as used within the present invention,, includes contiguous portions of the A-chain and the B-chain. sufficient to encode a molecule having biological activity as defined herein. The constituent portions of the mosaic can be chosen from wild-type A-chain or B-chain, as well as variants or derivatives of 20 the A-chain or B-chain. The portions of the mosaic may range from 1 to approximately 75 amino acids in length,.
provided that the overall primary structural features of the A- and B-chains are maintained. The common structural features of the A- and B-chains are the relative positions of the cysteine residues; the regions of amino acid charge; and regions of hydrophobic and hydrophilic character. In addition, it may be useful to maintain the blocks of sequence identity between the A- and B-chains.
As u further alternative, the sequences of these 30 hybrids may be modified, while retaining biological activity. For example, one or more amino acid changes, such as a change at A-chain amino acid number 10 or in B-chain at amino acid 16 from a cysteine to a serine results in a molecule retaining biological activity.
Further, combinations of the A- and B-chains or their derivatives may also be used-within the. present. :invention. The. term "combina-tns, .as usedi -;withi the;pfesent Irrr lr invention, includes heterodimers composed of two different polypeptides; the A-chain and the B-chain. The constituent polypeptides of the heterodimer can be chosen from wild-type A-chain or B-chain or portions thereof, as well as variants or derivatives of the A-chain or B-chain.
The DNA sequences to be utilized in expressing these polypeptides may be isolated, synthesized or constructed using standard recombinant DNA techniques.
In order to produce A-B heterodimers in yeast, constructs expressing both the A-chain and the B-chain of PDGF are introduced into the same yeast cell. In this way both polypeptide chains transit the secretory pathway simultaneously and are able to assemble into heterodimers. A preferred method is to place the A-chain and B-chain expression constructs on a single plasmid. In this way the copy number of the two sequences remains equal. It is also possible to introduce into and maintain within the same yeast cell separate plasmids, one encoding A-chain and the other a B-chain.
e 20 Within the present invention, it has been found that by utilizing the secretory pathway of eucaryotic cells G to express proteins substantially homologous or substantially identical to the A-chain or B-chain of PDGF or portions thereof, biologically active PDGF analogs may be obtained. Expression and secretion of these gene products from a eucaryotic cell enable processing and assembly, which result in molecules with native and biologically S"l active conformation.
The secretory pathways of eucaryotes are believed 30 to be quite similar. In particular, mammalian cell and ~yeast cell secretory pathways are well characterized and are homologous. The presence of a secretory signal sequence on the expressed polypeptide is an important element in eucaryotes, due to its role in directing the primary translation product into the secretory pathway, thereby leading to -proper p,ro.ca .sing. ;a d a:ssembly..:r p s Provided that ap'propr.rate:*_.; ioa'e r:' 'i n, a, 22 secretory signal sequences are utilized, generally any eucaryote could express and secrete PDGF-analogs in a biologically active form.
An easily manipulable and well-characterized eucaryote is the yeast cell. For these reasons, yeast was chosen as a model example of an appropriate eucaryotic cell within the present invention. In accordance with the present invention, the yeast promoter is followed downstream by a DNA sequence which encodes a protein having substantially the same biological activity as PDGF. For example, DNA sequences encoding the 109 amino acids of the PDGF B-chain or the 104 amino acids of the A-chain were inserted into yeast extrachromosomal elements containing a yeast promoter capable of -directing their expression. These extrachromosomal elements were transformed into yeast cells capable of expression and secretion of these biologically active PDGF analogs. In addition, variants and derivatives of the 'DGF A- and B-chains, as well as the mosaic sequences, were also S inserted into such a yeast extrachromosomal element.
20 The genes or sequences to be utilized in the presa ent invention may be isolated using standard recombinant DNA techniques.
S**
sea DNA sequences which encode a protein having .substantidlly the same structure and/or biological activity 25 as PDGF include the v-sis gene or derivatives of the v-sis gene, or portions thereof, or the human cDNAs for the A-chain or the B-chain of PDGF or portions thereof.
*a The human PDGF B-chain cDNA is isolated from a human cDNA library made from an appropriate source of 30 messenger RNA, preferably by using the v-sis gene or a fragment thereof as a hybridization probe, or through use of oligonucleotide probes designed from the B-chain DNA Ssequence. A preferred source of mRNA is human umbilical vein endothelial cells. These cells can be cultured in vitro for short periods of time and are known to secrete PDGF into the culture medium,..,(DiCporletL. and. Bp..en-Pope,., PNAS 80: 1919, 1983) and con.n an 'high leyels~; B-chaip,.. 1 mRNA. Breifly, polyadenylated RNA was prepared from freshly cultured human umbilical vein endothelial cells and used to make double-stranded cDNA by conventional techniques. This cDNA was cloned in bacteriophage lambda gtll.
The resulting cDNA library was screened with probes derived from the v-sis gene. A second such library was made and screened in a similar fashion. Clones identified in this manner were mapped by restriction enzyme analysis in order to establish their extent of overlap. The identity of these clones as encoding PDGF B-chain was verified by DNA sequencing.
The human A-chain cDNA may be isolated from a human cDNA library made from an appropriate source of messenger RNA by using the v-sis gene or a fragment thereof as 15 a hybridization probe, or through use of oligonucleotide probes designed from the A-chain DNA.or amino acid sequence (see, for example, Betsholtz et al., Nature 320: 6 9 5 6 9 9 00 1986). Preferred sources of mRNA are human transformed cell lines, U2-OS and T-24. These cells can be cultured in vitro and are known to secrete a protein having PDGF-like activity (Heldin et al., Nature 319: 511-514, 1986). The identity of this cDNA as that 'encoding A-chain may be verified by DNA sequencing.
In addition, suitable DNA sequences may be constructed using synthetic oligonucleotides.
Once an appropriate DNA sequence encoding a protein exhibiting PDGF-like biological activity is identiy* fied, the sequence is ligated to an appropriate promoter and secretory signal fragment. Promoters which may be 30 utilized in yeast include the yeast alpha-factor (MFal) promoter and the yeast triose phosphate isomerase (TPI1) promoter (Kawasaki, U.S. Patent No. 4,599,311). Promoters may also be obtained from other yeast genes, alcohol dehydrogenase 1 (ADH1), alcohol dehydrogonase 2 (ADH2).
Appropriate promoters for other eucaryotic species may also be used and will be apparent- to.tho.se ski:lled in-the -art-i The -constructidns dscribed~ here were designed .suc i_.'at h4. we. dsind s-b- -$w-Ctn so me s o So a, sc the PDGF-related gene products would be secreted from the host cell into the media. In yeast, this was accomplished through 'use of the prepro secretory signal sequence of the yeast mating pheromone alpha-factor (Kurjan and Herskowitz, Cell 30: 933, 1982; Julius et al., Cell 36: 309, 1984; and Brake et al., PNAS 81: 4642, 1984), although other secretion signals may be used. To ensure the efficient transcription termination and polyadenylation of mRNA, a yeast terminator sequence, such as the TPI1 terminator (Alber and Kawasaki, J. Molec. Genet. Appl. 1: 419, 1982), was added.
Methods of ligation of DNA fragments have .been amply described (Maniatis et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory 1982) and are well within the skill of those of ordinary skill in the art to 15 perform. After preparation of the expression unit constructions, the constructs are inserted into an appropriate expression vector.
It is preferable to use an expression vector which is stably maintained within the host cell in order to produce more biological activity per unit of culture. Suitable yeast expression. vectors in this regard include the plasmids pCPOT and pMPOT2, which include the Schizosaccharomyces pombe gene encoding the glycolytic enzyme triose phosphate isomerase (POT1 gene). Inclusion of the POT1 gene ensures the stable maintenance of the plasmid in an appropriate host cell having a deletion in the TPI gene due to its ability to complement the host cell gene deletion.
Other selection systems may also be used, such as the leu2 selection system described by Beggs (Nature 275: 104-109, 1978).
After preparation of the DNA construct incorporating the promoter, the alpha-factor secretory signal sequences, the appropriate DNA sequence encoding a molecule having PDGF-like biological activity, and the TPI terminator in an appropriate vector, the construct is transformed into the yeast h6st with a TPI:delet(on.,:Praoedureshfn r transforming 'yeast are :well known n f i :r .1 0 0 0000 for example, Beggs, ibid. and Hinnen et al., Proc. Natl.
Acad. Sci. U.S.A. 75: 1929-1933, 1978).
The transformed yeast cells may be selected by growth on conventional complex medium containing glucose when the pCPOT or pMPOT2 vector is utilized. A conventional medium, such as YEPD (20 grams glucose, 20 grams Bacto-peptone, 10 grams yeast extract per liter), may be used. Once selected, transformants containing the appropriate expression constructions are grown to stationary phase on conventional complex media, the cells removed by centrifugation or filtration, and the medium concentrated.
Noting that authentic human PDGF is a highly cationic and.
hydrophobic protein (Raines and Ross, ibid.; Antoniades, ibid.; Deuel et al., 1981, ibid.), it was expected that the 15 yeast-expressed, PDGF-related products would possess \6 similar characteristics, allowing the use of ion-exchange chromatography in their purification.
Using a variety of assays, it.-can be demonstrated that spent media from yeast cultures expressing the. PDGF analogs possess biological activities substantially identical to authentic human PDGF.
Expression of biologically active PDGF analogs in eucaryotic cells other than yeast cells can be achieved by a person skilled in the art through use of appropriate 25 expression/regulatory signals. Transcriptional promoters capable of directing the expression of these sequences are chosen for their ability to give efficient and/or regulated expression in the particular eucaryotic cell type. A variety of promoters are available, including viral 30 and adenovirus promoters) and cellular metallothi- 0 onein gene-karin, U.S. Patent No. 4,601,978) promoters.
Signal sequences capable of directing the gene product into the cell's secretory pathway are chosen for their function in the appropriate cell type. Other useful regulatory signals, such as transcription termination signals, polyadenylatio. signals and transcrip.tional;.-'enhaiger;Q sequen .esi. are also chosen :for their fdnjnion .in p1 appnr -ibe.. c type, the selection of which would be apparent to an individual skilled in the art. Methods for transforming mammalian cells and expressing cloned DNA sequences are described by Kaufman and Sharp Mol. Biol. 159: 601-621, 1982), Southern and Berg Mol. Appl. Genet. 1: 327-341, 1982), and Neumann et al. (EMBO J. 1: 841-845, 1982).
According to the present invention, it is possible to produce recombinant PDGF-like molecules which are homodimers or heterodimers of substantially identical polypeptide chains. To produce heterodimers, two different expression -units are .introduced into the same cell and heterodimers are identified among the biologically active products. The expression units may be.on different expres- *sion vectors with different selectable markers or, prefer- 15 ably, on a single expression vector. The second strategy S* offers the advantage of providing equal copy numbers of the two expression units.
The techniques of cell culture have advanced considerably in the -last several years as have the number and varieties of mammalian cells which will grow in culture.
Central to these advances is a better understanding of the nutritional requirements hormones and growth factors) of cultured cells (Barnes and Sato, Cell 22: 649, 1980). The types of cells able to grow in culture can be 25 crudely classified in two groups: normal and transformed.
So-called "normal" cells are generally not immortal in culture, they do not form tumors when injected into animals, and they retain a normal diploid karyotype. Normal cells may also retain much of their differentiated character in 30 culture. Within the category of normal cells- are those which will only grow for a limited number of generations in culture, termed "cell strains" or "primary cultures." Some normal cell lines, while not meeting all the criteria of transformation, may grow indefinitely in culture. Transformed cells are immortalized for growth in culture,.
typically have lost their 'differeot'jated--,phenQotype, and.: have -acquired karyotypi.c aber^tdons ihey haY b Z independent of anchorage for growth and induce tumors when injected into the appropriate host animal. Cells in any of these categories which grow in vitro and possess PDGF receptors will be responsive to the PDGF analogs of this invention.
As noted above, the proteins described herein are suitable for use within therapeutic compositions for enhancing the wound-healing process in warm-blooded animals.
The normal wound-healing process in warm-blooded animals proceeds by an orderly series of events involving the interaction of chemoattractants, growth factors, and a variety of specialized cell types. This process includes an ordered migration and, in some cases, the subsequent proliferation of a number of these specialized cell types 15 into the wound space, and involves the complex interaction of a variety of biologically active factors. This process se is discussed in detail in Hunt et al., eds., Soft and Hard Tissue Repair; Biological and Clinical Aspects, Praeger Publishers, New York, 1984, which is hereby incorporated by reference. Briefly, tissue injury results in the release of chemotactic factors which attract particular cell types, which then release additional and/or other chemoattractant or mitogenic factors. These factors, in turn, affect additional specialized cells, ultimately restoring the 25 injured tissue. Further, there is evidence that the rate S at which this process normally proceeds is limited by the levels of chemoattractants and growth factors at the wound te, and may be enhanced by the addition of these agents (Grotendorst et al., J. Clin. Invest. 76: 2323-2329, 1985, 30 herein incorporated by reference).
The wound-healing process in the dermis begins with the formation of a clot from the blood which flows into the wound. This results in a cross-linked network of fibrin molecules binding the wound together. During this process, platelets adhere to the injured tissue, becoming activated, and release the contet-s ,of.t:heir; :alpba~granu.l-es..r! The disruption -of, the drinmal: tisuJ .shsdbl#odf Cgltln a0:9Lr I i 28 reactions, and platelet activation all generate molecules which cause the migration of a series of new cells into the wound, thereby initiating the repair process.
Among the contents of the alpha granules released by the platelets is PDGF. In addition, other contents of the alpha granules and by-products of the coagulation reactions induce the appearance of macrophages. Macrophages are a second important source of PDGF in the wound. The deposition of PDGF at the site of an injury provides a chemotactic stimulus for fibroblasts to enter the wound space and a mitogenic stimulus for the fibroblasts to subse- S* quently proliferate therein, thereby participating in the process of repair. An important role of the fibroblast is the regeneration of connective tissue at the wound site.
The fibroblasts proliferate in the wound and deposit collagen types I and II and other extracellular proteins to the 00 connective tissue matrix. The presence of new fibroblasts and their protein products reconstitutes the dermal architecture such that it can be re-epithelialized and the wound thereby healed.
S* Similarly, the wound-healing process in relation to the repair of connective tissue also requires fibroblast infiltration and proliferation, leading to subsequent collagen deposition.
25 The proteins of the present invention have been shown to possess substantially the same biological activity as authentic PDGF. The basic biological activity of PDGF, Sparticularly the induction of chemotaxis and mitogenesis in S responsive cell types (inlcuding fibroblasts and smooth muscle cells), underlies many of the physiological roles of this protein, including its role in tissue repair.
Because the chemotactic and mitogenic properties of PDGF are central to its role in the wound-healing process, the biologically active proteins of the present invention will have 'similar therapeutic utility. These biologically active proteins are therefore expeted: to. have -='ciinical applicability in the :rteatmentnf i wounds inid. whih 29 healing requires the migration and/or proliferation of fibroblasts. In addition, PDGF acts as a chemotactic and mitogenic agent for smooth muscle cells, the proliferation of which may contribute to the healing of certain wounds.
Smooth muscle cells will, be affected by PDGF in a manner similar to that described above for fibroblasts, thereby contributing to the healing process.
In individuals with normal healing capacity, exogenous proteins having the biological activity of PDGF accelerate the rate of appearance of fibroblasts in the wound and their subsequent proliferation. In addition, there are a large number of individuals who have substantially impaired wound healing capacity, and thereby lack the ability to provide to the wound site endogenous growth :0 15 factors which are necessary for the process of wound healing. In these individuals, the addition of exogenous proteins having the biological activity of PDGF enables wound healing to proceed in a normal manner.
"o*0 The proteins of the present invention are 20 expected to accelerate the healing process in a broad spectrum of wound conditions. For purposes of the present invention, the terms "wound" or "wound condition" include any disruption of the dermal layer of the skin. Examples of disruptions to the dermal layer include chronic non-heal- 25 ing dermal ulcers (which can have a variety of causes), superficial wounds and lacerations, abrasions, surgical wounds, and some burns. In addition, wounds may also S result in damage to connective tissue, the repair of which involves fibroblast proliferation and collagen deposition.
30 The proteins of the present invention are useful in enhancing the. healing process of all of these wounds, and will also be useful in the treatment of other wounds in which healing requires the migration and/or proliferation of fibroblasts. Furthermore., normal wound-healing may be retarded by a number of factors, including advanced age, diabetes, cancer, and treatment-iwth t .ajt-i mmati drugs or -anticoagulahts, and::. Lther-obred fO I .tc. 'V may be used to offset the delayed wound-healing effects of such treatments. Lawrence et al., (Ann. Surgery 203: 142-147, 1986) demonstrated that PDGF restored the-woundhealing process to normal in diabetic rats. Knighton et al., (Ann. Surgery 204: 322-330, 1986) used a mixed growth factor preparation comprising PDGF on chronic non-healing dermal wounds of human patients and observed dramatic positive results. Their results indicate that some of the activity in their preparation is due to PDGF and that PDGF contributes to the rapid healing they see in humans as it does in animal experiments. PDGF acts synergistically with other components of the preparation.
For therapeutic use in the applications described herein, the proteins of the present invention are prefer- 15 ably administered topically in combination with a physiologically acceptable carrier or diluent. Further, it is 0e preferable to use a substantially pure preparation of the S'o* protein, that is, one which is generally free of impurities or contaminants which would interfere with its therapeutic 20 use. Particularly preferred are those preparations which are free of toxic, antigenic, inflammatory or other deleterious substances, and are greater than 80% pure.
Typically, the proteins desired herein will be in a concentration of about 1 to 50 pg/ml of total volume, although it 25 will be apparent that concentrations in the range of -pg/ml to 100 pg/ml may be used. However, it should be noted that concentrations in excess of 50 pg/ml may result in reduced therapeutic effectiveness. A therapeutically effective amount sufficient to accelerate the rate of 30 appearance and increase the number of new fibroblasts in the wound space and to stimulate DNA synthesis in and collagen deposition by those fibroblasts, will typically be in the range of 1 to 5 milliliters of the preparation, depending upon the characteristics of the wound.
Therapeutic compositions according to the present invention comprise the proteins- described-he-Oinz in! .opb.ina' tion with suitable carriers'- as,.wel- Iasij.a:djas at; ents, or stabilizers. Suitable adjuvants include collagen or hyaluronic acid preparations, fibronectin, factor XIII, or other proteins or substances designed to stabilize or otherwise enhance the active therapeutic ingredient(s).
Diluents include albumins, saline, sterile water, etc.
Other stabilizers, antioxidants, or protease inhibitors may also be added. Alternatively, the proteins may be applied to wound dressings as aqueous solutions. The therapeutic compositions according to the present invention may be reapplied at one- to several-day intervals until healing is complete.
a.
0*6 0o a Ca.
S
C. 0 *i S a. a o
S.
a. The therapeutic compositions of the present invention may also. contain other pharmaceutically active ingredients,' for exanmple, heparin, which has been shown to 15 accelerate the healing of. thermal burns. Other growth factors, such as TGF-a, TGF-0, EGF, FGF, platelet factor 4, 'insulin or somatomedins (see Grotendorst et al., 1985) and angiogenesis factor, may also work synergistically with the PDGF analogs described herein. Antibiotics may also be included to keep the wound free of infection.
To summarize the examples which follow, EXAMPLE I demonstrates the construction of a v-sis subclone of pSSV-11 in the E. coli replicating plasmid pUC13, subsequently designated pVSIS/Pst. EXAMPLE II demonstrates the 25 construction of the plasmid pVSa, which includes the ligation of v-sis to the MFal promoter and secretory signal sequence. EXAMPLE III demonstrates the oligonucleotidedirected deletion mutagenesis of the first 195 base pairs of the v-sis gene. using a technique which employs single stranded bacteriophage M13 in order to eliminate the first sixty-six amino acids of the v-sis gene product, p28 s i s which are not homologous to the B-chain of PDGF. A resulting phage with the correct deletion was designated mllvs2a.
EXAMPLE IV demonstrates the construction of the expression vector pVSBm. EXAMPLE V demonstrates the transformation of yeast host cells. EXAMPLE VI,deonQstrates -the cons.tructi.on of pSBl. EXAMPLE .VII'demonstri:gtesi ib oqnstruction o ants and derivatives of the B-chain. EXAMPLE VIII demonstrates the construction of variants and derivatives of the A-chain. EXAMPLE IX demonstrates the construction of yeast expression vectors for A- and B-chain variants and derivatives. EXAMPLE X demonstrates a method for producing an A-B heterodimer in yeast. EXAMPLE XI demonstrates the concentration of the spent yeast growth media from transformed cultures and subsequent analysis for PDGF-like material.
Clear evidence is presented that these yeast media containing the PDGF analogs described herein possess substantially the same biological activity as authentic human .PDGF.
EXAMPLE XII demonstrates methods for optimizing protein expression.
The following examples are offered by way of 15 illustration, and not by way of limitation.
.oo: EXAMPLE I Subcloning of v-sis from pSSV-11 o *o a 0 00 The SSV retroviral genome was cloned from SSV-ll nonproductively infected normal rat kidney (NRK) cells which had SSV integrated into their genome (Devare et al., 1982, ibid.). The SSV DNA was isolated as a 5.8 kilobase (kb) Eco RI fragment and subsequently inserted into the plasmid pBR322, resulting in the clone pSSV-ll. This clone was obtained from S. AaronLon (National Institutes of Health, Bethesda, MD).
Figure 1A is a schematic restriction map of the 5.8 kilobase proviral genome of SSV. Only the restriction sites relevant to the present invention are indicated. The open box designates the p28 s is coding portion of the v-sis gene.
Figure 1B depicts the-nucleotide sequence of the v-sis gene and some flanking SSV sequences. The v-sis gene is inserted 19 nucleotides 3' pf';I fl:the i.pta' AT.Griai;tia tion codon .of :the an elope e f V et al., 1982, ibid.). It is believed that transcription and translation of v-sis sequences are directed by SSV sequences resulting in an env-sis fusion protein. The nucleotide sequence shown in Figure lB is corrected from that published by Devare et al. in 1982 (ibid.). The corrections include those made by Devare et al. in 1983 (ibid.) and by the inventors herein. The original numbering scheme of Devare et al. (1982, ibid.) is retained here for ease of reference. The numbers assigned to the restriction sites in Figure 1A are from Figure lB.
A subclone of pSSV-11 (Figure 2) containing a portion of the v-sis gene -was constructed in the E. coli replicating plasmid pUC13 (Vieira and Messing, Gene, 19: 259, 1982; and Messing, Meth. in Enzymology 101: 20, 1983).
"15 five micrograms (pg) of pSSV-11 was digested with the o. restriction endonuclease Pst I and the 1.2 kb fragment containing sequences numbered 454-1679 (Figure 1) was purified by agarose gel electrophoresis and extracted from the gel with cetyltrimethylammonium bromide (CTAB) plus butanol (Langridge et al., ibid.). Two pg of pUCl3 was also digested with Pst I, phenol/chloroform (CHC1 3 extracted and ethanol (EtOH) precipitated. Forty ng of the 1.2 kb v-sis fragment and 50 ng of Pst I-cut 0 pUC13 were ligated overnight at room temperature with units of T 4 DNA ligase. The ligation mixture was used a to transform E. coli K-12 strain JM83 (Messing, Recombinant SDNA Technical Bulletin, NIH Publication. No. 79-009, 2, SB No. 2, 43-48, 1979) in the presence of 5-bromo, 4-chloro, S 3-indolyl-B-D-galactoside (X-gal) and isopropyl B-D-thiogalactoside (IPTG). Plasmid DNA prepared from ampicillinresistant white colonies was digested with Pst I to verify the presence of the insert and the resulting plasmid was designated pVSIS/Pst.
EXAMPLE II Construction of the Plasmid pVSa A. Preparation of v-sis for Fusion to MFal.
Six hundred pg of plasmid pSSV-ll (Figure 2) was digested with restriction endonucleases Bam HI and Pvu II in 200 microliters (pl) of 50 mM NaC1, 10 mM MgC12, 10 mM Tris pH 7.5 (medium salt buffer), and 100 pg/ml bovine serum albumin (BSA), overnight at 370C. The digestion products were electrophoresed through a 1.1% agarose gel and the 1100 base pair (bp) Bam HI--Pvu II fragment (Figure 2) cut out, extracted and EtOH precipitated. The DNA pellet was dissolved in 75 p 1 Hph I buffer to 'hich was added 20 pl of 1 mg/ml BSA and 5 pl Hph I. After overnight digestion at 370C, the mixture was electrophoresed through a 1.25% agarose gel and the 396 bp Hph I--Pvu II fragment 20 isolated from the gel and EtOH precipitated. The DNA pellet was dissolved in 30 pl of Klenow buffer (6mM Tris pH 7.5, 6 mM MgCl 2 60 mM NaC1) and the 3' overhanging nucleotide at the Hph I cleavage site removed by treatment with 5 u of Klenow polymerase for 5 minutes at 370C. One 25 pl of a mixture containing all four deoxyribonucleotides each at 1 mM was added and the reaction mixture incubated an additional 10 minutes. After phenol/CHC1 3 /ether (Et 2 0) Sextraction and EtOH precipitation, the DNA pellet was dissolved in 30 pl of medium salt buffer and digested with 5 u S 30 of Bgl II for three hours at 370C. The DNA was electrophoresed through a 1.25% agarose gel and the 269 bp Hph Bgl II fragment extracted and EtOH precipitated. The Hph I cleavage terminus of this Klenow blunted fragment begins with the tri-nucleotide sequence (Figure 2).
B. MFal Promoter and Secretory Leader Fragment.
Plasmid p192 (Figure 3) comprises a portion of the gene for the yeast mating pheromone a-factor (MFal gene) cloned in the bacterial plasmid pUC13 (Vieira and Messing,, ibid.; and Messing, Meth. in Enzymology 101: 1983). Cloning of the MFal gene from a genomic library has been described by Kurjan and Herskowitz (ibid.). The gene was isolated in this laboratory in a similar manner, using as starting material a yeast genomic library of partial Sau 3A fragments cloned into the Bam HI site of Yepl3 (Nasmyth and Tatchell, Cell 19: 753, 1980). From this library, a plasmid was isolated which expressed' a-factor in a diploid strain of yeast homozygous for the mata2-34 mutation (Manney et al., J. Cell Biol 96: 1592, 1983). The clone contained an insert overlapping with the. MFal gene characterized by Kurjan and Herskowitz (ibid.). This plasmid, S known as pZA2 (Figure was cut with Eco RI and the 1700 bp fragment comprising the MFal gene was purified. This fragment was then subcloned into the Eco RI site of pUC13 to produce the plasmid p192.
Fifteen pg of plasmid-pl92 was digested in 30 pl of medium salt buffer with 20 units' of Hind III overnight at 37 0 C. The reaction mixture was diluted to 60 p1 with t :25 Klenow buffer and the four deoxyribonucleotides added to a final concentration of 50 pM each. Ten units of Klenow S polymerase were added to the ice-cold mixture and incubation allowed to proceed 12 minutes at 15 0 C. Following phenol/CHCl 3 /Et 2 0 extraction, the aqueous phase was concen- 30 trated by lyophilization to. a volume of 10 pl and digested with 20 units of Eco RI for 70 minutes at 37 0 C. The products were electrophoresed through a 0.9% agarose gel and the 1.2 kb Eco RI--Hind III (blunted) MFal fragment extracted and EtOH precipitated. This DNA fragment contains the transcriptional promoter and secretory signal sequences of MFai... r j. 7 C. Preparation of v-sis 3' Sequences and Cloning Vector pUC12; Fragment Ligation.
Twenty pg of plasmid pVSIS/Pst was digested with Bgl 1II and Xba I in 40 pl of medium salt buffer. Subsequent electrophoresis through 1% agarose, extraction of the DNA and EtOH precipitation provided the purified v-sis 756 bp Bgl II--Xba I fragment (Figure E. coli replicating plasmid pUC12 (5 pg) was digested with Eco RI and Xba I and gel-purified as above (Figure 2).
Referring to Figure 2, equimolar amounts of the four DNA fragments described above, adjusted to 10 ng of the 296 bp Hph I--Bgl II v-sis fragment, were mixed in .5 15 pi of ligase buffer (6 mM Tris pH 7.6, 6.6 mM MgCl 2 0.4 mM ATP, 2 mM spermidine, 20 mM DTT, and 100 pg/ml BSA) and ligated with 40 units of T 4 DNA ligase overnight at 14°C. The reaction mixture was brought to room temperature, an additional 150 units of T 4 ligase added, 20 and incubated 10 more hours. Seven p1 of the ligation mix was used to transform E. coli K-12 RR1 (ATCC #31343; Bolivar et al., Gene 2: 95, 1977), and ampicillin-resistant transformants selected. Plasmid DNA was prepared from S twelve such bacterial colonies and digested with Xba I.
25 Two clones gave a 2.2 kb band predicted by the properfragment alignment (Figure Further analysis of these by Bgl II--Xba I restriction mapping gave expected bands of 9 approximately 1.5 kb from the MFal/v-sis fusion and 760 bp for the Bgl II--Xba I v-sis fragment. DNA sequence :30 analysis verified the desired nucleotide sequence at the MFal/v-sis junction. The resultant plasmid was designated pVSa.
t- EXAMPLE III Construction of mllVS2a 0e 40 a .a ce a a 0 08 .0 r' &B Homology between the v-sis protein p28 s is and PDGF begins at amino acid 67 of p28 sis a serine residue corresponding to the NH 2 terminal residue of the PDGF B-chain (Johnsson, ibid.) Proteolytic processing of the MFal primary translation product occurs at the Lys-Arg cleavage signal amino acids from the initiator methionine (Kurjan and Herskowitz, ibid.). A v-sis derivative was constructed in which the first 66 codons of p28 s is were removed such that serine residue 67 of v-sis immediately follows the MFal 15 Lys-Arg processing signal.
Referring to Figure 4, approximately 40'ng of the gel purified 2.2 kb Xba I fragment of pVSa was ligated with 120 ng of Xba I digested, alkaline phosphatase-treated M13mpll DNA (Messing, Meth. in Enzymology, ibid.). The 20 ligation mixture was used to transform E. coli K-12 strain JMl01 (ATCC 33876) in the presence of X-gal and IPTG.
Isolated white plaques were picked and used to infect 3 ml cultures of log phase growth JM101 cells. Replicativ^ Form (RF) DNA was prepared and clones identified which carried the insert fragment in the same orientation as the positive strand form of the single-stranded mature phage.
Single-stranded phage DNA was prepared from one such clone and designated mllVSa.
To precisely remove codons 1-66 of v-sis, oligonucleotide-directed mutagenesis was performed essentially according to the two-primer method of Zoller et al. (Manual for Advanced Techniques in Molecular Cloning Course, Cold Spring Harbor Laboratory, 1983). Oligonucleotide ZC 130 3' AGAAACCTATTTTCCTCGGACCCA 5' was synthesized on an Applied Biosystems 380-A DNA synthesizer. Fifty pmoles of ZC 130 was kinased in 10. pl of kinase fir. E (BROL): nwith-..4 units a be~e.
a e a a 38
T
4 polynucleotide kinase for 45 minutes at 370C. The enzyme was inactivated by heating at 65 0 C for 10 minutes.
One-half pmole of mllVSa was annealed with 1 pmole of kinased ZC130 and 1.5 pmoles of universal sequencing primer (BRL) using conditions described (Zoller et al., ibid.), except that the annealing mixture was first heated to 65 0 C for 10 minutes, shifted to 370C for 10 minutes, and then quickly chilled on ice. The annealed mixture was then treated with Klenow polymerase as described by Zoller et al. (ibid.) to create circular duplex DNA. Portions of the elongation mixture were used to transform E. coli K12 JM101 cells. The resulting phage plaques were screened for the proper deletion by transfer onto nitrocellulose filters and subsequent hybridization with 3 2 P-phosphorylated ZC130 at 65 0 C. Correctly juxtaposed sequences formed stable duplexes with the. radioactive probe at the stringent hybridization temperature employed. Approximately 1% of the .I o" transformants screened gave positive signals by autoradiography. Ten clones were plaque-purified and RF DNA was S.'020 prepared for restriction enzyme analysis. Five isolates showed the expected decrease in size of 195 bp to the 1450 bp Hind III--Bgl II fragment (Figure DNA sequence analysis of two isolates confirmed the correct fusion junction had been made, thus maintaining the proper translational reading frame. One of these phage was designated mllVS2a.
*o o EXAMPLE IV S* 0 0 Construction of pVSBm A. Construction of Plasmids YEpVSa and YEpVS2a.
Yeast-replicating vector YEpl3 (Broach et al., Gene 8: 121, 1979) was used as an expression vehicle for v-sis-derived constructions described. in.;Examples. III. YEpl3 is a mul.tiopy extcah'rom sobsal asm Cbat n c
I
ing a 2 micron replication origin and the yeast LEU2 gene.
This allows .for selection of the plasmid in yeast strains possessing a defective chromosomal LEU2 gene when grown on synthetic medium lacking leucine. Addition of yeast terminator sequences to foreign genes expressed in yeast ensures efficient transcription termination and polyadenylation of mRNA. The v-sis expression units VSa and VS2a were placed adjacent to thFe TPI terminator fragment which was previously cloned o-tc .3pl3 (below).
Plasmid p270 (see Figure 5) contains the transcription terminator region of the yeast triose phosphate isomerase (TPI) gene. It was constructed in the following manner. The yeast TPI terminator fragment was obtained from plasmid pFG1 (Albert' and Kawasaki, ibid.). It encompasses the region from the penultimate amino-acid codon of the TPI gene to the Eco RI site approximately 700 base 0 0, pairs downstream. A Bam HI site was substituted for this o unique Eco RI 'site of pFGl by first cutting the plasmid with Eco RI, then blunting the ends with DNA polymerase I 20 (Klenow fragment), adding synthetic Bam HI linkers (CGGATCCA), and re-ligating to produce plasmid p136. The o" TPI terminator was then excised from p136 as a Xba I-- Bam HI fragment. This fragment was ligated into YEpl3 (Broach et al., ibid.), which had been linearized with .25 Xba I and Bam HI. The resulting plasmid is known as p213.
0 The Hind III site was then removed from the TPI terminator region of p213 by digesting the plasmid with Hind III, blunting the resultant termini with DNA polymerase I S(Klenow fragment), and recircularizing the linear molecule 30 using T 4 DNA ligase. The resulting plasmid is p270.
Alternatively, p270 may be constructed by digesting plasmid pM220 (see below) with Xba I and Bam HI, purifying the TPI terminator fragment (-700 bp) and inserting this fragment into Xba I and Bam HI digested YEpl3.
Referring to Figure 6, plasmid p270 DNA was digested with Xba I and treated :ith,. ca;f a .k-aline phos- phatase to-preven'tf- eligation. o°.:tee che:ve~itor .end~s- Y. i.
V-sis expression units VSa and VS2a were prepared by Xba I digestion and agarose gel purification of pVSa and mllvs2a, respectively. Each of the isolated fragments was ligated with an approximately equimolar amount of phosphatased p 2 7 0 vector in the presence of 40 units of T 4 DNA ligase and the ligation mixtures transformed into E. coli K-12 RR1. Plasmid DNA was prepared from ampicillin-resistant colonies and restriction enzyme analysis performed in order to identify clones which possessed the TPI termina'tor adjacent to 3' v-sis sequences. Presence of 3.3 kb or 3.1 kb Bgl II fragments after gel electrophoresis indicated the correct orientation of YEpVSa and YEpVS2a, respectively.
B. Construction 6f the Plasmid pVSB.
Because the product encoded by pVS2a is larger than authentic human PDGF B-chain and because a smaller 0e product might result in higher expression levels in a transformed yeast host cell, a vector was constructed 20 comprising the v-sis sequence of pVS2a truncated at the 3' end. The polypeptide encoded by this sequence comprises amino acids 67 to 175 of p28 s is and is homologous to the B-chain of PDGF.
An expression vector containing this "B-chain" sequence was constructed by combining elements of the pVS2a expression unit with a partial v-sis gene and a synthetic double-stranded DNA fragment encoding amino acids 158 to 175 of p28 s i s This synthetic fragment was designed to substitute preferred yeast codons for many of the 13 v-sis 30 codons it replaces, and to supply a stop codon at the end of the coding sequence. The construction of this vector is illustrated in Figures 7 and 8.
Plasmid YEpVS2a was digested with Pst I and Bam HI; and the 1.8 kb fragment, comprising the partial MFal, v-sis, and TPI terminator sequences, was purified by agarose gel electrophpresis. Pla.sid gplC9R.](;arshet,al -Gene 32: 481-4861. 19.84), comR:-pris.' Chart 1 inserted into the Hind III site of pUC19 (Norrander et al., Gene 26: 101-106, 1983), was digested with Pst I and Bam HI, and the vector fragment was gel-purified and joined to the 1.8 kb fragment from pVS2a to produce plasmid pVS2aT.
CHART 1
GAATTCATCGATATCTAGATCTCGAGCTCGCGAAAGCTT
Eco R1 Eco RV Bql II Sac I Hind III Cla I Xba I Xho I Nru I The S. cerevisiae TPI promoter was used to control expression of VS2a sequences in a yeast expression vector.
Plasmid pM220 contains the TPI promoter fused to the MFal «Q signal sequence. E. coli RRI transformed with pM220 has a e" been deposited with American Type Culture Collection under
BO
accession number 39853.
Plasmid pM220 was digested with Bgl II and Pst I (Figure and the ca. 1 kb fragment comprising the TPI promoter and the 5' portion of the MFal sequence was isolated and cloned in Bgl II Pst I-digested pIC19R. The resultant plasmid was digested with Cla I and Pst I, and the TPI promoter--MFal fragment was gel-purified. Plasmid pVS2aT was then cut with Cla I and Pst I and joined to the TPI promoter--MFal fragment. The correct construct was identified by the presence of a 2.6 kb Cla I--Bam HI fragment and was designated pTVS2aT.
S
Ten pg of plasmid pVSa was digested with Xma. I and Sph I (Figure 8) to completion. The resulting ca.
4.9 kb vector fragment, which also comprises most of the v-sis sequence, was purified by agarose gel electrophoresis, extraction of the DNA and EtOH precipitation.
In order to supply a new 3' terminus for the v-sis sequence, a double-stranded DNA fragment was constructed from oligonucleotides synthesized on an Applied. Biosystems Model 380-A .DNA syn thes.'zer-. 0.'p mde-.of.ljligotuclotide 42 ZC299 (Table 1) was heated with an equimolar amount of oligonucleotide ZC300 in a volume of 10 pl containing 40 mM NaCI for 5 minutes at 65 0
C.
TABLE 1 ZC299: 5'TAAG TGT GAA ATC GTT GCC GCG GCT AGA GCT GTT ACC TAA TCT AGA 3 ZC300: 3'GTACA TTC ACA CTT TAG CAA CGG CGC CGA TCT CGA CAA TGG ATT AGA TCT GGCC 5 The mixture was then incubated at 370C for 5 minutes and allowed to cool to room temperature. 0.2 pmole of the purified 4.9 kb vector fragment was added, 'the mixture ligted al for 18 hours at 120C and used to transform E. coli HB101 (ATCC 33694) to ampicillin resistance. DNA was prepared from ampicillin-resistant colonies and digested with Bgl II and Xba I. After electrophoresis through agarose, the desired clone (known as pVSaB) was identified by loss of a ca. 750 bp Bgl II--Xba I fragment and appearance of two smaller fragments of approximately 500 and 260 bp.
Approximately 8 pg of plasmid pTVS2aT (Figure 8) were digested to completion with Xba I in a volume of 10 pi.
:25 The volume was increased to 40 pi with Bgl II buffer5 and 6 a units of Bgl II were added and the mixture was incubated at '3700. Ten pl aliquots 'were removed to a stop buffer containing 50 mM EDTA at 15 and 30 minutes, and the remaining pl stopped at 45 minutes. The resulting mixtures were 30 separated by electrophoresis through 0.7% agarose. The ca.
4.6 kb Bgl II--Xba I vector fragment was cut out, extracted from the gel, 'and EtOH precipitated. Plasmid pVSoB was digested with Bgl II and Xba I, and the ca. 260 bp fragment containing the synthetic 3' terminus and stop codon was isolated by electrophoresis through agarose, subsequent extraction from the gel, and EtOH precip-itatin.. -i i 43 The 4.6 kb Bgl II--Xba I vector fragment from pTVS2cT and the 260 bp Bgl II--Xba I fragment from pVSaB were ligated in the presence of T 4 DNA ligase for 7 hours at room temperature. The reaction mixture was used to transform E. coli HBl01 to ampicillin resistance. DNA was prepared from transformants and the presence of the desired insert was confirmed by screening for a 550 bp Pst I--Xba I band on an agarose gel. A plasmid having the correct configuration was designated pVSB.
There are several alternative approaches which can be used to construct plasmid pVSB. The essential elements of pVSB include: the TPI promoter/alpha-factor fusion, which can be obtained from plasmid pM220, the B-chain coding sequence (base 551 through 877 of Figure 1B) of the v-sis gene, which is widely available, and the TPI terminator, which can be obtained from plasmid p270. Someone skilled in the art could develop several strategies to arrive at pVSB using these elements.
20 C. Construction of pMPOT2.
so 89 In order to achieve maximal protein production from a yeast culture, it is desirable to use expression vehicles which are very stably maintained in the host cell.
Plasmid pCPOT is such a preferred expression vehicle.
SE. coli HB101 transformed with pCPOT has been deposited with American Type Culture Collection under accession number 39685. Plasmid pCPOT comprises the 2 micron circle genome (Hartley and Donelson, Nature 286: 860, "30 1980), E. coli plasmid pBR322 replication and selection S sequences, and the Schizosaccharomyces pombe DNA sequences encoding the glycolytic enzyme triose phosphate isomerase (POT1). Presence of the POT1 gene in pCPOT ensures stable maintenance of the plasmid in the appropriate host background during growth. on nonselective medium utilizing glucose as a carbon source.
44 For expression of the v-sis derivatives in yeast, a stable expression vector comprising the REPI, REP2, REP3 and ori sequences from yeast 2 micron .DNA and the Schizosaccharomyces -pombe triose phosphate isomerase (POT1) gene was constructed. The POT1 gene provides for plasmid maintenance in a transformed yeast host grown in complex media if such host is defective for triose phosphate isomerase.
The POT1 gene was obtained from the plasmid pFATPOT. S. cerevisiae strain E18 transformed with pFATPOT has been deposited.with ATCC under accession number 20699.
The plasmid may be purified from the host cells by conventional techniques. The POT1 sequence was removed from pFATPOT by digestion of the plasmid with Sal I and Bam HI.
This' 1600 bp fragment was then ligated to pIC19R, which had first .been linearized by .digestion with Sal I and Bam HI. The'Bam HI; Pst I and Sal I sites in the resultant Sdo** plasmid 'were destroyed in two steps to produce plasmid pICPOT*. The Pst I and Sal I sites were removed by cutting with Pst I and Sal I; the ends were blunted by digesting 20 the Pst I 3' -overhang with DNA polymerase I (Klenow frag- S ment) and filling in the Sal I 5' overhang with Klenow a fragment. The blunt ends were then ligated. The Bam HI site was then removed by cutting the plasmid with Bam HI., filling in the ends with DNA.polymerase I (Klenow fragment) and re-ligating the blunt ends.
0 .The 2u sequences were obtained from the-plasmids YEpl3 (Broach et al., Gene 8: 121-133-, 1979) and Cl/1.
Cl/1 was constructed from pJDB248 (Beggs, Nature 275: 0 104-109, .1978) by removal of the 'pMB9 sequences by partial :30 digestion with'Eco RI and replacement by Eco RI-cut pBR322.
The REP3 and ori sequences were removed from YEpl3 by digestion with Pst I and Xba I and gel purification. REP2 was obtained from C1/1 by digestion with Xba I and Sph I and gel purification. The two fragments were then joined to pUC18 (Norrander et al., Gene 26: 101-106, 1983) which had been linearized with Pst -I an i Sph I to .p.rduce,-pas.mid. pUCREP2, 3. REP1 was- obtained _y-i.s.-ion;.rw;iti Eco RI and Xba I and gel purification of the 1704 bp fragment. The Eco RI--Xba I fragment was cloned into pUC13 which had been linearized with Eco RI and Xba I. The resultant plasmid was designated pUC13 REP1. The pUC13 REP1 plasmid was cut with Hind II and ligated in the presence of Eco RI linkers (obtained from Bethesda Research -Laboratories). The REP1 gene was then removed as an Eco RI fragment of approximately 1720 bp. This Eco RI fragment was cloned into pIC7 (Marsh et al., ibid.), which had been linearized with Eco RI and Xba I. The resultant plasmid was designated pICREPl#9.
To construct the final expression vector pMPOT2 (Figure pICPOT* was linearized by a partial Hind III digestion and complete Sst I digestion. Plasmid pUCREP2,3 was cut with Hind III and Sst I, and the fragment comprising REP2, REP3 and ori sequences was gel-purified and joined to the linearized pICPOT*. The resultant plasmid, comprising REP2, REP3, ori, POT1 and ampr sequences, was designated pMPOT1. REP1 was then removed from pICREPI as a 4* 20 Bgl II--Nar I fragment and was ligated to pMPOT1, which had been cleaved with Bgl II and Nar I. The product of this ligation was designated pMPOT2 (deposited with ATCC, accession number 20744). Plasmid pMPOT2 was digested with Cla I and Bam HI, and the vector fragment was purified as above.
D. Insertion of-VSB expression unit into pMPOT2.
a Plasmid pVSB was digested with Cla I and Bam HI, Sand the 2.2 kb fragment containing the "B-chain" expression S 30 unit purified by agarose gel electrophoresis and EtOH precipitation. Plasmid pMPOT2 was also digested with Cla I and SBam HI. The fragments were ligated overnight at room temperature in the presence of T 4 DNA ligase and the reaction mixture used to transform E. coli HBl0 to ampicillin resistance. DNA was prepared from transformants and the presence of the insert verified by digestion with Cla I and Bam HI and agarose gel electrophoresis. The resulting expression vector was designated pVSBm (Figure 8).
EXAMPLE V Yeast Transformation Plasmids pVSBm and pMPOT2 were used to transform S. cerevisiae strain E18 #9 by conventional methods.
Strain E18 #9 is a diploid produced by crossing strains El-3c (ATCC No. 20727) (Atpi: :LEU2 pep4 leu2 MATa) and Atpi29 (Atpi::LEU2 pep4 leu2 his MATa). Atpi29 is produced by disrupting the triose phosphate isomerase gene of strain E2-7b (ATCC No. 20689), essentially as described by Rothstein (Meth. in Enzymology 101: 202-210, 1983).
EXAMPLE VI B B B Construction of pSB1 In order to begin replacing B-chain coding sequence with A-chain sequence in the pVSB vector, a convenient Sst I restriction endonuclease site was created close to the. a-factor prepro-B-chain boundary (Figure 8).
This was accomplished by oligonucleotide-directed mutagenesis (Zoller and Smith, DNA 3: 479-488, 1984) on a singlestranded pVSB template using established techniques. The mutagenic 'oligonucleotide used is termed ZC506 and can be seen in Table 2.
TABLE 2 ZC505 ZC506 ZC545 ZC546 ZC547
GAACCCAGGCTTGCAGCTGGCAAAGATACCCC
GGCTCCTTTTGAGCTCAGATACCCCT
GATCTCGTAGATAACGGTACGCGTCTTACAAACAGCTCTTGAGCT
CAAGAGAGCTCTTT.GTAAGACGGTACCGTT4TWACGA CAAGAGATTATCGAAGAAGQQ 3 ZC548 ZC671 ZC672 ZC675 ZC676 ZC685 ZC686 ZC687 ZC688 ZC692 ZC693 ZC746 ZC747 ZC748 ZC749 ZC750
GATCTCACGCGTCTTACAAACGGCTGGTACCGCTTCTTCGATAGATCT
CTTGAGCT
CGCGTCTTAGAAACAGCTG
GTACCAGCTGTTTCTAAGA
CAAGTGTGAAACCGTTGCTGCTGCTAGACCAGTTACCTAAT
CTAGATTAGGTAACTGGTCTAGCAGCAGCAACGGTTTCACACTTGCATG
CAAGAGATCCTTGGGTTCTTTGACCATCGCTGAA
AGCTGGTTCAGCGATGGTCAAAGAACCCAAGGATCTCTTGAGCT
CCAGCTATGATCGCTGAATGTAAGACCAGAACCGAAGTTTTCGA
GATCTCGAAAACTTCGGTTCTGGTCTTACATTCAGCGATCAT
GATCCCAAGATCCCAAGTTGACCCAACCTCTGCCAACTTC
TTGGCAGAGGTTGGGTCAACTTGGGATCTTGG
TTGAtTTGGCCACCATGTGTTGAAGTTAAGAGATGTACTGGGTGT
CAGTACATCTCTTAACTTCAACACATGGTGGCCAAATCAAGAAG
TGTCAAACCTCGAGTGTTAAGTGTCAACCATCCAGAGT
GATGGTTGACACTTAACACTCGAGGTTTGACAACACC
TCACCACAGATCCGTTAAGGTTGCCAAGGTTGAATACGTTAGAAAGAA
GCI C A A
AGCTTTGGCTTCTTTCTAACGTATTCAACCTTGGCAACCTTAACGGAT
CTGTGGTGAACTCTG
AGCTTAAGGAAGTTCAAGTTAGATTGGAAGAACACTTGGAATGTGCAT
GCGCTACCACCTCTTTGAACCCAGACTACAGAGAATAAT
CTAGATTATTCTCTGTAGTCTGGGTTCAAAGAGGTGGTAGCGCATGCA
CATTCCAAGTGTTCTTCCAATCTAACTTGAACTTCCTTA
CCCTTGTGCTACCACCTCTTTGAACCCAGACTACAGAGAATAAT
CTAGATTATTCTCTGTAGTCTGGGTTCAAAGAGGTGGTAGCACAAGCG
CATG
0 0 0 as* It 64 a 0 0 %V a ZC751 ZC752 ZC753 2 5 ZC ABA-1 ZC ABA-2 A Pst I--Xba I fragment of PVSB (Figure 8) was subcloned into the M13 phage vector mpl9. Single-stranded template DNA was prepared from E. coli JM107 cultures infected with this recombinant phage and used in the following mutagenesis reaction. Five V1 of M13 template DNA (0.5 picomole) were combined with 2 ml of oligonucleotide ZC506 (1.8 pmole) plus 2.5 V1 of water and 1.5 pl of lbX annealing buffer A (0.2 M Tris-HC1, 0.0 M MgC12, 0-01.1 M DTT ZokIe'r ahd Sf6Ah,'. D"'NA .4,79-488,;, 'This" 48 mixture was annealed by heating to 70 0 C for 5 minutes, cooled slowly to room temperature and then placed on ice.
To this c6ld annealing mixture was added 1.5 -p of elongation buffer B (0.2 M Tris-HCl, 0.1 M MgCI 2 0.1 M DTT pH 7.5, Zoller and Smith, ibid.), 6 pl of deoxynucleotide triphosphates (2.5 mM each dNTP), 1 pl of T 4 DNA ligase, 1 pl of DNA polymerase Klenow fragment, 1 pi ATP (10 mM) and 5 pl of water. This mixture was incubated for 16 hours at 18 0 C. This reaction mixture was then diluted with water, and 2 pl of the dilute mixture was used to transform E. coli JM107 cells. The resulting phage plaques were transferred to nitrocellulose discs by the procedure of Benton and Davis (Science 196: 180, 1977) and screened with 32 p-labeled ZC506 which was labeled with T 4 polynucleotide kinase under standard conditions. The hybridization of the 32 P-ZC506 to the filters was performed at 37 0 C in 6X SSSC (0.9 M NaC1, 0.09 M Na Citrate, pH 100 pg/ml S*e carrier DNA, 0.05% sodium pyrophosphate. Following hybridization, the filters were washed at 5400 in 6X SSC, 0.1% SDS.
Phage plaques giving strong autoradiographic signals were picked and RF DNA made. and analyzed for the presence of -a new Sst I restriction endonuclease site. The sequence around the Sst I site was also confirmed by DNA sequence analysis. The Pst I-Xba I subclone now containing an Sst I ,,25 site was ligated back into Pst I-Xba I digested pVSB and the resulting plasmid termed pSBl. Plasmid pSBI encodes two amino acid changes (Leu to Glu and Asp to Leu) in the S alpha-factor leader just upstream of the Lys-Arg. The o resulting junction sequence is: a-factor Glu Leu Lys 30 Arg Ser B-chain. The B-chain coding sequences of BpSBl are thus flanked by an Sst I site at the 5' end and an Xba site at the 3' end.
49 EXAMPLE VII Construction of Variants and Derivatives of the B-chain A. Construction of a Human B-chain Expression Unit.
The B-chain construction pVSB described in Example IV above encodes the monkey B-chain amino acid sequence derived from the v-sis gene. This B-chain amino acid sequence differs from the human B-chain amino acid sequence at four positions: 6, 7, 101 and 107. These amino acid differences are largely conservative and not likely to affect the biological activity of the'B-chain.
In order to express authentic human B-chain, the monkey-specific amino acids were changed to the human sequence by incorporating synthetic oligonucleotide *o duplexes, encoding the human amino acids into the pVSB 0 construction. In this case, the preferred starting vector was pSBl (described above), which has an Sst I site intro- 20 duced at the a-factor-B-chain junction. The DNA sequences between this Sst I site and the Bgl II site at amino acid #24 (Figure 9) were replaced to encode the human amino acids threonine and isoleucine at positions 6 and 7. Four S oligonucleotides, ZC685, ZC686, ZC687 and ZC688 (Table 2), 25 were designed to replace the pSBI sequences between Sst I and Bgl II. ZC685 and ZC686 were annealed to form one duplex, and ZC687 and'ZC688 were annealed to form the other.
These two annealed duplexes were then ligated with Sst I- 0 S Bgl II digested pSB1 vector. The resulting plasmid was confirmed by DNA sequencing and termed pSBIl.
The amino acid changes at the B-chain carboxyl 0 0 end were made in a similar fashion. Plasmid pSB1 is digested with Sph I and Xba I and the sequences in this region were replaced by a synthetic DNA duplex designed to encode human amino acids threonine at position 101 and proline at position 107. Oligonucleotides ZC675 and ZC676 were- annealed :-nd:llgated irt6-Sp- I-Xba I digested pSBl ann.,- e led a b~ under standard conditions. The construction was confirmed by DNA sequencing and termed pBl2. This plasmid encodes the authentic human B-chain amino acid sequence.
Alternatively, the human B-chain amino acid sequence could be expressed by performing site-specific mutagenesis on the pVSB plasmid to change the four amino acids in question or by expressing a human B-chain cDNA sequence.
B. Monomer-Size B-chain Mutant.
Biologically active PDGF, as it is isolated from platelets or transformed cells in culture, is a disulfide bonded dimer. Chemical reduction of this dimer molecule destroys its biological activity. Surprisingly, it has been found that changing B-chain cysteine residues which are involved in interchain disulfide bonds to other amino acids or changing amino acids near these cysteine residues allows the B-chain polypeptide to fold properly but not permit interchain disulphide bonas to occur. This results *o in a monomer B-chain folded in a confirmation which permits e* binding to the PDGF cell surface receptor. Changing B-chain amino acid lysine 98 to a leucine has resulted in a molecule which is active as a monomer. This molecule is .:25 made as follows.
Plasmid pVSB (Figure 8) is digested with Sph I and Xba I, and the DNA sequences between these restriction sites are replaced with a synthetic oligonucleotide duplex.
The duplex is formed by annealing oligonucleotides analogous to ZC299 and ZC300, but containing a leucine codon at position 98 instead of a lysine codon. All the other 0 codons in this region are preserved and encode B-chain amino acid sequence. The annealed duplex has a 5' Sph I cohesive end and a 3' Xba I cohesive end and is ligated into the Sph I-Xba I digested pVSB. This B-chain mutant is termed pSB6. 51 When this construction is cloned into the pMPOT2 plasmid (then termed pSB6m) and transformed into yeast, it produces mitogenically active material. Furthermore, when the expressed mitogenic material is fractionated on a polyacrylamide gel and subsequently eluted from slices of the gel, mitogenically active material is found in the monomer size range of the gel. This demonstrates that it is possible to produce a biologically active PDGF monomer by altering cysteine residues or the environment around them.
Mutagenesis of other cysteine residues in the molecule may therefore be expected to lead to a similar result.
C. Truncated Amino Terminal B-chain Mutant.
During biosynthesis of the B-chain in the yeast expression system, the a-factor prepro polypeptide is removed from the B-chain by proteolytic processing at the basic dipeptide, Lys-Arg. Another basic dipeptide Arg-Arg occrs 27 amino acids downstream in the B-chain (Figure 9).
20 It was of interest to know if the yeast processing machino ery would process the B-chain at this internal site and a still yield an active protein. In order to drive the proteolytic processing to occur at the internal Arg-Arg site, the Lys-Arg at the a-factor-B-chain boundary was removed by 25 oligonucleotide directed mutagenesis.
Ss* The mutagenesis was performed essentially as described for the construction of pSB1 above. The Pst I-- Xba I fragment .of pVSB (Figure 8) was subcloned into the S" M13 phage vector mpl9 and single-stranded template DNA 30 prepared. In this case, the mutagenic oligonucleotide used, ZC505 (Table 2) was designed to change the a-factor Lys-Arg residues to Gly-Leu and to introduce a new Pvu II restriction site. The mutagenesis reactions were carried out as described above for pSB1 and the resulting mutants screened for the new Pvu II site and then confirmed by DNA sequence analysis. The mutagenized Pst I-Xba I fragment ft 52 was subcloned back into the B-chain expression unit (pVSB) and the new plasmid termed pSB3.
EXAMPLE VIII Construction of Variants and Derivatives of the A-chain A. Synthesis of the A-chain Amino Terminus and Construction of A-B Hybrid Fusions.
0 00
P
04 0 000 0 0000 *0a 40 0 ID 00 4 4400 o 80i 0 00*, 0 00 The A-chain coding sequences were inserted into the pSBl vector as short 'synthetic oligonucleotide duplexes designed to encode known A-chain amino acid sequence (Johnson et al., EMBO J. 3: 921-928, 1984). ZC545 and ZC546 (Table 2) were annealed, creating a short duplex DNA fragment with a 5' Sst I cohesive end, a unique Mlu I restriction site, and a 3' Bgl II cohesive end. This duplex was cloned into Sst I and Bgl II-digested pSB1. One ul of'pSBl vector (0.15 pmole) was combined with 1 1i of ZC546 20 pmole) and 0.6 pl of ZC545 pmole), plus 0..25 pl of 0.3 M NaCl (final NaCI concentration in the annealing reaction is 30 mM) and the mixture was heated to 600C for five minutes. After heating, the mixture was brought to room temperature and then placed on ice. Then 0.5 ]pl of 10X ligase buffer (0.5 M Tris-HCl, 0.1 M MgCl 2 .2 M DTT, 0.01 M ATP, pH 0.1 -p of T 4 DNA ligase (New England Biolabs) and 2.5 pl of water were added and this ligation mixture was diluted and used to transform E. coli HB101 cells. Ampicillin-resistant, p'lasmid-bearing colonies were 'picked, grown up and plasmid DNA isolated by the "miniprep" method of Ish-Horowicz and Burke (Nuc. Acid Res. 9: .2989- 2998, 1981). The plasmids were analyzed for the presence of an Sst I-Bgl II insert and a new Mlu I restriction site and confirmed by DNA sequence analysis. The ZC545-546 duplex encoded A-chain amino acids alanine 8 through tryosine 17 (Figure 9) and the resulting, plasmid .was termed. pA:l ZC547 and ZC548 (Table 2) were annealed to create a second short Sst I--Bgl II fragment encoding A-chain amino acids serine 1 through arginine 13 (Figure 9) and also containing an Mlu I restriction site. The ZC547-548 duplex was separately cloned into Sst I and Bgl II digested pSBl. One pl of pSB1 (1.5 pmole) digested with Sst I and Bgl II was combined with 2 pl of ZC547 (1 pmole) and 2 pi of ZC548 (1 pmole) plus 0.25 pl of 0.3 M NaCl and the mixture was heated to 50 0 C for five minutes. After heating, this annealing mixture was brought to room temperature and then placed on ice. Then 0.6 pi of 10X ligase buffer and 0.,l pl of T 4 DNA ligase (New England Biolabs) were added and the reaction was incubated overnight at 120C. An aliquot of this ligation reaction was diluted and used to transform E. coli HB101 cells and the resulting plasmids were screened and analyzed as described above for pAl. In this case, the resulting plasmid was termed pA2.
The overlapping pAl and pA2 A-chain coding regions were joined at the unique Mlu I restriction site using con- 20 ventional techniques. Plasmid pA2 was digested with Mlu I and Bam HI and the "1.4 kb vector (pUC containing) fragment was isolated by agarose gel electrophoresis and extracted from the agarose with CTAB (Langridge et al., Anal.
Biochem. 103: 264-271, 1980). Plasmid pAl was also 25 digested with Mlu I and Bam HI and the "800 base pair o fragment, encoding A-chain amino acids 13 through 17 fused to B-chain amino acids 24 through 109 followed by the TPI S terminator, was isolated and extracted as above. Equimolar amounts of these two fragments were ligated under standard 30 conditions and an aliquot used to transform E. coli HB101 cells. Plasmids obtained from ampicillin-resistant colonies were analyzed by restriction enzyme digestion for the correct fragments and confirmed by DNA sequencing. The resulting plasmid termed pA3 thus encoded a hybrid protein beginning with A-chain amino acids 1 through 17 followed in frame by B-chain amino acids 24 through 109. The Cla I-- Bam HI frament of. pA3 containing the eoir.e epressi6n unit was cloned into pMPOT2 and the resulting plasmid pA3m was transformed into yeast.
Further addition of A-chain amino acids to the A-B hybrid was accomplished in a similar fashion. Plasmid pA3 was digested first with Asp718, which cuts the plasmid once in the A-chain sequence at proline codon 7, and with Bam HI, and the hybrid amino acid coding fragment subcloned into pUC118. This subclone was termed pA3N and was subsequently digested with Bgl II and Bst XI. Bgl II cuts at the boundary of the A- and.B-chain sequences in the hybrid and Bst XI cuts approximately 40 base pairs downstream in the .B-chain. The vector fragment (pUC-containing) from this digest was isolated by agarose gel electrophoresis and extracted with CTAB.- One picomole each of oligonucleotides ZC692 and ZC693 (Table 2) was annealed to form a short DNA duplex with a 5' .Bgl II 'end and a 3' Bst XI end. This duplex encoded A-chain glutamic acid 18 through phenylanine -*0o 31 and was ligated with 0.1 picomole of Bgl II-Bst XIdigested pA3N. The ligation was performed overnight and 20 *the ligated products transformed into E. coli MV1193 cells.
The resulting plasmid termed pA6N now has extended the A-':nain amino acid sequence ,to the Bst XI site at. amino acid A31 followed by B-chain amino acids B38 througl B109.
Plasmid pA6N was then digested with Asp718 and 25 Bam HI and the A-B hybrid fragment cloned back into Asp718- Bam HI digested pA3m. This new A-B hybrid plasmid is termed pA6m and encodes A-chain amino acid sequence up to amino acid 40 because the Bst XI site lies at the start of a region of high-homology between A- and B-chains.
B. Construction of A-B-A Hybrid Fusions.
Since the A- and B-chains of PDGF are so homologous in -structure and function, there are likely to be several biologically active hybrid, molecules which Qan be made between the two, -A nuMber.f ex.a ip.lest cntaining.,:,,: amino 'terminal A. hai equen- fopwe y, n, mi1ay/ B'c-h;tnn. .1 n3§rio acids are described above. Another example of this concept would be to construct a hybrid protein which contained A-chain amino acid sequence at the amino and carboxyl termini and B-chain sequence in the middle.
A preferred embodiment would use plasmid pA6, which encodes the hybrid protein Al-17, B24-109, and to exchange A-chain for B-chain amino acid sequence at its carboxyl end. In this case, the B-chain coding region is digested with the restriction endonuclease Sph I, which cuts in B-chain codohs 96 and 97 (Figure The plasmid pA6 is cut again with Xba I, which cutq immediately 3' of the translation termination codon. This sequence is then replaced with two- oligonucleotides which, when annealed, form a 'duplex with.5' and 3' Sph I and Xba I cohesive ends, respectively, and contain A-chain codons (Figure The wo oligonucleotides, ZC ABA-1 and ZC ABA-2, are shown in 2 Table 2. These two oligonucleotides are annealed by heating to 65 0 C and slow cooling as described above. The annealed duplex is then ligated into Sph I-Xba I digested 20 pA6 plasmid which has been isolated by agarose gel electrophoresis. The li'gated product is transformed into E. coli MV1193 cells and transformed colonies obtained on ampicillin plates. In this case, no new restriction sites are introduced by the new A-chain duplex, so the construction is confirmed by DNA sequence analysis.
C. Construction of an A-chain Cysteine Mutant.
9 ,'agog As can be seen from Figure 9, both the A- and 30 B-chains of PDGF contain eight cysteine residues which are capable of forming disulphide bonds. It can also be seen from Figure 9 that these cysteine residues are in analogous positions in the two polypeptides and hence may participate in similar disulfide arrangements in and between the two chains and even between two different chains (A and It has been known. for. several years that chemical reduction of 'the disulf-ide-bonded PDGF .dimBr to monpmers destroys. its 56 biological activity. It is of interest to know which of the cysteine residues in question are involved in disulfide bonds of both the intra- and intermolecular type. It is very likely that the role of each cysteine will be analogous in both A- and B-chains.
The first cysteine residue in the A-chain occurs at position #10, which is analogous to #16 in the B-chain (Figure The A-B hybrid pA3 (described above) encodes A-chain amino acids 1-17, followed by B-chain. The synj0 thetic strategy leading to construction of pA3 incorporated unique. restriction sites flanking.the cysteine at residue AlO. An Asp718 and an Mlu I restriction site were placed and respectively, to the A10 cysteine codon approximately .20 base pairs .apart. Two, oligonucleotides (ZC671 15 and ZC672, Table 2) were synthesized and annealed to form a S short DNA duplex with a 5' Asp718 cohesive end and- a 3' Mlu I cohesive end. This duplex encodes a serine residue in place of cysteine Al0. Plasmid pA3 was digested with Asp718 and Mlu I and the large vector (pUC containing) frag- ,20 ment isolated by agarose gel electrophoresis. Equimolar amounts of the vector and the ZC671-672 duplex were ligated under standard conditions as described above and then transformed into E. coli MV1193 cells. Plasmid (miniprep) DNA was prepared from the resulting transformants and screened 25 for a new Pvu II site present in the ZC671-672 duplex. The duplex region of the plasmid is then confirmed by DNA sequence analysis. The resulting plasmid, .termed encodes an A-B hybrid prote-in with A-chain amino acids 1-17 at the amino terminus, but residue 10 is a serine instead :30 of 'a cysteine. The remaining amino acids of the pA5 hybrid are the .normal B-chain residues (Glu 24 through Thr 109).
D. Complete'Synthesis of the A-chain Gene.
The remainder of the A-chain gene was synthesized with oligonucleotides in a -f-ashiQn ;rvry '.similar to that. described above. 'Many strategies. ,coudbe 'designe accomplish this task. One such strategy is described below.
The oligonucleotides used in this strategy are shown in Table 2 and their design reflects optimal codon usage for Saccharomyces cerevisiae. In this strategy, the remainder of the A-chain gene was synthesized with unique restriction sites introduced in order to facilitate subcloning and sequencing the synthetic oligonucleotide sequences. All the oligonucleotides were synthesized on an Applied Biosystems 380-A DNA synthesizer. Oligonucleotides ZC752 and ZC753, each 87mers, were annealed and subcloned as a Hind III--Xba I fragment encoding A-chain amino acids 77-104. ZC752 and ZC753 (1.25 picomole each) were annealed in 5 pl of 40 mM NaCl by heating to 65 0 C for 15 minutes and then allowing the mixture to come to room temperature and 15 putting on ice. One-tenth of this annealed duplex S (.0125 picomole) was ligated into both pUC118 (.07 pmole) and M13 mpl8 (.02 picomole) which were previously digested with Hind III and Xba I. The ligated mixtures were used to .transform the appropriate E. coli host strain (JM107 in the, case of M13 mpl8 and MV1193 in the case of pUC118) and the resulting plasmid or RF DNAs analyzed by restriction endonuclease digestion and DNA sequencing.
The oligonucleotides ZC746 747, 748 749, and 750 751 were designed to form short duplexes with cohe- 25 sive ends which when joined would constitute the sequence between the Bst XI site at A31 and the Hind III site at A77.
The oligonucleotides were phosphorylated with 32 p and T 4 a polynucleotide kinase under standard conditions. The pairs ZC746 ZC747, ZC748 ZC749, and ZC750 ZC751 were each annealed by.combining 2.5 pmole of each oligonucleotide in pl of 40 mM NaCl, heating to 650C for 15 minutes, allowing to come to room temperature, and putting on ice. The three annealing mixtures were combined (now 15 pi) and ligated in a final volume of 20 pl. The ligated products were electrophoresed in a 4% NuSieve agarose gel (FMC Corporation) in TBE buffer (90 mM Tris, 90 mM boric acid, 2 mM disddium EDTA) followed by .autoradiography- The "140
'V.
base pair fragment corresponding to the three correctly ligated duplexes was cut out of the gel and extracted with CTAB. This fragment, together with the previously cloned Hind III-Xba I fragment, was ligated into the Bst XI-Xba I digested pA6N vector. The resulting plasmid was termed pA6N+. Plasmid pA6N+ was then digested with Asp718 and Xba 1 and the A-chain coding fragment cloned back into pA3.
This plasmid pA7 encodes the entire mature A-chain.
For purposes of yeast expression, a preferred embodiment would employ oligonucleotides ZC748 and ZC749.
These encode a glutamine at position A-48 instead of an asparagine. This change destroys the N-linked glycosylation site which can be aberrantly glycosylated -in yeast.
Oligonucleotides designed to preserve the N-linked glyco- 15 sylation site could also be used.
0 *The strategy employing *total gene synthesis 0.o described above is desirable because the amino acid 0: sequence of the A-chain is known and the codon usage can be optimized for yeast. Alternatively, an A-chain cDNA 20 sequence could be expressed in yeast or other eukaryotic S cells, provided the cDNA was appropriately incorporated into a' suitable expression vector. An A-chain cDNA could be obtained from a variety of mammalian cell lines by conventional techniques (Betsholtz et al., Nature 320, 25 695-699, 1986.) E. Construction of A-chain Amino Terminal Truncated Mutant aee** During biosynthesis of the A-chain protein in the yeast expression system, the a-factor prepro-peptide is *removed from the A-chain by proteolytic processing at the basic dipeptide Lys-Arg, alpha factor amino acid residues #84 and #85. In order to drive the proteolytic processing to occur at an internal .A-chain. site, the Lys-Arg at the a-factor-A-chain boundary .is :.emoved 'and a. internal- Arg-,. Arg created by oligonucletide ir ed.,:m tagenesi 59 The Lys-Arg removal mutagenesis is performed essentially as described for the construction of pSBI above.
The Pst I--Xba I fragment of pVSB (Figure 8) is subcloned into the M13 phage vector mpl9 and single-stranded template DNA is prepared. In this case, the mutagenic oligonucleotide is designed to change the a-factor Lys-Arg residues to Gly-Leu and to introduce a new Pvu II restriction site.
The mutagenesis reactions are carried out as described above for pSBl and the resulting mutants are screened for the new Pvu II site and then confirmed by DNA sequence analysis. The mutagenized Pst I--Xba I fragment is subcloned back into the A-chain expression unit (designated pA7).
In order to introduce a dibasic peptide site into 15 the A-chain coding sequence, oligonucleotide-directed S mutagenesis is .employed as described above. Amino acid residue #22 in the A-chain is a serine, while #21 is an Arg.
In this case, the mutagenic oligonucleotide is designed to change the Ser #2.2 to an Arg, creating the sequence Arg-Arg ,20 at positions #21 rid This new dibasic site in the A-chain occurs in a position precisely analogous to one which is normally present in the B-chain (Figure By expressing this mutant construction from the a-factor leader lacking the dibasic processing site, the resultant t 25 A-chain molecule should be processed internally at the new Arg-Arg and be secreted as a truncated polypeptide.
6 EXAMPLE IX 6:30 Insertion of Expression Unit Constructions into pMPOT2 6 6 Each of the molecules constructed in Examples VI- VIII above was introduced back into the basic expression unit pVSB or pSB1 if the Sst I site was employed. Then each of them was ultimately cloned into the yeast plasmid pMPOT2 (Example IV). In each case, this was done by removing the expression unit, as. a s.ingle, fragment .forn pVSB- or pSBI by Cla I-Bam HI digestion. The Cla I--Bam HI fragment of' each was isolated by agarose gel electrophoresis and cloned into pMPOT2 which had been digested with Cla I and Bam HI. The names of the resulting plasmids are then amended with a lower case pA2 becomes pA2m.
Each of the mPOT constructions was then transformed into the yeast strain E18-#9 (Example VI).
EXAMPLE X A-B Heterodimer Expression Construction PDGF is a disulfide-bonded dimer, and as isolated from platelets, is domposed of two amino acid chains, an A-chain ahd a B-chain. It is presumed that this material S* is in the form of an A-B heterodimer. There are now a number of examples of PDGF' homodimers composed of either Aor B-chain (Kelly et al., EMBO J. 4: 3399-3405 1985; Stroobant and Waterfield EMBO J. 3: 2963, 1984; and S, 20 Heldin et al., Nature 319: 511, 1986). While platelet PDGF is still thought, to be a heterodimer, these data raise the possibility that it may .actually be a mixture of A-A and B-B homodimers.
.Having expressed biologically active A and B forms 25 of PDGF in the yeast expression system, it is possible to introduce both an A- and a B-chain expression unit into the same yeast cell and to identify A-B heterodimers among the.
biologically active products. This can be done by introducing the respective expression units into the yeast cell on different plasmids, possibly with different selectable markers. Using this strategy, it may' be difficult to control the relative copy numbers of the two plasmids and this may result in disproportionate amounts of -the A- and B-chain polypeptides in the 'cell. A preferred strategy would be to put both the A-chain and B-chain expression units on the same plasmid. In tbhs_ way-, itheir..popy .numbers would always be equal.. l There are numerous ways to incorporate both expression unitj into the same plasmid. Within the present invention, the B-chain expression unit from plasmid pVSB (Figure 8) was removed by complete digestion with Bam HI 3 followed by partial digestion with Bgl II. The fragment corresponding to the expression unit (TPI promoter-MFal-Bchain-terminator) was isolated by agarose gel electrophoresis and subcloned into the Bam HI site of pUCl8. The orientation of the insert in the resulting subclones was established by conventional restriction enzyme digestions.
A subclone in which the Bgl II end of the insert was adjacent to the Sal I site in the polylinker was chosen for the next step. This subclone was digested with Sal I and Bam HI and the insert fragment isolated. This B-chain 15 fragment was then ligated into plasmid pA7m, which had been So digested with Sal I and Bam HI. The resulting plasmid pAB2m contains both the A- and the B-chain expression units oriented tail to tail. This plasmid is then transformed
O.
into yeast strain E18-#9.
EXAMPLE XI Biological Activity Assays 25 A. Radioreceptor Assay (RRA) for PDGF.
The radioreceptor assay for PDGF (Bowen-Pope and S Ross, J. Biol. Chem. 257: 5161, 1982) is a specific and sensitive (0.2-2 ng/ml PDGF) method for detecting biologi- 30 cally active PDGF-like material in yeast. In this assay, 9 PDGF-like material is tested for its ability to compete with purified, radio-labeled 1 2 5 I-PDGF for binding sites on cell surface PDGF receptors. Results are interpreted by..
comparison to a standard curve generated with purified, unlabeled PDGF. Comparison of results obtained with other assay methods ELISA) provides an indication of the strength of the receptor/-iigand inter.adtion in -addition togo inter.
.62 quantitation of the material bound. The assay is conducted as follows: -Subconfluent monolayers of diploid human fibroblasts are prepared by plating 1.5 x 104 cells per 2 cm 2 culture well in Costar 24-well cluster trays in Dulbecco's Modified Eagles Medium (DMEM) supplemented with 1% human plasma-derived serum (PDS). Cultures are set on an ice tray and rinsed once with ice-cold binding rinse (Ham's medium F-12 buffered at pH 7.4 with 25 mM HEPES and supplemented with 0.25% BSA). One ml/well of test substance in binding medium is added and the cultures incubated in a refrigerated room on an oscillating platform for 3 to 4 hours. The trays are then placed on ice, aspirated,.rinsed once with cold binding rinse and incubated for one hour as above with 1 ml/well binding medium containing 0.5 ng/ml 125 I-PDGF. Labeling is terminated. with four rinses of S" binding rinse and cell-associated 1 2 5 I-PDGF determined by o extraction with solubilization -buffer. Standard -curves are, obtained using 0, 0.05, 0.1, 0.2, 0.4, and 0.8 ng/ml puri- .fied PDGF and test samples compared to these values.
S 20 PDGF receptor binding by CM-Sephadex media concentrates from -yeast transformants containing plasmids pVSBm and pMPOT2 was compared to receptor binding, by authentic.
PDGF. After concentration by binding to and elution from S CM-Sephadex the pVSBm concentrate was normalized to PDGF.
25 equivalents in an ELISA using polyclonal goat antibody to PDGF. The RRA results were interpreted by comparison. to a standard curve generated with purified, unlabeled PDGF, as shown in Figure 10. Media from cultures transformed with the pVSBm constructions are shown to compete with 125
I-PDGF
30 for binding to the PDGF receptor. Media from yeast cells transformed with pMPOT2 do not compete with radio-labeled PDGF for receptor binding.
B. Mitogenesis Assay.
The ability of PDGF to stimulate DNA :synthesis,.
and cell growth iri'culture was the basis f aits;! degi-iion S63 and discovery. 3 H-Thymidine incorporation into DNA of cultured cells responsive *to PDGF (Raines and Ross, Meth. in Enzomology 109: in press) is a preferred method for demonstrating the biological activity of PDGF-like .molecules produced in yeast.
Straight spent media test samples or concentrates of spent media or test samples in 10 mM acetic acid (up to 100 pi/well) are added to quiescent cultures of mouse 3T3 cells in 2cm 2 Costar 24-well culture dishes (2-3 x 108 cells/well in 1 ml). Quiescent test cultures can be obtained by plating the cells in 10% serum and allowing them to deplete the medium, 4 to 5 days. The test samples are removed from the wells at 20 hours and replaced with ml of fresh medium per well containing 2 uCi/ml 15 3 H]-Thymidine and 5% calf serum. After an additional 2-hour incubation at 370C the cells are harvested by: aspirating off the medium; washing the wells twice O a each with 1 ml of ice-cold 5% TCA; solubilizing TCA- S."o insoluble material in 0.8 ml 0.25N NaOH with mixing; and 20 counting 0.6 ml of .this solution in 5 ml Aquasol in a liquid scintillation counter. Fold stimulation over control wells (100 pV of 10 mM acetic acid alone) is determined (normally 30- to 50-fold maximal stimulation) and compared to a standard curve obtained using purified :25 PDGF preparations.
oa S35 64 The A-chain homodimer and the. B-chain homodimer' 'have been purified to -homogeneity, quantitated by amino.
acid analysis, and found to have substantially equal specific activity in the mitogenesis assay.
EXAMPLE XII Optimization of Protein Expression A. Optimized B-Chain Expression Construction The DNA sequences encoding the alpha-factor leader and' PDGF B-chain' were modified to contain, yeast-optimal.
15 codons and to encode wild-type alpha-factor as well as S* authencic human B-chain. This restored the alpha-factor sequence which had been, altered in previous constructions Sand allowed the optimization of B-chain expression levels.
The codon-optimized alpha-factor leader sequence was obtained from an expression vector containing the gene for the insulin analog B(1-29)-Ala-Ala-Lys-A(1-21) (Markussen et al., EP 163,529). An Eco RI-Xba I fragment comprising the alpha-factor pre-pro and insulin sequences was cloned into.. Eco RI, Xba I digested pUC118 (obtained from J. Vieria and J. Messing, Waksman Institute of Microbiology, Rutgers, Piscataway, and single-stranded template DNA was prepared. This template was then mutagen- S ized according to the two-primer method (Zoller and Smith, DNA 3: 479-488, 1984.) using the mutagenic oligonucleotide :30 ZC862 CGA ATC TTT TGA GCT CAG AAA'CAC C The mutagenesis resulted in the creation of an Sst I site at the 3' end of the alpha-factor leader. A correctly altered plasmid was selected and designated pKP23. The -leader sequence was excised from pKP23 by digestion with Eco RI and Sst I, and the leader fragment was subcloned int pICl9 (Marsh et al., Gene 32: 481-486, 1984).. '.Th.e resultant .p-asmid was designated pKP24. 2 The human B-chain sequence was obtained from plasmid pBl2 (Example VII pB12 was digested with Sst I and Xba I and the B-chain fragment was recovered. Plasmid comprising the TPI promoter--alpha-factor--VSB--TPI terminator of pSBl (Example VI) inserted into a pBR322 vector lacking an Eco RI site, was digested with Sst I and Xba I to remove the VSB sequence. The pBl2 B-chain sequence and the pKP24 alpha-factor sequence (Eco RI-Sst I) were then inserted into the pKPl0 expression unit. The resultant plasmid was designated pKP26.
The Sst I site introduced into the alpha-factor leader to facilitate the construction of pKP26 was then removed to restore the wild-type coding sequence. .Plasmid pKP26 was digested with Eco RI and Xba I and the alpha- 15 factor--B-chain fusion sequence was recovered. This frag- Sment was cloned into pUCll8 and single-stranded template DNA was isolated. The template was mutagenized by the two primer method using the mutagenic oligonucleotide ZC1019 (5 1 ACC CAA GGA TCT CTT GTC CAA AGA AAC ACC TTC TTC A correctly mutagenized plasmid was designated pKP32.
The entire expression unit was then reconstructed.
Plasmid pKP32 was digested with Eco RI and Xba I and the alpha-factor--B-chain fragment was recovered. This fragment was inserted into Eco RI, Xba I cut pKP25 to construct 25 pKP34. Plasmid pKP34 was digested with Cla I and Bam HI and the expression unit was recovered. This fragment was inserted into Cla I, Bam HI digested pMPOT2 to construct pKP36.
The B-chain sequence was then codon optimized.
30 An internal Bgl II--Sph I fragment of the B-chain sequence of pKP36 was replaced with a sequence assembled from the oligonucleotides shown in Table 4. The pMPOT2-based expression vector containing the fully optimized expression unit was designated pB170m.
66 Optimized A-Chain Expression Constru.ction The codon-optimized A-chain sequence from plasmid pA7 (Example VIII D) was combined with the codon-optimized alpha-factor leader sequence in a series of construction steps parallel to those described above for B-chain. The alpha-factor sequence of pKP24 was combined with the pA7 A-chain sequence and Eco RI, Xba I cut pKP10 to construct pKP27. Plasmid pKP27 was digested with Eco RI and Xba I and the alpha-factor--A-chain *fragment was .cloned into, pUC118..
Mutagenesis, using, the oligonucleotide ZC1018 TTC GAT AGA TCT CTT GTC CAA AGA. AAC ACC TCC TTC. 3' 1 was carried -out as described above to remove the Sst I site and 15 restore the wild-type alpha-factor sequence. The corrected S. plasmid was designated pKP31.
.A codon-optimized expression vector was then.
*o constructed. Plasmid pKP31 was digested with Eco RI and Xba I and the alpha-factor--A-chain fragment was joined to Eco RI, Xba I cut pKP24. The resultant vector, designa.ted pKP33, contained the entire expression unit.: Plasmid pKP33 was digested with Cla I and Bam HI and.the expression unit .fragment was recovered. This fragment was inse ted into Cla I, Bam HI cut pMPOT2 to construct the expres:ion vector, 25 C. Expression of -A-Chain and B-Chain 0 S. cerevisiae- strain XR13-5B was .separately 30 transformed with plasmids pBl70m and pKP35 according to O standard' procedures. Transformants were cultured in glucose media at 30 0 C with agitation. Cultures were harvested, cells were removed by centrifugation, and protein was purified from the supernatants as described below.
S. cerevisiae strain XB l3-5B t a-.s fr.mants j i; containing plasmids .pBl7Om anhd:.pKPi av eAeri in d sfedir, 67 with American Type Culture Collection, Rockville, Md.
20852, U.S.A.
D. Protein Purification Yeast culture supernatants (12 liters), prepared as described above, were concentrated on an Amicon RA2000 ultrafiltration membrane at a flow rate of 60 ml/min to a volume of 350 ml. The buffer was exchanged with 25 mM Na acetate pH 5.5 containing 0.1% NaN 3 The concentrated samples were centrifuged at 15,000 rpm for 20 min and stored at -20 0
C.
The frozen samples were thliaed, centrifuged at 15,000 rpm for 20 min and fractionated on an S-Sepharose 15 column (Pharmacia). 300 ml samples were loaded onto a 30 ml column at a flow rate of 2 ml/min. The column was o then washed with 25 mM Na acetate pH 5.5 containing 0.1% NaN 3 The column was eluted at a rate of 2 ml/min O0 using the following elution program: 20 min with 20 mM Na 20 phosphate pH 7.3 containing 0.1% NaN 3 30 min with 20 mM Na phosphate pH 7.3, 0.2 M NaCl; 50 min with 20 nM Na phosphate pH 7.3, 0.5 M NaC1; 20 min with 20 mM Na phosphate pH 7.3, 1M NaCl. A- and B-chain polypeptides eluted at 0.5 M NaCI. Fractions were assayed for mitogenic activity and by gel electrophoresis. Mitogenically active fractions were pooled and the pH adjusted to Final purification was accomplished by highperformance liquid chromatography (HPLC). The pooled fractions from the Sopharose chromatography were passed over a 30 MicroPak C-18 column at a flow rate of 1 ml/min. The PDGF polypeptides were eluted using a gradient of Buffer B (0.1% TFA in CH3CN) in Buffer A TFA in H20). The elution program was: Time (min.) Buffer B 17.5 32.5 33.0 100 ml fractions were collected and assayed for mitogenic activity, and active fractions were pooled.
TABLE 4 ZC886 GGCCACCATGTGTTGAAGTTCAAAGATGCTCGGGTTGTTGTAACAACAGAAAC
GTTCAATG
ZC887 TCGACATTGAACGTTTCTCTTGTTACAACAACCCGAGCATCTTTGAA.CTTCAA :15 CACATG ZC888 GATCTCTAGAAGATTGATCGACAGAACCAACGCCAACTTCTTGGTTT see Z8 89 GTGGCCAAACCAAGAAGTTGGCGTTGGTTCTGTCGATCAATCTTCTAQA *rs0 s o ZC907 CGTTAGAAAGAAGCCAATCTTCAAGAAGGCTACCGTTACCCTCGAGGACCACT 00..
TGGCATG
.20 ZC908 TCGACCAACCCAAGTTCAATTGCGGCCGGTTCAAGTGCGCAAGATCGAAAT ZC909 CTAACGATTTCGATCTTGCGCACTTGAACCGGCCGCAATTGAACTTGGGTTGG ZC9 10 CCAAGTGGTCCTCCAGGTAACGGTAGCCTTCTTGAAGATTGGCTTCTTT From the foregoing it will be appreciated thatalthough -specific embodiments. of the invention have been described herein for purposes., of illustration, various modifications may be made without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
Claims (33)
1. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide which is substantially identical to the A-chain of human PDGF.
2. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a DNA sequence, a portion of said DNA sequence encoding a polypeptide which is substantially identical to at least a portion of the A-chain of human PDGF, and a portion of said DNA sequence encoding a polypeptide which is substantially identical to at least a portion of the B-chain of human PDGF, said portions of said DNA sequence encoding a protein having substantially the same biological activity as PDGF.
3. The DNA construct of claim 2, wherein said DNA sequence encodes a S 15 polypeptide substantially identical to A-chain amino acids 1-17 fused in reading frame to S B-chain' amino acids 24-109.
4. The DNA construct of claim 2, wherein said DNA sequence encodes a 0 polypeptide substantially identical to A-chain amino acids 1-17 fused in reading frame to 00 B-chain amino acids 24-97 fused in reading frame A-chain amino acids 92-104. 0
5. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a DNA sequence encoding a biologically active protein monomer which is substantially homologous to the B-chain of human PDGF. 25 6. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide chain substantially homologous to the A-chain of human PDGF, and a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide chain substantially homologous to the B-chain of human PDGF, said chains forming a heterodimer.
7. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a secretory signal sequence lacking a 4493a/ii P 0 I pJ gj *eg ul S E JISS 4SO* i S proteolytie processing site, thereby resulting in proteolytic processing within the B-chain of human PDOF, said signal sequence being followed downstream by a DNA sequence encoding a protein which is substantially homologous to the B-chain of human PDGF
8. The DNA construct according to any one of claims 1 to 7, wherein said polypeptide includes at least one amino acid substitution of a cysteine residue.
9. The DNA construct according to any one of claims 1 to 8, wherein said eucaryotic cell is a yeast cell. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells, said DNA construct containing a transcriptional promoter followed downstream by a DNA sequence encoding a polypeptide which is substantially homologous to the B-chain of human PDGF, said polypeptide including at least one amino acid substitution of a cysteine residue.
11. A method of preparing biologically active PDGF analogs, comprising: introducing into a eucaryotic host cell a DNA construct according to any one of claims 1 to 10; growing said eucaryotic host cell in an appropriate medium; and isolating the PDGF analog from said eucaryotic host.
12. A eucaryotic host cell transformed with a DNA construct according to any one of claims 1 to
13. A eucaryotic host cell transformed with a first DNA construct comprising a DNA sequence encoding a polypeptide which is substantially identical to the A-chain of human PDGF, and a second DNA construct comprising a DNA sequence encoding a polypeptide which is substantially identical to the B-chain of human PDGF.
14. A recombinant protein having two polypeptide chains, each of said chains being substantially identical to the A-chain of human PDGF, said protein having substantially the same biological activity as PDGF. A recombinant protein having two polypeptide chains, one of said chains being a mosaic of amino acid sequences substantially identical to portions of the A- and B-chains of human PDGF, the second of said chains being substantially homologous to the A-chain of human PDGF, said protein having substantially the same biological activity as PDGF.
16. A recombinant protein having two polypeptide chains, one of said chains being a mosaic of amino acid sequences substantially identical to portions of the A- and B-chains of human PDGF, the second of said chains being substantially homologous to 4493a/jj i 71 the B-chain of human PDGF, said protein having substantially the same biological activity as PDGF.
17. A recombinant protein having two polypeptide chains, each of said chains being a mosaic of amino acid sequences substantially identical to portions of the A- and B-chains of human PDGF, said protein having substantially the same biological activity as PDGF.
18. The recombinant protein according to any one of claims 14 to 17, wherein said protein includes at least one amino acid substitution of a cysteine residue.
19. A recombinant protein having two polypeptide chains, each of said chains being substantially identical to the B-chain of human PDGF, said protein including at least one amino acid substitution of a cysteine residue. A recombinant protein monomer which is substantially homologous to the B- chain of human PDGF, said protein having substantially the same biological activity as PDGF. 0* 15 21. The protein according to any one of claims 14 to 20, wherein said protein is unglycosylated. 0I
22. The protein according to claim 14, wherein said polypeptide chains are substantially identical to the A-chain of human PDGF from amino acid 9 to amino acid 104; the A-chain of human PDGF from amino acid 23 to amino acid 104; (c) the A-chain of human PDGF from'amino acid 9 to amino acid 95; or the A-chain of human PDGF from amino acid 1 to amino acid 95; or the amino acid sequence of Figure 9, from A-chain amino acid 1 to amino acid 104.
23. The protein according to claim 15, wherein said second polypeptide chain is substantially identical to the A-chain of human PDGF from amino acid 9 to amino 25 acid 104; the A-chain of human PDGF from amino acid 23 to amino acid 104; (c) S the A-chain of human PDGF from amino acid 9 to amino acid 95; the A-chain of human PDGF from amino acid 23 to amino acid 95; or the A-chain of human PDGF from amino acid 1 to amino acid 0
24. The protein according to claim 15 or claim 16, wherein said mosaic chain is substantially identical to A-chain amino acids 1-17 fused in reading frame to B-chain amino acids 24-109; or A-chain amino acids 1-17 fused in reading frame to B-chain amino acids 24-97 fused in reading frame to A-chain amino acids 92-104. The protein according to claim 15 or claim 16, wherein said polypeptide 4493a/jj 72 chains are substantially identical to one another,
26. The protein according to claim 16, wherein said second chain is substantially identical to the B-chain of human PDGF from amino acid 15 to amino acid 109; (b) the B-chain of human PDGF from amino acid 29 to amino acid 109; the B-chain of human PDGF from amino acid 15 to amino acid 101; the B-chain of human PDGF from amino acid 29 to amino acid 101; the B-chain of human PDGF from amino acid 1 to amino acid 101; or the amino acid sequence of Figure 9, from B-chain amino acid 1 to amino acid 109.
27. A therapeutic composition comprising a protein according to any one of claims 14 to 26 and a physiologically acceptable carrier or diluent.
28. The therapeutic composition according to claim 27, wherein said carrier or diluent is selected from the group consisting of albumin, sterile water and saline.
29. The therapeutic composition according to claim 27 or claim 28, including an adjuvant. 15 30. The therapeutic composition according to claim 29, wherein said adjuvant is collagen, hyaluronic acid, fibronectn, factor XIII or an antibiotic.
31. The therapeutic composition according to claim 27, wherein s-id protein is present in a concentration of from about 1 to 50 jig/ml of total volume. 0 f: 00
32. A method for the enhancement of the wound-healing process in a warm blooded animal requiring said enhancement, v :ich method comprises administering to said animal an effective amount of a protein according to any one of claims 14 to 26 or of a composition according to any one of claims 27 to 31. 00b~ 0* 33. A method of promoting the growth of mammalian cells, comprising incubating the cells with a protein according to any one of claims 14 to 26. 25 34. A wound dressing containing a protein according to any one of claims 14 to 26. A recombinant protein having two polypeptide chains, each of said chains being substantially identical to the B-chain of human PDGF, at least one of said chains having at least one amino acid substitution of a tyrosine residue for a phenylalanine residue.
36. The product of the method of claim 11. 4493a/jj 73
37. The product of the method of claim 33.
38. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells substantially as hereinbefore described with reference to any one of examples I to X or XII.
39. A DNA construct capable of directing the expression and secretion of biologically active PDGF analogs in eucaryotic cells substantially as hereinbefore described with reference to any one of figures 2 to 7 or 9. A eucaryotic host cell transformed with a DNA construct substantially as hereinbefore described with reference to any one of examples I to X or XII.
41. A eucaryotic host cell transformed with a DNA construct substantially as hereinbefore described with reference to any one of figures 2 to 7 or 9.
42. A recombinant protein substantially as hereinbefore described with reference to any one of examples VI, VII, VIII, X or XII.
43. A recombinant protein substantially as hereinbefore described with reference S 15 to figure 1B or figure 9. 00 a 8050 0 44, A method of preparing biologically active PDGF analogs, comprising: introducing into a eucaryotic host cell a DNA construct substantially as hereinbefore 0 a* described with reference to any one of examples I to X or XII; growing said eucaryotic host cell in an appropriate medium; and isolating the PDGF analog from said eucaryotic host.
45. A method of promoting the growth of mammalian cells comprising incubating the cells with a protein substantially as hereinbefore described with reference to any one of examples VI, VII, VIII, X or XII. see**: DATED this THIRTIETH day of OCTOBER 1991 ZymoGenetics, Inc. Patent Attorneys for the Applicant SPRUSON FERGUSON 4493a/ji
Applications Claiming Priority (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US06/896,485 US4766073A (en) | 1985-02-25 | 1986-08-13 | Expression of biologically active PDGF analogs in eucaryotic cells |
US896485 | 1986-08-13 | ||
US942484 | 1986-12-15 | ||
US941970 | 1986-12-15 | ||
US06/942,161 US4845075A (en) | 1985-02-25 | 1986-12-15 | Biologically active B-chain homodimers |
US06/941,970 US4849407A (en) | 1986-08-13 | 1986-12-15 | Biologically active mosaic proteins |
US942161 | 1986-12-15 |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU76816/87A Division AU7681687A (en) | 1986-08-13 | 1987-08-12 | Expression of platelet-derived growth factor and analogues |
Publications (2)
Publication Number | Publication Date |
---|---|
AU8695791A AU8695791A (en) | 1992-03-19 |
AU641816B2 true AU641816B2 (en) | 1993-09-30 |
Family
ID=27420571
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
AU86957/91A Expired AU641816B2 (en) | 1986-08-13 | 1991-11-01 | Expression of biologically active PDGF analogs in eucaryotic cells |
Country Status (1)
Country | Link |
---|---|
AU (1) | AU641816B2 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10071182B2 (en) | 2014-10-14 | 2018-09-11 | Samuel E. Lynch | Methods for treating wounds |
-
1991
- 1991-11-01 AU AU86957/91A patent/AU641816B2/en not_active Expired
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US10071182B2 (en) | 2014-10-14 | 2018-09-11 | Samuel E. Lynch | Methods for treating wounds |
Also Published As
Publication number | Publication date |
---|---|
AU8695791A (en) | 1992-03-19 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US4849407A (en) | Biologically active mosaic proteins | |
US4766073A (en) | Expression of biologically active PDGF analogs in eucaryotic cells | |
US5187263A (en) | Expression of biologically active PDGE analogs in eucaryotic cells | |
EP0259632B1 (en) | Expression of biologically active PDGF analogs in eucaryotic cells | |
EP0177957B2 (en) | Expression of biologically active platelet derived growth factor analogs in yeast cells | |
US5516896A (en) | Biologically active B-chain homodimers | |
US4769328A (en) | Expression of biologically active PDGF analogs in yeast | |
US5094941A (en) | Monoclonal antibodies to PDGF | |
AU646014B2 (en) | Novel platelet-derived growth factor B chain analogs and method for homogeneous production thereof | |
US5045633A (en) | Expression of biologically active PDGF analogs in eucaryotic cells | |
EP0547064B1 (en) | Protease resistant pdgf and methods of use | |
US5705484A (en) | Biologically active polypeptide fusion dimers | |
US6004929A (en) | Biologically active PDGF A-chain homodimers | |
US5498600A (en) | Biologically active mosaic proteins | |
US5474982A (en) | PDGF analogs and methods of use | |
AU641816B2 (en) | Expression of biologically active PDGF analogs in eucaryotic cells |