AU2760502A - Truncated Apaf-1 and methods of use thereof - Google Patents

Description

AUSTRALIA

PATENTS ACT 1990 DIVISIONAL APPLICATION NAME OF APPLICANT: 0.

o go g0 Thomas Jefferson University ADDRESS FOR SERVICE: DAVIES COLLISON CAVE Patent Attorneys 1 Little Collins Street Melbourne, 3000.

INVENTION TITLE: "Truncated Apaf-1 and methods of use thereof' The following statement is a full description of this invention, including the best method of performing it known to us: Q:\OPER\Fas\March\48229-99-80.doc 22/3/02

DESCRIPTION

TRUNCATED APAF-I AND METHODS OF USE THEREOF TECHNICAL FIELD The present invention relates generally the regulation of apoptosis, and more particularly, to truncated Apaf-I and methods of using truncated Apaf-I and selfoligomerizing caspases to identify modulators of apoptosis.

BACKGROUND OF THE INVENTION Apoptosis is the normal physiological process of programmed cell death that maintains tissue homeostasis. Changes to the apoptotic pathway that prevent or delay normal cell turnover can be just as important in the pathogenesis of diseases as are abnormalities in the regulation of the cell cycle. Like cell division, which is 15 controlled through complex interactions between cell cycle regulatory proteins, S"apoptosis is similarly regulated under normal circumstances by the interaction of gene products that either prevent or induce cell death.

Since apoptosis functions in maintaining tissue homeostasis in a range of physiological processes such as embryonic development, immune cell regulation and 20 normal cellular turnover, the dysfunction or loss of regulated apoptosis can lead to a variety of pathological disease states. For example, the loss of apoptosis can lead to the pathological accumulation of self-reactive lymphocytes that occurs with many autoimmune diseases. Inappropriate loss or inhibition of apoptosis can also lead to the accumulation of virally infected cells and of hyperproliferative cells such as neoplastic or tumor cells. Similarly, the inappropriate activation of apoptosis can also contribute to a variety of pathological disease states including, for example, acquired immunodeficiency syndrome (AIDS), neurodegenerative diseases and ischemic injury.

Treatments which are specifically designed to modulate the apoptotic pathways in these and other pathological conditions can alter the natural progression of many of these diseases.

Although apoptosis is mediated by diverse signals and complex interactions of cellular gene products, the results of these interactions ultimately feed into a cell death pathway that is evolutionarily conserved between humans and invertebrates. The pathway, itself, is a cascade of proteolytic events analogous to that of the blood coagulation cascade.

Several gene families and products that modulate the apoptotic process have now been identified. One family is the aspartate-specific cysteine proteases ("caspases"). The human caspase family includes, for example, Ced-3. human ICE (interleukin-1- converting enzyme) (caspase-1), ICH-1- (caspase-2), CPP32 (caspase- ICE,oII (caspase-4). ICEjreIII (caspase-5), Mch2 (caspase-6), ICE-LAP3 (casepase- Mch5 (caspase-8), ICE-LAP6 (caspase-9). Mch4 (caspase-10). and others.

The caspase proteins share several common features. In this regard.

caspases are cysteine proteases (named for a cysteine residue in the active site) that cleave substrates at Asp-X bonds. Furthermore, caspases are primarily produced as inactive zymogens that require proteolytic cleavage at specific internal aspartate residues for activation. The primary gene product is arranged such that the N-terminal peptide (prodomain) precedes a large subunit domain, which precedes a small subunit *domain. The large subunit contains the conserved active site pentapeptide QACXG R, Q, G) which contains the nucleophilic cysteine residue. The small subunit contains residues that bind the Asp carboxylate side chain and others that determine substrate specificity. Cleavage of a caspase yields the two subunits. the large (generally 15 approximately 20 kD) and the small (generally approximately 10 kD) subunit that associate non-covalently: to form a heterodimer, and, in some caspases. an N-terminal peptide of varying length. The heterodimer may combine non-covalently to form a tetramer.

Caspase zymogens are themselves substrates for caspases. Inspection of 20 the interdomain linkages in each zymogen reveals target sites protease sites) that indicate a hierarchical relationship of caspase activation. By analyzing such pathways, it has been demonstrated that caspases are required for apoptosis to occur. Moreover, caspases appear to be necessary for the accurate and limited proteolytic events which are the hallmark of classic apoptosis (see Salvesen and Dixit, Cell 91:443-446, 1997).

Once activated, most caspases can process and activate their own and other inactive procaspases in vitro (Femandes-Alnemri et al., Proc. Natl. Acad Sci. USA 93:7464- 7469, 1996; Srinivasula et al., Proc. Natl. Acad. Sci. USA 93:13706-13711, 1996. This characteristic suggests that caspases implicated in apoptosis may execute the apoptotic program through a cascade of sequential activation of initiators and executioner procaspases (Salvesen and Dixit, Cell 91:443-446, 1997). The initiators are responsible for processing and activation of the executioners. The executioners are responsible for proteolytic cleavage of a number of cellular proteins leading to the characteristic morphological changes and DNA fragmentation that are often associated with apoptosis (reviewed by (Cohen, Biochem. J. 326:1-16, 1997; Henkart, Immunity 4:195-201, 1996; Martin and Green, Cell 82:349-352, 1995; Nicholson and Thomberry, TIBS 257:299- 306, 1997; Porter et al., BioEssays 19:501-507, 1997; Salvesen and Dixit, Cell 91:443- 446, 1997. The first evidence for an apoptotic caspase cascade was obtained -from studies on death receptor signaling (reviewed by (Fraser and Evan, Cell 85:781-784, 1996; Nagata, Cell 88:355-365, 1997) which indicated that the death signal is transmitted in part by sequential activation of the initiator procaspase-8 and the executioner procaspase-3 (Boldin et al.. Cell 85:803-815, 1996; Ferandes-Alnemri et al., Proc. Natl. Acad Sci. USA 93:7464-7469. 1996; Muzio et al., Cell 85:817-827, 1996; Srinivasula et al., Proc. Nail. Acad Sci. USA 93:13706-13711, 1996). More direct evidence was provided, recently, when it was demonstrated that the cytochrome c death signal is transmitted through activation of a cascade involving procaspase-9 and -3 (Li et al., Cell 91:479-489, 1997).

However, it remains unclear how the initiator caspases. like procaspase-8 and -9 are activated. While Apaf-1 is known to play a role in the activation of procaspase-9 the exact mechanism has yet to be determined.

Therefore, there exists a need in the art for methods of assaying compounds for their ability to affect Apaf-1 mediated caspase activity as well as for 15 methods of modulating apoptosis in order to treat diseases and syndromes. The present invention fulfills this need, while further providing other related advantages.

a SUMMARY OF THE INVENTION 20 The present invention generally provides truncated Apaf-1. In one aspect, the invention provides an isolated nucleic acid molecule encoding a truncated Apaf-1 or a variant thereof. In one embodiment, the encoded truncated Apaf-1 is a human truncated Apaf-1. In another embodiment, the human truncated Apaf-1 has the amino acid sequence of SEQ ID NO:2 or a variant thereof. In another embodiment, the nucleic acid molecule encoding a truncated Apaf-1 or variant thereof has the nucleic acid sequence of SEQ ID NO:1 or a variant thereof. In another embodiment, the nucleic acid molecule encodes a truncated Apaf-1 or fragment thereof that oligomerizes with a caspase.

In yet another embodiment, the nucleic acid molecule encodes a human truncated Apaf-1 having the amino acid sequence of SEQ ID NO:2 or variant thereof that oligomerizes with a caspase.

It is another aspect of the invention to provide an expression vector comprising any of the nucleic acid molecules encoding a truncated Apaf-I or a variant thereof referred to above, wherein the nucleic acid molecule encoding the truncated Apaf-1 is operatively linked to a promoter. In one embodiment, the promoter is inducible. In another aspect, the invention provides a host cell 4 transfected with such expression vectors. In certain embodiments, the host cell may be a bacterium, an insect cell or a mammalian cell.

Another aspect of the invention pertains to an isolated truncated Apaf-1 polypeptide or fragment thereof. In one embodiment, the isolated truncated Apaf-1 polypeptide or fragment thereof oligomerizes with a caspase.

In another embodiment, the isolated truncated Apaf-1 polypeptide or fragment thereof is a human truncated Apaf-1, which in a further embodiment may oligomerize with a caspase. In certain embodiments, the caspase with which an isolated truncated Apaf-I polypeptide or fragment thereof oligomerizes may be caspase-1, caspase-2, caspase-3, caspase-4. caspase-5, caspase-6. caspase-7.

caspase-8, caspase-9, caspase-10, caspase-11, caspase-12 or caspase-13. In certain embodiments, the caspase with which an isolated human truncated Apaf- 1 polypeptide or fragment thereof oligomerizes may be caspase-1. caspase-2.

caspase-3, caspase-4. caspase-5. caspase-6, caspase-7, caspase-8, caspase-9, procaspase-9, caspase-10, caspase-11, caspase-12 or caspase-13. In another embodiment, the isolated human truncated Apaf-l polypeptide or fragment thereof comprises SEQ ID NO:2 or a variant thereof. In another embodiment, the isolated human truncated Apaf-1 polypeptide or fragment thereof is encoded by SEQ ID NO: or a variant thereof.

20 It is another aspect of the invention to provide a method of identifying an inhibitor or enhancer of Apaf-I mediated caspase processing, by contacting a sample containing a truncated Apaf-l or fragment thereof and one or more caspases with a candidate inhibitor or candidate enhancer, detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase processing inhibitor, and wherein an increase in processing indicates the presence of a caspase processing enhancer. In one embodiment of this aspect of the invention, at least one of the caspases is procaspase-9 or a functional fragment thereof. In another embodiment, the caspase is in vitro translated and labeled. In a further embodiment, the label may be a radioactive label, a peptide tag, an enzyme or biotin.

Another aspect of the invention provides a method of identifying an inhibitor or enhancer of Apaf-1 mediated caspase processing, by contacting a cell transfected with a vector expressing a nucleic acid encoding truncated Apaf- 1 or a variant thereof as described above with a candidate inhibitor or candidate enhancer, detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase inhibitor, and wherein an increase in processing indicates the presence of a caspase processing enhancer.

In certain embodiments of these methods of identifying an inhibitor or enhancer of Apaf-1 mediated caspase processing, the step of detecting comprises gel electrophoresis.

Turning to another aspect of the invention, a method is provided for identifying an inhibitor or enhancer of Apaf-I mediated apoptosis by contacting a cell transfected with a vector expressing truncated Apaf-I or a variant thereof as described above with a candidate inhibitor or candidate enhancer, and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor and an decrease in cell viability indicates *an enhancer.

It is another aspect of the invention to provide a method for 15 inducing apoptosis in a cell, by delivering to a cell an effective amount of a nucleic acid molecule encoding a truncated Apaf-l polypeptide, and maintaining the cell under conditions sufficient for expression of the polypeptide. In one embodiment, the step of delivering comprises injecting the nucleic acid molecule into the cell. In another embodiment, the step of delivering comprises 20 administering the nucleic acid molecule to the circulatory system of a warmblooded mammal in which the cell is located.

In another aspect of the invention, an antisense nucleic acid molecule is provided comprising a nucleic acid sequence that is complementary to a nucleic acid molecule encoding a truncated Apaf-1.

In another aspect of the invention, a gene delivery vehicle is provided comprising a nucleic acid molecule encoding truncated Apaf-1 or a variant thereof as described above wherein the nucleic acid molecule is operatively linked to a promoter. In certain embodiments the vehicle is a retrovirus or adenovirus. In certain other embodiments, the nucleic acid molecule is associated with a polycation. In certain other embodiments, the gene delivery vehicle may further comprise a ligand that binds a cell surface receptor.

The invention also provides a method of treating cancer, by administering to a patient a gene delivery vehicle comprising a nucleic acid molecule encoding truncated Apaf-1 or a variant thereof as described above, wherein the nucleic acid molecule is operatively linked to a promoter and wherein the gene delivery vehicle is internalized by tumor cells.

In another aspect the invention provides a method of treating autoimmune disease by administering to a patient a gene delivery vehicle comprising a nucleic acid molecule encoding truncated Apaf-1 or a variant thereof as described above wherein the nucleic acid molecule is operatively linked to a promoter and which may further be a retrovirus or adenovirus, a nucleic acid molecule associated with a polycation or a ligand that binds a cell surface receptor, and wherein the gene delivery vehicle is internalized by cells mediating autoimmune disease.

Another aspect of the invention provides a method of identifying an inhibitor of Apaf-1 mediated caspase processing by contacting a cell transfected with an inducible expression vector expressing truncated Apaf-1 or a variant thereof as described above with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing truncated Apaf- expression.

and detecting the presence of large and small caspase subunits, and therefrom 15 determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase processing inhibitor. In one embodiment, the step of detecting comprises gel electrophoresis.

In another aspect of the invention, a method is provided for identifying an inhibitor of Apaf-l mediated apoptosis by contacting a cell 20 transfected with an inducible expression vector expressing truncated Apaf-1 or a variant thereof as described above with a candidate inhibitor, contacting the transfected cell with an inducer capable of inducing truncated Apaf-I expression; and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor.

Another aspect of the invention provides a method of identifying an inhibitor of apoptosis by contacting a cell transfected with an inducible expression vector capable of expressing a self-oligomerizing and self-processing caspase with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing self-oligomerizing caspase expression, and detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of an apoptosis inhibitor. In one embodiment, the step of detecting comprises gel electrophoresis.

Another aspect of the invention provides a method of identifying an inhibitor of apoptosis, by contacting a cell transfected with an inducible expression vector capable of expressing a self-oligomerizing and self-processing caspase with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing self-oligomerizing caspase expression; and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor.

Another aspect of the invention provides a method for inhibiting apoptosis in a cell by delivering to a cell an effective amount of a nucleic acid molecule encoding a caspase-9 prodomain; and maintaining the cell under conditions sufficient for expression of the polypeptide.

Another aspect of the invention provides a method for inducing apoptosis in a cell, by delivering to a cell an effective amount of a nucleic acid molecule encoding a self-oligomerizing caspase-9 polypeptide; and maintaining the cell under conditions sufficient for expression of the polypeptide. In one embodiment, the step of delivering comprises injecting the nucleic acid molecule into the cell. In another embodiment, the step of delivering comprises administering the nucleic acid molecule to the circulatory system of a warm- 15 blooded mammal in which the cell is located.

Another aspect of the invention provides a gene delivery vehicle comprising a nucleic acid molecule encoding a self-oligomerizing caspase-9 polypeptide, wherein the nucleic acid molecule is operatively linked to a promoter. In certain embodiments, the vehicle is a retrovirus or adenovirus. In 20 certain other embodiments, the nucleic acid molecule is associated with a polycation. In certain other embodiments, the gene delivery vehicle may further comprise a ligand that binds a cell surface receptor.

Turning to another aspect, the invention provides a method of treating cancer by administering to a patient a gene delivery vehicle comprising a nucleic acid molecule encoding a self-oligomerizing caspase-9 polypeptide, wherein the nucleic acid molecule is operatively linked to a promoter, wherein the gene delivery vehicle is internalized by tumor cells. In certain embodiments, the vehicle is a retrovirus or adenovirus. In certain other embodiments, the nucleic acid molecule is associated with a polycation, and in certain other embodiments, the gene delivery vehicle may further comprise a ligand that binds a cell surface receptor.

It is yet another aspect of the invention to provide a method of treating autoimmune disease by administering to a patient a gene delivery vehicle comprising a nucleic acid molecule encoding a self-oligomerizing caspase- 9 polypeptide, wherein the nucleic acid molecule is operatively linked to a promoter and wherein the gene delivery vehicle is internalized by tumor cells.

In certain embodiments, the vehicle is a retrovirus or adenovirus. In certain other embodiments, the nucleic acid molecule is associated with a polycation.

These and other aspects of the present invention will become evident upon reference to the following detailed description and attached drawings. In addition, the various references set forth below that describe in more detail certain procedures or compositions plasmids, etc.), and are therefore incorporated by reference in their entirety.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a schematic diagram of full length Apaf-I and truncated forms thereof. The hatched boxes at the C-termini represent His6-tags, to facilitate urification, while the hatched boxes located at the N-termini represent T7-tags, to aid in immunoblot detection. The N-terminal CARD domain is labeled and represented as a white box (residues 1-97), the central CED-4 homology domain (residues 98-412) 15 containing Walker A and B (represented by A and B) sequences which include a P-loop sequence for nucleotide binding (residues 139-157) and a putative Mg" binding site (residues 228-235) is represented by black box, and the C-terminal domain that contains 12 WD-40 repeats (residues 413-1194) is illustrated by box containing gray and white rectangles.

20 Figures 2A and 2B are scanned images representing SDS-PAGE analysis of the processing of procaspase-9 either by truncated Apaf-530 in the presence and absence of cytochrome c and dATP (2A imaged by autoradiogram) or truncated forms of Apaf-l (2B upper panel imaged by autoradiogram, lower panel imaged by immunoblot).

Figure 3 is a scanned image of an autoradiogram representing SDS- PAGE analysis of Apaf-530 mediated procaspase-9 autoprocessing at Asp315.

Figure 4 is a scanned image of an autoradiogram representing SDS- PAGE analysis of cytochrome c/dATP-dependent processing of mutant forms of procaspase-9 in 293 cellular extracts.

Figure 5 is a scanned image of an autoradiogram representing SDS- PAGE analysis cytochrome c/dATP-dependent processing of procaspase-9 and procaspase-3 in 293 and MCF-7 cellular extracts as a function of incubation time.

Figure 6 is a schematic representation of full length procaspase-9, illustrating the sites of processing by caspase-9 and -3 and the resulting fragments.

Figure 7 is a scanned image of an autoradiogram representing SDS- PAGE analysis of caspase-9 processing of procaspase-3, procaspase-6, and procaspase-7.

Figure 8 is a scanned image of an autoradiogram representing SDS- PAGE analysis of processing of procaspase-3, procaspase-6, and procaspase-7 in the cell extracts.

Figure 9 is a scanned image of an autoradiogram representing SDS- PAGE analysis of in vitro translated WT procaspase-9 and Fc-fusion procaspase-9 variants.

Figure 10 is a bar diagram representing the ability of procaspase-Fc fusion constructs to oligomerize and induce apoptosis in MCF-7 cells. The bar diagram illustrates the percentage of round blue apoptotic cells (mean as a function of total blue cells under each condition (n 2 3).

Figure 11 is a scanned immunoblot representing SDS-PAGE analysis of the ability of N-terminal tagged Apaf-l variants to form oligomers. The molecular mass markers are indicated to the right of the lower panel.

Figure 12 is a schematic diagram illustrating two possible mechanisms 15 of activation of procaspase-9 by oligomerization.

Figure 13 is a scanned image of an autoradiogram representing SDS- PAGE analysis of the complementary processing ability of procaspase-9 mutants in the presence of Apaf-530.

Figure 14 is a scanned image of an autoradiogram representing SDS- PAGE analysis of the ability of WT procaspase-9 in the presence of Apaf-530 to induce autoprocessing of procaspase-9 mutants.

Figure 15 is a scanned image of an autoradiogram representing SDS- .PAGE analysis of the ability of mature Apaf-530-bound caspase-9 to process a chimeric procaspase-3 with an N-terminal procaspase-9 prodomain. Apl2 indicates the chimeric procaspase-3 without its p12 region.

Figure 16 is a scanned image of an immunoblot representing SDS- PAGE analysis of the ability of Apaf-1 to interact with Bcl-xL. The molecular mass markers are indicated to the right of the lower panel.

Figure 17 is a bar diagram representing the ability of dominant negative procaspase-9 to inhibit apoptosis in vivo.

Figure 18 is a scanned image of an autoradiogram representing SDS- PAGE analysis of the ability of dominant negative procaspase-9-C287A mutant to inhibit autoprocessing of procaspase-3 and -9 in vitro.

Figure 19 depicts the nucleic acid sequence (SEQ ID NO:1) and the amino acid sequence (SEQ ID NO:2) of Apaf-1.

Figure 20 depicts the nucleic acid sequence (SEQ ID NO:3) of Caspase- DETAILED DESCRIPTION OF THE INVENTION Prior to setting forth the invention, it may be helpful to an understanding thereof to set forth definitions of certain terms that will be used hereinafter.

"Truncated Apaf-1" refers to an Apaf-1 molecule comprising less than and in some embodiments less than 50% and other embodiments less than 45% of the native human sequence and being capable of oligomerizing with a caspase in the absence of cytochrome c and dATP. Briefly, Apaf-1 is the functional homolog of C.

elegans CED-4 (Yuan and Horvitz, Development 1/6:309-320. 1992; Zou et al., Cell 90:405-413, 1997). It is composed of three functional domains, a short N-terminal CARD (caspase recruitment domains) (Hofmann ei al.. Trends Biochem. Sci. 257:155- 156, 1997), a central CED-4 homology domain and a long WD-40 repeat domain.

Binding of Apaf-1 to cytochrome c in the presence of dATP exposes its CARD, which 15 then binds to a corresponding motif in the prodomain of procaspase-9 resulting in its .I recruitment to this complex (Li el al., Cell 91:479-489. 1997). Recruitment of procaspase-9 to the Apaf-l complex results in its activation by an as yet unknown mechanism.

The truncated Apaf-1 molecules of the subject invention also include variants (including alleles) of the native protein sequence. Briefly, such variants may result from natural polymorphisms or may be synthesized by recombinant methodology, and differ from wild-type protein by one or more amino acid substitutions, insertions, deletions, or the like. Variants generally have at least nucleotide identity to native sequence, preferably at least 80%-85%, and most preferably at least 90% nucleotide identity. Typically, when engineered, amino acid substitutions will be conservative, substitution of amino acids within groups of polar, non-polar, aromatic, charged, etc. amino acids. In the region of homology to the native sequence, variants should preferably have at least 90% amino acid sequence identity, and within certain embodiments, greater than 92%, 95%, or 97% identity.

Such amino acid sequence identity may be determined by standard methodologies, including use of the National Center for Biotechnology Information BLAST search methodology available at www.ncbi.nlm.nih.gov. The identity methodologies most preferred are those described in U.S. Patent 5,691,179 and Altschul et al., Nucleic Acids Res. 25:3389-3402, 1997, both of which are incorporated herein by reference.

As will be appreciated by those skilled in the art, a nucleotide sequence encoding a truncated Apaf-1 or variant thereof may differ from known native sequence, due to codon degeneracies, nucleotide polymorphisms, or amino acid differences. In 11 certain embodiments, variants will preferably hybridize to the native nucleotide sequence at conditions of normal stringency, which is approximately 25-30 0 C below Tm of the native duplex 5X SSPE, 0.5% SDS, 5X Denhardt's solution, formamide. at 42 0 C or equivalent conditions; see generally, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, 1989; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1995). By way of comparison, low stringency hybridizations utilize conditions approximately below Tm, and high stringency hybridizations utilize conditions approximately below Tm.

A "caspase" refers to a cysteine protease that specifically cleaves proteins after Asp residues. Caspases are initially expressed as zymogens, in which a large subunit is N-terminal to a small subunit. Caspases are generally activated by cleavage at internal Asp residues. These proteins have been identified in many eukaryotes, including C. elegans, Drosophila, mouse. and humans. Currently, there are 15 at least 13 known caspase genes, named caspase-I through caspase-13. Caspases are found in myriad organisms, including human, mouse, insect Drosophila). and other invertebrates C. elegans). In Table 1, ten human caspases are listed along with their alternative names.

o o Caspase Alternative name Caspase-1 ICE Caspase-2 ICH-1 Caspase-3 CPP32. Yama, apopain Caspase-4 ICErll; TX, ICH-2 ICE,,,III; TY Caspase-6 Mch2 Caspase-7 Mch3, ICE-LAP3, CMH-1 Caspase-8 FLICE; MACH; Caspase-9 ICE-LAP6; Mch6 Mch4, FLICE-2 An "isolated nucleic acid molecule" refers to a polynucleotide molecule in the form of a separate fragment or as a component of a larger nucleic acid construct, that has been separated from its source cell (including the chromosome it normally resides in) at least once, and preferably in a substantially pure form. Nucleic acid molecules may be comprised of a wide variety of nucleotides, including DNA, RNA, nucleotide analogues, or combination thereof.

12 The term "self-oligomerizing" refers to the ability of a polypeptide construct to form multimers with other copies of itself. The polypeptide may be caspases which are chimeras of other caspases, caspase-fusion constructs Fccaspase fusions), mutagenized caspases, or truncated caspases. Self-oligomerizing constructs which are useful within the context of the invention are caspases which either activate caspases, following oligomerization, thereby activating apoptosis, or which bind to and inhibit or sequester other caspases, thereby inhibiting caspase activation and resulting apoptosis.

The term "in vitro" refers to cell free systems.

The term "in vivo" refers to whole cell systems, which include, for example, primary and secondary cell culture, whole organs culture, whole organisms, and similar systems as known to those of ordinary skill in the art.

A. TRUNCATED APAF-1 NUCLEIC ACID MOLECULES AND ENCODED PRODUCTS

THEREOF

S1. Isolation ofApaf-1 and caspase nucleic acid molecules The present invention provides truncated Apaf-1 nucleic acid molecules *which. in certain embodiments, are constructed from full-length Apaf- nucleic acid o molecules. Apaf-1 and caspase nucleic acid molecules used in the subject invention may be isolated from either genomic DNA or preferably cDNA (see U.S. Ser. No.

08/869,553 and U.S. Pat. 5,550,019, each of which are incorporated herein by S. :reference). Isolation of Apaf-1 and caspase nucleic acid molecules from genomic DNA :or cDNA typically can proceed by, first, generating an appropriate DNA library through techniques for constructing libraries that are known in the art (see Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989) or purchased from commercial sources Clontech, Palo Alto, CA). Briefly, cDNA libraries can be constructed in bacteriophage vectors (e.g.,XZAPII), plasmids, or others, which are suitable for screening, while genomic DNA libraries can be constructed in chromosomal vectors, such as YACs (yeast artificial chromosomes), bacteriophage vectors, such as XEMBL3, Xgtl 0, cosmids, or plasmids.

In one embodiment, known Apaf-1 and caspase sequences may be utilized to design an oligonucleotide hybridization probe suitable for screening genomic or cDNA libraries. Preferably, such oligonucleotide probes are 20-30 bases in length.

To facilitate hybridization detection, the oligonucleotide may be conveniently labeled, generally at the 5' end, with a reporter molecule, such as a radionuclide, 32p), enzymatic label, protein label, fluorescent label, or biotin. Such libraries are then generally plated as phage or colonies, depending upon the vector used. Subsequently, a nitrocellulose or nylon membrane, to which the colonies or phage have been transferred, is probed to identify candidate clones which contain the caspase gene.

Such candidates may be verified as containing caspase DNA by any of various means including, for example, DNA sequence analysis or hybridization with a second, nonoverlapping probe.

Once a library is identified as containing an Apaf-I or caspase nucleic acid molecule. the molecule can be isolated by amplification. Briefly, when using cDNA library DNA as a template, amplification primers are designed based upon known Apaf-1 or caspase nucleic acid sequences (see GenBank Accession Nos.

AF013263 (Apaf-1), X65019 (caspase-1), U13021 (caspase-2), U13737 (caspase-3), U25804 (caspase-4), U28015 (caspase-5), U20536 (caspase-6), U37448 (caspase-7), U60520 (caspase-8). U56390 (caspase-9), U60519 (caspase-10), and sequences provided herein). Amplification of cDNA libraries made from cells with high caspase or Apaf-I activity is preferred. Primers for amplification are preferably derived from 15 sequences in the 5' and 3' untranslated region in order to isolate a full-length cDNA.

The primers preferably have a GC content of about 50% and contain restriction sites to facilitate cloning and do not have self-complementary sequences nor do they contain S--complementary sequences at their 3' end (to prevent primer-dimer formation). The primers are annealed to cDNA or genomic DNA and sufficient amplification cycles are 20 performed to yield a product readily visualized by gel electrophoresis and staining. The amplified fragment is purified and inserted into a vector, such as kgtl0 or pBS(M13+), and propagated. Confirmation of the nature of the fragment may be obtained by DNA sequence analysis, or indirectly through amino acid sequencing of the encoded protein.

Other methods may also be used to obtain an Apaf-1 or caspase encoding nucleic acid molecule. For example, a nucleic acid molecule encoding an Apaf-1 or caspase may be obtained from an expression library by screening with an antibody or antibodies reactive to such an Apaf-1 or caspase (see, Sambrook, et al.

Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, NY, 1989; Ausubel, et al. Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Interscience, NY, 1995).

Apaf-I and caspase nucleic acid molecules from a variety of species may be isolated using the compositions provided herein. For closely related species, the human sequence or portion thereof may be utilized as a probe on a genomic or cDNA library. For example, a fragment of nucleic acid that encodes a polypeptide region that encompasses the CARD domain of Apaf-1 or the catalytic site of a caspase may be labeled and used as a probe on a library constructed from mouse, primate, rat, dog, or other vertebrate, warm-blooded or mammalian species. An initial hybridization at normal stringency may yield candidate clones or fragments. If no hybridization is initially observed, varying degrees of stringency may be used (see Sambrook et al., supra, and other well-known sources for stringency conditions). While such probes may also be used to probe libraries from evolutionarily diverse species, such as Drosophila, hybridization conditions will likely be less stringent.

While relaxed hybridization conditions using probes designed from human sequences may identify Apaf-1 or caspase nucleic acid molecules of evolutionarily diverse species, it may be more beneficial to attempt to directly isolate these molecules from a library using methods which do not require the human sequence per se. These methods include, but are not limited to, amplification using primers derived from conserved areas, amplification using degenerate primers from various regions, antibody probing of expression libraries, and the like. For example, randomprimed amplification polymerase chain reaction) may be employed (see, e.g., 0. Methods Enzymol. 254:275, 1995; Trends Genet. 11:242, 1995; Liang and Pardee, 15 Science 257:967, 1992; Welsh et al.. Nucl. Acids Res. 20:4965, 1992). In addition, s variations of random-primed PCR may also be used, especially when a particular gene or gene family is desired. In such a method, one of the amplification primers is an 0* "anchored oligo(dT) (oligo(dT)dN)" and the other primer is a degenerate primer based 0000 upon amino acid or nucleotide sequence of a related gene. A gene sequence is ,20 identified as an Apaf-1 or caspase by amino acid similarity and/or nucleic acid similarity. Generally, amino acid similarity is preferred. Candidate Apaf-l or caspase genes may be examined for enzyme activity by one of the functional assays described herein, or other equivalent assays.

Variants of Apaf-1, truncated Apaf-l, and caspase nucleic acid molecules provided herein may be engineered from natural variants polymorphisms, splice variants, mutants), synthesized or constructed. Many methods have been developed for generating mutants (see, generally, Sambrook et al., supra; Ausubel, et al., supra, and the discussion above). Briefly, preferred methods for generating nucleotide substitutions utilize an oligonucleotide that spans the base or bases to be mutated and contains the mutated base or bases. The oligonucleotide is hybridized to complementary single stranded nucleic acid and second strand synthesis is primed from the oligonucleotide. The double-stranded nucleic acid is prepared for transformation into host cells, typically E. coli. but alternatively, other prokaryotes, yeast or other eukaryotes. Standard screening and vector growth protocols are used to identify mutant sequences and obtain high yields.

Similarly, deletions and/or insertions of the Apaf-l, truncated Apaf-1, or caspase nucleic acid molecule may be constructed by any of a variety of known methods as discussed supra. For example, the nucleic acid molecule can be digested with restriction enzymes and religated, thereby deleting or religating a sequence with additional sequences, such that an insertion or large substitution is made. Other means of generating variant sequences may be employed using methods known in the art, for example those described in Sambrook et al., supra; Ausubel et al.. supra. Verification of variant sequences is typically accomplished by restriction enzyme mapping, sequence analysis, or probe hybridization. Variants of caspase nucleic acid molecules whose encoded product is capable of oligomerizing to itself or a form of Apaf-I or capable of being processed to an active form which will catalyze Asp-specific cleavages, are useful in the context of the subject invention. Moreover, the variant Apaf-1 and truncated Apaf-1 nucleic acid molecules which encode products capable of oligomerizing with caspases, caspase variants, or Bcl-xL proteins are useful in the context of this invention.

15 B. TRUNCATED APAF-I The truncated Apaf-1 molecules of the present invention may be generated by truncating the gene sequence of the Apaf-1 gene. or variant thereof. In certain embodiments, the nucleic acid sequence encodes an Apaf-1 molecule lacking most, and preferably all, of the WD-40 repeats (Figure 1).

20 The sequence motifs contained within Apaf-1 are related to those contained in initiator caspases which contain large prodomains. (Ahmad el al., Cancer.

Res. 57:615-619, 1997; Boldin et al., J. Biol. Chem. 270:7795-7798, 1995; Chinnaiyan et al., Cell 81:505-512, 1995; Duan and Dixit, Nature 385:86-89, 1997; Zou el al.. Cell 90:405-413, 1997). While such motifs exist in the cytochrome c-Apaf-I signaling pathway (Li et al., Cell 91:479, 1997; Zou et al., Cell 90:405-413, 1997), studies of Apaf-1 have demonstrated that both cytochrome c and dATP are necessary for activation of caspases, such as procaspase-9 (Liu et al., Cell 86:147, 1996). The domains of several caspase molecules are demonstrated below.

Caspase Prodomain Large Intervening Small Subunit sequence Subunit Caspase-1 1-357 358-891 892-948 949-1212 Caspase-2 1-456 457-948 949-990 991-1305 Caspase-3 1-84 85-525 526-831 Caspase-4 1-240 241-810 811-867 868-1131 1-363 364-933 934-1254 Caspase-6 1-69 70-537 538-579 580-879 Caspase-7 1-69 70-594 595-909 Caspase-8 1-681 682-1173 1174-1488 Caspase-9 1-390 391-945 946-990 991-1248 1-657 658-1116 1117-1437 The truncated Apaf-1 of the present invention, in one embodiment, can oligomerize with a caspase. In a further embodiment, the truncated Apaf-1 of the present invention is capable of inducing the processing of a caspase in the absence of dATP and cytochrome c.

Structure of truncated Apaf- Full length Apaf-1 is 1194 amino acids in length. It contains an N-terminal CARD that is homologous to the CED-3 prodomain (residues 1-97), a 10 central CED-4 homology domain (residues 98-412) and a C-terminal domain that contains 12 WD-40 repeats (residues 413-1194). The CED-4 homology domain contains Walker A and B sequences which include a P-loop sequence for nucleotide binding (residues 139-157) and a putative Mg- binding site (residues 228-235) (Figure Truncated Apaf-1 molecules of the present invention comprise at least a portion of CARD domain and at least a portion of the central CED-4 homology domain. In preferred embodiments, the truncated Apaf-1 also includes a portion of the 12 S" repeats. In other embodiments, a truncated Apaf-1 is fused to other polypeptide sequences to aid in expression, purification, oligomerization and/or targeting. For example, fusions with His6, T7, and Flag tags may aid in purification and/or immunoidentification.

In one embodiment, truncated Apaf-1 encoding nucleic acid molecules are designed that encode amino acid residues 1 through at least 420 of SEQ ID NO:2.

In a further embodiment, truncated Apaf-1 encoding nucleic acid molecules are designed that encode amino acid residues 1 through at least 530 (SEQ ID NO:2). One of skill in the art would recognize that the absolute length of the Apaf-1 is only a secondary consideration when designing a truncated form which is capable of initiating caspase processing without the presence of cytochrome c or dATP. Such constructs can be readily tested for their ability to initiate caspase processing by the assays described herein. Further, such constructs can be tested for their ability to oligomerize a caspase, procaspase-9). Such oligomerization may be determined by a variety of means, including radiolabeling a caspase and counting the resulting complex to determine the extent of oligomer formation. Such experiments are readily performed by those of skill in the art.

2. Construction of truncated Apaf- Truncated Apaf-1 molecules of the subject invention may be constructed from Apaf-1 sequences by a variety of methods known in the art. A preferred method is amplification polymerase chain reaction (PCR)) to selectively amplify the individual regions and place these in cloning vectors such as pUC such as described in Example 1. Moreover, such PCR reactions can be performed in a variety of ways such that the primers used for amplification contain specific restriction endonuclease sites to facilitate insertion into a vector.

Further, a variety of other methodologies besides PCR may be used to attain the desired construct. For example, one skilled in the art may employ isothermal methods to amplify the nucleotide sequence of interest, using existing restriction 15 endonuclease sites present in the nucleotide sequence to excise and insert sequences, or by the introduction of distinct restriction endonuclease sites by site-directed mutagenesis followed by excision and insertion. These and other methods are described in Sambrook et al., supra; Ausubel, el al., supra. Briefly, one methodology is to generate single-stranded cDNA of Apaf-1, followed by annealing a primer, which 20 is complementary except for the desired alteration a small insertion, deletion, or mutation such that a unique restriction site is created between the domains). Bacterial cells are transformed and screened for those cells which contain the desired construct.

.0 This construct is then digested to liberate the desired sequences, which can then be purified and religated into the appropriate orientation.

As indicated above, Apaf-l nucleic acid molecules may be manipulated to contain insertions, deletions or substitutions. Moreover, such variant Apaf-1 molecules useful in the context of this invention include those which inhibit or facilitate caspase processing.

C. VECTORS, HOST CELLS AND METHODS OF EXPRESSING AND PRODUCING PROTEIN Truncated Apaf-1 may be expressed in a variety of host organisms. In certain embodiments, truncated Apaf-1 is produced in bacteria, such as E. coli, or mammalian cells CHO and COS-7), for which many expression vectors have been developed and are available. Other suitable host organisms include other bacterial species, and eukaryotes, such as yeast Saccharomyces cerevisiae), and insect cells Sf9).

18 In one embodiment, a DNA sequence encoding a truncated Apaf-l is introduced into an expression vector appropriate for the host cell. In certain embodiments, truncated Apaf-1 is inserted into a vector such that a fusion protein is produced. The truncated Apaf-1 sequence is derived as described herein. As discussed above, the sequence may contain alternative codons for each amino acid with multiple codons. The alternative codons can be chosen as "optimal" for the host species.

Restriction sites are typically incorporated into the primer sequences and are chosen with regard to the cloning site of the vector. If necessary, translational initiation and termination codons can be engineered into the primer sequences.

At a minimum, the vector will contain a promoter sequence. As used herein, a "promoter" refers to a nucleotide sequence that contains elements that direct the transcription of a linked gene. At a minimum, a promoter contains an RNA polymerase binding site. More typically. in eukaryotes, promoter sequences contain binding sites for other transcriptional factors that control the rate and timing of gene 15 expression. Such sites include TATA box. CAAT box, POU box, API binding site, and the like. Promoter regions may also contain enhancer elements. When a promoter is linked to a gene so as to enable transcription of the gene, it is "operatively linked".

Other regulatory sequences may be included. Such sequences include a transcription termination sequence, secretion signal sequence, origin of replication, :20 selectable marker, and the like. The regulatory sequences are operationally associated with one another to allow transcription or translation.

The expression vectors used herein include a promoter designed for expression of the proteins in a host cell bacterial). Suitable promoters are widely available and are well known in the art. Inducible or constitutive promoters are preferred. Such promoters for expression in bacteria include promoters from the T7 phage and other phages, such as T3, T5, and SP6, and the trp, Ipp, and lac operons.

Hybrid promoters (see, U.S. Patent No. 4,551,433), such as tac and ire, may also be used. Promoters for expression in eukaryotic cells include the P10 or polyhedron gene promoter of baculovirus/insect cell expression systems (see, U.S. Patent Nos.

5,243,041, 5,242,687, 5,266,317, 4,745,051, and 5,169,784), MMTV LTR, CMV IE promoter, RSV LTR, SV40, metallothionein promoter (see, U.S. Patent No. 4,870,009), ecdysone response element system, tetracycline-reversible silencing system (tet-on, tet-off), and the like.

The promoter controlling transcription of truncated Apaf-1 may itself be controlled by a repressor. In some systems, the promoter can be derepressed by altering the physiological conditions of the cell, for example, by the addition of a molecule that competitively binds the repressor, or by altering the temperature of the growth media.

19 Preferred repressor proteins include, but are not limited to the E. coli lacl repressor responsive to IPTG induction, the temperature sensitive XcI857 repressor, and the like.

In other optional embodiments, the vector also includes a transcription termination sequence. A "transcription terminator region" has either a sequence that provides a signal that terminates transcription by the polymerase that recognizes the selected promoter and/or a signal sequence for polyadenylation.

In one aspect, the vector is capable of replication in the host cells. Thus, when the host cell is a bacterium, the vector preferably contains a bacterial origin of replication. Bacterial origins of replication include the fl-ori and col El origins of replication, especially the ori derived from pUC plasmids. In yeast. ARS or CEN sequences can be used to assure replication. A well-used system in mammalian cells is SV40 ori.

The plasmids also preferably include at least one selectable marker that is functional in the host. A selectable marker gene includes any gene that confers a 15 phenotype on the host that allows transformed cells to be identified and selectively grown. Suitable selectable marker genes for bacterial hosts include the ampicillin resistance gene (Ampr), tetracycline resistance gene (Tcr) and the kanamycin resistance gene (Kanr). The kanamycin resistance gene is presently preferred. Suitable markers for eukaryotes usually require a complementary deficiency in the host thymidine 20 kinase (tk) in tk- hosts). However, drug markers are also available G418 resistance and hygromycin resistance).

The sequence of nucleotides encoding truncated Apaf-l may also include a secretion signal, whereby the resulting peptide is a precursor protein processed and secreted. The resulting processed protein may be recovered from the periplasmic space or the fermentation medium. Secretion signals suitable for use are widely available and are well known in the art (von Heijne, J. Mol. Biol. 184:99-105, 1985). Prokaryotic and eukaryotic secretion signals that are functional in E. coli (or other host) may be employed. The presently preferred secretion signals include, but are not limited to, those encoded by the following E. coli genes: pelB (Lei et al.. J Bacteriol. 169:4379, 1987), phoA, ompA, ompT, ompF, ompC, beta-lactamase, and alkaline phosphatase.

One skilled in the art will appreciate that there are a wide variety of suitable vectors for expression in bacterial cells and which are readily obtainable.

Vectors such as the pET series (Novagen, Madison, WI), the tac and trc series (Pharmacia, Uppsala, Sweden), pTTQ18 (Amersham International plc, England), pACYC 177, pGEX series, and the like are suitable for expression of a truncated Apaf- 1. Baculovirus vectors, such as pBlueBac (see. U.S. Patent Nos. 5,278.050, 5,244,805, 5,243,041, 5,242,687, 5,266.317, 4,745.051, and 5,169.784; available from Invitrogen, San Diego) may be used for expression in insect cells, such as Spodoptera frugiperda sf9 cells (see, U.S. Patent No. 4,745,051). The choice of a bacterial host for the expression of a truncated Apaf-1 is dictated in part by the vector. Commercially available vectors are paired with suitable hosts.

A wide variety of suitable vectors for expression in eukaryotic cells are also available. Such vectors include pCMVLacl, pXTI (Stratagene Cloning Systems, La Jolla, CA); pCDNA series, pREP series, pEBVHis (Invitrogen, Carlsbad, CA). In certain embodiments, the truncated Apaf-1 nucleic acid molecule is cloned into a gene targeting vector, such as pMClneo, a pOG series vector (Stratagene Cloning Systems).

Truncated Apaf-I may be isolated by standard methods, such as affinity chromatography, size exclusion chromatography, metal ion chromatography, ionic exchange chromatography, HPLC, and other known protein isolation methods. (see generally Ausubel et al. supra; Sambrook et al. supra). An isolated purified protein 15 gives a single band on SDS-PAGE when stained with Coomassie blue.

Truncated Apaf-1 may be expressed as a hexa-his (His6) fusion protein and isolated by metal-containing chromatography, such as nickel-coupled beads.

Briefly, a sequence encoding His6 is linked to a DNA sequence encoding a truncated Apaf-1. Although the His6 sequence can be positioned anywhere in the molecule, 20 preferably it is linked at the 5' end or at the 3' end immediately preceding the termination codon. The fusion may be constructed by any of a variety of methods. A convenient method is amplification of the truncated Apaf-1 nucleic acid molecule using a downstream primer that contains the codons for His6. In a similar manner T7, Flag, and a variety of other fusions are possible.

Caspase proteins/polypeptides and nucleic acid molecules may be isolated, modified, and expressed by all the methods described above applicable to truncated Apaf-1. For example, nucleic acid molecules may be manipulated as previously described, to create molecules encoding caspase fusion proteins Fccaspase), caspase chimeras Example 11), and other caspase variants capable of oligomerization with self, other caspase molecules, or a form of Apaf-1. In one embodiment caspases constructed such that they can oligomerize with procaspase-9 or other caspases and inhibit their processing are useful in inhibiting apoptosis. For example, a nucleic acid encoding an active site mutant caspase can be constructed such that upon introduction to a cell, the encoded product binds to and inhibits processing of or sequesters other caspases or endogenous Apaf-1, thereby inhibiting apoptosis. In a further embodiment, the prodomain of a caspase, such as caspase-9 may be introduced to a cell to inhibit apoptosis. For example, a nucleic acid molecule encoding the caspase-9 prodomain may be introduced into a cell under a constitutive promoter such that the encoded polypeptide competes with endogenous caspase-9 for endogenous Apaf-l binding. In another embodiment, chimeric caspases or protein fusion-caspases can be constructed by standard molecular biological techniques as described by Sambrook et al., supra; Ausubel et al., supra. Briefly, the region of interest of one caspase can be cloned into a cloning vector and with the aid of restriction enzymes digested such that the nucleic acid sequence of another caspase may be fused thereto, thereby creating a chimeric nucleic acid molecule encoding a chimeric protein. The same procedure can be used to create a caspase fusion protein, however, in this case many vectors are commercially available which contain fusion constructs and allow direct cloning of the insert of interest into the vector in a simple one step process.

Purified truncated Apaf- protein and caspase fusion proteins may be used in assays to screen for molecules which modulate apoptosis as described in detail infra. In further embodiments, these proteins may also be crystallized and subjected to 15 X-ray analysis to determine the 3-dimensional structure or utilized to generate antibodies.

D. USES OF TRUNCATED APAF-1 NUCLEIC ACID MOLECULES AND ENCODED 20 PRODUCTS THEREOF 1. Identification of inhibitors and enhancers of caspase activity Candidate inhibitors and enhancers may be isolated or procured from a variety of sources, such as bacteria, fungi, plants, parasites, libraries of chemicals, peptides or peptide derivatives and the like. Inhibitors and enhancers may be also be rationally designed, based on the protein structures determined from X-ray crystallography. In certain preferred embodiments, the inhibitor targets the Apaf- 1/caspase interaction.

Without being wishing to be bound to a particular theory or held to a particular mechanism, the inhibitor may act by preventing processing of caspase or by preventing enzymatic activity, by inhibiting Apaf-1/caspase complex formation, or by other mechanisms. The inhibitor may act directly or indirectly. In preferred embodiments. inhibitors interfere in the processing of the caspase protein or the Apaf- 1/caspase complex formation and/or the integrity of the complex. In other embodiments, the inhibitors are small molecules. In one embodiment, the inhibitors prevent apoptosis. Inhibitors should have a minimum of side effects and are preferably non-toxic. Inhibitors that can penetrate cells are preferred.

In addition, enhancers of caspase processing activity or expression are desirable in certain circumstances. At times, increasing apoptosis will have a therapeutic effect. For example, tumors or cells that mediate autoimmune diseases are appropriate cells for destruction. Enhancers may increase the rate or efficiency of caspase processing, increase transcription or translation, or act through other mechanisms. As will be apparent to those skilled in the art, many of the guidelines presented above apply to the design of enhancers as well. Within the context of the present invention truncated Apaf-1 itself can act as an enhancer. Further, other compounds which facilitate caspase oligomerization are reasonably expected to enhance apoptosis. For example, caspase proteins fused to Fc domains, FKBP (FK506 binding protein), or the like can form oligomers which lead to caspase activation Example 8).

Screening assays for inhibitors and enhancers will vary according to the type of inhibitor or enhancer and the nature of the activity that is being affected.

15 Assays may be performed in vitro or in vivo. In general, in vitro assays are designed to evaluate caspase protein processing or caspase enzymatic activity, and in vivo assays are designed to evaluate caspase protein processing, caspase enzymatic activity, apoptosis, or caspase cleavage of substrate. In any of the assays, a statistically significant increase or decrease compared to a proper control is indicative of 20 enhancement or inhibition. In one embodiment, the caspase utilized for the assays is procaspase-9.

One in vitro assay can be performed by examining the effect of a candidate compound on processing of a caspase into two subunits. Briefly, a caspase, that is a primary translation product, is obtained from an in vitro translation system.

The caspase is preferably constructed to be capable of normal auto-processing, but can be constructed so that the caspase self-oligomerizes, thereby inducing auto-processing.

As mentioned above, self-oligomerization may be achieved by creating a fusion with the caspase and a domain known to self associate, such as an Fc domain. Further, chimeric caspase constructs can be created such that the domain responsible for oligomerization in one caspase is transferred to another see EXAMPLE 11). Such chimeric constructs can be readily tested for self, Apaf-1, or truncated Apaf-1 oligomerization by known methods of detecting protein-protein binding. For example, one can utilize sedimentation analysis, electrophoretic gel shift analysis, radiolabeled binding studies, and the like. In addition, if the primary in vitro translation product is constructed to self-oligomerize, it is contacted with or without, or translated in the presence or absence of, a candidate compound and assessed for appearance of the two subunits. Further, to facilitate detection, typically the in vitro translation product is labeled during translation. Alternatively, truncated Apaf-1 can be contacted with a caspase (typically, in vitro translated in the presence of a label) in the presence or absence of a candidate compound and the processing of the caspase assessed by the appearance of the two caspase subunits. The two subunits may be readily detected by autoradiography after gel electrophoresis. One skilled in the art will recognize that other methods of labeling and detection may be used alternatively.

An alternative in vitro assay is designed to measure cleavage of a caspase substrate Acetyl DEVD-aminomethyl coumarin (amc), lamin. PRPP, PARP, and the like). Substrate turnover by the caspase of interest may be assayed which will provide data as to the degree of processing of the caspase. Briefly. in this method, the caspase is translated and allowed sufficient time to oligomerize in the presence or absence of a candidate compound. As described above, the oligomerization may occur by having truncated Apaf-l in the mixture or constructing self-oligomerizing caspases as previously described. The caspase substrate is then added to the reaction.

15 Detection of cleaved substrate is performed by any one of a variety of standard methods. Generally, the substrate will be labeled and followed by an appropriate detection means.

Moreover, any known enzymatic analysis can be used to follow the inhibitory or enhancing ability of a candidate compound with regard to the ability of 20 self-oligomerizing caspases or truncated Apaf-1/caspase complexes to produce enzymatically active caspases. For example, one could express a self-oligomerizing caspase construct or a truncated Apaf-1 construct of interest in a cell line, be it bacterial, insect, mammalian or other, and purify the resulting polypeptide. The purified truncated Apaf-l or self-oligomerizing caspase could then be used in a variety of assays to follow its ability to facilitate processing or catalytic ability in the presence of candidate compounds, as noted above. Such methods of expressing and purifying recombinant proteins are known in the art and examples can be found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, 1989 as well as in a number of other sources.

In vivo assays are typically performed in cells transfected either transiently or stably with an expression vector containing truncated Apaf-1 nucleic acid molecule or a self-oligomerizing caspase nucleic acid molecule, such as those described herein. These cells are used to measure caspase processing, substrate turnover, or apoptosis in the presence or absence of a candidate compound. When assaying apoptosis, a variety of cell analyses may be used including, for example, dye staining and microscopy to examine nucleic acid fragmentation and porosity of the cells.

Further, in vivo assaying for the ability of the transfected self-oligomerizing caspases to 24 cleave known substrates or truncated Apaf-1 to facilitate cleavage of native caspases can be performed by co-transfecting known substrates or placing these substrates in the cell culture media in the presence of the candidate compound thereby allowing for the detection and determination of substrate turnover.

The assays briefly described herein may be used to identify an enhancer or inhibitor that is specific for an individual caspase or for the Apaf-1/caspase interaction.

A variety of methodologies exist that can be used to investigate the effect of a candidate compound. Such methodologies are those commonly used to analyze enzymatic reactions and include, for example, SDS-PAGE, spectroscopy, HPLC analysis, autoradiography, chemiluminescence, chromogenic reactions, and immunochemistry blotting, precipitating, etc.).

.o 2. Uses of inhibitors and enhancers 15 Inhibitors and enhancers may also be used in the context of this invention to exert control over the cell death process or cytokine activation IL-1, which is activated by caspase-1). Thus, these inhibitors and enhancers will have utility in diseases characterized by either excessive or insufficient levels of apoptosis.

Inhibitors of caspase activation may be used to treat the major neurodegenerative 20 diseases: stroke, Parkinson's Disease, Alzheimer's Disease, and ALS. As well, caspase activation inhibitors may be used to inhibit apoptosis in the heart following myocardial 'i infarction, in the kidney following acute ischemia, and in diseases of the liver.

Enhancers of caspase activation may be used in contexts where apoptosis or cytokine activation are desired. For example, inducing or increasing apoptosis in cancer cells or aberrantly proliferating cells may be effected by delivery of a caspase enhancer. In this regard truncated Apaf-I and self-oligomerizing caspases procaspase-9), themselves, can function as enhancers of apoptosis when introduced into a cell.

Further embodiments include the inhibition of neoplasia or apoptosis by utilizing specific antisense polynucleotides complementary to all or part of the nucleic acid sequence SEQ ID NO:1 encoding truncated Apaf-1 or the nucleic acid sequence SEQ ID NO:3 encoding caspase-9. Such complementary antisense polynucleotides may include substitutions, additions, deletions, or transpositions, as long as specific hybridization to the relevant target sequence in SEQ ID NO:1 or SEQ ID NO:3 is retained as a functional property of the polynucleotide. Antisense polynucleotides that prevent transcription and/or translation of mRNA corresponding to caspase-9 and Apaf- 1 may inhibit apoptosis. Antisense polynucleotides of various lengths may be produced and used, however, the sequence length is typically at least 20 consecutive nucleotides that are substantially or wholly identical the sequence of SEQ ID NO:1 or SEQ ID NO:3. (see U.S. Pat. 5,691,179 and Antisense RNA and DNA, D.A. Melton, Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 1988, each of which is incorporated herein by reference).

The inhibitors and enhancers may be further coupled with.a targeting moiety that binds a cell surface receptor specific to the cells. Administration of inhibitors or enhancers will generally follow established protocols. The compositions of the present invention may be administered either alone, or as a pharmaceutical composition. Briefly, pharmaceutical compositions of the present invention may comprise one or more of the inhibitors or enhancers as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may comprise buffers such as neutral buffered saline.

phosphate buffered saline and the like, carbohydrates such as glucose, mannose, 15 sucrose or dextrans, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants aluminum hydroxide) and preservatives. In addition, pharmaceutical compositions of the present invention may also contain one or more additional active ingredients.

Compositions of the present invention may be formulated for the manner 20 of administration indicated, including for example, for oral, nasal, venous, intracranial, intraperitoneal, subcutaneous, or intramuscular administration. Within other embodiments of the invention, the compositions described herein may be administered as part of a sustained release implant. Within yet other embodiments, compositions of the present invention may be formulized as a lyophilizate, utilizing appropriate excipients which provide stability as a lyophilizate, and subsequent to rehydration. One skilled in the art may further formulate the enhancers or inhibitors of this invention in an appropriate manner, and in accordance with accepted practices, such as those disclosed in Remington's Pharmaceutical Sciences, Gennaro, Ed., Mack Publishing Co., Easton, PA 1990.

3. Gene therapy As noted above, truncated Apaf-1 or self-oligomerizing caspases may be delivered to cells in combination with gene delivery vehicles. In many diseases and syndromes, insufficient apoptosis is an important feature in their development.

Treatment of many autoimmune diseases and tumors would benefit from increased apoptosis. One means to increase apoptosis is to provide target cells with selfoligomerizing caspase nucleic acid molecules in an expressible and form.

Alternatively, one may provide target cells with truncated Apaf-I nucleic acid molecules in an expressible form. These methods may be accomplished by delivery of DNA or cDNA capable of in vivo transcription of either the truncated Apaf-1 or the self-oligomerizing caspase. More specifically, in order to produce either truncated Apaf-l or self-oligomerizing caspases in vivo, a nucleic acid sequence coding for either is placed under the control of a eukaryotic promoter a pol III promoter, CMV or promoter). Where it is desired to more specifically control transcription, the truncated Apaf-1 or self-oligomerizing caspase may be placed under the control of a tissue or cell specific promoter to target cells in the liver), or an inducible promoter, such as MMTV LTR, CMV IE promoter, RSV LTR. SV40, metallothionein promoter (see, U.S. Patent No. 4,870,009), ecdysone response element system, tetracycline-reversible silencing system (tet-on, tet-off). and the like.

Many techniques for introduction of nucleic acids into cells are known.

15 Such methods include retroviral vectors and subsequent retrovirus infection, adenoviral or adeno-associated viral vectors and subsequent infection, and complexes of nucleic acid with a condensing agent poly-lysine). These complexes or viral vectors may be targeted to particular cell types by way of a ligand incorporated into the vehicle.

Many ligands specific for tumor cells and other cells are well known in the art.

20 A wide variety of vectors may be utilized within the context of the present invention, including for example, plasmids, viruses, retrotransposons and cosmids. Representative examples include adenoviral vectors WO 94/26914, WO 93/9191; Yei et al., Gene Therapy 1:192-200, 1994; Kolls el al., PNAS 91(1):215-219, 1994; Kass-Eisler et al., PNAS 90(24):11498-502, 1993: Guzman et al., Circulation 88(6):2838-48, 1993; Guzman et al., Cir. Res. 73(6):1202-1207, 1993; Zabner et al., Cell 75(2):207-216, 1993; Li et al., Hum Gene Ther. 4(4):403-409, 1993; Caillaud et al., Eur. J. Neurosci. 5(10):1287-1291, 1993), adeno-associated type 1 or adeno-associated type 2 vectors (see WO 95/13365; Flotte et al., PNAS 90(22):10613-10617, 1993), hepatitis delta vectors, live, attenuated delta viruses and herpes viral vectors U.S. Patent No. 5,288,641), as well as vectors which are disclosed within U.S. Patent No. 5,166,320. Other representative vectors include retroviral vectors EP 0 415 731; WO 90/07936; WO 91/02805; WO 94/03622; WO 93/25698; WO 93/25234; U.S. Patent No. 5,219,740; WO 93/11230; WO 93/10218.

Within certain aspects of the invention, nucleic acid molecules that encode truncated Apaf-1 or self-oligomerizing caspases may be introduced into a host cell utilizing a gene delivery vehicle, or by various physical methods. Representative examples of such methods include transformation using calcium phosphate precipitation (Dubensky et al., PNAS 81:7529-7533. 1984), direct microinjection of such nucleic acid molecules into intact target cells (Acsadi et al.. Nature 352:815-818, 1991), and electroporation whereby cells suspended in a conducting solution are subjected to an intense electric field in order to transiently polarize the membrane, allowing entry of the nucleic acid molecules. Other procedures include the use of nucleic acid molecules linked to an inactive adenovirus (Cotton et al., PNAS 89:6094, 1990), lipofection (Felgner et al., Proc. Nail. Acad Sci. USA 84:7413-7417, 1989), microprojectile bombardment (Williams et al.. PNAS 88:2726-2730, 1991), polycation compounds such as polylysine, receptor specific ligands, liposomes entrapping the nucleic acid molecules, spheroplast fusion whereby E. coli containing the nucleic acid molecules are stripped of their outer cell walls and fused to animal cells using polyethylene glycol, viral transduction. (Cline et al.. Pharmac. Ther. 29:69, 1985; and Friedmann et al., Science 244:1275, 1989). and DNA ligand (Wu et al., J Biol. Chem.

15 264:16985-16987, 1989), as well as psoralen inactivated viruses such as Sendai or Adenovirus. In one embodiment, the truncated Apaf-l or self-oligomerizing caspase construct is introduced into the host cell using a liposome.

As noted above, pharmaceutical compositions also are provided by this invention. These compositions may contain any of the above described inhibitors, 20 enhancers, DNA molecules, vectors or host cells, along with a pharmaceutically or physiologically acceptable carrier, excipients or diluents. Generally, such carriers .i .should be nontoxic to recipients at the dosages and concentrations employed.

Ordinarily, the preparation of such compositions entails combining the therapeutic agent with buffers, antioxidants such as ascorbic acid, low molecular weight (less than about 10 residues) polypeptides, proteins, amino acids, carbohydrates including glucose, sucrose or dextrins, chelating agents such as EDTA, glutathione and other stabilizers and excipients. Neutral buffered saline or saline mixed with nonspecific serum albumin are exemplary appropriate diluents.

In addition, the pharmaceutical compositions of the present invention may be prepared for administration by a variety of different routes, including for example intraarticularly, intracranially, intradermally, intrahepatically, intramuscularly, intraocularly, intraperitoneally, intrathecally, intravenously, subcutaneously or even directly into a tumor. In addition, pharmaceutical compositions of the present invention may be placed within containers, along with packaging material which provides instructions regarding the use of such pharmaceutical compositions. Generally, such instructions will include a tangible expression describing the reagent concentration, as well as within certain embodiments, relative amounts of excipient ingredients or diluents water, saline or PBS) which may be necessary to reconstitute the pharmaceutical composition. Pharmaceutical compositions are useful for both diagnostic or therapeutic purposes.

Pharmaceutical compositions of the present invention may be administered in a manner appropriate to the disease to be treated (or prevented). The quantity and frequency of administration will be determined by such factors as the condition of the patient, and the type and severity of the patient's disease. Dosages may be determined most accurately during clinical trials. Patients may be monitored for therapeutic effectiveness by appropriate technology, including signs of clinical exacerbation, imaging and the like.

The following examples are offered by way of illustration, and not by wav of limitation.

o o•

°O

EXAMPLES

EXAMPLE 1 GENERATION OF cDNA EXPRESSION CONSTRUCTS eDNAs encoding truncated or mutated Apaf- I variants were generated by PCR and subcloned into the bacterial expression vectors pET-28a or pET-2 1b (Invitrogen). Recombinant proteins with C-terminal His6 tags were expressed in BL-21 DE3 bacteria and purified by affinity purification on a Ni2>-affinity resin.

Constructs encoding wild type (WT) or mutant caspase-9, procaspase-3, Apaf-1, DR4, or Bcl-xL have been described previously (Hegde et al.. J Biol. Chem., 2 73:7783- 15 7786, 1998; Li et al., Cell 91:479-489, (1997);. MacFarlane et al., J Biol. Chem., 272:25417-25420, 1997; Srinivasula et al., J Biol. Chem., 271:27099-27106, 1996).

Constructs encoding T7-or Flag-epitope tagged proteins were made by cloning cDNAs :of the respective genes in frame into the mammalian expression vectors T7-pcDNA' or pFLAG-CMV-2.

Primers used for truncated form amplification are provided below: APAF-530 Bam-ATG primer: CGGGATCCGATGGATGCAAAAGCTCG 53OXho-end primer: CCGCTCGAGCTCACTGACTGCACAAATCCTTTTC APAF-420 Bamn-ATG prmer: CGGGATCCGATGGATGCAAAAGCTCG 42OXho-end primer: CCGCTCGAGCTTTCCATTCCGATCACAG APAF-350 Bam-ATG primer: CGGGATCCGATGGATGCAAAAGCTCG Aplice Xho-end primer: CGCCTCGAGGCCTTTACATTCTTTTATAATAC APAF-97 3 5 Bam-ATG primer: CGGGATCCGATGGATGCAAAAGCTCG H Domain Xho-end primer: CGCCTCGAGGGAAGAAGAGACAACAGG APAF-530ACARD ACARD-Bamn-Start primer: CGCGGATCCAGTGTAAGGACAGTCCTG 53OXho-end primer: CCGCTCGAGCTCACTGACTGCACAATCCTTTTC

APAF-WD

APAF-WD start primer: CGGGATCCATGGAGAATTTTCAGGAGTTTTTATC APAF-Xho-end primer:

CGCCTCGAGTTCTAAAGTCTGTAAAATATATAAAATACC

EXAMPLE 2 IN VITRO CASPASE 9 ACTIVATION ASSAY Affinity purified Apaf-I variants were incubated (2 h) with in vitro translated WT or mutant procaspase-9 in buffer A (20 mM HEPES, pH 7.5, 10 mM 15 KC1, 1.5 mM MgCIl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 0.1 mM PMSF) in the presence or absence of cytochrome c and/or dATP. SDS sample buffer was then added to each sample, boiled and subjected to SDS-PAGE analysis followed by autoradiography. In Figure 2A procaspase-9 was in vitro translated in the presence of

S

3 S-methionine. Following translation procaspase-9 was desalted by gel filtration through a biospin column (BioRad) to remove unincorporated methionine and free nucleotides. Desalted procaspase-9 was then incubated with 200 ng Ni2-affinity purified bacterially expressed recombinant Apaf-530 (WT or K149R mutant) in the presence or absence of cytochrome c or dATP or both for 2 h at 300 C. A mock sample containing Ni -affinity purified material from bacteria transformed with an empty vector was used as a negative control. Following incubation the products were analyzed by SDS-PAGE and autoradiography. In Figure 2B "S-labeled procaspase-9 (as described above) was incubated with bacterial lysates containing truncated Apaf-I variants as indicated and then analyzed as above (2B upper panel). The bacterial lysates were analyzed by SDS-PAGE and immunoblotted with an Apaf-I antibody which recognizes the N-terminus of Apaf-I (lanes 2-6) and an anti T7-tag antibody (lanes 7-8) to confirm expression and equivalent concentration of the different Apaf-1 variants (2B lower panel). The molecular mass markers are indicated to the right of the lower panel.

3 S-labeled caspases were obtained by in vitro translation in the presence of "S-methionine using a coupled transcription/translation system in rabbit reticulocyte lysate using TNT Kit (Promega) according to the manufacturer's recommendations.

31 EXAMPLE 3 EXPRESSION OF TRUNCATED APAF-1 CONSTRUCTS IN MAMMALIAN CELLS AND ASSAY FOR APOPTOSIS To express the caspases or truncated Apaf-1 in mammalian cells and assay their apoptotic activity, they were amplified with the T7-tag primer and reverse primers using the pET28a constructs as templates, and subcloned into the mammalian double expression vector pRSC-LacZ (MacFarlane er al., J. Biol. Chem.. 272:25417- 10 25420, 1997; Tsang et al., Bio/Technology, 22:68, 1997) or as previously described (Li et al., Cell 91.479-489, 1997; Srinivasula et al.. J. Biol. Chem., 272:18452-18545, 1997). This vector allows the expression of lacZ under the Rous Sarcoma virus promoter, and the test cDNA under the CMV promoter. To assay for apoptosis, MCF-7 or 293 cells were transfected. using the method commercially available as the Lipofect Amine method (Life Technologies, Inc.), with the pRSC-LacZ constructs in the presence or absence of different apoptosis-inhibitors. 30 h after transfection cells were 't.ined with P-galactosidase and examined for morphological signs of apoptosis. The percentage of round blue apoptotic cells (mean SD) were determined by phase contrast microscopy and then represented as a function of total blue cells under each condition (n 2 3).

EXAMPLE 4 TRUNCATED APAF- 1 WITHOUT ITS WD REPEATS FUNCTIONS INDEPENDENT OF CYTOCHROME C AND DATP To determine the role of the WD-40 repeat in the mechanism of Apaf-l-induced processing of procaspase-9, truncated Apaf-I (Apaf-530) lacking its WD-40 repeats (Figure 1) was expressed and purified. To reconstitute a recombinant caspase-9 activation system, the truncated Apaf-530 was incubated with in vitro translated recombinant procaspase-9 in the presence or absence of cytochrome c and dATP. Unlike previous observations with the full length native Apaf-1 (Li el al., Cell 91:479-489, 1997), recombinant Apaf-530 was able to promote processing of procaspase-9 to produce a 35 kDa fragment (p35) in the absence of cytochrome c or dATP (Figure 2A). It was previously shown that mutation of CED-4 K165R which is required for nucleotide binding destroys its activity (Chinnaiyan et al., Nature 388:728- 729, 1997; James et al., Curr. Biol. 7:246-252, 1997: Seshagiri and Miller, Curr. Biol.

7:455-460, 1997). Interestingly, a similar mutation in Apaf-l (K149R) slightly reduced but did not inhibit the activity of recombinant Apaf-530 (Figure 2A). These observations suggest that the WD-40 repeats may exert a dominant negative effect on the activity of Apaf-1. Therefore, either binding of Apaf-1 to cytochrome c and dATP or deletion of the repeats could induce a conformational change enabling Apaf-l to bind and process procaspase-9.

To determine the minimal sequence of Apaf-1 that is able to promote 10 activation of procaspase-9, reconstitution experiments were performed with several truncated recombinant Apaf-1 variants (Figure As shown in Figure 2B, Apaf -420 (residues 1-420) which contains the minimal conserved sequence between Apaf-I and CED-4, produced nearly 90 less activity than Apaf-530 (lane Further deletions in the CED-4 homology region of Apaf-1 (Apaf-350, residues 1-350) further reduced its activity (lane Deletion of the entire CED-4 homology region (Apaf-97, residues 1-97) or the CARD domain of Apaf-1 (Apaf-530ACARD, residues 98-530). inactivated Apaf-1 (lanes 6 and The WD-40 repeat region (Apaf-WD, residues 530-1194) was also inactive (lane Therefore, a portion of the CED-4 homology region of Apaf-l and at least a portion of its CARD domain are required for its activity.

*e EXAMPLE PROCESSING OF PROCASPASE-9 BY APAF-530 OCCURS BY AUTOCATALYSIS To map the exact processing site(s) in procaspase-9 and to determine whether processing of procaspase-9 occurs by autocatalysis, two potential processing sites (Asp315 and Asp330) and the active site Cys287 were mutated. If processing occurs at these sites by autocatalysis, then mutation of the processing sites or the active site C287 should prevent processing. To investigate this processing event, the 10 Apaf-530 reconstitution system was utilized.

.In Figure 3. 3 "S-labeled WT or mutant D330A, D315A or C287A mutants of procaspase-9 or prodomainless procaspase-9 (Apro, residues 134-416) were incubated with buffer (lanes 1, 4, 7, 10, 13), purified Apaf-530 (lanes 2, 5, 8, 11, 14) or mock purified material (lanes, 3. 6, 9, 12. 15) and then analyzed by SDS-PAGE and autoradiography.

As demonstrated by Figure 3, incubation of Apaf-530 with WT or D330A mutant procaspase-9 produced the p35 fragment (lanes 2 and However, Apaf-530 was unable to process the D315A mutant procaspase-9 indicating that processing occurs at Asp315 (lane 11). Therefore, Apaf-1 triggers processing of procaspase-9 only at Asp315. Apaf-530 was also unable to promote processing of the procaspase-9 active site C287A mutant (lane suggesting that Apaf-1 does not have a proteolytic activity capable of processing procaspase-9. Hence, Apaf-1-mediated processing of procaspase-9 is an intrinsic activity of procaspase-9 itself and occurs by autocatalysis.

The prodomain of caspase-9 is also necessary for activation of procaspase-9 by Apaf-530. Deletion of this domain prevented processing of procaspase-9 (Figure 3, lane 14). Taken together these data demonstrate that interaction of procaspase-9 with Apaf-1 through-its prodomain induces it to undergo autoproteolytic processing at Asp315.

EXAMPLE 6 PROCASPASE-9 PROCESSING IN THE CYTOCHROME C/APAF-1-DEPENDENT PATHWAY To study processing of procaspase-9 in the cytochrome c/Apaf- -dependent pathway, WT and the Asp to Ala mutants of procaspase-9 were incubated with a cellular S100 extract in the presence or absence of cytochrome c and dATP. As illustrated in Figure 4, "S-labeled WT (lanes 1-3) or mutant D315A+D330A (lanes D315A (lanes D330A (lanes 10-12) procaspase-9 were incubated with 10 S100 extract from 293 cells in the presence or absence of cytochrome c plus dATP or DEVD-CHO (a caspase-3 and -7 inhibitor), or both for 1 h at 30 0 C. Samples were then analyzed by SDS-PAGE and autoradiography.

Figure 4 demonstrates that cytochrome c and dATP induced processing of WT procaspase-9 to generate a 37 kDa fragment (p37) and a 35 kDa fragment (lane Further, cytochrome c and dATP were unable to induce processing of the double mutant Asp315+330 (lane However, they were able to induce processing of the Asp315 or Asp330 mutants to generate a p37 (lane 8) or a p35 (lane 11) fragment, respectively. This confirms that processing at Asp315 produces the p35 fragment.

whereas processing at Asp330 produces the p37 fragment. Interestingly, processing at Asp330 (lanes 3 and 9) but not at Asp315 (lanes 3 and 12) was sensitive to inhibition by DEVD-CHO (Asp-Glu-Val-Asp-aldehyde). Since processing at Asp315 activates caspase-9 which directly activates the downstream caspase-3, the processing at Asp330 must be attributed to activated caspase-3 that is potently inhibited by DEVD-CHO.

To confirm this, a time course analysis of procaspase-9 and procaspase-3 processing was performed in cellular S100 extracts from 293 and MCF-7 cells.

Extracts from these two cell lines were used because the 293 cells express procaspase-3 whereas the MCF-7 do not (Li et al., J. Biol. Chem. 272:30299-30305, 1997). As illustrated in Figure 5, "S-labeled WT procaspase-9 was incubated with S100 extracts from 293 or MCF-7 cells in the presence or absence of cytochrome c/dATP or DEVD-CHO, or both. At the indicated times the reactions were stopped and then analyzed by SDS-PAGE and autoradiography (procaspase-9 panels) or Western blot analysis using anti-caspase-3 p20 polyclonal antibody (procaspase-3 panels). Small arrows indicate a non-specific band detected by the anti-caspase-3 antibody.

As shown in Figure 5, in the 293 S100 extract, processing at Asp315 and Asp330 did not occur simultaneously. The autocatalytically generated p35 fragment was detected within the first 5 min (Figure 5, lane 2, 2 9 3-upper panel). Ten minutes later the p37 fragment was detectable and its appearance coincided with the activation of caspase-3 (Figure 5, lanes 3-6, 293-lower panel). In the presence of DEVD-CHO, both the generation of caspase-9-p37 fragment and the autoconversion of caspase-3-p20 to p19 were blocked (lane indicating that active caspase-3 is responsible for generation of the p37 fragment. Nevertheless, DEVD-CHO did not block the autocatalytic generation of the p35 fragment, but it slightly attenuated processing of procaspase-3 (lane These data are consistent with our previous observation that caspase-9 is upstream of caspase-3 and is responsible for its activation in the cytochrome c-dependent pathway (Li et al., 1997b). However, once procaspase-3 is activated by caspase-9 it feeds back on the remaining procaspase-9 and cleaves it at 10 Asp330 to generate more active caspase-9 thus amplifying the caspase cascade.

In the MCF-7 extract, activation by cytochrome c and dATP generated only the p35 fragment and no p37 fragment was seen (Figure 5, MCF-7-upper panel).

Also Western blot analysis revealed a very faint caspase-3 reactive species in these extracts (Figure 5, MCF-7-lower panel). This is consistent with previous observations that MCF-7 cells lack or contain negligible amount of procaspase-3 (Li et al.. J. Biol.

Chem., 272:30299-30305, 1997). This confirms that processing of procaspase-9 at Asp330 is an activity of the executioner caspase-3 (Figure 6).

EXAMPLE 7 CASPASE-9 CAN ALSO PROCESS PROCASPASE-7 BUT NOT PROCASPASE-6 To test the activity of caspase-9 towards precursors of the other executioner caspases, namely procaspase-6 and purified recombinant mature caspase-9 was incubated with "S-labeled procaspase-3 (Figure 7, lane procaspase-6 (Figure 7, lane 4) or procaspase-7 (Figure 7, lane 6) for Ih at 37 0 C and analyzed by SDS-PAGE and autoradiography.

As shown in Figure 7, caspase-9 was able to process procaspase-3 (lane 2) and procaspase-7 (lane but not procaspase-6 (lane to the corresponding large and small subunit fragments. Interestingly, all three caspases underwent processing in the 293 S100 extracts, when these extracts were stimulated with cytochrome c and dATP (Figure In Figure 8, "S-labeled procaspase-3, -6 or -7 were incubated with S100 extracts from 293 cells in the presence or absence of cytochrome c/dATP. or DEVD-CHO, or both and analyzed by SDS-PAGE followed by autoradiography.

However, when DEVD-CHO was included, processing of procaspase-6 (lane but not procaspase-3 (lane 3) or -7 (lane 9) was inhibited. Since the activity of both caspase-3 and but not caspase-9, are potently inhibited by DEVD-CHO, it follows that either 36 caspase-3 or -7 are responsible for processing of procaspase-6. Also, since caspase-7 cannot process procaspase- 6 (Srinivasula et al., J. Biol. Chem. 271:27099-27106, 1996), caspase- 3 is the one responsible for processing of procaspase-6 in the cytochrome c plus dATP-dependent pathway.

EXAMPLE 8 ACTIVATION OF PROCASPASE- 9 BY HETEROLOGOUS

OLIGOMERIZATION

10 Artificially-induced oligomerization of procaspase-1 or procaspase-8 by overexpression or by heterologous-inducible oligomerization systems causes their autocatalytic processing/activation (Gu et al., EMBO 14:1923-1931, 1995; Muzio et al., J. Biol. Chem. 273:2926-2930, 1998; Yang et al.. Mol. Cell 1:319-325, 1998). To test if procaspase- 9 can also be activated by heterologous oligomerization, WT and the 15 C287A mutant procaspase- 9 was fused to the mouse IgG-Fc portion which can form spontaneous dimers by intermolecular disulfide linkages. Figure 9 depicts processing of non-fusion WT procaspase- 9 (pcasp- 9 lane 1) or C-terminal Fc-fusion WT (pcasp-9-Fc, lane 2) or C287A (active site) mutant (pcasp-9-C287A-Fc, lane 3) procaspase- 9 which were in vitro translated in the presence of "S-methionine and then 20 analyzed by SDS-PAGE and autoradiography.

In vitro translated "S-labeled procaspase-9-Fc fusion protein was capable of processing itself to the large subunit (p35 fragment) and a peptide corresponding to the small subunit (pl2-Fc) (Figure 9, lane The C287A-Fc mutant (lane 3) and the WT procaspase- 9 (lane 1) were incapable of processing and migrated as peptides corresponding to unprocessed procaspase-9.

In vivo overexpression of the WT procaspase-9 in MCF-7 cells induced little apoptosis (Figure 10). In Figure 10, mammalian expression constructs encoding Fc or the procaspase- 9 variants described in Figure 9 were transfected into MCF-7 cells together with a reporter P-gal expression construct at a ratio of 3:1. 30 hours after transfection cells were stained with p-gal and examined for morphological signs of apoptosis. However, as illustrated, overexpression of the procaspase-9-Fc fusion protein potently induced apoptosis in 90% of transfected cells. The C287A-Fc mutant or Fc itself was unable to induce apoptosis. Taken together these data confirm that oligomerization can induce autocatalytic processing and activation of procaspase-9.

EXAMPLE 9 APAF-530 FORMS OLIGOMERS The ability of APAF-530 to oligomerize pro-caspase-9 was tested. Cotransfection experiments in 293 cells were performed with T7-tagged Apaf-530 and different Flag-tagged Apaf-l variants, and cell lysates were prepared and immunoprecipitated with an anti-Flag antibody. The immunoprecipitates were 10 analyzed by Western blotting with an anti-T7 antibody. As shown in Figure 11, the T7-Apaf-530 co-immunoprecipitated with full length Flag-Apaf-1, Flag-Apaf-530 and Flag-Apaf-530ACARD, but not with Flag-Apaf-97, indicating that Apaf-530 forms oligomers through self association of its CED-4 homology domain.

In Figure 11, 293 cells were co-transfected with constructs encoding T7-tagged Apaf-530 and an empty vector (lane 1) or constructs encoding Flag-tagged Apaf-1 (lane Flag-tagged Apaf-530 (lane Flag-tagged Apaf-530ACARD (lane 4) or Flag-tagged Apaf-97 (lane After 36 hours, extracts were prepared and immunoprecipitated with a monoclonal antibody to the Flag epitope. The immunoprecipitates (upper panel) were analyzed by SDS-PAGE and immunoblotted 20 with a horseradish peroxides-conjugated T7 antibody. The corresponding cellular extracts were also analyzed by SDS-PAGE and immunoblotted with a horseradish peroxides-conjugated T7 antibody (middle panel) or an anti-Flag antibody (lower panel).

EXAMPLE APAF-530 ACTIVATES PROCASPASE-9 BY OLIGOMERIZATION Since Apaf-1 can form oligomers, it could bring two procaspase-9 into close proximity, allowing their subunits to complement each other. This process could then lead to the formation of a catalytically active intermediary complex capable of processing itself (Figure 12). The complementation mechanism assumes that the two subunits of the mature heterodimer arise from two proximal precursor molecules. The mature caspase-9-like intermediary complex mechanism assumes that the two subunits of the mature heterodimer are derived from the same precursor molecule.

In this case, one subunit of the mature heterodimer is derived from the first precursor molecule and the other subunit from the second proximal precursor molecule. Alternatively, since the mature active form of caspases is a heterotetramer, Apaf-1 mediated oligomerization could result in the formation of a mature caspase-9-like intermediary complex capable of processing itself or adjacent molecules (Figure 12). In this case the two subunits of the mature heterodimer are derived from the same precursor molecule.

To test the first possibility, procaspase- 9 intragenic complementation experiments were performed with the Apaf-530 reconstitution system. Two 10 procaspase- 9 active site mutants one with a C287A mutation in the large subunit and the other with an R355E mutation in the small subunit were incubated with APAF-530.

:If Apaf-530 induces activation of procaspase- 9 by complementation, then the C287A mutant and the R355E mutant should associate to form an active caspase capable of autoprocessing. On the other hand, if Apaf-530 induces procaspase- 9 activation by 15 formation of a mature caspase-9-like intermediary complex, these mutants would not be able to complement each other. In Figure 13, "S-labeled C287A or R355E mutant procaspase- 9 were incubated with Apai-530 separately (lanes 3 and 4, respectively) or together (lane 5) for 1 hour at 30 0 C and analyzed by SDS-PAGE followed by autoradiography. WT procaspase- 9 incubated with buffer (lane 1) or Apaf-530 (lane 2) 20 were used as controls. As evidenced by Figure 13. none of the mutants were able to autoprocess when incubated with Apaf-530 separately or together, indicating that Apaf-530 does not allow complementation-induced activation.

To test the second possibility, Apaf-530 was incubated with 3 5 S-labeled full length C287A mutant (Figure 14, lanes 1-4) or prodomainless procaspase- 9 (Figure 14, lanes 5-8) in the presence or absence of a non-radiolabeled WT procaspase- 9 Samples were then analyzed by SDS-PAGE and autoradiography. If Apaf-530 induces activation of procaspase- 9 by formation of a mature caspase-9-like intermediary complex capable of processing itself or adjacent molecules, then the WT procaspase- 9 should associate with and process the C287A mutant, but not the prodomainless mutant. In another words, Apaf-530 will be able to bring the C287A mutant and the WT procaspase- 9 into close proximity, but will not be able to do the same with the prodomainless mutant. The Apaf-530-procaspase- 9 complex was able to induce processing of the C287A mutant, but not the prodomainless mutant (Figure 14). This indicates that Apaf-530 oligomer was able to bring the two precursor molecules

(WT

and C287A) into close proximity forcing the WT molecule to process the C287A mutant. Because Apaf-530 cannot recruit the prodomainless mutant to the complex, the activated Apaf-530-bound caspase-9 was unable to process it.

EXAMPLE 11 ACTIVATED APAF-530-BOUND CASPASE-9 CANNOT PROCESS PROCASPASE-3 It has recently been demonstrated that recombinant soluble caspase-9 or Apaf-1-activated caspase-9 can process procaspase-3 (Li el al., Cell 91:479-489, 1997).

Interestingly, while analyzing the activity of the activated Apaf-530-bound caspase-9 towards procaspase- 3 no processing of procaspase-3 was observed. This suggested that Apaf-530 is not able to release the activated caspase-9 from the complex.

Therefore, if procaspase-3 could be brought into the complex, then the mature Apaf-530-bound :aspase-9 should be able to process it. To achieve this, a chimeric 0 procaspase-3 with an N-terminal caspase-9 prodomain was constructed. Caspase-9 prodomain in the chimera may allow recruitment of the chimeric procaspase-3 to the 15 Apaf-530-caspase-9 complex. As evidenced by Figure 15, when the chimeric procaspase- 3 was incubated with Apaf-530 in the presence of nonradiolabeled procaspase- 9 the chimeric procaspase-3 was processed to fragments corresponding to the large and small subunits. In Figure 15, 3 S-labeled chimeric procaspase-3 with an N-terminal procaspase- 9 prodomain (lanes 1-4) or WT procaspase-3 (lanes 5-8) were 20 incubated with buffer or Apaf-530 in the presence or absence of a non-radiolabeled WT procaspase-9 and analyzed by SDS-PAGE followed by autoradiography.

As shown in Figure 15, no processing was observed with the non-chimeric WT procaspase-3 under the same conditions. Also, no processing was observed with the chimeric procaspase-3 in the absence of procaspase-9, suggesting that this process is specific for activation of procaspase-9. This provides further demonstration that Apaf-530 forms multimeric complexes. The difference between the activity of the full length Apaf-1 and the Apaf-530 complexes towards procaspase-3 suggest two possibilities either the full length Apaf-1 can release the activated caspase-9 from the complex where it can then activate procaspase-3 in the cytosol, or it could bring procaspase-3 into the complex where it gets activated by the bound caspase-9 and then released into the cytosol. Since the Apaf-530 lacks the repeats, this may explain its inability to promote processing of procaspase- 3 EXAMPLE 12 BCL-XL INTERACTS WITH APAF-1 In vivo interaction experiments between Apaf-1 variants and Bcl-xL were performed. To analyze the ability of Apaf-1 to interact with Bcl-x

L

293 cells were co-transfected with constructs encoding T7-tagged Bcl-xL and constructs encoding Flag-tagged Apaf-97 (Figure 16, lane Apaf-l (Figure 16, lane Apaf-530 (Figure 16, lane 3) Apaf-530ACARD (Figure 16, lane or procaspase-9 C287A (Figure 16, lane After 36 hours, extracts were prepared and immunoprecipitated with a monoclonal antibody to the Flag epitope. The immunoprecipitates (Figure 16, upper panel) were analyzed by SDS-PAGE and immunoblotted with a horseradish peroxidase-conjugated T7 antibody. The corresponding cellular extracts were also analyzed by SDS-PAGE and immunoblotted with a horseradish peroxides-conjugated T7 antibody (Figure 16, middle panel) or an anti-Flag antibody (Figure 16, lower panel).

As demonstrated by Figure 16, full length Apaf-1, Apaf-530, and Apaf-530ACARD, but not Apaf-97 were all capable of immunoprecipitating Bcl-xL.

The ability of Bcl-XL to immunoprecipitate Apaf-530ACARD, but not Apaf-97, 20 suggests that the interaction motif is present in the CED-4 homology region.

Bcl-xL was also capable of immunoprecipitating procaspase-9, suggesting that Bcl-XL could form a ternary complex with Apaf-1 and procaspase-9. A similar ternary complex composed of CED-9, CED-4, and CED-3 was described previously (Chinnaiyan et al., Science 275:1122-1126, 1997). Therefore, our data indicate that a Bcl-XL-Apaf-l-procaspase- 9 ternary complex may exist in mammalian cells.

EXAMPLE 13 DOMINANT NEGATIVE CASPASE-9 INHIBITS MULTIPLE PATHWAYS OF APOPTOSIS Recently it has been demonstrated that a dominant negative caspase-9 mutant (caspase-9-DN) can inhibit apoptosis induced by the proapoptotic members of the Bcl-2 family (Hegde et al., J. Biol. Chem. 273:7783-7786, 1998; Li et al., Cell 91:479-489, 1997). Caspase-9-DN can also inhibit apoptosis induced by UV, Fas agonist antibody, TRAIL, and overexpression of the TRAIL receptors, DR4 and (Figures 17 and 18). The ability of dominant negative procaspase-9 to inhibit apoptosis 41 in vivo is presented in Figure 17 wherein MCF-7 cells were transiently transfected with constructs expressing dominant negative procaspase-9-C 2 8 7 A mutant, Bcl-xL or X-IAP and a p-gal reporter plasmid and then treated 30 hours after transfection with the ligand TRAIL, agonist Fas-antibody, or UV. MCF-7 cells were also transiently transfected with pRSC-lacZ plasmids encoding DR4 or DR5 in combination with 4-fold excess of procaspase- 9

-C

2 8 7 A, Bcl-xL or X-IAP (X-linked Inhibitor of Apoptosis Protein), or empty vector.

The inhibition by the dominant negative caspase-9 mutant was as efficient as that observed with Bcl-xL or X-IAP. The caspase-9-DN was also able to attenuate cytochrome c/dATP-induced activation of procaspase- 9 and procaspase- 3 in the 293 S100 extract in a dose-dependent manner (Figure 18). In Figure 18. 293 cellular S100 extracts supplemented with "S-labeled procaspase- 9 (upper panel) or procaspase- 3 (lower panel) were incubated with (lanes 3-7) or without (lane 2) cytochrome c plus dATP in the presence of increasing amounts of purified recombinant 15 procaspase- 9

-C

2 8 7 A mutant for 1 hour at 30 0 C and then analyzed by SDS-PAGE and autoradiography. A similar result was also obtained with the Apaf-530-induced activation of procaspase- 9 in the in vitro reconstituted system (data not shown). This indicates that the Apaf-1/cytochrome c complex is the target of inhibition by caspase-9-DN in vivo. Consequently, the Apaf-1/caspase-9 pathway appears to be a .i 20 central apoptotic pathway, on which most apoptotic signals converge.

o

Claims (41)

1. An isolated nucleic acid molecule encoding a truncated Apaf-l or a variant thereof.

2. The nucleic acid molecule of claim 1, wherein the encoded truncated Apaf-1 is a human truncated Apaf-1. o o

3. The nucleic acid molecule of claim 2. wherein the human truncated Apaf-1 comprises SEQ ID NO:2 or a variant thereof.

4. The nucleic acid molecule of claim 2, comprising SEQ ID NO:1 or a variant thereof. The nucleic acid molecule of claim 1. wherein the truncated Apaf-I or fragment thereof oligomerizes with a caspase.

6. The nucleic acid molecule of claim 3, wherein the truncated Apaf-1 or fragment thereof oligomerizes with a caspase.

7. An expression vector comprising the nucleic acid molecule of any one of claims 1-6, wherein the nucleic acid molecule encoding the truncated Apaf-I is operatively linked to a promoter.

8. The expression vector of claim 7, wherein the promoter is inducible.

9. A host cell transfected with the expression vector of claim 7. The host cell of claim 9, wherein the cell is selected from the group consisting of a bacterium, an insect and a mammalian cell. 43

11. An isolated truncated Apaf-1 polypeptide or fragment thereof.

12. The truncated Apaf-1 of claim 11, wherein the polypeptide or fragment thereof oligomerizes with a caspase.

13. The truncated Apaf-1 of claim 11, wherein the truncated Apaf-1 is a human truncated Apaf-1.

14. The truncated Apaf-1 of claim 13. wherein the truncated Apaf-l polypeptide or fragment thereof oligomerizes with a caspase. S*

15. The truncated Apaf-1 of claim 12, wherein the caspase is selected from the group consisting of caspase-1. caspase-2. caspase-3. caspase-4, caspase-5, caspase-6, oo*o •caspase- 7 caspase-8, caspase-9. caspase-10, caspase-11. caspase-12. and caspase-13.

16. The truncated Apaf-1 of claim 14, wherein the caspase is selected from the group consisting of caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, caspase-6, caspase-7, caspase-8, caspase-9, caspase-10, caspase-11, caspase-12, and caspase-13.

17. The truncated Apaf-1 of claim 14, wherein the caspase is procaspase-9.

18. The truncated Apaf-1 of claim 13, wherein the truncated Apaf-1 comprises SEQ ID NO:2 or a variant thereof.

19. The truncated Apaf-1 of claim 13, wherein the truncated Apaf-1 is encoded by SEQ ID NO:1 or a variant thereof. A method of identifying an inhibitor or enhancer of Apaf-1 mediated caspase processing, comprising: 44 contacting a sample containing a truncated Apaf-1 or fragment thereof and one or more caspases with a candidate inhibitor or candidate enhancer; and detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase processing inhibitor, and wherein an increase in processing indicates the presence of a caspase processing enhancer.

21. The method of claim 20, wherein at least one of the caspases is procaspase- 9 or a functional fragment thereof.

22. The method of claim 20. wherein the caspase is in vitro translated and labeled. o. 23 The method of claim 22, wherein the label is selected from the group consisting of a radioactive label, a peptide tag. an enzyme and biotin. S.

24. A method of identifying an inhibitor or enhancer of Apaf-l mediated caspase processing, comprising: contacting a cell transfected with a vector expressing truncated Apaf-1 according to claim 7 with a candidate inhibitor or candidate enhancer; and detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase inhibitor, and wherein an increase in processing indicates the presence of a caspase processing enhancer. The method of either of claims 20 or 24, wherein the step of detecting comprises gel electrophoresis.

26. A method of identifying an inhibitor or enhancer of Apaf-1 mediated apoptosis, comprising: contacting a cell transfected with a vector expressing truncated Apaf-l according to claim 7 with a candidate inhibitor or candidate enhancer; and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor and an decrease in cell viability indicates an enhancer.

27. (a) encoding a truncated (b) A method for inducing apoptosis in a cell, comprising: delivering to a cell an effective amount of a nucleic acid molecule Apaf-1 polypeptide; and maintaining the cell under conditions sufficient for expression of the S polypeptide.

28. The method of claim 27, wherein the step of delivering comprises injecting the nucleic acid molecule into the cell.

29. The method of claim 27, wherein the step of delivering comprises administering the nucleic acid molecule to the circulatory system of a warm-blooded mammal in which the cell is located. An antisense nucleic acid molecule comprising a nucleic acid sequence which is complementary to a nucleic acid molecule encoding a truncated Apaf-1.

31. A gene delivery vehicle comprising a nucleic acid molecule according to any one of claims 1-6, wherein the nucleic acid molecule is operatively linked to a promoter.

32. The gene delivery vehicle of claim 31, wherein the vehicle is a retrovirus or adenovirus.

33. The gene delivery vehicle of claim 31, wherein the nucleic acid molecule is associated with a polycation.

34. The gene delivery vehicle of claim -31, further comprising a ligand that binds a cell surface receptor. A method of treating cancer, comprising administering to a patient a gene delivery vehicle according to claim 31, wherein the gene delivery vehicle is internalized by tumor cells. S. 36. A method of treating autoimmune disease, comprising administering to a patient a gene delivery vehicle according to any one of claims 31-34, wherein the gene delivery vehicle is internalized by cells mediating autoimmune disease.

37. A method of identifying an inhibitor of Apaf-I mediated caspase processing, comprising: contacting a cell transfected with an inducible expression vector according to claim 8 with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing truncated Apaf- expression; and detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of a caspase processing inhibitor.

38. The method of claim 37, wherein detecting comprises gel electrophoresis.

39. A method of identifying an inhibitor of Apaf-1 mediated apoptosis, comprising: contacting a cell transfected with an inducible expression vector according to claim 8 with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing truncated Apaf-1 expression; and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor. A method of identifying an inhibitor of apoptosis, comprising: contacting a cell transfected with an inducible expression vector capable of expressing a self-oligomerizing and self-processing caspase with a candidate inhibitor;6 contacting the transfected cell with an inducer capable of inducing self- oligomerizing caspase expression: and detecting the presence of large and small caspase subunits, and therefrom determining the level of caspase processing activity, wherein a decrease in processing indicates the presence of an apoptosis inhibitor.

41. The method of claim 40, wherein detecting comprises gel electrophoresis.

42. A method of identifying an inhibitor of apoptosis, comprising: contacting a cell transfected with an inducible expression vector capable of expressing a self-oligomerizing and self-processing caspase with a candidate inhibitor; contacting the transfected cell with an inducer capable of inducing self- oligomerizing caspase expression; and detecting cell viability, wherein an increase in cell viability indicates the presence of an inhibitor.

43. A method for inhibiting apoptosis in a cell, comprising: delivering to a cell an effective amount of a nucleic acid molecule encoding a caspase-9 prodomain; and maintaining the cell under conditions sufficient for expression of the polypeptide.

44. A method for inducing apoptosis in a cell, comprising: delivering to a cell an effective amount of a nucleic acid molecule encoding a self-oligomerizing caspase-9 polypeptide; and maintaining the cell under conditions sufficient for expression of the polypeptide. The method of claim 44, wherein the step of delivering comprises injecting the nucleic acid molecule into the cell.

46. The method of claim 44, wherein the step of delivering comprises administering the nucleic acid molecule to the circulatory system of a warm-blooded mammal in which the cell is located.

47. A gene delivery vehicle comprising a nucleic acid molecule encoding a self-oligomerizing caspase-9 polypeptide. wherein the nucleic acid molecule is operatively Slinked to a promoter.

48. The gene delivery vehicle of claim 47, wherein the vehicle is a retrovirus or adenovirus.

49. The gene delivery vehicle of claim 47, wherein the nucleic acid molecule is associated with a polycation. The gene delivery vehicle of any one of claims 47-49, further comprising a ligand that binds a cell surface receptor.

51. A method of treating cancer, comprising administering to a patient a gene delivery vehicle according to any one of claims 47-49, wherein the gene delivery vehicle is internalized by tumor cells. 49

52. A method of treating autoimmune disease, comprising administering to a patient a gene delivery vehicle according to any one of claims 47-49, wherein the gene delivery vehicle is internalized by cells mediating autoimmune disease. DATED this 2 2 nd day of March 2002 Thomas Jefferson University by DAVIES COLLISON CAVE Patent Attorneys for the Applicants C. S S