AU2021105645A4 - Use of cornel iridoid glycoside in resisting diabetes mellitus - Google Patents

Abstract

The present disclosure provides use of Cornel iridoid glycoside (CIG) in resisting diabetes mellitus, and belongs to the technical field of biomedicine. In the present disclosure, iridoid glycosides, major active pharmaceutical ingredients extracted from Comi Fructus, can be used to prepare a medicament for treating diabetes mellitus and solve the problems of single hypoglycemic pathway and severe side effects in western medicine, thus providing a basis for lowering the blood glucose through active pharmaceutical ingredients of TCM. The CIG of the present disclosure is safer, more effective, moderate, long-lasting, and free of toxic and side effects. Moreover, the action mechanism of CIG is multiple in effect, target and function, and the CIG is of great importance in lowering plasma glucose and controlling diabetic complications. Therefore, the CIG has considerable development and application value in diabetes mellitus improvement.

Description

USE OF CORNEL IRIDOID GLYCOSIDE IN RESISTING DIABETES MELLITUS TECHNICAL FIELD

[01] The present disclosure belongs to the technical field of biomedicine, and particularly relates to use of Cornel iridoid glycoside (CIG) in resisting diabetes mellitus.

BACKGROUND ART

[02] Diabetes mellitus is a chronic disease caused by absolute or relative hyposecretion of insulin, characterized by hyperglycemia and disorders of glucose, lipid and protein metabolisms. Research shows that there are approximately 285 million patients with diabetes mellitus worldwide and it is expected that the incidence of diabetes mellitus will reach 438 million by 2030. Therefore, the research and development of antidiabetic drugs has become an impending task. However, chemosynthetic oral hypoglycemic agents remain a major therapy for treating diabetes mellitus, such as sulfonylureas, thiazolidones, metformins, and a-glucosidase inhibitors. These hypoglycemic agents have distinct efficacy in treating diabetes mellitus, but various side effects and drug resistance may be induced, also with high prices. In particular, the majority of chemosynthetic hypoglycemic agents have a single action pathway. However, because diabetes mellitus is a chronic disease of multiple etiologies, simple hypoglycemic therapy can only relieve symptoms, but cannot solve other symptoms such as glucose and lipid metabolism disorder, inflammation, and oxidative stress. Therefore, searching for safer and more effective oral hypoglycemic agents from natural Chinese medicinal herbs has become a direction of the development of antidiabetic drugs.

[03] Insulin resistance (IR) is the main cause of diabetes mellitus, and glucose and lipid metabolism disorder, inflammatory response, oxidative stress, and abnormal insulin signaling pathway are the main mechanisms leading to IR.

[04] Corni Fructus is a dry and mature fruit of Cornus officinalis Sieb. et Zucc. of the family Cornaceae. Corni Fructus is sour and astringent in taste and slightly warm in nature, and belongs to liver and kidney channels. Comi Fructus has the efficacies of tonifying the liver and kidney, astringing essence for relieving desertion, treating vertigo, tinnitus, internal heat dispersion-thirst. Herein, iridoid glycosides are the main active pharmaceutical ingredients in Corni Fructus, and it is particularly important to develop and utilize the pharmacological action of CIG.

SUMMARY

[05] Embodiments of the present disclosure provide use of CIG in resisting diabetes mellitus. Iridoid glycosides, major active pharmaceutical ingredients extracted from Comi Fructus, can be used to prepare a medicament for treating diabetes mellitus and solve the problems of single hypoglycemic pathway and severe side effects in western medicine, thus providing a basis for lowering the blood glucose through active pharmaceutical ingredients of TCM.

[06] The present disclosure is achieved by the following technical solution:

[07] Use of CIG in the preparation of a medicament and/or a health care product for resisting diabetes mellitus is provided.

[08] The medicament and/or health care product is intended to enhance body's glucose tolerance, raise insulin sensitivity index (ISI), and lower insulin resistance index (IRI).

[09] The medicament and/or health care product is intended to improve lipid metabolism disorder.

[10] The medicament and/or health care product is intended to lower levels of total cholesterol (T-CHO), triglyceride (TG), and low density lipoprotein (LDL).

[11] The medicament and/or health care product is intended to raise high-density lipoprotein cholesterol (HDL-C) levels.

[12] The medicament and/or health care product is intended to exert a hypoglycemic effect through an antioxidant mechanism.

[13] The medicament and/or health care product is intended to lower a level of malondialdehyde (MDA) in the liver tissue and raise a level of superoxide dismutase (SOD) in the liver tissue.

[14] The medicament and/or health care product is intended to lower levels of inflammatory factors interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-a), and C-reactive protein (CRP).

[15] The medicament and/or health care product is intended to intervene in an insulin signaling pathway and improve insulin resistance (IR).

[16] The medicament and/or health care product is intended to up-regulate mRNA expression of GLUT-4, INSR, P3K, and PKB.

[17] Compared with the prior art, the present disclosure has the following beneficial technical effects:

[18] In the present disclosure, mice in each group are treated with CIG, and the results show that conditions of the mice in each group are improved after 4-week treatment, where body weights of the mice in the CIG-M, CIG-H, and PC groups have increased; fasting blood glucose (FBG) is significantly decreased in each CIG dose group and the PC group (all P < 0.01); fasting insulin (FINS), ISI, and HDL-C are significantly increased (all P < 0.05), while IRI, T CHO, TG, and LDL-C are significantly decreased (all P < 0.05); oral glucose tolerance test (OGTT) and all visceral indexes are improved, indicating that the CIG may lower blood glucose by improving glucolipotoxicity and stimulating islet P cells or repairing damaged islet P cells to release more insulin; levels of TNF-a, IL-6, CRP, and MDA are decreased and SOD level is increased in each CIG dose group and PC group, indicating that the CIG may lower levels of inflammatory factors in the liver tissue, reduce lipid peroxidation, increase the activity of antioxidant enzymes, and reduce the damage of oxidative stress to tissues; further, the antioxidant capacity of tissues may be enhanced, and the blood glucose may be lowered by improving insulin resistance through multiple targets. Histopathological section results show that the CIG may significantly improve the pathological degree of hepatocytes and pancreatic cells in diabetic mice. In the CIG-H and PC groups, the mRNA expression of GLUT-4, INSR, PI3K, and PKB genes in mouse skeletal muscle is significantly up-regulated (all P < 0.01), indicating that the CIG may improve IR in mice to treat diabetes mellitus by up-regulating the expression of key target genes in the insulin signaling pathway. Therefore, the CIG has a significant hypoglycemic effect on diabetic model mice induced by high-fat and high-sugar diet assisted low-dose injection of streptozotocin (STZ).

[19] Compared with the existing oral hypoglycemic agents, the active ingredient in the present disclosure is a kind of main active pharmaceutical ingredient extracted from natural Chinese herb Corni Fructus, i.e. iridoid glycosides, which is safer, more effective, moderate, long-lasting, and free of toxic and side effects in lowering blood glucose, and the mechanism of action is multi-pathway, multi-target, and multi-functional; the present disclosure explores four important IR-inducing factors, i.e., glucose toxicity, lipotoxicity, hepatic and skeletal muscle insulin resistance, from the aspects of glucose and lipid metabolism, liver inflammation and oxidative stress, and mRNA expression of key target genes for skeletal muscle IR in diabetic mice, so as to solve the existing problems of single hypoglycemic pathway and severe side effects, and provide an experimental basis for the further studies on the mechanism underlying that the CIG intervenes in diabetes mellitus.

BRIEF DESCRIPTION OF THE DRAWINGS

[20] FIG. 1 illustrates effects of CIG on glucose tolerance in mice of each group;

[21] FIG. 2 shows fluorescent micrographs of effects of CIG on the morphology and changes of hepatocytes in mice of each group;

[22] where Al and A2 represent photographs of a normal control (NC) group at magnifications of 200 and 400 folds, respectively; B1 and B2 represent photographs of a diabetic model (DM) group at magnifications of 200 and 400 folds, respectively; Cl and C2 represent photographs of a positive control (PC) group at magnifications of 200 and 400 folds, respectively; Dl and D2 represent photographs of a Comel iridoid glycoside low (CIG-L) group at magnifications of 200 and 400 folds, respectively; El and E2 represent photographs of a Cornel iridoid glycoside middle (CIG-M) group at magnifications of 200 and 400 folds, respectively; Fl and F2 represent photographs of a Cornel iridoid glycoside high (CIG-H) group at magnifications of 200 and 400 folds, respectively;

[23] FIG. 3 shows fluorescent micrographs of effects of CIG on the pathology of mouse pancreatic tissues in mice of each group, where A represents an NC group; B represents a DM group; C represents a PC group; D represents a CIG-L group; E represents a CIG-M group; F represents a CIG-H group; amplification factor is 400 folds.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[24] The present disclosure will be further described in detail with reference to the specific examples, which are intended to illustrate and not to limit the present disclosure.

[25] I. Experimental materials

[26] Preparation of CIG: 1.00 g of Corni Fructus powder (sieved through a 40 mesh sieve) was accurately weighed, mixed with 21 mL of 80% methanol solution, extracted at a microwave power of 641 W and an ultrasonic power of 360 W for 9 min, and filtered by suction filtration; after methanol was volatilized, the solution was extracted with petroleum ether at 60-90°C thrice, evaporated to dryness under reduced pressure, reconstituted in distilled water, and purified by D101 macroporous resin (adsorption time 1.5 h, elution time 2 h, elution concentration 50% ethanol, and elution volume 7 BV); an eluent was concentrated under reduced pressure and lyophilized in vacuo to obtain the CIG.

[27] Experimental animals and husbandry: 90 SPF grade, 4-week-old, male Kunming mice weighing 18 2 g were purchased from the Experimental Animal Center of Xi'an Jiaotong University Health Science Center. The mice were fed at 25± 2C within a relative humidity range of 40-60%, and given free access to food and drinking water.

[28] Experimental reagents: streptozotocin (Sigma company, USA); metformin hydrochloride sustained-release tablets (Hebei SMS Pharmaceutical Co., Ltd., National Medicine Permission Number: H20123024); T-CHO detection kit (Changchun Huili Biotechnology Co., Ltd.); TG detection kit (Changchun Huili Biotechnology Co., Ltd.); HDL-C detection kit (Changchun Huili Biotechnology Co., Ltd.); LDL-C detection kit (Changchun Huili Biotechnology Co., Ltd.); T-SOD detection kit (NO. A001-1, Nanjing Jiancheng Bioengineering Institute); MDA detection kit (NO. A003-1, Nanjing Jiancheng Bioengineering Institute); mouse CRP ELISA kit (Beijing Keyingmei Technology Co., Ltd); mouse TNF-a ELISA kit (Beijing Keyingmei Technology Co., Ltd); mouse IL-6 ELISA kit (Beijing Keyingmei Technology Co., Ltd.); mouse insulin ELISA kit (Beijing Keyingmei Technology Co., Ltd.); Primescript T M RT reagent Kit with gDNA Eraser (Takara Bio, NO. RR 047B); DL2,000 DNA Marker(TaKaRa Bio, NO. 3427Q); SYBR@ Premix Ex TaqTM II (Tli RNaseH Plus), ROX plus(TaKaRa Bio, NO. RR82LR). TRNzol total RNA extraction reagent (Tiangen Biotech (Beijing) Co., Ltd.).

[29] The water used in experiments is Millipore ultrapure water and 0.9% normal saline. Analysis of ethanol (Tianjin Tianli Chemical Reagent Co., Ltd.); paraformaldehyde (Beijing Chemical Reagent Company); RNA preservation solution (Tiangen Biotech (Beijing) Co., Ltd.).

[30] II. Experimental methods

[31] 1. Preparation of drug solutions

[32] Preparation of CIG solutions: Separately, 1,125 mg, 2,250 mg, and 4,500 mg of CIG extracts were accurately weighed, dissolved with 0.9% (v/v) normal saline, and diluted to 100 mL to obtain 11.25 mg/mL, 22.50 mg/mL, and 45.00 mg/mL suspensions; the suspensions were stored in a refrigerator at 4°C in the dark.

[33] Preparation of metformin solution: In a ready-to-use manner, Metformin Hydrochloride Sustained-Release Tablets were ground into a powder in a mortar; 225 mg of the powder was accurately weighed, dissolved with 0.9% (v/v) normal saline, and diluted to 10 mL to obtain a 22.50 mg/mL solution, and the solution was stored in a refrigerator at 4°C in the dark.

[34] Preparation of streptozotocin (STZ) solution: In a ready-to-use manner, 90 mg of streptozotocin powder was accurately weighed in the dark, dissolved with 0.1 mol/L sodium citrate buffer and diluted to 10 mL to obtain a 9 mg/mL streptozotocin solution; the solution was stored in a refrigerator at 4°C in the dark.

[35] Preparation of high-fat and high-sugar diet: 20% sucrose, 10% lard, 3% cholesterol, and 0.02% pig bile salt were added to 66.98% normal diet.

[36] 2. Establishment of a diabetic model

[37] Ninety male Kunming mice purchased were acclimatized for three days, weighed, and were randomly divided into a normal group and a model group according to the body weight. Of them, 10 normal mice were housed in two separate cages; 80 model mice were housed in 15 separate cages, 5-6 mice per cage. The normal group was fed with normal diet, and the model group was fed with high-fat and high-sugar diet.

[38] One month after feeding, the model mice were intraperitoneally injected with STZ (60 mg/kg) for three consecutive days. Five days after STZ injection, all mice were deprived of food but not water for 12 h, and the blood was drawn from the tail vein to detect fasting blood glucose (FBG). If the blood glucose level is > 11.1 mmol/L, diabetes mellitus can be determined. The control mice in normal group were injected with an equal volume of normal saline.

[39] 3. Animal grouping experiment and administration

[40] According to the modeling results, unsuccessfully modeled mice were excluded. Sixty successfully modeled mice were randomly divided into five groups according to the blood glucose level and the body weight, namely, a diabetic model (DM) group, a positive control (PC) group, a Cornel iridoid glycoside low (CIG-L) group, a Cornel iridoid glycoside middle (CIG-M) group, a Cornel iridoid glycoside high (CIG-H) group, and a normal control (NC) group. The drug concentrations are shown in Table 1.

[41] Table 1 Reagents and concentrations of each group Group Reagent and concentration Normal control (NC) 0.9% Normal saline Diabetic model (DM) 0.9% Normal saline Positive control (PC) 150 mg/kg, 22.50 mg/mL Comel iridoid glycoside low (CIG-L) group 75 mg/kg, 11.25 mg/mL Cornel iridoid glycoside middle (CIG-M) group 150 mg/kg, 22.50 mg/mL Cornel iridoid glycoside high (CIG-H) group 300 mg/kg, 45.00 mg/mL

[42] 4. Specimen collection

[43] i. Preparation of blood samples

[44] Four weeks after administration, the mice in each group were killed and sampled. Before execution, the mice in each group were deprived of food but not water for 12 h. Before sampling, the mice in each group were anesthetized with ether, the blood was drawn from eyeballs, centrifuged at 3000 r/min for 10min, the serum was separated, packed in 1mL centrifuge tubes, sealed and cryopreserved in a refrigerator at -20°C for later use.

[45] ii. Preparation of tissue samples

[46] After blood was drawn from eyeballs, each mouse was sacrificed by cervical dislocation and dissected immediately. The pancreas, liver, kidneys, spleen, and skeletal muscles were quickly found and completely isolated from other tissues. After rinsing with normal saline, the pancreas was placed in 4% polyformaldehyde solution for light microscopy; after weighing the whole liver, 0.5 g of liver tissue was cut and placed in normal saline at a ratio of 1:10 for tissue homogenization, and the remaining liver tissue was placed in 4% polyformaldehyde solution for light microscopy; the isolated spleen and kidneys were weighed, and the visceral indexes of the liver, spleen, and kidneys were measured; the mouse thigh skeletal muscle was stored in an RNA Storage Buffer at -20°C for later use.

[47] 5. Detection indexes

[48] 1) FBG measurement

[49] During the 4 weeks of administration, the blood was drawn from the tail vein and the

FBG levels of mice in each group were measured at 2 and 4 weeks after administration; the mice in each group were deprived of food but not water for 12 h before the measurement.

[50] 2) Oral glucose tolerance test (OGTT)

[51] Mice in each group were subjected to OGTT four weeks after administration. Before the measurement, the mice in each group were deprived of food but not water for 12 h, and the blood was drawn from the tail vein to measure FBG as a sample at 0 min. After the FBG was measured, the mice in each group were intragastrically administered with 2 g/kg glucose solution; subsequently, the CIG-L, CIG-M, and CIG-H groups were intragastrically administered with 75 mg/kg, 150 mg/kg, and 300 mg/kg CIG solutions, respectively, the PC group were intragastrically administered with 150 mg/kg metformin solution, and the NC group and the DM group were intragastrically administered with the same amount of normal saline; blood glucose levels of the mice in each group were measured at 30 min, 60 min, 120 min, and 180 min after administration, respectively.

[52] 3) Determination of fasting serum insulin (FINS)

[53] The sera were drawn from mice in each group, serum insulin concentrations thereof were determined by the "competitive inhibition enzyme-linked immunosorbent assay (ELISA)" four weeks after intragastric administration. The specific operation was in accordance with the kit instructions. The main principle is that insulin in the test sample and enzyme-labeled antigens commonly compete for antibodies coated on the microplate to form a labeled antigen complex, and finally the enzyme produces a yellow color reaction with the substrate. When the insulin concentration is low in the sample, there are a plurality of antibody-bound enzyme labeled antigens bound to the antibody, and the yellow color becomes dark, and vice versa. A standard curve was plotted by reading the absorbance at a wavelength of 450 nm, and the concentration of the test sample was derived from the standard curve.

[54] 4) Determination of IRI and ISI

[55] According to the method introduced by HOMA model, the HOMA-IRI and the HOMA-ISI were calculated as follows: HOMA-IRI = (FINS x FBG)/22.5; HOMA-ISI =

ln[l/(FINS x FBG)].

[56] 5) Serum lipid profile

[57] The lipid profile includes T-CHO, TG, HDL-C, and LDL-C. The T-CHO level was determined by the COD-PAP method, the TG level was determined by the GPO-PAP method, and the HDL-C and LDL-C levels were determined by the direct method. The experimental procedure was carried out in accordance with the kit instructions.

[58] 6) Determination of visceral indexes of the liver, kidneys, and spleen

[59] The wet weights of the mouse liver, kidneys, and spleen were accurately weighed, and the visceral indexes of the mice in each group were calculated according to the formula visceral index = (organ wet weight/mouse body weight) x 100%".

[60] 7) Determination of hepatic inflammatory factors

[61] The levels of TNF-a, IL-6, and CRP were determined by competitive inhibition ELISA. The supernatant homogenized from the liver tissue was collected, and the operation was carried out in accordance with the kit instructions.

[62] 8) Determination of oxidative stress indexes

[63] Total superoxide dismutase (T-SOD) was determined by the hydroxylamine method, and MDA was determined by the TBA method. The specific procedures were conducted in accordance with the kit instructions.

[64] 9) Histopathological observations of the liver and the pancreas

[65] i. The liver tissue and pancreatic tissue were fixed in 10% formalin for 24 h, rinsed with running water, dehydrated with alcohol gradiently (50% ethanol -- 70% ethanol -- 80% ethanol -- 90% ethanol -- 95% ethanol -- 100% ethanol -- 100% ethanol), and permeabilized with xylene, respectively.

[66] ii. paraffin embedding: the above-mentioned permeabilized liver tissue and pancreatic tissue were placed in the melted paraffin, and embedded until the paraffin was completely immersed in the tissues;

[67] iii. sectioning: the embedded tissues were sectioned to a thickness of 4 m, placed on a glass slide treated with an anti-slice escaping agent, and baked in an oven at 60°C for 12 h;

[68] iv. HE staining: slices were stained with hematoxylin for 10 min, rinsed to bluish with tap water, subjected to color separation for 5 s with acidulated alcohol, and eluted with alcohol gradiently; the slices were stained with eosin for 10 min, destained with alcohol gradiently, and permeabilized with xylene;

[69] v. after coverslipping with neutral gum, histopathological slices of the liver and pancreas of the mice in each group were observed under fluorescence microscope, photographed, and saved.

[70] 10) Detection of the mRNA expression of GLUT-4, INSR, P13K, and PKB in skeletal muscles of mice in each group influenced by CIG

[71] (1) Sample total RNA extraction

[72] Sample RNA was extracted by using TRNzol Universal RNA Extraction Kit, and the experimental procedure was performed in accordance with the product instructions. Specific procedures were as follows:

[73] the tissue was ground in a pre-cooled mortar, and after the tissue sample was powdered:

[74] i. Trizol was added, and the mixture was stored at room temperature for 5 min;

[75] ii. 0.2 ml of chloroform was added, the centrifuge tube was shaken vigorously for mixing well, and let stand for 5-10 min at room temperature;

[76] iii. the upper aqueous phase (70%) was pipetted into a second new centrifuge tube 15 min after centrifugation at 12,000 rpm, taking care not to pipette the protein between two aqueous phases; the upper aqueous phase was transferred into a new tube, inversed fully and mixed well after adding an equal volume of isopropanol pre-cooled at -20°C, and placed on ice for 10 min;

[77] iv. after centrifugation at 12,000 rpm for 15 min, the supernatant was carefully discarded, and the precipitates were washed by adding 75% DEPC ethanol in a ratio of 1 mL/mL Trizol (stored at 4°C); the precipitates were washed, mixed by shaking, and centrifuged at 12,000 rpm for 5 min at 4°C;

[78] v. the ethanol was discarded; the precipitates were let stand at room temperature for 5 min to dry thoroughly, dissolved with DEPC-treated water, and cryopreserved at -80°C.

[79] (2) Determination of total RNA concentration and purity

[80] The absorbance was measured at 230, 260, and 280 nm using a Nanodrop 2000 ultraviolet spectrophotometer. RNA concentration (ng/4L)= (OD 2 6o/OD 2 8 0, OD 2 6 0 / 2 3 0 ).

[81] 5 L of the above total RNA extract was electrophoresed on a 1% agarose gel, and the observation results were observed, photographed, and saved on a gel imaging system, and the presence of characteristic bands was identified in the extracted RNA based on the results.

[82] (3) Synthesis of cDNA by reverse transcription of RNA

[83] cDNA was reverse transcribed using PrimeScript T M RT reagent Kit with gDNA Eraser. The experimental procedure was performed in accordance with the product instructions; the specific procedure was as follows:

[84] i. Removal of genomic DNA reaction

[85] A reaction mix was prepared on ice according to the following ingredients. In order to ensure the accuracy of the preparation of the reaction mix, when each reaction was conducted, Master Mix should be prepared according to the number of reaction number + 2, dispensed into each reaction tube, and finally mixed with an RNA sample.

[86] Table 2 The reverse transcription reaction system I Reagent Consumption 5xgDNA Eraser Buffer 2.0 1 gDNA Eraser 1.0 1 Total RNA 1 g RNase Free H2 0 Up to 10 1

[87] The above samples were mixed well and incubated at 42°C for 2 min.

[88] ii. Reverse transcription reaction

[89] In order to ensure the accuracy of the preparation of the reaction mix, when each reaction was conducted, Master Mix should be prepared according to the number of reaction number + 2, 10 1 was dispensed into each reaction tube, and reverse transcription reaction was conducted immediately after gently mixing well.

[90] Table 3 The reverse transcription reaction system II

Reagent Consumption Reaction mix in step 1 10.0 1u PrimeScript RT Enzyme Mix I 1.0 1u RT Primer Mix 1.0 1u 5x PrimeScript Buffer 2 4.0 1u RNase Free H 2 0 4.0 1u Total 20 1u

[91] The above-mentioned sample was incubated at 37°C for 15 min, and incubated at 85°C for 5 s to obtain cDNA, which was stored in a refrigerator at -20°C for later use.

[92] (4) Real-time PCR

[93] i. Primer design: all target gene primers for real-time PCR were synthesized by Beijing Invitrogen Inc. The primer sequences of the four target genes are shown in Table 4:

[94] Table 4 Primer sequences Name of primer Primer sequence (5' to 3') Size of product (bp) Forward primer of the AKT TTTGGGAAGGTGATTCTGGTG 153 Reverse primer of the AKT CGTAAGGAAGGGATGCCTAGAGTT Forward primer of the INSR CAAGAAATGATTCAGATGACAGCAG 238 Reverse primer of the INSR AGACTCCATCCTTCAGGGACTCA Forward primer of the GLUT-4 CCCCATTCCCTGGTTCATT 141 Reverse primer of the GLUT-4 GACCCATAGCATCCGCAAC Forward primer of the P13K GACCCATAGCATCCGCAAC 187 Reverse primer of the P13K CTCGCAATAGGTTCTCCGCTTT Forward primer of the ACTIN GCCTTCCTTCTTGGGTAT Reverse primer of the ACTIN GGCATAGAGGTCTTTACGG 97

[95] ii. Reaction system: Amplification was carried out with Premix Ex TaqTM II (Tli RNaseH Plus), ROX plus, and the experimental operation was carried out in accordance with the product specifications. Amplification program was: 95°C for 30 s, (95°C for 5 s, 60°C for s) x 45 cycles. The real-time reaction system (20 l) is shown in Table 5:

[96] Table 5 Real-time reaction system

Reagent Sampling volume 2x SYBR Green mix 10 1 Forward primer (10 M) 0.5 l Reverse primer (10 [M) 0.5 1 cDNA 2 1d ddH 20 7 1d

[97] The above amplification process was carried out using an ABI 7500 real-time PCR system, and GAPDH was used as an internal control, and a relative quantitative 2-AACT method was used for data analysis:

[981 F =2-fAvergeCtvaluoftagetgenesintestgroupAverageCtvaluofhousekeepiggenesintestgroup]-[AverageCtvauoftagetgenesincontolgioupAver III. Statistical analysis

[99] The experimental data were analyzed by SPSS16.0 statistical software. The data of each group were expressed as mean standard deviation (). One-way ANOVA was used for comparison between groups. The significant difference between groups was compared by LSD multiple comparison; P < 0.05 showed a statistically significant difference, and P < 0.01 showed a very significant difference.

[100] IV. Experimental results

[101] 1. Effects of CIG on glucose and lipid metabolism in mice of each group

[102] 1) General conditions of mice of each group

[103] High-fat and high-sugar diet combined with low-dose intraperitoneal injection of streptozotocin (STZ) were given for five days, the blood was drawn from the tail vein to measure the FBG level. Before the experiment, the mice were deprived of food but not water for 12 h. If the FBG level was > 11.1 mmol-L-1, successful modeling is considered. The FBG level was more than 11.1 mmol-L-1 in 60 of 80 mice, with a successful modeling rate of 75%.

[104] During the administration, the mice in the NC group were in good condition, sensitive in response, normal in activity, glossy in fur, stable in weight gain, and normal in urine volume. The mice in the model group showed obvious symptoms of polydipsia, polyphagia, polyuria, apatheia, burnout, slow moving, slow response, gathering together to lie in curled-up posture, sleepiness, and dry, messy and dull fur; two weeks after administration, CIG-L, CIG-M, CIG-H groups and PC group had different degrees of improvement on the condition of mice, of which the CIG-H group and the PC group had obvious improvement effects, and the activity levels of the mice were increased, and the fur was glossy.

[105] 2) Changes in body weight of mice in each group

[106] Table 6 Effects of CIG on the body weights of mice in each group after administration (n = 10) Group Initial (g) 1 weeks (g) 2 weeks (g) 3 weeks (g) 4 weeks (g) NC 31.72±2.26 32.49±2.20 32.87±1.54^^ 33.2±2.1O^^ 32.48±2.60^^

DM 31.26±2.43 30.23±2.48 29.5±2.28** 28.±1.97** 27.3±1.78*** PC 30.98±1.38 31.04±2.14 31.23±1.03 31.79±1.74^ 31.14±1.43^ CIG-L 30.77±0.63 30.50±1.93 30.75±1.31 30.6±0.78 30.45±0.54

CIG-M 31.80±1.48 31.45±0.88 30.0±1.62** 30.5±1.95 30.19±2.27

CIG-H 31.53±1.36 31.33±1.54 30.78±2.24* 31.2±2.66^ 31.12±2.66^ NOTE: *P< 0.05 and **P < 0.01 versus NC group; ^P < 0.05 and^^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[107] From Table 6, there is no significant difference in body weight between groups before and one week after administration; two weeks after administration, the mice in the DM group, the CIG-M group, and the CIG-H group show significant weight losses, which show a significant difference in body weight from the mice in the NC group (P< 0.05); 3-4 weeks after administration, the mice in the DM group show a continuous decrease in body weight, while the those in the CIG-M and CIG-H groups show weight gains, among which there is a significant difference between the CIG-H group and the DM group (P< 0.05).

[108] 3) Changes in FBG of mice in each group

[109] As shown in Table 7, two weeks after administration, the FBG is lower in the CIG-M, CIG-H, and PC groups than in the DM group, with a very significant difference (all P < 0.01); compared with the NC group, FBG is significantly increased in model mice (DM, CIG-L, CIG M, CIG-H, and PC groups) (all P < 0.01), while the PC group is significantly different from the CIG-L and CIG-H groups (both P < 0.05), and insignificantly different from the CIG-M group. Four weeks after administration, the FBG is significantly lower in the CIG-L, CIG-M, CIG-H, and PC groups than in the DM group (all P < 0.01), and there is a significant difference in FBG between the CIG-H group and the PC group (P < 0.01), indicating that the hypoglycemic effect of the CIG-H group is better than that of the PC group.

[110] Table 7Effects of CIG onFBG ofmiceineachgroup (n = 10) Group 2 weeks (mmol/L) 4 weeks (mmol/L) NC 5.88±1.51^"" 5.44±1.03^^""

DM 27.35±3.32**** 27.71±2.25**** PC 21.46±2.94**^^ 19.66±2.57**^^ CIG-L 24.70±1.56*** 22.55±2.05**^^ CIG-M 23.15±3.50**^^ 22.44±2.02**^^ CIG-H 18.28±3.26**^^^ 14.44±3.51**^^"" NOTE: *P< 0.05 and **P < 0.01 versus NC group; ^P < 0.05 and^^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[111] 4) Effects of CIG on oral glucose tolerance of mice in each group

[112] As shown in Table 8 and FIG. 1, the blood glucose levels of the mice in each group increase first and then decrease, but the blood glucose level of the DM group is always higher than that of each administration group. At 0 min, there is a very significant difference in blood glucose level between the DM group and other groups (P < 0.01), and there is also a very significant difference between each administration group and NC group (P < 0.01); however, the PC group shows a very significant difference from the NC, DM, and CIG-H groups (all P < 0.01) and is not statistically different from the CIG-L and CIG-M groups. After 30 min, because the mice in each group were intragastrically administered with glucose or drug, and efficacy thereof had not yet worked, the blood glucose levels of the mice in each group increase. At 60 min, the blood glucose levels of the mice in each group decrease, but only the PC, CIG-H, and NC groups show very significant differences from the DM group (all P < 0.01). At 120 min and 180 min, the blood glucose levels of the mice in the group are still decreasing, and basically become stable at 180 min. Except that the blood glucose levels of the CIG-L group and the DM group do not reach a significant difference, the other groups have lower blood glucose levels than the DM group and reaches a significant difference (P < 0.05); the CIG-M and CIG-H groups have lower blood glucose levels than the PC group, but the statistical difference is not reached. This indicates that the CIG plays a role in improving glucose tolerance of the mice in each group, and has better efficacy than metformin hypoglycemic agents on the market.

[113] Table 8 Effects of CIG on glucose tolerance of mice in each group (n = 10) Group 0 min 30 min 60 min 120 min 180 min NC 5.391.02-^** 10.42±2.14^^** 7.54+0.77-^** 7.20+0.59-^** 6.010.91^^**

DM 27.99+2.37**** 32.93+0.84**** 29.03+2.37**** 25.13+2.25*** 21.69+2.89***

PC 22.862.71**** 27.73+2.70**** 23.501.67**-** 19.26+2.54**-* 18.09±1.44**-*

CIG-L 23.01±1.98**** 32.60±0.91**** 28.61±2.03**** 23.83±1.57**** 19.96+2.32**

CIG-M 22.38+2.99**** 31.56+2.04**** 27.89+1.38**** 22.14+2.48** 17.48+1.19***

CIG-H 14.48+2.34****** 26.93±3.14**** 24.55+2.68**-** 17.931.56**-** 15.72+2.29****

NOTE: *P< 0.05 and **P < 0.01 versus NC group;,AP < 0.05 and^^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[114] 5) Changes in FINS, ISI, and IRI of mice in each group

[115] As shown in Table 9, four weeks after administration, compared with the DM group, the FINS levels are elevated in each administration group, and the CIG-M, CIG-H, and PC groups are very significantly different from the DM group (all P < 0.01); the PC and CIG-H groups are insignificantly different from the NC group; the DM, CIG-L, and CIG-M groups are very significantly different from the PC group (P< 0.01).

[116] Four weeks after administration, compared with the DM group, the HOMA-ISI increases in each administration group, and the PC, CIG-M, and CIG-H groups are significantly different from the DM group (all P < 0.05), while the HOMS-IRI decreases and each group is significantly different from the DM group (P < 0.05). Compared with the NC group, the HOMA-ISI decreases and the HOMA-IRI increases in each administration group, both of which reach very significant differences (both P < 0.01); the HOMA-ISI and the HOMA-IRI in the CIG-L and CIG-M groups are not statistically different from those in the PC group.

[117] Table 9 Effects of CIG on FINS levels, ISI, and IRI of mice in each group after administration (n = 10) Group FINS (mIU/L) HOMA-ISI HOMA-IRI NC 11.02±1.23^^ -4.06±0.21^"" 2.87±0.45^^"" DM 7.02±0.50**** -5.42±0.16*** 9.100.59*** PC 10.46±1.06^^ -5.19±0.12**^ 7.90±0.70**^

CIG-L 7.800.89**** -5.26±0.10** 8.05±1.04**^^

CIG-M 9.07±1.15**^^#" -5.18±0.11**^ 7.69±0.68**^^ 10.59±0.70^^ -4.94±0.20**^^# 6.30±0.80**^^#" CIG-H

NOTE: *P<0.05 and **P<0.01 versus NC group; ^PA< 0.05 and^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[118] 6) Effects of CIG on serum lipid profile of mice in each group

[119] As shown in Table 10, compared with the DM group, the T-CHO, TG, and LDL-C of the mice in each group tend to decrease, and the CIG-M and CIG-H groups are significantly different from the DM group (both P < 0.05); for TG, the PC and CIG-L groups are very significantly different from the DM group (P < 0.01), while HDL-C increases compared with the DM group, and the PC, CIG -L, CIG-M, and CIG-H groups are significant different from the DM group (all P < 0.05); the CIG -L, CIG-M, and CIG-H groups are not statistically different in T-CHO, TG, and HDL-C from the PC group, and the CIG-M and CIG-H groups are very significantly different in LDL-C from the PC group (both P < 0.01), indicating that the CIG has effects on lowering the levels of T-CHO, TG, and LDL-C, increasing the HDL-C levels, and improving lipid metabolism disorder in diabetic mice.

[120] Table 10 Effects of CIG on changes of serum lipid levels of mice in each group (n = 10) Group T-CHO (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) NC 2.40±0.25^^"" 1.20±0.15^^ 1.37±0.07^^ 2.98±0.49^^"" DM 3.71±0.48** 1.93±0.34**** 0.99±0.14**** 5.45±0.38**

PC 3.33±0.52** 1.26±0.44^^ 1.33±0.09^^ 5.04±0.55**

CIG-L 3.48±0.42** 1.45±0.14^^ 1.34±0.12^^ 5.22±0.60**

CIG-M 3.51±0.68**^\ 1.12±0. 15 ^^ 1.21±0. 14 *^ 3.76±0.41**^^* CIG-H 3.01±0.24*^^ 1.19±0. 15AA 1.25±0. 16AA 3.29±0.32^^**

NOTE: *P< 0.05 and **P < 0.01 versus NC group; AP < 0.05 and^^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[121] Glucose toxicity and lipotoxicity are the known main mechanisms of IR in diabetes mellitus. Long-term hyperglycemia causes a pathological, persistent and irreversible influence to the body, which is called "glucose toxicity". On the one hand, the glucose toxicity aggravates the occurrence and development of diabetes mellitus, and on the other hand, it causes various diabetic vascular diseases. Under normal condition, insulin binds with its receptor, which activates a series of phosphorylation processes in downstream cells, makes GLUT-4 transfer from the cells to the cell membrane, and completes the oxidative decomposition of intracellular glucose. The lipid metabolism disorder will destroy this process, causing a large amount of glucose to accumulate outside the cells, reducing the uptake of glucose by cells, thus aggravating hyperglycemia. At the same time, the lipotoxicity (lipid metabolism disorder) also significantly increases the incidence and mortality of diabetic macrovascular complications. Therefore, the islet P cells can be improved and repaired through hypoglycemic and lipid lowering measures, thus reducing insulin resistance, delaying and improving the occurrence of diabetes.

[122] In this study, diabetic model mice induced by high-fat and high-sugar diet assisted with low-dose injection of STZ showed significant "three-high-one-low" symptoms (polydipsia, polyphagia, polyuria and weight loss). FBG reached 27.71 mmol/L, FINS, ISI, and HDL-C were significantly reduced, IRI, T-CHO, TG, and LDL-C were significantly increased, OGTT and various visceral indexes were abnormal, indicating that the body had disorders of glucose and lipid metabolism, certain damages to visceral organs, and IR. After 4-week administration, the conditions of the mice in each group were improved, of which the body weights of the mice in the CIG-M, CIG-H, and PC groups increased; FBG was significantly lowered in the CIG and PC groups (all P < 0.01); FINS, ISI, and HDL-C were significantly increased (all P < 0.05), IRI, T-CHO, TG, and LDL-C were significantly decreased (all P < 0.05); OGTT and various visceral indexes were improved partly. It can be seen that the CIG can lower blood glucose by improving glucolipotoxicity, stimulating islet P cells or repairing damaged islet P cells to release more insulin.

[123] 7) Effects of CIG on visceral indexes of mice in each group

[124] The experimental results are shown in Table 11. The liver index tends to significantly decrease in the CIG-L, CIG-M, CIG-H, and PC groups compared with the DM group (P< 0.01), the PC group is insignificantly different from the CIG-L group and very significantly different from the CIG-M and CIG-H groups (both P < 0.01). The spleen index tends to significantly decrease in the CIG-L, CIG-M, and CIG-H groups compared with the DM group (all P < 0.05), very close to the data corresponding to the NC group (P > 0.05), without statistical difference between PC group and each dose group; the CIG-L, CIG-M, and PC groups show a significant difference in kidney index from the DM group have (all P < 0.05) and no significant difference from the NC group, indicating that the CIG can partly improve organ lesions caused by diabetes mellitus induced by high-fat and high-sugar diet assisted with STZ

.

[125] Table 11 Effects of CIG onvisceral indexes of mice in each group (n = 10, is) Group Liver index% Spleen index% Kidney index% NC 4.97±0.64^^** 0.27±0.08^^ 1.47±0.44

DM 8.79±0.55**** 0.39±0.03** 1.74±0.20" PC 7.74±0.33**^^ 0.34±0.10 1.41±0.30^

CIG-L 7.55±0.67**^^ 0.26±0.06^^ 1.48±0.08^

CIG-M 6.65±0.74**^^"# 0.31±0.08^ 1.42±0.14^^

CIG-H 6.35±0.33**^^## 0.25±0.07^^ 1.44±0.02

NOTE: *P< 0.05 and **P < 0.01 versus NC group; ^P < 0.05 and ^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[126] 2. Effects of CIG on liver inflammation, oxidative stress, and visceral indexes of mice in each group

[127] 1) Effects of CIG on inflammatory factors TNF-a, IL-6, and CRP in liver tissues of mice in each group

[128] As shown in Table 12, the three liver inflammatory factors IL-6, TNF-a, and CRP are decreased in each administration group compared with the DM group, and the CIG-M and CIG H groups are significantly different from the DC group (both P < 0.05); with respect to IL-6 and CRP, the CIG-M and CIG-H groups are not statistically different from the NC group, and with respect to TNF-a, both the CIG-L and CIG-M groups are significantly different from the NC group (both P < 0.05). With respect to IL-6, the CIG-L group is not significantly different from the PC group, while the CIG-M and CIG-H groups are significantly different from the PC group (both P < 0.01). With respect to TNF-a, the CIG-L, CIG-M, and CIG-H groups are not significantly different from the PC group; with respect to CRP, the CIG-H group is very significantly different from the PC group (P < 0.05), and the CIG-L and CIG-M groups is not significantly different from the PC group, indicating that the CIG-H group plays a significant role in the treatment of liver inflammation in mice, and the therapeutic effect is stronger than that of the metformin positive control group (PC group).

[129] Table 12 Effects of CIG on levels of IL-6, TNF-a, and CRP in the liver tissues of mice in each group (n = 10) 8Group IL-6 (pg/mL) TNF-a (pg/mL) CRP ( g/mL) NC 42.14±5.85^^"" 101.83±3.6^^^ 0.42±0.06^^""

DM 84.63±7.73*** 135.44±3.35* 0.58±0.07**

PC 72.63±10.66**^ 126.60±8.21** 0.55±0.03**

CIG-L 70.41±5.34**^^ 121.07±4.75* 0.51±0.07

CIG-M 52.49±6.62^^ "" 115.23±15.60*^ 0.46±0.06^^

CIG-H 47.87±5.99^^"" 113.04±3.64^^ 0.41±0.02^^"" NOTE: *P< 0.05 and **P < 0.01 versus NC group; AP < 0.05 and^^P < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[130] 2) Effects of CIG on levels of MDA and SOD in liver tissues of mice in each group

[131] As shown in Table 13, the MDA activity is significantly increased (P < 0.01), and the SOD activity is decreased sharply (P< 0.01) in the DM group compared with the NC group; the MDA levels decrease in the CIG-L, CIG-M, CIG-H, and PC groups compared with the DM group, and the CIG-M group has the most significant lowering effect (P < 0.01), and the data are very close to the corresponding data in the NC group; the SOD levels in the CIG-L, CIG-M, CIG-H, and PC groups increase, and there is no significant difference between CIG-H group and NC group (P > 0.05); the CIG-M and CIG-H groups are not statistically different from the PC group. Both MDA and SOD are indexes reflecting liver oxidative stress. MDA is one of the most important products during lipid peroxidation, and SOD plays a crucial role in the equilibrium of oxidation and antioxidation in the body. Therefore, it can be confirmed by this experiment that the CIG can exert a significant hypoglycemic effect by the antioxidant mechanism.

[132] Table 13 Effects of CIG on MDA levels and SOD activity in the liver tissues of mice in each group (n = 10) Group MDA (nmmol/mg) T-SOD (U/mg)

NC 1.39±0.51^^ 222.85±19.92^^* DM 2.88±0.62**** 135.83±26.03****

PC 1.77±0.80^^ 189.51±35.37*^^ CIG-L 2.79±0.75**** 145.76±16.15****

CIG-M 1.34±0.89^^ 174.29±27.29**^^

CIG-H 1.95±0.55^ 212.31±32.78^^ NOTE: *P< 0.05 and **P < 0.01 versus NC group; AP < 0.05 and AAP < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[133] The liver is the main place of glucose and lipid metabolism, and the main tissue of IR. The IR and metabolism disorder of the liver is an important inducement of diabetes. Therefore, we can intervene diabetes by improving IR in the liver and protecting its function. Epidemiological data show that the occurrence of IR is often positively correlated with inflammatory factors. Numerous studies have shown that TNF-a is involved in the occurrence of IR and plays an important role in its pathogenesis. IL-6 is involved in the formation of IR in liver. IL-6 can interfere with obese mice induced by diet, thereby enhancing insulin sensitivity. CRP is an important inflammatory factor produced by liver. CRP can reduce the sensitivity of target cells (liver, muscle, adipose tissue) to insulin, resulting in hyperglycemia and hyperlipidemia, and then increasing the burden of islet P cells and producing insulin resistance.

[134] The main mechanism of insulin resistance induced by cytokines TNF-a and IL-6 is through insulin signal transduction pathway. TNF-a and IL-6 can block the normal tyrosine phosphorylation of INSR and IRS by activating JNK and IKK, promote the phosphorylation of serine and threonine, thus leading to a decrease of binding ability of INSR and IRS. TNF-a and IL-6 can also inhibit the binding of PI3K to IRS, and then inhibit the activity of PI3K and GLUT, interfere in the expression, synthesis and translocation of GLUT-1 and GLUT-4, and hinder insulin signal transduction, thus leading to a decline of insulin biological function, a decrease of glucose uptake and utilization, and IR. In addition, IR is often accompanied by an increase or a decrease of reactive oxygen species (ROS) in the body, which leads to the imbalance of ROS generation and elimination, and then leads to the aggravation of oxidative stress level in tissues. ROS plays an important role in increasing lipid peroxide. MDA is a kind of lipid peroxide, which can reflect the damage degree of liver attacked by free radicals. SOD is an antioxidant enzyme that can scavenge free radicals in cells, the activity of which can reflect the ability of organism to scavenge free radicals. At the same time, numerous studies have shown that oxidative stress can interact with inflammatory reaction in IR state, and inflammation such as TNF-a and IL-6 can stimulate ROS production, and ROS can activate various signal transduction mechanisms in cells, eventually leading to the occurrence of IR.

[135] The experimental results showed that, in the DC group, the levels of TNF-a, IL-6, CRP, and MDA in the mouse liver tissue were significantly increased (all P < 0.05), and the SOD activity was significantly decreased (P < 0.01), indicating that inflammation and oxidative stress occurred in the liver tissue; the levels of TNF-a, IL-6, CRP, and MDA were lowered and the SOD level was elevated in the CIG groups and PC group, and there were significant differences between CIG-M and CIG-H groups (P < 0.05). However, in the PC group, inflammatory factors TNF-a and CRP were improved but had not reached a significant level. Presumably, the reason may be that the selected positive drug metformin acts mainly to enhance insulin sensitivity, and the target is not directed against inflammatory factors. The CIG can lower the levels of inflammatory factors in the liver tissue, lower lipid peroxidation, increase the activity of antioxidant enzymes, reduce the tissue damages induced by oxidative stress, and further enhance the antioxidant capacity of tissues and lower blood sugar by improving IR through multiple targets.

[136] 3. Effects of CIG on the pathological morphology of liver and pancreas of mice in each group

[137] 1) Pathological morphological changes of the mouse liver

[138] After HE staining, the morphology and changes of the liver tissue were observed under a fluorescence microscope. As shown in FIG. 2:

[139] NC group: The mouse liver is structurally intact, and the hepatocytes are radially distributed around the central vein and arranged regularly. The hepatic sinusoids are regular, the hepatocytes appear polygonal, the morphology is normal, and the cytoplasm is uniformly distributed.

[140] DM group: Mouse hepatocytes have fatty degeneration and are arranged in disorder; endolysis and plasmolysis are noted, and transparent vacuoles appear, and free fatty droplets of different sizes are accumulated in the cytoplasm.

[141] PC group: Hepatocytes are arranged in disorder, fatty degeneration is not significantly improved in the hepatocytes, and the nucleus is partially separated from the cytoplasm.

[142] CIG-L group: Fatty degeneration decreases in mouse hepatocytes, and the arrangement of hepatocytes is improved compared with the DM group, but the cytoplasmic vacuolization is more serious.

[143] CIG-M group: The mouse liver is structurally clear, the fatty degeneration and vacuolar degeneration decrease, and the plasmolysis is improved.

[144] CIG-H group: The mouse liver is structurally clear, the fatty degeneration and vacuolization are significantly reduced in hepatocytes, and the hepatocytes are regularly arranged.

[145] By comparison, the CIG has a protective effect on the diabetic mouse liver, and the middle and high dose groups are superior to the metformin group.

[146] 2) Pathological morphological changes of the mouse pancreas

[147] After HE staining, the morphology and changes of the pancreas of the mice in each group were observed under a fluorescence microscope at high magnifications. As shown in FIG. 3:

[148] NC group: In the field, the boundaries between pancreas islets and exocrine glands are clear, the pancreas islets are large in size, and the cells in the pancreas islets are numerous and arranged neatly, and the cytoplasm is uniform.

[149] DM group: In the field, the size and number of pancreas islets decrease, the pancreas islets are irregular in shape, vacuolar degeneration is noted in the cells, the pancreas islets are destroyed, and IR is serious.

[150] PC group: In the field, the boundaries between pancreas islets and exocrine glands are relatively clear, the number of islet cells increases, and the vacuolar degeneration is alleviated in the cytoplasm.

[151] CIG-L group: In the field, the boundaries between pancreas islets and exocrine glands are relatively clear, the number of islet cells mildly increases, the size is slightly enlarged, the vacuolar degeneration decreases, and the islet cells tend to be repaired.

[152] CIG-M group: In the field, the boundaries between pancreas islets and exocrine glands are relatively clear, the number of islet cells moderately increases, the size is significantly enlarged, the vacuolar degeneration is rare, and the cytoplasm is uniform.

[153] CIG-H group: In the field, the boundaries between pancreas islets and exocrine glands are clear, the pancreas islets are significantly enlarged in size, the number of cells increases significantly, the vacuolar degeneration is occasional, and the cytoplasm is relatively uniform.

[154] In this experiment, it was found by observing the histopathological sections of liver that in the DC group, the mouse liver showed obvious fatty degeneration, vacuolization, endolysis, and lipid droplet accumulation. Under light microscope, in the CIG-M and CIG-H groups, the liver was structurally clear, fatty degeneration and vacuolization were significantly reduced in hepatocytes, and the hepatocytes were arranged regularly; in the CIG-L and PC groups, improvement was not significant. It is speculated that the possible mechanism may be that lipid deposition in the liver leads to decreased sensitivity of liver and peripheral tissues to insulin or induces IR, further affecting the insulin signaling pathway. The results demonstrate that the CIG can control and improve hepatic fatty degeneration and vacuolization, indicating that the CIG has a protective effect on the liver.

[155] It was found by observing the pancreatic tissue sections of the mice in each group that, in the DC group the number and size of mouse pancreas islets significantly decreased, and the vacuolar degeneration occurred; in the CIG groups and the PC group, the decreases in the volume and number of pancreas islets were improved, and the vacuolar degeneration was alleviated; particularly, the size of pancreas islets was enlarged significantly in the CIG-H group, but there was still a certain gap compared with the NC group. The results show that the CIG can repair damaged islet cells and alleviate IR. However, it is not possible to completely reverse the pathological damage caused by high-fat and high-sugar diet assisted with multiple low-dose injections of STZ.

[156] 4. Effects of CIG on the mRNA expression of GLUT-4, INSR, P13K, and PKB in the skeletal muscle of the mice in each group

[157] The mRNA expression of GLUT-4, INSR, P13K, and PKB in skeletal muscle tissues of the mouse in each group is as shown in Table 14. Compared with the NC group, the relative mRNA expression of GLUT-4, INSR, P13K, and PKB in the skeletal muscle tissue was down regulated in the DM group (all P < 0.01). Compared with the DM group, the relative mRNA expression levels of all indexes were significantly up-regulated in the CIG and PC groups (all P < 0.01), where the CIG and PC groups were not statistically different from the NC group with respect to INSR (both P < 0.05); the relative mRNA expression of PKB and P13K was up regulated in the CIG groups compared with the PC group, but a significant difference was not reached, indicating that the CIG can up-regulate the mRNA expression of PKB, INSR, GLUT-4, and P13K in the diabetic mouse skeletal muscle.

[158] Table 14 The relative mRNA expression of PKB, INSR, GLUT-4, and P13K in skeletal muscles of the mice in each group detected by real-time PCR (n = 10, i s) Group GLUT-4 INSR P13K PKB NC 1.00±0.03^^* 1.00 0.09^^ 1.00±0.02^^"" 1.00 0.01^^"" DM 0.58±0.01**** 0.53±0.05**** 0.50±0.03**** 0.25±0.01**** PC 0.94±0.04*^^ 0.92±0.04^^ 0.87±0.05**^^ 0.72±0.02**^^

CIG 0.92±0.02**^^ 0.86±0.07^^ 0.94±0.04^^ 0.75±0.01**^^* NOTE: *P< 0.05 and **P < 0.01 versus NC group; AP < 0.05 and AAP < 0.01 versus DM group; "P< 0.05 and ""P < 0.01 versus PC group.

[159] The main causes of diabetes are insulin resistance in peripheral tissues (such as muscle and fat) and liver. Besides insulin content, IR may also be related to insulin signal transduction pathway. GLUT-4, IRS, P13K and PKB are the key target genes of insulin signal transduction pathway and glucose uptake. Any problem in any part may lead to IR. It has become a research hotspot for scholars at home and abroad to explore the IR mechanism of drug intervention from the molecular level.

[160] GLUT-4 is the main glucose transporter, which bears 50-80% of the whole body's glucose transport. Only when glucose is carried by GLUT-4 can it pass through the lipid bilayer of cell membrane and play its role. In skeletal muscle, glucose transport is an important speed limiting step of glucose metabolism. Down-regulation or up-regulation of GLUT-4 expression level can lead to decreased sensitivity to insulin in peripheral tissues or trigger IR in peripheral tissues. Under normal conditions, CLUT-4 exists on the membrane of insulin-sensitive vesicles (skeletal muscle, myocardium and fat). When stimulated by insulin, GLUT-4 can translocate from the outer membrane to the cytoplasmic membrane.

[161] INSR is the first effector molecule of insulin function, which is distributed on the cell membranes of various tissues. After reaching the corresponding target organs through blood circulation, insulin binds to INSR on the cell surface. At the same time, insulin causes phosphorylation of INSR under the action of tyrosine protein kinase, thus affecting the insulin signal transduction pathway. Therefore, enhancing the activity of INSR tyrosine kinase is an important way to improve IR.

[162] The decrease of P13K expression or activity will prevent insulin signal from being transmitted through P13K pathway, which will hinder glucose uptake and utilization and lead to IR.

[163] PKB is a key molecule in insulin signaling pathway. Through its cascade reaction, insulin can exert corresponding physiological effects, such as stimulating CLUT-4 translocation, promoting glycogen synthase synthesis, regulating glycogen synthesis and promoting glucose uptake by cells.

[164] The results of this experiment showed that the mRNA expression levels of GLUT-4, INSR, P3K, and PKB in the mouse skeletal muscle were significantly down-regulated in the DC group, indicating that the insulin signaling pathway regulating glucose metabolism was impaired, which further led to IR; the mRNA expression of GLUT-4, INSR, P13K and PKB genes in mouse skeletal muscle could be significantly up-regulated in the CIG-H and PC groups (both P < 0.01), indicating that the CIG can improve mouse IR to treat diabetes mellitus by up regulating the expression levels of key target genes in insulin signaling pathways.

[165] In conclusion, the present study explores four important IR-inducing factors, i.e., glucolipotoxicity, hepatic and skeletal muscle insulin resistance, by observing the effects of CIG on glucose and lipid metabolism, liver inflammation and oxidative stress, and mRNA expression of key target genes for skeletal muscle IR in diabetic mice, so as to provide an experimental basis for studies on the mechanism underlying that the CIG intervenes in diabetes mellitus.

[166] The term "comprise" and variants of the term such as "comprises" or "comprising" are used herein to denote the inclusion of a stated integer or stated integers but not to exclude any other integer or any other integers, unless in the context of usage an exclusive interpretation of the term is required.

SEQUENCE LISTING 17 Aug 2021

<110> Shaanxi Normal University

<120> USE OF CORNEL IRIDOID GLYCOSIDE IN RESISTING DIABETES MELLITUS

<130> GWP202106421

<160> 10

<170> PatentIn version 3.5 2021105645

<210> 1 <211> 21 <212> DNA <213> Artificial Sequence

<220> <223> Forward primer of the AKT

<400> 1 tttgggaagg tgattctggt g 21

<210> 2 <211> 24 <212> DNA <213> Artificial Sequence

<220> <223> Reverse primer of the AKT

<400> 2 cgtaaggaag ggatgcctag agtt 24

<210> 3 <211> 25 <212> DNA <213> Artificial Sequence

<220> <223> Forward primer of the INSR

<400> 3 caagaaatga ttcagatgac agcag 25

<210> 4 <211> 23 <212> DNA <213> Artificial Sequence

<220>

<223> Reverse primer of the INSR 17 Aug 2021

<400> 4 agactccatc cttcagggac tca 23

<210> 5 <211> 19 <212> DNA <213> Artificial Sequence 2021105645

<220> <223> Forward primer of the GLUT-4

<400> 5 ccccattccc tggttcatt 19

<210> 6 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Reverse primer of the GLUT-4

<400> 6 gacccatagc atccgcaac 19

<210> 7 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Forward primer of the PI3K

<400> 7 gacccatagc atccgcaac 19

<210> 8 <211> 22 <212> DNA <213> Artificial Sequence

<220> <223> Reverse primer of the PI3K

<400> 8 ctcgcaatag gttctccgct tt 22

<210> 9 17 Aug 2021

<211> 18 <212> DNA <213> Artificial Sequence

<220> <223> Forward primer of the ACTIN

<400> 9 gccttccttc ttgggtat 18 2021105645

<210> 10 <211> 19 <212> DNA <213> Artificial Sequence

<220> <223> Reverse primer of the ACTIN

<400> 10 ggcatagagg tctttacgg 19

Claims (4)

1. Use of Cornel iridoid glycoside (CIG) in the preparation of a medicament and/or a health care product for resisting diabetes mellitus; wherein the medicament and/or health care product is intended to enhance body's glucose tolerance, raise insulin sensitivity index (ISI), and lower insulin resistance index (IRI); or the medicament and/or health care product is intended to improve lipid metabolism disorder; or the medicament and/or health care product is intended to exert a hypoglycemic effect through an antioxidant mechanism; or the medicament and/or health care product is intended to lower levels of inflammatory factors interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-a), and C-reactive protein (CRP); or the medicament and/or health care product is intended to intervene in an insulin signaling pathway and improve insulin resistance (IR); or the medicament and/or health care product is intended to up-regulate mRNA expression of GLUT-4, INSR, P13K, and PKB.

2. The use according to claim 1, wherein the medicament and/or health care product is intended to lower levels of total cholesterol (T-CHO), triglyceride (TG), and low density lipoprotein (LDL).

3. The use according to claim 1, wherein the medicament and/or health care product is intended to raise high-density lipoprotein cholesterol (HDL-C) levels.

4. The use according to claim 1, wherein the medicament and/or health care product is intended to lower a level of malondialdehyde (MDA) in the liver tissue and raise a level of superoxide dismutase (SOD) in the liver tissue.

FIG. 1 －1/4－

－2/4－

FIG. 2 －3/4－

FIG. 3 －4/4－