WO2013116126A1 - Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery - Google Patents

Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery Download PDF

Info

Publication number
WO2013116126A1
WO2013116126A1 PCT/US2013/023359 US2013023359W WO2013116126A1 WO 2013116126 A1 WO2013116126 A1 WO 2013116126A1 US 2013023359 W US2013023359 W US 2013023359W WO 2013116126 A1 WO2013116126 A1 WO 2013116126A1
Authority
WO
WIPO (PCT)
Prior art keywords
dimethylamino
compound
ethyl
methyl
cyclopropyl
Prior art date
Application number
PCT/US2013/023359
Other languages
French (fr)
Inventor
Steven L. Colletti
Matthew G. Stanton
Original Assignee
Merck Sharp & Dohme Corp.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck Sharp & Dohme Corp. filed Critical Merck Sharp & Dohme Corp.
Publication of WO2013116126A1 publication Critical patent/WO2013116126A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
    • C08L91/00—Compositions of oils, fats or waxes; Compositions of derivatives thereof

Definitions

  • the present invention relates to novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides, to facilitate the cellular uptake and endosomal escape, and to knockdown target mRNA both in vitro and in vivo.
  • Cationic lipids and the use of cationic lipids in lipid nanoparticles for the delivery of oligonucleotides, in particular siRNA and miRNA have been previously disclosed.
  • Lipid nanoparticles and use of lipid nanoparticles for the delivery of oligonucleotides, in particular siRNA and miRNA has been previously disclosed.
  • Oligonucleotides (including siRNA and miRNA) and the synthesis of oligonucleotides has been previously disclosed. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US 2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060,
  • cationic lipids are disclosed in the following patent applications: US 2009/0263407, US 2009/0285881 , US 2010/0055168, US 2010/0055169, US 2010/0063135, US 2010/0076055, US 2010/0099738, US 2010/0104629, WO2010/088537, WO2010/144740, US2010/0324120, US 8,034,376, WO2011/143230, WO2011/000106, US2011/0117125, US2011/0256175, WO2011/141703, WO2011/141704 and WO201 1/141705.
  • cationic lipids such as CLinDMA and DLinDMA have been employed for siRNA delivery to the liver but suffer from non-optimal delivery efficiency along with liver toxicity at higher doses. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver.
  • the present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA.
  • the instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver.
  • the present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA.
  • the various aspects and embodiments of the invention are directed to the utility of novel cationic lipids useful in lipid nanoparticles to deliver oligonucleotides, in particular, siRNA and miRNA, to any target gene.
  • novel cationic lipids useful in lipid nanoparticles to deliver oligonucleotides, in particular, siRNA and miRNA, to any target gene.
  • WO2010/054384 WO2010/054401, WO2010/054405, WO2010/054406 and WO201 1/153493.
  • WO2010/054384 Rational design of cationic lipids for siRNA delivery, Nature Biotechnology, 2010, 28, 172-176.
  • the cationic lipids of the instant invention are useful components in a lipid nanoparticle for the delivery of oligonucleotides, specifically siRNA and miRNA.
  • R1 and R2 are independently selected from H, (Ci-C6)alkyl, heterocyclyl, and polyamine, wherein said alkyl, heterocyclyl and polyamine are optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R';
  • R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
  • R' is independently selected from halogen, R", OR", SR", CN, C0 2 R" or
  • R" is independently selected from H and (Ci-C6)alkyl, wherein said alkyl is optionally substituted with halogen and OH;
  • n 0, 1 , 2, 3, 4 or 5;
  • the invention features a compound having Formula A, wherein:
  • R and R2 are each methyl
  • n 0;
  • R is independently selected from (C-j.-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
  • Ql and Q2 are each, independently, a bond or -C(0)O, with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
  • the invention features a compound having Formula A, wherein:
  • R1 and R2 are each methyl
  • n 2;
  • R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
  • R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
  • Ql and Q2 are each, independently, a bond or -C(0)0-, with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
  • Specific cationic lipids are:
  • the cationic lipids disclosed are useful in the preparation of lipid nanoparticles.
  • the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of oligonucleotides.
  • the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA and miRNA.
  • the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA.
  • the cationic lipids of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, being included in the present invention.
  • the cationic lipids disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invention, even though only one tautomeric structure is depicted.
  • substituents and substitution patterns on the cationic lipids of the instant invention can be selected by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.
  • Si atoms can be incorporated into the cationic lipids of the instant invention by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art from readily available starting materials.
  • the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature.
  • the present invention is meant to include all suitable isotopic variations of the compounds of Formula A.
  • different isotopic forms of hydrogen (H) include protium (iH) and deuterium (2H).
  • Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples.
  • Isotopically-enriched compounds within Formula A can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by processes analogous to those described in the Scheme and Examples herein using appropriate isotopically-enriched reagents and/or intermediates.
  • alkyl means a straight chain, cyclic or branched saturated aliphatic hydrocarbon having the specified number of carbon atoms.
  • alkenyl means a straight chain, cyclic or branched unsaturated aliphatic hydrocarbon having the specified number of carbon atoms including but not limited to diene, triene and tetraene unsaturated aliphatic hydrocarbons.
  • cyclic “alkyl” or “alkenyl” examples include:
  • heterocyclyl or “heterocycle” means a 4- to 10-membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups.
  • Heterocyclyl therefore includes, the following: benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridinyl, pyridazinyl, pyridyl, pyri
  • polyamine means compounds having two or more amino groups. Examples include putrescine, cadaverine, spermidine, and spermine.
  • halogen means Br, CI, F and I.
  • Rl and R2 are independently selected from H and (Ci-C6)alkyl, wherein said alkyl is optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R'.
  • Rl and R2 are independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R * .
  • Rl and R2 are independently selected from H, methyl, ethyl and propyl.
  • Rl and R2 are each methyl.
  • R3 is independently selected from: (C4-
  • R3 is independently selected from: (C14-C18) alkenyl.
  • R3 is independently selected from: (Ci6) alkenyl.
  • R3 is independently selected from: (C14) alkenyl. In an embodiment of Formula A, R3 is independently selected from: (Ci6) alkenyl.
  • R3 is independently selected from: ( 3 ⁇ 4-
  • R3 is independently selected from: (C7)alkyl.
  • R4 is independently selected from: (Ci- C 16) alkyl or alkenyl .
  • R4 is independently selected from: (C4-C10) alkenyl.
  • R4 is independently selected from: (C9) alkenyl.
  • R4 is independently selected from: (Q- 1)
  • R4 is independently selected from: (Ci- C2)alkyl.
  • R4 is (C2)alkyl.
  • R4 is (Ci)alkyl.
  • R3 is (C7)alkyl and R4 is (C9)alkenyl.
  • R is (Ci4)alkenyl and R4 is (C2)alkyl.
  • R is (Ci6)alkenyl and R4 is (Ci)alkyl.
  • R5 is independently selected from (C4-C8) alkyl or alkenyl.
  • R5 is independently selected from (C4-C8) alkyl.
  • R5 is independently selected from (C6-C8) alkyl.
  • R5 is (C8)alkyl.
  • R6 is independently selected from (C1-C2) alkyl.
  • R6 is (C2)alkyl. In an embodiment of Formula A, R.6 is (Cl)alkyl.
  • R5 is (Cs)alkyl and R4 is (C2)alkyl.
  • R5 is (Cs)alkyl and R4 is (C])alkyl.
  • R5 is (C7)alkyl and R is (C2)alkyl.
  • R5 is (C7)alkyl and R4 is (Ci)alkyl.
  • Ql and Q2 are each, independently a bond or - C(0)0-, with the proviso that when either Q or Q is a bond then the other is not a bond.
  • R' is R".
  • R" is independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one or more halogen and OH.
  • R" is independently selected from H, methyl, ethyl and propyl.
  • n 0, 1, 2 or 3.
  • n 0, 1 or 2.
  • n 0.
  • n 1
  • n 2
  • heterocyclyl is pyrolidine, piperidine, morpholine, imidazole or piperazine.
  • "monocyclic heterocyclyl” is pyrolidine, piperidine, morpholine, imidazole or piperazine.
  • polyamine is putrescine, cadaverine, spermidine or spermine.
  • alkyl is a straight chain saturated aliphatic hydrocarbon having the specified number of carbon atoms.
  • alkenyl is a straight chain unsaturated aliphatic hydrocarbon having the specified number of carbon atoms.
  • cationic lipids of Formula A include the free form of cationic lipids of Formula A, as well as the pharmaceutically acceptable salts and stereoisomers thereof.
  • Some of the isolated specific cationic lipids exemplified herein are the protonated salts of amine cationic lipids.
  • the term "free form" refers to the amine cationic lipids in non-salt form.
  • the encompassed pharmaceutically acceptable salts not only include the isolated salts exemplified for the specific cationic lipids described herein, but also all the typical pharmaceutically acceptable salts of the free form of cationic lipids of Formula A.
  • the free form of the specific salt cationic lipids described may be isolated using techniques known in the art.
  • the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate.
  • the free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.
  • the pharmaceutically acceptable salts of the instant cationic lipids can be synthesized from the cationic lipids of this invention which contain a basic or acidic moiety by conventional chemical methods.
  • the salts of the basic cationic lipids are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents.
  • the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
  • pharmaceutically acceptable salts of the cationic lipids of this invention include the conventional non-toxic salts of the cationic lipids of this invention as formed by reacting a basic instant cationic lipids with an inorganic or organic acid.
  • conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic (
  • suitable “pharmaceutically acceptable salts” refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases.
  • Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from
  • organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, ⁇ , ⁇ 1 - dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like.
  • basic ion exchange resins such as arginine, betaine caffeine, choline,
  • the cationic lipids of the present invention are potentially internal salts or zwitterions, since under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom.
  • Synthesis of the novel cationic lipids is a linear process starting from lipid acid (i). Addition of a lipid based Grignard reagent can generate secondary alcohol (ii). This alcohol is protected as its silyl ether (iii) and the olefin is dihydroxylated with osmium tetroxide to give diol (iv). The diol is oxidatively cleaved with sodium periodate to provide aldehyde (v). The aldehyde is converted to the carboxylic acid containing olefin (vi) by a Wittig olenfination. The acid is converted to the ester (vii) in situ, followed by silyl ether deprotection to give alcohol (viii).
  • the alcohol is oxidized to the ketone (ix) which is further converted to the cyclopropane containing material (x).
  • Either ketone (ix or x) is reductively aminated to give final cationic lipids (xi or xii, respectively).
  • Synthesis of the single carbon homologated cationic lipids xv and xvi is a linear process starting from lipid ketones (ix or x). Conversion of the ketone to the nitrile (xiii or xiv) is accomplished via treatment with TOSMIC and potassium feri-butoxide. Hydrolysis of the nitrile is achieved under acidic conditions to give the primary amide. The amide is selectively reduced to the primary amine and this is reductively aminated to give amines (xv or xvi)
  • Synthesis of two carbon homologated cationic lipids xxi or xxii is a linear process starting from lipid ketone (ix or x). Conversion of the ketone to the ⁇ , ⁇ -unsaturated amide xvii or xviii is accomplished under Peterson conditions. Conjugate reduction of the ⁇ , ⁇ -unsaturation is performed to give amide xix or xx. Chemoselective reduction of the amide could provide final cationic lipids xxi or xxii.
  • Oleyl aldehyde in THF is cooled to 0 °C and treated with nonylmagnesium bromide.
  • the reaction is warmed to room temperature and quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol ii.
  • the crude product is purified by flash column chromatography.
  • Alcohol ii is taken up in dichloromethane and treated with tri ethyl amine and DMAP. To this solution is added TBDPSC1 in a single portion at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude silyl ether iii. The crude product is purified by flash column chromato graphy .
  • Silyl ether iii is taken up in a mixture of tert-butanol, THF and water and treated with osmium tetroxide and NMO.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol iv.
  • the crude product is purified by flash column chromatography.
  • Diol iv is taken up in a mixture of THF, dichloromethane, methanol and water and treated with sodium periodate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude aldehyde v. The crude product is purified by flash column chromatography.
  • Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide.
  • aldehyde v Upon reaction completion, the solution is treated with sodium bicarbonate and dimethylsulfate. The reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester vii.
  • the crude product is purified by flash column chromatography.
  • Ester vii is taken up in THF and treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol viii. The crude product is purified by flash column chromatography.
  • Alcohol viii is taken up in a mixture of DMSO and dichloromethane and treated with S03- pyridine at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ketone ix. The crude product is purified by flash column chromatography.
  • a solution of ketone ix in THF is treated with dimethylamine, titanium isopropoxide and sodium borohydride.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude amine 1.
  • the crude product is purified by flash column chromatography.
  • a solution of diethylzinc in dichloromethane is cooled to -1 °C and treated drop wise with TFA. After 30 minutes, diiodomethane is added and the resulting solution aged for 30 minutes in an ice bath. To this solution is added ketone ix and the resulting solution is warmed slowly to ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude cyclopropane x. The crude product is purified by flash column chromatography.
  • Ketone x is carried on to amine 2 as described for compound 1 above.
  • Compounds 3-48 are novel cationic lipids and are prepared according to the
  • a solution of ketone ix is treated with TOSMIC in dimethoxyethane at 0 °C followed by treatment with potassium tert-butoxide.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude nitrile xiii.
  • the crude product is purified by flash column chromatography.
  • a solution of nitrile xiii in methanol is treated with concentrated hydrochloric acid and warmed to reflux.
  • the reaction is evaporated in vacuo upon completion (conversion to primary amide).
  • the crude amide is selectively reduced by dilution in THF and treatment with zinc acetate and triethoxysilane.
  • the reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion.
  • the organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude primary amine. This material is purified by flash chromatography.
  • the primary amine is taken up in THF and treated with formaldehyde and sodium
  • Amine 50 is prepared from ketone x in a manner analogous to that outlined above for compound
  • Compounds 51 -96 are novel cationic lipids and are prepared according to the
  • the silyl amide Peterson reagent is dissolved in THF and cooled to -63°C. To this solution is added nBuLi. The reaction is warmed to ambient temperature for 30 minutes. The ketone ix is dissolved in THF in a second flask. The ketone solution is transferred to the Peterson reagent over 30 minutes while maintaining the temperature between -60°C and -40°C. The reaction is warmed to -40°C for 1 hour then warmed to 0°C for 30 minutes. The reaction is quenched with sodium bicarbonate, diluted with additional water and partitioned between water/hexanes. The organics is washed with brine, dried over sodium sulfate, filtered and evaporated in vacuo to give crude , ⁇ -unsaturated amide xvii. The crude product is purified by flash column chromatography.
  • the Copper catalyst is dissolved in toluene under nitrogen. To this is added the PMHS in a single portion. The reaction is aged for 5 minutes. To the solutions are added the ⁇ , ⁇ -unsatured amide xvii. To this mixture, the t-amyl alcohol is added over 3h via syringe pump. After the addition is complete, to the solution is added 20% NH40H to rxn in small portions. Caution: there is a vigorous effervescence and foaming in the beginning of the quench and it should be closely monitored and the ammonium hydroxide added slowly in small portions. The reaction is partitioned between water and hexanes. The organics is filtered through celite and evaporated in vacuo.
  • the resulting rubber solid material is pulverized using a mechanical stirrer in hexanes to give small particulates which is filtered and washed with hexanes.
  • the organics are then evaporated in vacuo and purified by flash chromatography to give amide xix.
  • the amide xix is selectively reduced by dilution in THF and treatment with zinc acetate and triethoxysilane.
  • the reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion.
  • the organics is dried over sodium sulfate, filtered and evaporated in vacuo to give crude amine 97. This material is purified by flash
  • Amine 98 is prepared from ketone x in a manner analogous to that outlined above for compound 97.
  • a solution of acid xxiii and C9-alcohol in DMF is treated with EDCI and diisopropylethylamine.
  • Compound 146 is prepared in a manner analogous to that described above for compound 145 employing the cyclopropanation chemistry as described for compound 2 above.
  • Compounds 147- 162 are novel cationic lipids and are prepared according to General Schemes 1-4 above.
  • a solution of acid xxix in THF is treated with sodium bicarbonate and dimethylsulfate.
  • the solution is warmed to ambient temperature.
  • the reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion.
  • the organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto-ester xxx. This material is purified by flash chromatography.
  • Ketone xxx is carried forward to amine 163 in a manner analogous to that described above for compound 1.
  • Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide.
  • aldehyde xxxv Upon reaction completion, the solution is treated with sodium bicarbonate and dimethylsulfate. The reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester xxxvii.
  • the crude product is purified by flash column chromatography.
  • a solution of silyl ether xxxvii in THF is treated with TBAF.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol.
  • the crude product is purified by flash column chromatography.
  • a solution of alcohol in DMF is treated with pyridinium dichromate.
  • the reaction is quenched with water upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid xxxviii.
  • the crude product is purified by flash column chromatography.
  • a solution of acid xxxviii in THF is treated with sodium bicarbonate and dimethyl sulfate.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diester xxxix.
  • the crude product is purified by flash column chromatography.
  • Ketone xxxix is converted to amine 175 in a manner analogous to that described for compound 1.
  • Diesters similar to compound 175 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.
  • a solution of acid XLVI in dichloromethane is treated with C9 alcohol and EDCI and diisopropylethylamine.
  • the reaction is quenched with aqueous bicarbonate solution upon completion.
  • the reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto ester XLVII.
  • the crude product is purified by flash column chromatography.
  • Ketone XLVII is converted to amine 176 in a manner analogous to that described for compound 175 above.
  • Diesters similar to compound 176 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.
  • lipid nanoparticle compositions of the instant invention are useful for the delivery of oligonucleotides, specifically siRNA and miRNA:
  • the Lipid Nano-Particles is prepared by an impinging jet process.
  • the particles are formed by mixing lipids dissolved in alcohol with siRNA dissolved in a citrate buffer.
  • the mixing ratio of lipids to siRNA are targeted at 45-55% lipid and 65-45% siRNA.
  • the lipid solution can contain a novel cationic lipid of the instant invention, a helper lipid (cholesterol) , PEG (e.g. PEG-C-DMA, PEG-DMG) lipid, and DSPC at a concentration of 5-15 mg/mL with a target of 9-12 mg/mL in an alcohol (for example ethanol).
  • the ratio of the lipids can have a mole percent range of 25-98 for the cationic lipid with a target of 35-65
  • the helper lipid can have a mole percent range from 0-75 with a target of 30-50
  • the PEG lipid can have a mole percent range from 1-15 with a target of 1-6
  • the DSPC can have a mole precent range of 0-15 with a target of 0-12.
  • the siRNA solution can contain one or more siRNA sequences at a concentration range from 0.3 to 1 .0 mg/mL with a target of 0.3 -0.9 mg/mL in a sodium citrate buffered salt solution with pH in the range of 3.5-5.
  • the two liquids are heated to a temperature in the range of 15-40°C, targeting 30-40°C, and then mixed in an impinging jet mixer instantly foraiing the LNP.
  • the teelD can have a range from 0.25 to 1.0 mm and a total flow rate from 10 -600 mL/min.
  • the combination of flow rate and tubing ID can have the effect of controlling the particle size of the LNPs between 30 and 200 nm.
  • the solution can then be mixed with a buffered solution at a higher pH with a mixing ratio in the range of 1 : 1 to 1 :3 vol: vol but targeting 1 :2 vol: vol. This buffered solution is at a temperature in the range of 15-40°C, targeting 30-40°C.
  • the mixed LNPs are held from 30 minutes to 2 hrs prior to an anion exchange filtration step.
  • the temperature during incubating is in the range of 15-40°C, targeting 30-40°C.
  • the solution is filtered through a 0.8 um filter containing an anion exchange separation step.
  • This process can use tubing IDs ranging from 1 mm ID to 5 mm ID and a flow rate from 10 to 2000 mL/min.
  • the LNPs are concentrated and diafiltered via an ultrafiltration process where the alcohol is removed and the citrate buffer is exchanged for the final buffer solution such as phosphate buffered saline.
  • the ultrafiltration process can use a tangential flow filtration format (TFF).
  • This process can use a membrane nominal molecular weight cutoff range from 30 -500 KD.
  • the membrane format is hollow fiber or flat sheet cassette.
  • the TFF processes with the proper molecular weight cutoff can retain the LNP in the retentate and the filtrate or permeate contains the alcohol; citrate buffer; final buffer wastes.
  • the TFF process is a multiple step process with an initial concentration to a siRNA concentration of
  • the LNPs solution is diafiltered against the final buffer for 10 -20 volumes to remove the alcohol and perform buffer exchange. The material can then be concentrated an additional 1 -3 fold.
  • the final steps of the LNP process are to sterile filter the concentrated LNP solution and vial the product.
  • siRNA duplex concentrations are determined by Strong Anion-Exchange High-Performance Liquid Chromatography (SAX-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a 2996 PDA detector.
  • the LNPs otherwise referred to as RNAi Delivery Vehicles (RDVs)
  • RDVs RNAi Delivery Vehicles
  • SAX separation using a Dionex BioLC DNAPac PA 200 (4 x 250 mm) column with UV detection at 254 nm.
  • Mobile phase is composed of A: 25 mM NaC10 4 , 10 mM Tris, 20% EtOH, pH 7.0 and B: 250 mM NaC10 4 , 10 mM Tris, 20% EtOH, pH 7.0 with liner gradient from 0-15 min and flow rate of 1 ml/min.
  • the siRNA amount is determined by comparing to the siRNA standard curve.
  • Fluorescence reagent SYBR Gold is employed for RNA quantitation to monitor the encapsulation rate of RDVs.
  • RDVs with or without Triton X-l 00 are used to determine the free siRNA and total siRNA amount.
  • the assay is performed using a SpectraMax M5e microplate spectrophotometer from Molecular Devices (Sunnyvale, CA). Samples are excited at
  • siRNA amount is determined by comparing to the siRNA standard curve.
  • Encapsulation rate (1- free siRNA/total siRNA) xl00%
  • RDVs containing 1 ⁇ g siRNA are diluted to a final volume of 3 ml with 1 x PBS.
  • the particle size and polydispersity of the samples is measured by a dynamic light scattering method using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, NY). The scattered intensity is measured with He-Ne laser at 25°C with a scattering angle of 90°. 4) Zeta Potential analysis
  • RDVs containing 1 ⁇ g siRNA are diluted to a final volume of 2 ml with 1 mM Tris buffer (pH 7.4). Electrophoretic mobility of samples is determined using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, NY) with electrode and He-Ne laser as a light source. The Smoluchowski limit is assumed in the calculation of zeta potentials.
  • lipid concentrations is determined by Reverse Phase High- Performance Liquid Chromatography (RP-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a Corona charged aerosol detector (CAD) (ESA Biosciences, Inc, Chelmsford, MA). Individual lipids in RDVs are analyzed using an Agilent Zorbax SB-C18
  • the mobile phase is composed of A: 0.1% TFA in H 2 0 and B: 0.1% TFA in IPA.
  • the gradient can change from 60% mobile phase A and 40% mobile phase B from time 0 to 40% mobile phase A and 60%) mobile phase B at 1.00 min; 40% mobile phase A and 60% mobile phase B from 1.00 to 5.00 min; 40% mobile phase A and 60% mobile phase B from 5.00 min to 25% mobile phase A and 75% mobile phase
  • the individual lipid concentration is determined by comparing to the standard curve with all the lipid components in the RDVs with a quadratic curve fit. The molar percentage of each lipid is calculated based on its molecular weight.
  • Oligonucleotide synthesis is well known in the art. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US
  • siRNAs disclosed and utilized in the Examples are synthesized via standard solid phase procedures.
  • LNPs utilizing Compounds 1-176, in the nominal compositions described immediately above, are evaluated for in vivo efficacy.
  • the siRNA can target the mRNA transcript for the firefly (Photinus pyralis) luciferase gene (Accession # Ml 5077).
  • the primary sequence and chemical modification pattern of the luciferase siRNA is displayed above.
  • the in vivo luciferase model employs a transgenic mouse in which the firefly luciferase coding sequence is present in all cells.
  • ROSA26- LoxP-Stop-LoxP-Luc (LSL- Luc) transgenic mice licensed from the Dana Farber Cancer Institute are induced to express the Luciferase gene by first removing the LSL sequence with a recombinant Ad-Cre virus (Vector Biolabs). Due to the organo-tropic nature of the virus, expression is limited to the liver when delivered via tail vein injection. Luciferase expression levels in liver are quantitated by measuring light output, using an IVIS imager (Xenogen) following administration of the luciferin substrate (Caliper Life Sciences). Pre-dose luminescence levels is measured prior to administration of the RDVs.
  • Luciferin in PBS 15mg/mL is intraperitoneally (IP) injected in a volume of 150 ⁇ ⁇ . After a four minute incubation period mice are anesthetized with isoflurane and placed in the IVIS imager. The RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 0.2 mL. Final dose levels can range from 0.1 to 0.5 mg/kg siRNA. PBS vehicle alone is dosed as a control. Mice are imaged 48 hours post dose using the method described above. Changes in luciferin light output directly correlate with luciferase mRNA levels and represent an indirect measure of luciferase siRNA activity. In vivo efficacy results are expressed as % inhibition of luminescence relative to pre-dose luminescence levels. EXAMPLE 2
  • LNPs are incubated at 37°C in 90% rhesus serum at a final LNP concentration of 4ug/mL. Incubation is for 20 minutes with orbital rotation. After incubation, the samples are diluted 1 :20 in PBS and 100 iL of each diluted sample is aliquoted to wells of an anti-PEG antibody coated 96-well plate (Life Diagnostics Cat. No. P-0001PL. After incubation at room temperature for 1 hour, the plate is washed 5X with 300uL PBS. After washing, 50uL of 0.2% Triton X-100 is added to each well and the plate incubated at 37°C for 10 minutes, followed by shaking on a plate shaker for 1 minute at 750 rpm. Samples are frozen prior to performing the ApoE ELISA and stem loop PCR analysis of samples.
  • An ApoE ELISA assay is performed to quantitate ApoE bound to the LNPs after incubation in rhesus serum.
  • Anti-ApoE antibody (Milipore, Cat No. AB947) is diluted 1 : 1000 in PBS and 100 xL of diluted antibody is added to each well of a polystyrene high binding plate. The plate with antibody is incubated overnight at 4°C, after which the plate is washed 2X with 200 ⁇ of PBS. Next, 200 ⁇ of buffer containing 1% BSA and 0.05% Tween-20 in PBS
  • E887-biotin diluted 1 :500 in incubation buffer, is added to each well and incubated for 1 hour at room temperature, followed by a 5X wash with 0.05% Tween-20 in PBS.
  • 100 xL per well, of Streptavidin-HPR (Thermo, Cat. No. TS- 125-HR) is then added and incubated for 1 hour at room temperature.
  • ⁇ of TMB Substrate (Thermo, Cat. No. 34028) is added to each well, followed by incubation at room temperature for 20 minutes in the dark. The colorimetric reaction is stopped with ⁇ of TMB Stop Solution (KPL, Cat. No.
  • An ApoE standard curve is prepared by diluting rhesus Recombinant ApoE in incubation buffer with 0.03%> Triton X-100 with concentrations ranging from 100 ng/mL to 0.78 ng/mL. ApoE standards are evaluated in the ELISA in parallel to the test samples. A rhesus serum only (no LNP) control is utilized to obtain a background subtraction for non-LNP dependent ApoE signal in the ELISA.
  • the amount of siRNA retained in the anti-PEG antibody well is quantitated by stem-loop PCR and related to the number of siRNAs encapsulated per LNP, to give an approximate measure of total LNP particles bound per well.
  • the standard curve is prepared using the molecular weight of the siRNA (13693 g/mol for ApoB 17063) to calculate the copy number.
  • the high standard should contain 10 11 copies per 3 ⁇ 1.
  • a 10-fold serial dilution is performed across a row of an assay plate until the lowest standard contains 10 2 copies per 3 ⁇ 1.
  • Triton lysates from the PEG antibody plate capture is diluted 1 to 2000 in nuclease free water. 10 ⁇ of 'RT-Primer Mix' (Applied Biosystem's TaqMan MicroRNA Reverse Transcription Kit Cat. No. 4366596) is added to each well of a 96-well Micro-Amp QPCR plate (ABI Cat# N801-0560).
  • ApoB RT primer sequence 5' GTCGTATCCAGTGCAGGGTCCGAGGTA
  • ⁇ ⁇ , of each test sample (diluted 1 to 2000) or spiked standard curve (above) is aliquoted into the 96-well plate.
  • the plate is covered with a mat (ABI Cat. No. N801-0550), to minimize evaporation.
  • the plate is briefly centrifuged at 800 rpm for 1 minute.
  • the plate is run on a thermocycler using the following cycling parameters:
  • the RT cycling reaction is composed of ⁇ 0 L test sample, ⁇ ⁇ ⁇ of RT primer mix and 10 ⁇ ., of RT Mix components for a total volume of 3Q ⁇ L.
  • the final concentration of the RT-primer in the total 30 ⁇ , total RT mix is 200nM.
  • the plate is then sealed with the same plate mat, briefly centrifuged at 800 rpm for 1 minute, then run on the thermocycler using the following cycling parameters:
  • the QPCR result is utilized to calculate the siRNA concentration in the PEG antibody capture plate Triton lysates. Based on an estimate of 500 siRNA per LNP particle, the number of LNPs retained in each well of the anti-PEG antibody plate can be calculated. Using the ApoE concentration per well, as determined by the ApoE ELISA and the number of LNP particles per well, an approximate ApoE molecules bound per LNP particle can be calculated.
  • Lipid nanoparticles (LNP) with neutral surface charge are not retained after injection onto heparin sepharose with IX Dulbecco's phosphate buffered saline (DPBS) as the running buffer but elute in the column void volume.
  • Serum apolipoprotein E (ApoE) exhibits high affinity binding with heparin sulfate and it can be shown that LNPs bind to heparin sepharose to an extent dependent on their intrinsic ability to bind ApoE (depending on both lipid nanoparticle composition and ApoE concentration) after incubation with purified and/or recombinant human ApoE or serum samples.
  • Lipid nanoparticles with surface bound ApoE bind to heparin sepharose with high affinity can be eluted only at high salt (1M NaCl).
  • a heparin sepharose binding assay is developed to assess serum ApoE binding to lipid nanoparticles based on the high affinity interaction that ApoE-LNP complexes exhibit toward heparin sepharose.
  • Lipid nanoparticles are incubated at 37°C for 20 min at a final siRNA concentration of 50 ⁇ g/mL with various concentrations of either purified or recombinant human apolipoprotein E or 0.1-50% rat/mouse/rhesus monkey/human serum in IX Dulbecco's phosphate buffered saline (DPBS). After incubation with ApoE or serum LNP samples are diluted 10-fold using IX DPBS and analyzed by heparin sepharose chromatography.
  • DPBS IX Dulbecco's phosphate buffered saline
  • Peak area of retained LNP (after subtraction of appropriate blank signals) is compared to total peak area of LNP control without ApoE and/or serum incubation to determine the percentage of the LNP which undergoes shift to high affinity heparin interaction after incubation with ApoE/serum.
  • a heparin sepharose HI-TRAPTM chromatography column (GE Healthcare; 1 mL bed volume) is equilibrated with either IX or 2X Dulbecco's PBS; the higher 2X salt concentration is used for LNPs with higher intrinsic retention on heparin sepharose (presumably due to higher positive surface charge).
  • LNPs utilizing compounds in the nominal compositions described above are evaluated for in vivo efficacy and increases in alanine amino transferase and aspartate amino transferase in Sprague-Dawley (Crl:CD(SD) female rats (Charles River Labs).
  • the siRNA targets the mRNA transcript for the ApoB gene (Accession # NM 019287).
  • the primary sequence and chemical modification pattern of the ApoB siRNA is displayed above.
  • the RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 1 to 1.5 mL. Infusion rate is approximately 3 ml/min. Five rats are used in each dosing group. After LNP
  • rats are placed in cages with normal diet and water present. Six hours post dose, food is removed from the cages. Animal necropsy is performed 24 hours after LNP dosing. Rats are anesthetized under isoflurane for 5 minutes, then maintained under anesthesia by placing them in nose cones continuing the delivery of isoflurane until ex-sanguination is completed. Blood is collected from the vena cava using a 23 gauge butterfly venipuncture set and aliquoted to serum separator vacutainers for serum chemistry analysis. Punches of the excised caudate liver lobe is taken and placed in RNALater (Ambion) for mRNA analysis.
  • RNALater RNALater
  • liver tissue is homogenized and total RNA isolated using a Qiagen bead mill and the Qiagen miRNA-Easy RNA isolation kit following the manufacturer's instructions. Liver ApoB mRNA levels are determined by quantitative RT-PCR. Message is amplified from purified RNA utilizing a rat
  • ApoB commercial probe set (Applied Biosystems Cat # RN01499054_ml).
  • the PCR reaction is performed on an ABI 7500 instrument with a 96-well Fast Block.
  • the ApoB mRNA level is normalized to the housekeeping PPIB (NM 011149) mRNA.
  • PPIB mRNA levels are determined by RT-PCR using a commercial probe set (Applied Biosytems Cat. No. Mm00478295_ml). Results are expressed as a ratio of ApoB mRNA/ PPIB mRNA. All mRNA data is expressed relative to the PBS control dose.
  • Serum ALT and AST analysis is performed on the Siemens Advia 1800 Clinical Chemistry Analyzer utilizing the Siemens alanine aminotransferase (Cat# 03039631) and aspartate aminotransferase (Cat# 03039631) reagents.
  • Liver tissue is weighed into 20-ml vials and homogenized in 9 v/w of water using a GenoGrinder 2000 (OPS Diagnostics, 1600 strokes/min, 5min). A 50 aliquot of each tissue homogenate is mixed with 300 ⁇ ⁇ of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 ⁇ of each supernatant is then transferred to separate wells of a 96-well plate and 10 ⁇ samples were directly analyzed by LC/MS-MS.
  • OPS Diagnostics 1600 strokes/min, 5min.
  • a 50 aliquot of each tissue homogenate is mixed with 300 ⁇ ⁇ of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 ⁇ of each supernatant is then transferred to separate wells of
  • Standards are prepared by spiking known amounts of a methanol stock solution of compound into untreated rat liver homogenate (9 vol water/weight liver). Aliquots (50 ⁇ ) each standard/liver homogenate is mixed with 300 ⁇ ⁇ of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 ⁇ , of each supernatant is transferred to separate wells of a 96-well plate and 10 ⁇ of each standard is directly analyzed by LC/MS-MS.
  • Absolute quantification versus standards prepared and extracted from liver homogenate is performed using an Aria LX-2 HPLC system (Thermo Scientific) coupled to an API 4000 triple quadrupole mass spectrometer (Applied Biosystems). For each run, a total of 10 ⁇ , sample is injected onto a BDS Hypersil C8 HPLC column (Thermo, 50 x 2mm, 3 ⁇ ) at ambient temperature.
  • LNPs utilizing compounds in the nominal compositions described above are evaluated for in vivo efficacy in male or female Macaca mulatta (rhesus) monkeys.
  • the siRNA targets the mRNA transcript for the ApoB gene (Accession # XM 001097404).
  • the primary sequence and chemical modification pattern of the ApoB siRNA is displayed above.
  • the RDVs (containing siRNA) in PBS vehicle are administered by intravenous injection in the saphenous vein at an injection rate of 20 mL/minute to a dose level of 0.25 mg/kilogram siRNA.
  • the injection volumes are from 1.9 to 2.1 niL/kilogram and monkeys can range in weight from 2.5 to 4.5 kilograms.
  • the RDV or PBS control is administered to three monkeys.
  • liver biopsy samples ( ⁇ 0.5-l gram/sample) are collected from male rhesus monkeys by laparoscopic surgical resection (resection of one biopsy sample from outer edge of one randomly selected liver lobe per monkey). A 5 mm tissue punch is used to sample three non-adjacent ⁇ 50 mg samples from each predose biopsy. Samples are preserved in RNAlaterTM (Ambion) for later CTNNB1 mRNA analysis.
  • liver biopsy samples ( ⁇ 0.5-l gram/sample) are collected from monkeys by laparoscopic surgical resection (2 separate randomly selected liver lobes were resected per monkey). A 5 mm tissue punch is used to sample three non-adjacent ⁇ 50 mg samples per each 48 hr and 168 hr surgical biopsy sample. Samples are preserved in RNAlaterTM (Ambion) for later CTNNBl mRNA analysis.
  • CTNNBl mRNA levels are measured by relative quantitative RT-PCR using a primer/probe set validated for CTNNBl and normalized against mRNA levels of peptidylprolyl isomerase B (also known as PPIB or cyclophilin B) and RNA levels of 18S ribosomal RNA (18S rRNA) .
  • Change in CTNNBl mRNA liver expression are measured as the difference in PCR threshold cycle number (AACt) between post-dose samples and each corresponding monkey's predose liver samples.
  • AACt PCR threshold cycle number
  • mRNA (% knockdown) 100- (100/2 " Ct )
  • ALT Alanine aminotransferase
  • serum that is harvested from clotted monkey whole blood after centrifugation.
  • a Roche Modular System automated chemistry analyzer measures the enzymatic activity of ALT in the serum by using International Federation of Clinical Chemistry standardized procedures and reagents.
  • the analyzer's computer uses absorbance measurements to calculated ALT activity in the sample as compared to a standard curve. The ALT activity is reported in International Units per Liter (IU/L).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Preparation (AREA)
  • Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA.

Description

TITLE OF THE INVENTION
NOVEL LOW MOLECULAR WEIGHT, BIODEGRADABLE CATIONIC LIPIDS FOR OLIGONUCLEOTIDE DELIVERY
BACKGROUND OF THE INVENTION
The present invention relates to novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides, to facilitate the cellular uptake and endosomal escape, and to knockdown target mRNA both in vitro and in vivo.
Cationic lipids and the use of cationic lipids in lipid nanoparticles for the delivery of oligonucleotides, in particular siRNA and miRNA, have been previously disclosed. Lipid nanoparticles and use of lipid nanoparticles for the delivery of oligonucleotides, in particular siRNA and miRNA, has been previously disclosed. Oligonucleotides (including siRNA and miRNA) and the synthesis of oligonucleotides has been previously disclosed. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US 2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060,
WO2009/132131 , WO2010/042877, WO2010/054384, WO2010/054401 , WO2010/054405, WO2010/054406 and WO201 1/153493). See also Semple S. C. et al, Rational design of cationic lipids for siRNA delivery, Nature Biotechnology, 2010, 28, 172-176.
Other cationic lipids are disclosed in the following patent applications: US 2009/0263407, US 2009/0285881 , US 2010/0055168, US 2010/0055169, US 2010/0063135, US 2010/0076055, US 2010/0099738, US 2010/0104629, WO2010/088537, WO2010/144740, US2010/0324120, US 8,034,376, WO2011/143230, WO2011/000106, US2011/0117125, US2011/0256175, WO2011/141703, WO2011/141704 and WO201 1/141705.
Traditional cationic lipids such as CLinDMA and DLinDMA have been employed for siRNA delivery to the liver but suffer from non-optimal delivery efficiency along with liver toxicity at higher doses. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA. SUMMARY OF THE INVENTION
The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA.
DETAILED DESCRIPTION OF THE INVENTION
The various aspects and embodiments of the invention are directed to the utility of novel cationic lipids useful in lipid nanoparticles to deliver oligonucleotides, in particular, siRNA and miRNA, to any target gene. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US 2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060, WO2009/132131, WO2010/042877,
WO2010/054384, WO2010/054401, WO2010/054405, WO2010/054406 and WO201 1/153493). See also Semple S. C. et al., Rational design of cationic lipids for siRNA delivery, Nature Biotechnology, 2010, 28, 172-176.
The cationic lipids of the instant invention are useful components in a lipid nanoparticle for the delivery of oligonucleotides, specifically siRNA and miRNA.
In a first embodiment of this invention, the cationic lipids are illustrated by the
Formula A:
Figure imgf000003_0001
A wherein:
R1 and R2 are independently selected from H, (Ci-C6)alkyl, heterocyclyl, and polyamine, wherein said alkyl, heterocyclyl and polyamine are optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R';
R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
Ql and Q2 are each, independently, a bond, -OC(O)-, -C(0)0-, -SC(O)-, -C(0)S- , -OC(S)-, -S-S-, -C(R")=N-, -N=C(R")-, -C(R")=N-0-, -0-N=C(R")-, -C(0)(NR")-, - N(R")C(0)-, C(S)(NR")-, -N(R")C(0)-, -N(R")C(0)N(R")-, -OC(0)0-, OSi(R")20-, -
C(0)(CR"2)C(0)0-, or -OC(0)(CR"2)C(0)-), with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
R' is independently selected from halogen, R", OR", SR", CN, C02R" or
CON(R")2;
R" is independently selected from H and (Ci-C6)alkyl, wherein said alkyl is optionally substituted with halogen and OH;
n is 0, 1 , 2, 3, 4 or 5;
or any pharmaceutically acceptable salt or stereoisomer thereof.
In a second embodiment, the invention features a compound having Formula A, wherein:
R and R2 are each methyl;
n is 0;
R is independently selected from (C-j.-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R'; R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
Ql and Q2 are each, independently, a bond or -C(0)O, with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
or any pharmaceutically acceptable salt or stereoisomer thereof.
In a third embodiment, the invention features a compound having Formula A, wherein:
R1 and R2 are each methyl;
n is 2;
R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C1 -C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
Ql and Q2 are each, independently, a bond or -C(0)0-, with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
or any pharmaceutically acceptable salt or stereoisomer thereof.
Specific cationic lipids are:
methyl (9Z)-19-(dimethylamino)octacos-9-enoate (Compound 1);
methyl 8-{2-[9-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 2);
methyl (9Z)-19-(dimethylamino)heptacos-9-enoate (Compound 3);
methyl (9Z)-19-(dimethylamino)hexacos-9-enoate (Compound 4);
methyl (9Z)-19-(dimethylamino)pentacos-9-enoate (Compound 5);
methyl (9Z)-21-(dimethylamino)triacont-9-enoate (Compound 6);
methyl (9Z)-21-(dimethylamino)nonacos-9-enoate (Compound 7);
methyl (9Z)-21-(dimethylamino)octacos-9-enoate (Compound 8); methyl (9Z)-21-(dimethylamino)heptacos-9-enoate (Compound 9);
methyl (1 lZ)-19-(dimethylamino)octacos-l 1-enoate (Compound 10);
methyl (7Z)-19-(dimethylamino)octacos-7-enoate (Compound 11);
methyl 8-{2-[9-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 12); methyl 8-{2-[9-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 13); methyl 8-{2-[9-(dimethylamino)pentadecyl]cyclopropyl}octanoate (Compound 14); methyl 8-{2-[l l-(dimethylamino)icosyl]cyclopropyl}octanoate (Compound 15); methyl 8-{2-[l l-(dimethylamino)nonadecyl]cyclopropyl}octanoate (Compound 16); methyl 8-{2-[l l-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 17); methyl 8-{2-[l l-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 18); methyl 10- {2-[7-(dimethylamino)hexadecyl]cyclopropyl}decanoate (Compound 19); methyl 6-{2-[l l-(dimethylamino)icosyl]cyclopropyl}hexanoate (Compound 20); ethyl (7Z)-17-(dimethylamino)hexacos-7-enoate (Compound 21);
ethyl (7Z)-17-(dimethylamino)pentacos-7-enoate (Compound 22);
ethyl (7Z)-17-(dimethylamino)tetracos-7-enoate (Compound 23);
ethyl (7Z)-17-(dimethylamino)tricos-7-enoate (Compound 24);
ethyl (9Z)-17-(dimethylamino)hexacos-9-enoate (Compound 25);
ethyl (5Z)-17-(dimethylamino)hexacos-5-enoate (Compound 26);
ethyl (9Z)-19-(dimethylamino)octacos-9-enoate (Compound 27);
ethyl (9Z)-19-(dimethylamino)heptacos-9-enoate (Compound 28);
ethyl (9Z)-19-(dimethylamino)hexacos-9-enoate (Compound 29);
ethyl (9Z)-19-(dimethylamino)pentacos-9-enoate (Compound 30);
ethyl (9Z)-21-(dimethylamino)triacont-9-enoate (Compound 31);
ethyl (9Z)-21-(dimethylamino)nonacos~9-enoate (Compound 32);
ethyl (9Z)-21-(dimethylamino)octacos-9-enoate (Compound 33);
ethyl (9Z)-21-(dimethylamino)heptacos-9-enoate (Compound 34);
ethyl 6- {2-[9-(dimethylamino)octadecyl]cyclopropyl}hexanoate (Compound 35); ethyl 6- {2-[9-(dimethylamino)heptadecyl]cyclopropyl}hexanoate (Compound 36); ethyl 6- {2-[9-(dimethylamino)hexadecyl]cyclopropyl}hexanoate (Compound 37); ethyl 6- {2-[9-(dimethylamino)pentadecyl]cyclopropyl}hexanoate (Compound 38); ethyl 8- {2-[7-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 39); ethyl 4- {2-[l l-(dimethylamino)icosyl]cyclopropyl}butanoate (Compound 40);
ethyl 8- {2-[9-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 41); ethyl 8-{2-[9-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 42);
ethyl 8-{2-[9-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 43);
ethyl 8-{2-[9-(dimethylamino)pentadecyl]cyclopropyl}octanoate (Compound 44);
ethyl 8-{2-[l l-(dimethylamino)icosyl]cyclopropyl}octanoate (Compound 45);
ethyl 8-{2-[l 1 -(dimethyl amino)nonadecyl]cyclopropyl}octanoate (Compound 46);
ethyl 8-{2-[l l-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 47);
ethyl 8- {2-[l l-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 48);
methyl (9Z)-19-[(dimethylamino)methyl]octacos-9-enoate (Compound 49);
methyl 8-(2- {9-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 50); methyl (9Z)- 19-[(dimethylamino)methyl]heptacos-9-enoate (Compound 51);
methyl (9Z)-19-[(dimethylamino)methyl]hexacos-9-enoate (Compound 52);
methyl (9Z)-19-[(dimethylamino)methyl]pentacos-9-enoate (Compound 53);
methyl (9Z)-21-[(dimethylamino)methyl]triacont-9-enoate (Compound 54);
methyl (9Z)-21-[(dimethylamino)methyl]nonacos-9-enoate (Compound 55);
methyl (9Z)-21-[(dimethylamino)methyl]octacos-9-enoate (Compound 56);
methyl (9Z)-21 -[(dimethylamino)methyl]heptacos-9-enoate (Compound 57);
methyl (HZ)-19-[(dimethylamino)methyl]octacos-l l-enoate (Compound 58);
methyl (7Z)-19-[(dimethylamino)methyl]octacos-7-enoate (Compound 59);
methyl 8-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 60); methyl 8-(2- {9-[(dimethylamino)methyl]hexadecyl } cyclopropyl)octanoate (Compound 61); methyl 8-(2-{9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)octanoate (Compound 62); methyl 8-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)octanoate (Compound 63); methyl 8-(2-{l l-[(dimethylamino)methyl]nonadecyl}cyclopropyl)octanoate (Compound 64); methyl 8-(2-{l l-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 65); methyl 8-(2-{l l-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 66); methyl 10-(2-{7-[(dimethylamino)methyl]hexadecyl}cyclopropyl)decanoate (Compound 67); methyl 6-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)hexanoate (Compound 68); ethyl (7Z)-17-[(dimethylamino)methyl]hexacos-7-enoate (Compound 69);
ethyl (7Z)-17-[(dimethylamino)methyl]pentacos-7-enoate (Compound 70);
ethyl (7Z)-17-[(dimethylamino)methyl]tetracos-7-enoate (Compound 71);
ethyl (7Z)-17-[(dimethylamino)methyl]tricos-7-enoate (Compound 72);
ethyl (9Z)-17-[(dimethylamino)methyl]hexacos-9-enoate (Compound 73);
ethyl (5Z)-17-[(dimethylamino)methyl]hexacos-5-enoate (Compound 74); ethyl (9Z)-19-[(dimethylamino)methyl]octacos-9-enoate (Compound 75);
ethyl (9Z)-19-[(dimethylamino)methyl]heptacos-9-enoate (Compound 76);
ethyl (9Z)-19-[(dimethylamino)methyl]hexacos-9-enoate (Compound 77);
ethyl (9Z)-19-[(dimethylamino)methyl]pentacos-9-enoate (Compound 78);
ethyl (9Z)-21-[(dimethylamino)methyl]triacont-9-enoate (Compound 79);
ethyl (9Z)-21-[(dimethylamino)methyl]nonacos-9-enoate (Compound 80);
ethyl (9Z)-21-[(dimethylamino)methyl]octacos-9-enoate (Compound 81);
ethyl (9Z)-21-[(dimethylamino)methyl]heptacos-9-enoate (Compound 82);
ethyl 6-(2- {9-[(dimethylamino)methyl]octadecyl}cyclopropyl)hexanoate (Compound 83); ethyl 6-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)hexanoate (Compound 84); ethyl 6-(2-{9-[(dimethylamino)methyl]hexadecyl}cyclopropyl)hexanoate (Compound 85); ethyl 6-(2-{9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)hexanoate (Compound 86); ethyl 8-(2-{7-[(dimethylamino)methyl]hexadecyl}cyclopropyl)octanoate (Compound 87); ethyl 4-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)butanoate (Compound 88); ethyl 8-(2-{9-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 89); ethyl 8-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 90); ethyl 8-(2-{9-[(dimethylamino)methyl]hexadecyl}cyclopropyl)octanoate (Compound 91); ethyl 8-(2- {9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)octanoate (Compound 92); ethyl 8-(2- {l l-[(dimethylamino)methyl]icosyl}cyclopropyl)octanoate (Compound 93); ethyl 8-(2-{l l-[(dimethylamino)methyl]nonadecyl}cyclopropyl)octanoate (Compound 94); ethyl 8-(2-{l l-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 95); ethyl 8-(2-{l l-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 96); methyl (9Z)-19-[2-(dimethylamino)ethyl]octacos-9-enoate (Compound 97);
methyl 8-(2-{9-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 98); methyl (9Z)-19-[2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 99);
methyl (9Z)-19-[2-(dimethylamino)ethyl]hexacos-9-enoate (Compound 100);
methyl (9Z)-19-[2-(dimethylamino)ethyl]pentacos-9-enoate (Compound 101);
methyl (9Z)-21-[2-(dimethylamino)ethyl]triacont-9-enoate (Compound 102);
methyl (9Z)-21-[2-(dimethylamino)ethyl]nonacos-9-enoate (Compound 103);
methyl (9Z)-21-[2-(dimethylamino)ethyl]octacos-9-enoate (Compound 104);
methyl (9Z)-21-[2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 105);
methyl (l lZ)-19-[2-(dimethylamino)ethyl]octacos-l l-enoate (Compound 106);
methyl (7Z)-19-[2-(dimethylamino)ethyl]octacos-7-enoate (Compound 107); methyl 8-(2-{9-[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 108); methyl 8-(2-{9-[2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)octanoate (Compound 109); methyl 8-(2-{9-[2-(dimethylamino)ethyl]pentadecyl}cyclopropyl)octanoate (Compound 110); methyl 8-(2-{ 1 l-[2-(dimethylamino)ethyl]icosyl}cyclopropyl)octanoate (Compound 11 1); methyl 8-(2- { 1 l-[2-(dimethylamino)ethyl]nonadecyl}cyclopropyl)octanoate (Compound 112); methyl 8-(2- { 1 l-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 113); methyl 8-(2- { 1 l-[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 114); methyl 10-(2- {7-[2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)decanoate (Compound 115); methyl 6-(2- { 1 l-[2-(dimethylamino)ethyl]icosyl}cyclopropyl)hexanoate (Compound 116); ethyl (7Z)-17-■[2-(dimethylamino)ethyl]hexacos-7-enoate (Compound 117);
ethyl (7Z)-17-■[2-(dimethylamino)ethyl]pentacos-7-enoate (Compound 1 18);
ethyl (7Z)-17-■[2-(dimethylamino)ethyl]tetracos-7-enoate (Compound 119);
ethyl (7Z)-17-■[2-(dimethylamino)ethyl]tricos-7-enoate (Compound 120);
ethyl (9Z)-17-■[2-(dimethylamino)ethyl]hexacos-9-enoate (Compound 121);
ethyl (5Z)-17-■[2-(dimethylamino)ethyl]hexacos-5-enoate (Compound 122);
ethyl (9Z)-19-■[2-(dimethylamino)ethyl]octacos-9-enoate (Compound 123);
ethyl (9Z)-19-■[2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 124);
ethyl (9Z)-19-■[2-(dimethylamino)ethyl]hexacos-9-enoate (Compound 125);
ethyl (9Z)- 19-•[2-(dimethylamino)ethyl]pentacos-9-enoate (Compound 126);
ethyl (9Z)-21- [2-(dimethylamino)ethyl]triacont-9-enoate (Compound 127);
ethyl (9Z)-21- [2-(dimethylamino)ethyl]nonacos-9-enoate (Compound 128);
ethyl (9Z)-21 [2-(dimethylamino)ethyl]octacos-9-enoate (Compound 129);
ethyl (9Z)-21 - [2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 130);
ethyl 6-(2- {9 [2-(dimethylamino)ethyl]octadecyl}cyclopropyl)hexanoate (Compound 131); ethyl 6-(2- {9 [2-(dimethylamino)ethyl]heptadecyl} cyclopropyl)hexanoate (Compound 132); ethyl 6-(2-{9- [2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)hexanoate (Compound 133); ethyl 6-(2-{9- [2-(dimethylamino)ethyl]pentadecyl}cyclopropyl)hexanoate (Compound 134); ethyl 8-(2-{7- [2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)octanoate (Compound 135); ethyl 4-(2-{l l [2-(dimethylamino)ethyl]icosyl} cyclopropyl)butanoate (Compound 136);
ethyl 8-(2-{9 [2-(dimethylamino)ethyl] octadecyl } cyclopropyl)octanoate (Compound 137); ethyl 8-(2-{9- [2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 138); ethyl 8-(2-{9 [2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)octanoate (Compound 139); ethyl 8-(2- {9 [2-(dimethylamino)ethyl]pentadecyl} cyclopropyl)octanoate (Compound 140); ethyl 8-(2-{l l-[2-(dimethylamino)ethyl]icosyl}cyclopropyl)octanoate (Compound 141); ethyl 8-(2-{l l-[2-(dimethylamino)ethyl]nonadecyl}cyclopropyl)octanoate (Compound 142); ethyl 8-(2-{l l-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 143); ethyl 8-(2-{l l-[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 144); (2Z)-non-2-en-l-yl 10-(dimethylamino)nonadecanoate (Compound 145);
(2-hexylcyclopropyl)methyl 10-(dimethylamino)nonadecanoate (Compound 146);
(2Z)-undec-2-en-l-yl 8-(dimethylamino)heptadecanoate (Compound 147);
(2Z)-hept-2-en-l-yl 12-(dimethylamino)henicosanoate (Compound 148);
(2-octylcyclopropyl)methyl 8-(dimethylamino)heptadecanoate (Compound 149);
(2-butylcyclopropyl)methyl 12-(dimethylamino)henicosanoate (Compound 150);
(2Z)-non-2-en-l-yl 10-[(dimethylamino)methyl]nonadecanoate (Compound 151);
(2Z)-undec-2-en-l-yl 8-[(dimethylamino)methyl]heptadecanoate (Compound 152);
(2Z)-hept-2-en-l-yl 12- [(dimethyl amino)methyl]henicosanoate (Compound 153);
(2-hexylcyclopropyl)methyl 10-[(dimethylamino)methyl]nonadecanoate (Compound 154); (2-octylcyclopropyl)methyl 8-[(dimethylamino)methyl]heptadecanoate (Compound 155); (2-butylcyclopropyl)methyl 12-[(dimethylamino)methyl]henicosanoate (Compound 156); (2Z)-non-2-en-l-yl 10-[2-(dimethylamino)ethyl]nonadecanoate (Compound 157);
(2Z)-undec-2-en-l -yl 8-[2-(dimethylamino)ethyl]heptadecanoate (Compound 158);
(2Z)-hept-2-en-l-yl 12-[2-(dimethylamino)ethyl]henicosanoate (Compound 159);
(2-hexylcyclopropyl)methyl 10-[2-(dimethylamino)ethyl]nonadecanoate (Compound 1 0); (2-octylcyclopropyl)methyl 8-[2-(dimethylamino)ethyl]heptadecanoate (Compound 161); (2-butylcyclopropyl)methyl 12-[2-(dimethylamino)ethyl]henicosanoate (Compound 162); methyl (19Z,22Z)-9-(dimethylamino)octacosa-19,22-dienoate (Compound 163);
ethyl (18Z,21Z)-8-(dimethylamino)heptacosa-18,21-dienoate (Compound 164);
methyl 9-(dimethylamino)-16-(2-octylcyclopropyl)hexadecanoate (Compound 165);
ethyl 8-(dimethylamino)-15-(2-octylcyclopropyl)pentadecanoate (Compound 166);
methyl (19Z,22Z)-9-[(dimethylamino)methyl]octacosa-19,22-dienoate (Compound 167); ethyl (18Z,21Z)-8-[(dimethylamino)methyl]heptacosa-18,21-dienoate (Compound 168); methyl 9-[(dimethylamino)methyl]-16-(2-octylcyclopropyl)hexadecanoate (Compound 169); ethyl 8-[(dimethylamino)methyl]-15-(2-octylcyclopropyl)pentadecanoate (Compound 170); methyl (19Z,22Z)-9-[2-(dimethylamino)ethyl]octacosa-19,22-dienoate (Compound 171); ethyl (18Z,21Z)-8-[2-(dimethylamino)ethyl]heptacosa-18,21-dienoate (Compound 172); methyl 9-[2-(dimethylamino)ethyl]-16-(2-octylcyclopropyl)hexadecanoate (Compound 173); ethyl 8-[2-(dimethylamino)ethyl]-15-(2-octylcyclopropyl)pentadecanoate (Compound 174); dimethyl (9Z)-19-(dimethylamino)heptacos-9-enedioate (Compound 175); and
1 -methyl 18-[(2Z)-non-2-en-l-yl] 9-(dimethylamino)octadecanedioate (Compound 176);
or any pharmaceutically acceptable salt or stereoisomer thereof.
In another embodiment, the cationic lipids disclosed are useful in the preparation of lipid nanoparticles.
In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of oligonucleotides.
In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA and miRNA.
In another embodiment, the cationic lipids disclosed are useful components in a lipid nanoparticle for the delivery of siRNA.
The cationic lipids of the present invention may have asymmetric centers, chiral axes, and chiral planes (as described in: E.L. Eliel and S.H. Wilen, Stereochemistry of Carbon Compounds, John Wiley & Sons, New York, 1994, pages 1119-1190), and occur as racemates, racemic mixtures, and as individual diastereomers, with all possible isomers and mixtures thereof, including optical isomers, being included in the present invention. In addition, the cationic lipids disclosed herein may exist as tautomers and both tautomeric forms are intended to be encompassed by the scope of the invention, even though only one tautomeric structure is depicted.
It is understood that substituents and substitution patterns on the cationic lipids of the instant invention can be selected by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art, as well as those methods set forth below, from readily available starting materials. If a substituent is itself substituted with more than one group, it is understood that these multiple groups may be on the same carbon or on different carbons, so long as a stable structure results.
It is understood that one or more Si atoms can be incorporated into the cationic lipids of the instant invention by one of ordinary skill in the art to provide cationic lipids that are chemically stable and that can be readily synthesized by techniques known in the art from readily available starting materials.
In the compounds of Formula A, the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominantly found in nature. The present invention is meant to include all suitable isotopic variations of the compounds of Formula A. For example, different isotopic forms of hydrogen (H) include protium (iH) and deuterium (2H). Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples. Isotopically- enriched compounds within Formula A can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by processes analogous to those described in the Scheme and Examples herein using appropriate isotopically-enriched reagents and/or intermediates.
As used herein, "alkyl" means a straight chain, cyclic or branched saturated aliphatic hydrocarbon having the specified number of carbon atoms.
As used herein, "alkenyl" means a straight chain, cyclic or branched unsaturated aliphatic hydrocarbon having the specified number of carbon atoms including but not limited to diene, triene and tetraene unsaturated aliphatic hydrocarbons.
Examples of a cyclic "alkyl" or "alkenyl include:
As used herein, "heterocyclyl" or "heterocycle" means a 4- to 10-membered aromatic or nonaromatic heterocycle containing from 1 to 4 heteroatoms selected from the group consisting of O, N and S, and includes bicyclic groups. "Heterocyclyl" therefore includes, the following: benzoimidazolyl, benzofuranyl, benzofurazanyl, benzopyrazolyl, benzotriazolyl, benzothiophenyl, benzoxazolyl, carbazolyl, carbolinyl, cinnolinyl, furanyl, imidazolyl, indolinyl, indolyl, indolazinyl, indazolyl, isobenzofuranyl, isoindolyl, isoquinolyl, isothiazolyl, isoxazolyl, naphthpyridinyl, oxadiazolyl, oxazolyl, oxazoline, isoxazoline, oxetanyl, pyranyl, pyrazinyl, pyrazolyl, pyridazinyl, pyridopyridinyl, pyridazinyl, pyridyl, pyrimidyl, pyrrolyl, quinazolinyl, quinolyl, quinoxalinyl, tetrahydropyranyl, tetrazolyl, tetrazolopyridyl, thiadiazolyl, thiazolyl, thienyl, triazolyl, azetidinyl, 1 ,4-dioxanyl, hexahydroazepinyl, piperazinyl, piperidinyl, pyrrolidinyl, morpholinyl, thiomorpholinyl, dihydrobenzoimidazolyl,
dihydrobenzofuranyl, dihydrobenzothiophenyl, dihydrobenzoxazolyl, dihydrofuranyl, dihydroimidazolyl, dihydroindolyl, dihydroisooxazolyl, dihydroisothiazolyl, dihydrooxadiazolyl, dihydrooxazolyl, dihydropyrazinyl, dihydropyrazolyl, dihydropyridinyl, dihydropyrimidinyl, dihydropyrrolyl, dihydroquinolinyl, dihydrotetrazolyl, dihydrothiadiazolyl, dihydrothiazolyl, dihydrothienyl, dihydrotriazolyl, dihydroazetidinyl, methylenedioxybenzoyl, tetrahydrofuranyl, and tetrahydrothienyl, and N-oxides thereof all of which are optionally substituted with one to three substituents selected from R".
As used herein, "polyamine" means compounds having two or more amino groups. Examples include putrescine, cadaverine, spermidine, and spermine.
As used herein, "halogen" means Br, CI, F and I.
In an embodiment of Formula A, Rl and R2 are independently selected from H and (Ci-C6)alkyl, wherein said alkyl is optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R'.
In an embodiment of Formula A, Rl and R2 are independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R*.
In an embodiment of Formula A, Rl and R2 are independently selected from H, methyl, ethyl and propyl.
In an embodiment of Formula A, Rl and R2 are each methyl.
In an embodiment of Formula A, R3 is independently selected from: (C4-
C20)alkyl or alkenyl.
In an embodiment of Formula A, R3 is independently selected from: (C14-C18) alkenyl.
In an embodiment of Formula A, R3 is independently selected from: (Ci6) alkenyl.
In an embodiment of Formula A, R3 is independently selected from: (C14) alkenyl. In an embodiment of Formula A, R3 is independently selected from: (Ci6) alkenyl.
In an embodiment of Formula A, R3 is independently selected from: ( ¾-
C9)alkyl.
In an embodiment of Formula A, R3 is independently selected from: (C7)alkyl.
In an embodiment of Formula A, R4 is independently selected from: (Ci- C 16) alkyl or alkenyl .
In an embodiment of Formula A, R4 is independently selected from: (C4-C10) alkenyl.
In an embodiment of Formula A, R4 is independently selected from: (C9) alkenyl.
In an embodiment of Formula A, R4 is independently selected from: (Q-
C4)alkyl.
In an embodiment of Formula A, R4 is independently selected from: (Ci- C2)alkyl.
In an embodiment of Formula A, R4 is (C2)alkyl.
In an embodiment of Formula A, R4 is (Ci)alkyl.
In an embodiment of Formula A, R3 is (C7)alkyl and R4 is (C9)alkenyl.
In an embodiment of Formula A, R is (Ci4)alkenyl and R4 is (C2)alkyl.
In an embodiment of Formula A, R is (Ci6)alkenyl and R4 is (Ci)alkyl.
In an embodiment of Formula A, R5 is independently selected from (C4-C8) alkyl or alkenyl.
In an embodiment of Formula A, R5 is independently selected from (C4-C8) alkyl.
In an embodiment of Formula A, R5 is independently selected from (C6-C8) alkyl.
In an embodiment of Formula A, R5 is (C8)alkyl.
In an embodiment of Formula A, R6 is independently selected from (C1-C2) alkyl.
In an embodiment of Formula A, R6 is (C2)alkyl. In an embodiment of Formula A, R.6 is (Cl)alkyl.
In an embodiment of Formula A, R5 is (Cs)alkyl and R4 is (C2)alkyl.
In an embodiment of Formula A, R5 is (Cs)alkyl and R4 is (C])alkyl.
In an embodiment of Formula A, R5 is (C7)alkyl and R is (C2)alkyl.
In an embodiment of Formula A, R5 is (C7)alkyl and R4 is (Ci)alkyl.
In an embodiment of Formula A, Ql and Q2 are each, independently a bond, - OC(O)-, -C(0)O, -SC(O)-, -C(0)S-, -OC(S)-, -S-S-, -C(R")=N-, -N=C(R")-, -C(R")=N-0-, -O- N=C(R")-, -C(0)(NR")-, -N(R")C(0)-, C(S)(NR")-, -N(R")C(0)-, -N(R")C(0)N(R")-, -OC(0)0- , OSi(R")20-, -C(0)(CR"2)C(0)0-, or -OC(0)(CR"2)C(0)-, with the proviso that when either Ql or Q2 is a bond then the other is not a bond.
In an embodiment of Formula A, Ql and Q2 are each, independently a bond or - C(0)0-, with the proviso that when either Q or Q is a bond then the other is not a bond.
In an embodiment of Formula A, R' is R".
In an embodiment of Formula A, R" is independently selected from H, methyl, ethyl and propyl, wherein said methyl, ethyl and propyl are optionally substituted with one or more halogen and OH.
In an embodiment of Formula A, R" is independently selected from H, methyl, ethyl and propyl.
In an embodiment of Formula A, n is 0, 1, 2 or 3.
In an embodiment of Formula A, n is 0, 1 or 2.
In an embodiment of Formula A, n is 0.
In an embodiment of Formula A, n is 1.
In an embodiment of Formula A, n is 2.
In an embodiment of Formula A, "heterocyclyl" is pyrolidine, piperidine, morpholine, imidazole or piperazine.
In an embodiment of Formula A, "monocyclic heterocyclyl" is pyrolidine, piperidine, morpholine, imidazole or piperazine.
In an embodiment of Formula A, "polyamine" is putrescine, cadaverine, spermidine or spermine.
In an embodiment, "alkyl" is a straight chain saturated aliphatic hydrocarbon having the specified number of carbon atoms. In an embodiment, "alkenyl" is a straight chain unsaturated aliphatic hydrocarbon having the specified number of carbon atoms.
Included in the instant invention is the free form of cationic lipids of Formula A, as well as the pharmaceutically acceptable salts and stereoisomers thereof. Some of the isolated specific cationic lipids exemplified herein are the protonated salts of amine cationic lipids. The term "free form" refers to the amine cationic lipids in non-salt form. The encompassed pharmaceutically acceptable salts not only include the isolated salts exemplified for the specific cationic lipids described herein, but also all the typical pharmaceutically acceptable salts of the free form of cationic lipids of Formula A. The free form of the specific salt cationic lipids described may be isolated using techniques known in the art. For example, the free form may be regenerated by treating the salt with a suitable dilute aqueous base solution such as dilute aqueous NaOH, potassium carbonate, ammonia and sodium bicarbonate. The free forms may differ from their respective salt forms somewhat in certain physical properties, such as solubility in polar solvents, but the acid and base salts are otherwise pharmaceutically equivalent to their respective free forms for purposes of the invention.
The pharmaceutically acceptable salts of the instant cationic lipids can be synthesized from the cationic lipids of this invention which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic cationic lipids are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
Thus, pharmaceutically acceptable salts of the cationic lipids of this invention include the conventional non-toxic salts of the cationic lipids of this invention as formed by reacting a basic instant cationic lipids with an inorganic or organic acid. For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and the like, as well as salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic (TFA) and the like.
When the cationic lipids of the present invention are acidic, suitable "pharmaceutically acceptable salts" refers to salts prepared form pharmaceutically acceptable non-toxic bases including inorganic bases and organic bases. Salts derived from inorganic bases include aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic salts, manganous, potassium, sodium, zinc and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium and sodium salts. Salts derived from
pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as arginine, betaine caffeine, choline, Ν,Ν1- dibenzylethylenediamine, diethylamin, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, hydrabamine, isopropylamine, lysine, methylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine tripropylamine, tromethamine and the like.
The preparation of the pharmaceutically acceptable salts described above and other typical pharmaceutically acceptable salts is more fully described by Berg et a ,
"Pharmaceutical Salts," J. Pharm. Set, 1977:66:1-19.
It will also be noted that the cationic lipids of the present invention are potentially internal salts or zwitterions, since under physiological conditions a deprotonated acidic moiety in the compound, such as a carboxyl group, may be anionic, and this electronic charge might then be balanced off internally against the cationic charge of a protonated or alkylated basic moiety, such as a quaternary nitrogen atom.
EXAMPLES
Examples provided are intended to assist in a further understanding of the invention. Particular materials employed, species and conditions are intended to be further illustrative of the invention and not limitative of the reasonable scope thereof. The reagents utilized in synthesizing the cationic lipids are either commercially available or readily prepared by one of ordinary skill in the art.
Synthesis of the novel cationic lipids is a linear process starting from lipid acid (i). Addition of a lipid based Grignard reagent can generate secondary alcohol (ii). This alcohol is protected as its silyl ether (iii) and the olefin is dihydroxylated with osmium tetroxide to give diol (iv). The diol is oxidatively cleaved with sodium periodate to provide aldehyde (v). The aldehyde is converted to the carboxylic acid containing olefin (vi) by a Wittig olenfination. The acid is converted to the ester (vii) in situ, followed by silyl ether deprotection to give alcohol (viii). The alcohol is oxidized to the ketone (ix) which is further converted to the cyclopropane containing material (x). Either ketone (ix or x) is reductively aminated to give final cationic lipids (xi or xii, respectively).
GENERAL SCHEME 1
Figure imgf000018_0001
xi xii
Synthesis of the single carbon homologated cationic lipids xv and xvi is a linear process starting from lipid ketones (ix or x). Conversion of the ketone to the nitrile (xiii or xiv) is accomplished via treatment with TOSMIC and potassium feri-butoxide. Hydrolysis of the nitrile is achieved under acidic conditions to give the primary amide. The amide is selectively reduced to the primary amine and this is reductively aminated to give amines (xv or xvi)
GENERAL SCHEME 2
Figure imgf000018_0002
xvi
Synthesis of two carbon homologated cationic lipids xxi or xxii is a linear process starting from lipid ketone (ix or x). Conversion of the ketone to the α,β-unsaturated amide xvii or xviii is accomplished under Peterson conditions. Conjugate reduction of the α,β-unsaturation is performed to give amide xix or xx. Chemoselective reduction of the amide could provide final cationic lipids xxi or xxii.
GENERAL SCHEME 3
Figure imgf000019_0001
Synthesis of ester containing lipids (xxv, xxvi, and xxvii) is achieved by oxidation of aldehyde v to carboxylic acid xxiii, followed by ester formation. Conversion to xxv, xxvi or xxvii is completed in a manner analogous to that described in General Schemes 1-3.
GENERAL SCHEME 4
Figure imgf000019_0002
v xxiii xxiv
Figure imgf000019_0003
xxv xxvi XXVII
Synthesis of ester containing lipids xxxi, xxxii and xxxiii is a linear sequence beginning with carboxylic acid xxv. The acid is converted to the Weinreb amide xxvi followed by Grignard addition to give ketone xxvii. The alcohol is deprotected, oxidized and esterified to give ester xxx. Ketone xxx is converted to final amines xxxi, xxxii or xxxiii in a manner analogous to that outlined above in General Schemes 1-3. GENERAL SCHEME 5
Figure imgf000020_0001
xxxi xxxii xxxiii
Synthesis of diester amines is accomplished as outlined in General Scheme 6. Alkene xxvi is dihydroxylated and oxidatively cleaved to give aldehyde xxxv. The aldehyde is converted to the carboxylic acid containing alkene via a Wittig olefmation. The resulting acid xxxvi is converted to its corresponding ester in situ. The silyl ether is deprotected and the alcohol oxidized to give carboxylic acid xxxviii. This is esterified to give ketone intermediate xxxix. This ketone is carried on to final amines XL-XLV as outlined in General Schemes 1-3 above.
Figure imgf000021_0001
Synthesis of bis-ester compounds (XLVII-XLIX) is achieved by oxidation of aldehyde (xxxv) followed by esterification to give ester XL VI. Conversion to the final amines is achieved in a manner analogous to that described above in General Schemes 1-6.
GENERAL SCHEME 7
Figure imgf000021_0002
XLVI1 XLVIII XLIX
Methyl (9ZH9-(dimethylamino)octacos-9-enoate (Compound 1)
Figure imgf000022_0001
ii
Oleyl aldehyde in THF is cooled to 0 °C and treated with nonylmagnesium bromide. The reaction is warmed to room temperature and quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol ii. The crude product is purified by flash column chromatography.
Figure imgf000022_0002
ii
Figure imgf000022_0003
iii
Alcohol ii is taken up in dichloromethane and treated with tri ethyl amine and DMAP. To this solution is added TBDPSC1 in a single portion at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude silyl ether iii. The crude product is purified by flash column chromato graphy .
Figure imgf000023_0001
Silyl ether iii is taken up in a mixture of tert-butanol, THF and water and treated with osmium tetroxide and NMO. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol iv. The crude product is purified by flash column chromatography.
Figure imgf000023_0002
v
Diol iv is taken up in a mixture of THF, dichloromethane, methanol and water and treated with sodium periodate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude aldehyde v. The crude product is purified by flash column chromatography.
Figure imgf000024_0001
Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide. To this solution is added aldehyde v. Upon reaction completion, the solution is treated with sodium bicarbonate and dimethylsulfate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester vii. The crude product is purified by flash column chromatography.
Figure imgf000024_0002
Ester vii is taken up in THF and treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol viii. The crude product is purified by flash column chromatography.
viii
Figure imgf000025_0002
ix
Alcohol viii is taken up in a mixture of DMSO and dichloromethane and treated with S03- pyridine at ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ketone ix. The crude product is purified by flash column chromatography.
(CH3)2NH, Ti(OiPr)4, NaBH4
Figure imgf000025_0003
ix
Figure imgf000025_0004
A solution of ketone ix in THF is treated with dimethylamine, titanium isopropoxide and sodium borohydride. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude amine 1. The crude product is purified by flash column chromatography.
Methyl 8-(2-[9-(dimethylamino')octadecyl1cvclopropylloctanoate (Compound 2)
Figure imgf000026_0001
A solution of diethylzinc in dichloromethane is cooled to -1 °C and treated drop wise with TFA. After 30 minutes, diiodomethane is added and the resulting solution aged for 30 minutes in an ice bath. To this solution is added ketone ix and the resulting solution is warmed slowly to ambient temperature. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude cyclopropane x. The crude product is purified by flash column chromatography.
Figure imgf000026_0002
Ketone x is carried on to amine 2 as described for compound 1 above.
Compounds 3-48 are novel cationic lipids and are prepared according to the
General Scheme 1 above.
Figure imgf000026_0003
Figure imgf000027_0001
l]cyclopropyl}octanoate methyl 8-{2-[9- (dimethylamino)pentadec yl]cyclopropyl}octanoate methyl 8-{2-[l l- (dimethylamino)icosyljcy clopropyl}octanoate methyl 8-{2-[l l- (dimethylamino)nonadecy l]cyclopropyl}octanoate methyl 8-{2-[l l- (dimethylamino)octadecyl ] cyclopropyl } octanoate methyl 8- {2-[l l- (dimethylamino)heptadec yl] cyclopropyl} octanoate methyl 10-{2-[7- (dimethylamino)hexadecy 1] cyclopropyl } decanoate methyl 6- {2-[l l- (dimethylamino)icosyl] cy clopropyl } hexano ate ethyl (7Z)-17- (dimethylamino)hexacos- 7-enoate ethyl (7Z)- 17- (dimethylamino)pentacos- 7-enoate ethyl (7Z)-17-
^^^^ (dimethylamino)tetracos- 7-enoate ethyl (7Z)- 17- (dimethylamino)tricos-7- enoate ethyl (9Z)- 17-
25 (dimethylamino)hexacos- 9-enoate ethyl (5Z)-17-
26 (dimethylamino)hexacos- 5-enoate ethyl (9Z)- 19-
27 (dimethylamino)octacos- 9-enoate ethyl (9Z)- 19-
28 (dimethylamino)heptacos- 9-enoate ethyl (9Z)-19-
29 (dimethylamino)hexacos- 9-enoate ethyl (9Z)-19-
30 (dimethylamino)pentacos- 9-enoate ethyl (9Z)-21-
31 (dimethylamino)triacont- 9-enoate ethyl (9Z)-21-
32 (dimethylamino)nonacos- 9-enoate ethyl (9Z)-21 -
33 (dimethylamino)octacos- 9-enoate ethyl (9Z)-21 -
34 (dimethylamino)heptacos- 9-enoate ethyl 6-{2-[9-
35 (dimethylamino)octadecyl
] cyclopropyl } hexanoate
V ethyl 6- {2-[9-
36 (dimethylamino)heptadec yl] cyclopropyl } hexanoate ethyl 6- {2-[9-
37 (dimethylamino)hexadecy
1] cyclopropyl} hexanoate ethyl 6-{2-[9-
38 (dimethylamino)pentadec yl] cyclopropyl } hexanoate ethyl 8-{2-[7-
39 (dimethylamino)hexadecy
1] cyclopropyl } octano ate ethyl 4-{2-[l l -
40 (dimethylamino)icosyl]cy clopropyl } butanoate ethyl 8-{2-[9-
41 (dimethylamino)octadecyl
] cyclopropyl } octanoate ethyl 8-{2-[9-
42 (dimethylamino)heptadec yl] cyclopropyl } octanoate ethyl 8-{2-[9-
43 (dimethylamino)hexadecy
1] cyclopropyl } octanoate ethyl 8-{2-[9-
44 (dimethylamino)pentadec yl] cyclopropyl } octanoate ethyl 8-{2-[l l-
45 (dimethylamino)icosyl] cy clopropyl } octanoate ethyl 8-{2-[l l-
46 (dimethylamino)nonadecy
1] cyclopropyl } octanoate ethyl 8-{2-[l l-
47 (dimethylamino)octadecyl
] cyclopropyl } octanoate ethyl 8-{2-[l l-
48 (dimethylamino)heptadec yl] cyclopropyl } octanoate
Methyl (9Z)-19-[(dimethylamino)methyl1octacos-9-enoate (Compound 49)
Figure imgf000031_0001
A solution of ketone ix is treated with TOSMIC in dimethoxyethane at 0 °C followed by treatment with potassium tert-butoxide. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude nitrile xiii. The crude product is purified by flash column chromatography.
Figure imgf000032_0001
49
A solution of nitrile xiii in methanol is treated with concentrated hydrochloric acid and warmed to reflux. The reaction is evaporated in vacuo upon completion (conversion to primary amide). The crude amide is selectively reduced by dilution in THF and treatment with zinc acetate and triethoxysilane. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude primary amine. This material is purified by flash chromatography.
The primary amine is taken up in THF and treated with formaldehyde and sodium
triacetoxyborohydride. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude amine 49. The crude product is purified by flash column chromatography.
Methyl 8-(2-{9-r(dimethylamino methyl]octadecyllcvclopropyl)octanoate (Compound 50)
Figure imgf000032_0002
50
Amine 50 is prepared from ketone x in a manner analogous to that outlined above for compound
49.
Compounds 51 -96 are novel cationic lipids and are prepared according to the
General Scheme 2 above.
Figure imgf000033_0001
ctacos-ll-enoate 1
methyl (7Z)- 19-
59 [(dimethylamino)methyl]o ctacos-7-enoate
1
methyl 8-(2-{9- [(dimethylamino)methyl]h
60
eptadecyl} cyclopropyl)oct anoate
1
methyl 8-(2- {9- [(dimethylamino)methyl]h
61
exadecyl} cyclopropyl)oct anoate
1
methyl 8-(2- {9- [(dimethylamino)methyl]p
62
entadecyl } cyclopropyl)oct anoate
1
methyl 8-(2- {11- [(dimethylamino)methyl]i
63
cosyl}cyclopropyl)octano ate
1
methyl 8-(2-{l l- [ (dimethyl amino)methyl] n
64
onadecyl} cyclopropyl)oct anoate
1
methyl 8-(2- {l l- [(dimethylamino)methyl] o
65
ctadecyl} cyclopropyl)octa noate
1
methyl 8-(2-{ 1 1- [(dimethylamino)methyl]h
66
eptadecyl} cyclopropyl)oct anoate 1
methyl 10-(2-{7- [(dimethylamino)methyl]h
67
exadecyl } cyclopropyl)dec anoate
1
methyl 6-(2-{l l- [ (dimethyl amino)methyl] i
68
cosyl} cyclopropyl)hexano ate ethyl (7Z)-17-
69 [(dimethylamino)methyl]h exacos-7-enoate
ethyl (7Z)- 17-
70 [(dimethylamino)methyl]p entacos-7-enoate
ethyl (7Z)-17-
71 [(dimethylamino)methyl]t etracos-7-enoate
ethyl (7Z)- 17-
72 [(dimethylamino)methyl]t ricos-7-enoate
ethyl (9Z)- 17-
73 [(dimethylamino)methyl]h exacos-9-enoate
ethyl (5Z)-17-
74 [(dimethylamino)methyl]h exacos-5-enoate
Figure imgf000036_0001
eptacos-9-enoate ethyl 6-(2-{9- [(dimethylamino)methyl]o
83
ctadecyl } cyclopropyl)hex anoate
1
ethyl 6-(2-{9- [(dimethylamino)methyl]h
84
eptadecyl } cyclopropyl)he xanoate ethyl 6-(2-{9- [(dimethylamino)methyl]h
85
exadecyl } cyclopropyl)hex anoate ethyl 6-(2-{9- [ (dimethyl amino)methyl]p
86
entadecyl } cyclopropyl)he xanoate
/N ethyl 8-(2-{7- [(dimethylamino)methyl]h
87
exadecyl} cyclopropyl)oct anoate ethyl 4-(2- {11- [(dimethylamino)methyl]i
88
cosyl } cyclopropyl)butano ate
1
ethyl 8-(2- {9- [ (dimethyl amino)methyl] o
89
ctadecyl} cyclopropyl)octa noate
1
ethyl 8-(2-{9- [(dimethylamino)methyl]h
90
eptadecyl} cyclopropyl)oct anoate
Figure imgf000038_0001
Methyl (9Z)-19-r2-(dimethylaminoethyloctacos-9-enoate (Compound 97)
Figure imgf000039_0001
xvii
The silyl amide Peterson reagent is dissolved in THF and cooled to -63°C. To this solution is added nBuLi. The reaction is warmed to ambient temperature for 30 minutes. The ketone ix is dissolved in THF in a second flask. The ketone solution is transferred to the Peterson reagent over 30 minutes while maintaining the temperature between -60°C and -40°C. The reaction is warmed to -40°C for 1 hour then warmed to 0°C for 30 minutes. The reaction is quenched with sodium bicarbonate, diluted with additional water and partitioned between water/hexanes. The organics is washed with brine, dried over sodium sulfate, filtered and evaporated in vacuo to give crude ,β-unsaturated amide xvii. The crude product is purified by flash column chromatography.
Figure imgf000039_0002
xix
The Copper catalyst is dissolved in toluene under nitrogen. To this is added the PMHS in a single portion. The reaction is aged for 5 minutes. To the solutions are added the α,β-unsatured amide xvii. To this mixture, the t-amyl alcohol is added over 3h via syringe pump. After the addition is complete, to the solution is added 20% NH40H to rxn in small portions. Caution: there is a vigorous effervescence and foaming in the beginning of the quench and it should be closely monitored and the ammonium hydroxide added slowly in small portions. The reaction is partitioned between water and hexanes. The organics is filtered through celite and evaporated in vacuo. The resulting rubber solid material is pulverized using a mechanical stirrer in hexanes to give small particulates which is filtered and washed with hexanes. The organics are then evaporated in vacuo and purified by flash chromatography to give amide xix.
Figure imgf000040_0001
97
The amide xix is selectively reduced by dilution in THF and treatment with zinc acetate and triethoxysilane. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics is dried over sodium sulfate, filtered and evaporated in vacuo to give crude amine 97. This material is purified by flash
chromatography.
Methyl 8-(2-{9-[2-(dimethylamino)ethyl1octadecyl|cvclopropyl)octanoate (Compound 98)
Figure imgf000040_0002
Amine 98 is prepared from ketone x in a manner analogous to that outlined above for compound 97.
Compounds 99-144 are novel cationic lipids and are prepared according to the General Scheme 3 above.
Figure imgf000041_0001
methyl 8-(2-{9-[2- (dimethylamino)ethyl]hexa
109
decyl} cyclopropyl)octanoat e
methyl 8-(2- {9-[2- (dimethylamino)ethyl]pent
110
adecyl} cyclopropyl)octano ate
methyl 8-(2-{l l-[2-
^^--^^
111 (dimethylamino) ethyl] ico sy l}cyclopropyl)octanoate methyl 8-(2-{l l-[2- (dimethylamino)ethyl]nona
112
decyl } cyclopropyl)octanoat e
methyl 8-(2-{l l-[2- (dimethylamino)ethyl]octa
113
decyl} cyclopropyl)octanoat e
methyl 8-(2-{l l-[2- (dimethylamino)ethyl]hept
114
adecyl}cyclopropyl)octano ate
methyl 10-(2-{7-[2- (dimethylamino)ethyl]hexa
115
decyl } cyclopropyl)decanoa te
methyl 6-(2-{l l-[2-
116 (dimethylamino)ethyl]icosy
1 } cyclopropyl)hexanoate ethyl (7Z)-17-[2-
117 (dimethylamino)ethyl]hexa cos-7-enoate ethyl (7Z)-17-[2-
118 (dimethylamino)ethyl]pent acos-7-enoate ethyl (7Z)-17-[2-
119 (dimethylamino)ethyl]tetra cos-7-enoate ethyl (7Z)-17-[2-
120 (dimethylamino)ethyl]trico s-7-enoate ethyl (9Z)-17-[2-
121 (dimethylamino)ethyl]hexa cos-9-enoate ethyl (5Z)-17-[2-
122 (dimethylamino)ethyl]hexa cos-5-enoate ethyl (9Z)-19-[2-
123 (dimethylamino)ethyl]octac os-9-enoate ethyl (9Z)-19-[2-
124 (dimethylamino)ethyl]hept acos-9-enoate ethyl (9Z)-19-[2-
125 (dimethylamino)ethyl]hexa cos-9-enoate ethyl (9Z)-19-[2-
126 (dimethylamino)ethyl]pent acos-9-enoate ethyl (9Z)-21-[2-
127 (dimethylamino)ethyl] triac ont-9-enoate
Figure imgf000044_0001
ethyl 8-(2- {9-[2- (dimethylamino)ethyl]hept
138
adecyl} cyclopropyl)octano ate
ethyl 8-(2- {9-[2- (dimethylamino)ethyl]hexa
139
decyl } cyclopropyl)octanoat e
ethyl 8-(2- {9-[2- (dimethylamino)ethyl]pent
140
adecyl } cyclopropyl)octano ate
ethyl 8-(2-{l l-[2-
141 (dimethylamino)ethyl]icosy
1} cyclopropyl)octanoate ethyl 8-(2-{l l-[2- (dimethylamino)ethyl]nona
142
decyl } cyclopropyl)octanoat e
ethyl 8-(2-{l l-[2- (dimethylamino)ethyl]octa
143
decyl } cyclopropyl)octanoat e
ethyl 8-(2- {l l-[2- (dimethylamino)ethyl]hept
144
adecyl } cyclopropyl)octano ate
(2Z)-non-2-en-l -yl 10-('dimethylamino)nonadecanoate (Compound 145)
Figure imgf000045_0001
A solution of aldehyde v in DMF is treated with Oxone at ambient temperature. The reaction quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid xxiii. This material is purified by flash chromatography.
Figure imgf000046_0001
xxiv
A solution of acid xxiii and C9-alcohol in DMF is treated with EDCI and diisopropylethylamine.
The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid xxiv. This material is purified by flash chromatography.
Figure imgf000046_0002
Conversion of silyl ether xxiv to Compound 145 is carried out in a manner analogous to that described for Compound 1 above
(2-hexylcvclopropyDmethyl lO-fdimethylamino^nonadecanoate (Compound 146)
Figure imgf000046_0003
146
Compound 146 is prepared in a manner analogous to that described above for compound 145 employing the cyclopropanation chemistry as described for compound 2 above. Compounds 147- 162 are novel cationic lipids and are prepared according to General Schemes 1-4 above.
Figure imgf000047_0001
1 (2- octylcyclopropyl)methyl
155 8-
[ (dimethyl amino )methyl] heptadecanoate
(2- butylcyclopropyl)methyl
156 12-
[(dimethylamino)methyl] henicosanoate
(2Z)-non-2-en-l-yl 10- [2-
157
(dimethylamino)ethyl]no nadecanoate
(2Z)-undec-2-en-l-yl 8- [2-
158
(dimethylamino)ethyl]he ptadecanoate
(2Z)-hept-2-en-l-yl 12- [2-
159
(dimethylamino)ethyl]he nicosanoate
(2- hexylcyclopropyl)methyl
160 10-[2-
(dimethyl amino) ethyl] no nadecanoate
(2- octylcyclopropyl)methyl
161 8-[2-
(dimethyl amino) ethyl] he ptadecanoate
(2- butylcyclopropyl)methyl
162 12-[2-
(dimethylamino)ethyl]he nicosanoate Methyl (19Z,22Z -9-(dimethylamino octacosa-19,22-dienoate (Compound 163)
Figure imgf000049_0001
1 1 ,14-Eicosadienoic acid, (11Z,14Z)- (50 g, 162 mmol), N, 0-Dimethylhydroxylamine hydrochloride (31.6 g, 324 mmol), HOAt (44.1 g, 324 mmol), Et3N (45.2 mL, 324 mmol), and
EDC (62.1 g, 324 mmol) were mixed in DCM (810 mL) and stirred overnight at ambient temperature. Reaction was then washed 5 x 700 mL water, then washed 1 x 600 mL 1 M NaOH, dried with sodium sulfate, filtered through celite and evaporated to obtain 53.06 g (93%) 1 1 ,14-eicosadienamide, N-methoxy-N-methyl-, (11Z,14Z) as a clear golden oil. Ή NMR (400 MHz, CDC13) δ 5.35 (m, 4H), 3.68 (s, 3H), 3.18 (s, 3H), 2.77 (m, 2H), 2.41 (t, J= 7 Hz, 2H),
2.05 (m, 4H), 1.63 (m, 2H), 1.40-1.26 (m, 18H), 0.89 (t, J= 7 Hz, 3H).
xxvii
A solution of alkyl bromide in THF is treated with magnesium turnings to generate the Grignard reagent. A separate solution of Weinreb amide xxvi in THF is treated with this resulting
Grignard solution at ambient temperature. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude ketone xxvii. This material is purified by flash chromatography.
Figure imgf000050_0001
xxvii
Figure imgf000050_0002
xxviii
A solution of silyl ether xxvii in THF is treated with TBAF. The reaction is quenched with ammonium chloride solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol xxviii. This material is purified by flash chromatography.
Figure imgf000050_0003
xxviii
Figure imgf000050_0004
xxix
A solution of acohol xxviii in DMF is treated with pyndinium dichromate at 0 °C. The solution is warmed to ambient temperature. The reaction is quenched with water and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid xxix. This material is purified by flash chromatography.
Figure imgf000051_0001
XXX
A solution of acid xxix in THF is treated with sodium bicarbonate and dimethylsulfate. The solution is warmed to ambient temperature. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto-ester xxx. This material is purified by flash chromatography.
Figure imgf000051_0002
163
Ketone xxx is carried forward to amine 163 in a manner analogous to that described above for compound 1.
Compounds 164-174 are novel cationic lipids and are prepared according to General Schemes 1- 5 above.
Figure imgf000052_0001
methyl 9- [2- (dimethylamino)ethyl]-l 6-
173
octylcyclopropyl)hexadeca noate
ethyl 8-[2- (dimethylamino)ethyl]-l 5-
174 (2- octylcyclopropyl)pentadec anoate
Dimethyl (9Z)-19-(dimethylamino)heptacos-9-enedioate (Compound 175)
Figure imgf000053_0001
xxvii
A solution of alkyl bromide in THF is treated with magnesium turnings and aged to generate the Grignard reagent. A separate solution of Weinreb amide is treated with the Grignard reagent. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude ketone xxvii. This material is purified by flash chromatography.
Figure imgf000053_0002
xxxiv A solution of ketone in THF, tert-butanol and water is treated with osmium tetroxide and NMO. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude diol xxxiv. This material is purified by flash chromatography.
Figure imgf000054_0001
xxxiv
Figure imgf000054_0002
XXXV
A solution of diol xxxiv is taken up in THF, dichloromethane, methanol and water and treated with sodium periodate. The reaction is quenched with sodium bicarbonate solution and partitioned between hexanes and water upon completion. The organics are dried over sodium sulfate, filtered and evaporated in vacuo to give crude aldehyde xxxv. This material is purified by flash chromatography.
Figure imgf000054_0003
xxxvii
Ylide precursor triphenylphosphinium bromide is taken up in THF and treated with HMPA and lithium hexamethyldisilazide to generate the ylide. To this solution is added aldehyde xxxv. Upon reaction completion, the solution is treated with sodium bicarbonate and dimethylsulfate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude ester xxxvii. The crude product is purified by flash column chromatography.
Figure imgf000055_0001
xxxviii
A solution of silyl ether xxxvii in THF is treated with TBAF. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude alcohol. The crude product is purified by flash column chromatography.
A solution of alcohol in DMF is treated with pyridinium dichromate. The reaction is quenched with water upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid xxxviii. The crude product is purified by flash column chromatography.
Figure imgf000055_0002
xxxix
A solution of acid xxxviii in THF is treated with sodium bicarbonate and dimethyl sulfate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude diester xxxix. The crude product is purified by flash column chromatography.
Figure imgf000056_0001
Ketone xxxix is converted to amine 175 in a manner analogous to that described for compound 1.
Diesters similar to compound 175 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.
1 -methyl 18-lY2Z)-non-2-en-l-yll 9-(dimethylamino)octadecanedioate (Compound 176)
Figure imgf000056_0002
XXXV XLVI
A solution of aldehyde xxxv in DMF is treated with pyridinium dichromate. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude acid XLVI. The crude product is purified by flash column chromatography.
Figure imgf000057_0001
XLVII
A solution of acid XLVI in dichloromethane is treated with C9 alcohol and EDCI and diisopropylethylamine. The reaction is quenched with aqueous bicarbonate solution upon completion. The reaction mixture is partitioned between water and hexanes, the organics dried over sodium sulfate, filtered and evaporated in vacuo to give crude keto ester XLVII. The crude product is purified by flash column chromatography.
Figure imgf000057_0002
176
Ketone XLVII is converted to amine 176 in a manner analogous to that described for compound 175 above.
Diesters similar to compound 176 are prepared wherein modifications to the structure are similar to those outlined in the tables above, i.e. varying lipid chain lengths, methyl and ethyl esters, inclusion of cylcopropanes, modifying position of unsaturation or cyclopropane incorporation, homologation of the dimethylamine headgroup by one or two carbons, and all possible combinations of above.
LNP COMPOSITIONS
The following lipid nanoparticle compositions (LNPs) of the instant invention are useful for the delivery of oligonucleotides, specifically siRNA and miRNA:
Cationic Lipid / Cholesterol / PEG-DMG 56.6/38/5.4;
Cationic Lipid / Cholesterol / PEG-DMG 60/38/2; Cationic Lipid/ Cholesterol / PEG-DMG 67.3/29/3.7;
Cationic Lipid / Cholesterol / PEG-DMG 49.3/47/3.7;
Cationic Lipid / Cholesterol / PEG-DMG 50.3/44.3/5.4;
Cationic Lipid / Cholesterol / PEG-C-DMA / DSPC 40/48/2/10;
Cationic Lipid / Cholesterol / PEG-DMG / DSPC 40/48/2/10; and
Cationic Lipid / Cholesterol / PEG-DMG / DSPC 58/30/2/10.
LNP process description:
The Lipid Nano-Particles (LNP) is prepared by an impinging jet process. The particles are formed by mixing lipids dissolved in alcohol with siRNA dissolved in a citrate buffer. The mixing ratio of lipids to siRNA are targeted at 45-55% lipid and 65-45% siRNA. The lipid solution can contain a novel cationic lipid of the instant invention, a helper lipid (cholesterol) , PEG (e.g. PEG-C-DMA, PEG-DMG) lipid, and DSPC at a concentration of 5-15 mg/mL with a target of 9-12 mg/mL in an alcohol (for example ethanol). The ratio of the lipids can have a mole percent range of 25-98 for the cationic lipid with a target of 35-65, the helper lipid can have a mole percent range from 0-75 with a target of 30-50, the PEG lipid can have a mole percent range from 1-15 with a target of 1-6, and the DSPC can have a mole precent range of 0-15 with a target of 0-12. The siRNA solution can contain one or more siRNA sequences at a concentration range from 0.3 to 1 .0 mg/mL with a target of 0.3 -0.9 mg/mL in a sodium citrate buffered salt solution with pH in the range of 3.5-5. The two liquids are heated to a temperature in the range of 15-40°C, targeting 30-40°C, and then mixed in an impinging jet mixer instantly foraiing the LNP. The teelD can have a range from 0.25 to 1.0 mm and a total flow rate from 10 -600 mL/min. The combination of flow rate and tubing ID can have the effect of controlling the particle size of the LNPs between 30 and 200 nm. The solution can then be mixed with a buffered solution at a higher pH with a mixing ratio in the range of 1 : 1 to 1 :3 vol: vol but targeting 1 :2 vol: vol. This buffered solution is at a temperature in the range of 15-40°C, targeting 30-40°C. The mixed LNPs are held from 30 minutes to 2 hrs prior to an anion exchange filtration step. The temperature during incubating is in the range of 15-40°C, targeting 30-40°C. After incubating the solution is filtered through a 0.8 um filter containing an anion exchange separation step. This process can use tubing IDs ranging from 1 mm ID to 5 mm ID and a flow rate from 10 to 2000 mL/min. The LNPs are concentrated and diafiltered via an ultrafiltration process where the alcohol is removed and the citrate buffer is exchanged for the final buffer solution such as phosphate buffered saline. The ultrafiltration process can use a tangential flow filtration format (TFF). This process can use a membrane nominal molecular weight cutoff range from 30 -500 KD. The membrane format is hollow fiber or flat sheet cassette. The TFF processes with the proper molecular weight cutoff can retain the LNP in the retentate and the filtrate or permeate contains the alcohol; citrate buffer; final buffer wastes. The TFF process is a multiple step process with an initial concentration to a siRNA concentration of
1 -3 mg/mL. Following concentration, the LNPs solution is diafiltered against the final buffer for 10 -20 volumes to remove the alcohol and perform buffer exchange. The material can then be concentrated an additional 1 -3 fold. The final steps of the LNP process are to sterile filter the concentrated LNP solution and vial the product.
Analytical Procedure;
1) siRNA concentration
The siRNA duplex concentrations are determined by Strong Anion-Exchange High-Performance Liquid Chromatography (SAX-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a 2996 PDA detector. The LNPs, otherwise referred to as RNAi Delivery Vehicles (RDVs), are treated with 0.5% Triton X-l 00 to free total siRNA and analyzed by SAX separation using a Dionex BioLC DNAPac PA 200 (4 x 250 mm) column with UV detection at 254 nm. Mobile phase is composed of A: 25 mM NaC104, 10 mM Tris, 20% EtOH, pH 7.0 and B: 250 mM NaC104, 10 mM Tris, 20% EtOH, pH 7.0 with liner gradient from 0-15 min and flow rate of 1 ml/min. The siRNA amount is determined by comparing to the siRNA standard curve.
2) Encapsulation rate
Fluorescence reagent SYBR Gold is employed for RNA quantitation to monitor the encapsulation rate of RDVs. RDVs with or without Triton X-l 00 are used to determine the free siRNA and total siRNA amount. The assay is performed using a SpectraMax M5e microplate spectrophotometer from Molecular Devices (Sunnyvale, CA). Samples are excited at
485 nm and fluorescence emission is measured at 530 nm. The siRNA amount is determined by comparing to the siRNA standard curve.
Encapsulation rate = (1- free siRNA/total siRNA) xl00%
3) Particle size and polydispersity
RDVs containing 1 μg siRNA are diluted to a final volume of 3 ml with 1 x PBS.
The particle size and polydispersity of the samples is measured by a dynamic light scattering method using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, NY). The scattered intensity is measured with He-Ne laser at 25°C with a scattering angle of 90°. 4) Zeta Potential analysis
RDVs containing 1 μg siRNA are diluted to a final volume of 2 ml with 1 mM Tris buffer (pH 7.4). Electrophoretic mobility of samples is determined using ZetaPALS instrument (Brookhaven Instruments Corporation, Holtsville, NY) with electrode and He-Ne laser as a light source. The Smoluchowski limit is assumed in the calculation of zeta potentials.
5) Lipid analysis
Individual lipid concentrations is determined by Reverse Phase High- Performance Liquid Chromatography (RP-HPLC) using Waters 2695 Alliance system (Water Corporation, Milford MA) with a Corona charged aerosol detector (CAD) (ESA Biosciences, Inc, Chelmsford, MA). Individual lipids in RDVs are analyzed using an Agilent Zorbax SB-C18
(50 x 4.6 mm, 1.8 μηι particle size) column with CAD at 60 °C. The mobile phase is composed of A: 0.1% TFA in H20 and B: 0.1% TFA in IPA. The gradient can change from 60% mobile phase A and 40% mobile phase B from time 0 to 40% mobile phase A and 60%) mobile phase B at 1.00 min; 40% mobile phase A and 60% mobile phase B from 1.00 to 5.00 min; 40% mobile phase A and 60% mobile phase B from 5.00 min to 25% mobile phase A and 75% mobile phase
B at 10.00 min; 25% mobile phase A and 75% mobile phase B from 10.00 min to 5% mobile phase A and 95% mobile phase B at 15.00 min; and 5% mobile phase A and 95% mobile phase B from 15.00 to 60% mobile phase A and 40% mobile phase B at 20.00 min with flow rate of 1 ml/min. The individual lipid concentration is determined by comparing to the standard curve with all the lipid components in the RDVs with a quadratic curve fit. The molar percentage of each lipid is calculated based on its molecular weight.
Utilizing the above described LNP process, specific LNPs with the following ratios are identified:
Nominal composition:
Cationic Lipid / Cholesterol / PEG-DMG 60/38/2
Cationic Lipid / Cholesterol / PEG-DMG / DSPC 58/30/2/10
Luc siRNA
5'-iB-Ai/AAGGCi/Ai7GAAGAGAC/ATT-iB 3' (SEQ.ID.NO.: l) y-\]\ UAUUCCGAUACUUCUOJA\ -y (SEQ.ID.NO.:2)
AUGC - Ribose
iB - Inverted deoxy abasic
UC - Fluoro AGT - T Deoxy
AGU - T OCH3
Nominal composition
Cationic Lipid /Cholesterol/PEG-DMG 60/38/2
Cationic Lipid / Cholesterol / PEG-DMG / DSPC 40/48/2/10
Cationic Lipid / Cholesterol / PEG-DMG / DSPC 58/30/2/10
ApoB siRNA
5'-iB-CUUU^C^UUCCUG^4^UTsT-iB-3' (SEQ ID NO.:3) y-VsOGAAA /GUUA4GG^CUsUsUsA-5' (SEQ ID NO.:4)
AUGC - Ribose
iB - Inverted deoxy abasic
UC - T Fluoro
AGT - 2' Deoxy
AGU - 2' OCH3
UsA - phophorothioate linkage beta-catenin siRNA
5'-iB-CUGUUGGAUUGAUUCGAAAUsU-iB-3' (SEQ ID NO.:5) y- s GACAACCUAACUAAGCUUUS' (SEQ ID NO.:6)
AUGC - Ribose
iB - Inverted deoxy abasic
UC - Fluoro
AGT - 2' Deoxy
AGU - 2' OCH3
UsA - phophorothioate linkage
5'-iB-^CG^CUAG£/UCAGUUGCUUUsU-iB-3' (SEQ ID NO.:7) 3'-UsUUGCUG^£/CAAGUCAy4CG 4-5' (SEQ ID NO.:8)
AUGC - Ribose
iB - Inverted deoxy abasic
UC - Fluoro
AGT - T Deoxy AGU - 2' OCH3
UsA - phophorothioate linkage
5'-iB-^CG^CUAGCAJCAGUUGCUUUU-iB-3' (SEQ ID NO.:9) 3'-UUUGCUG^l/CAAGUCA^CGA4-5' (SEQ ID NO.: 10)
AUGC - Ribose
iB - Inverted deoxy abasic
UC - Fluoro
AGT - 2' Deoxy
AGU - 2' OCH3
UsA - phophorothioate linkage
Oligonucleotide synthesis is well known in the art. (See US patent applications: US 2006/0083780, US 2006/0240554, US 2008/0020058, US 2009/0263407 and US
2009/0285881 and PCT patent applications: WO 2009/086558, WO2009/127060,
WO2009/132131, WO2010/042877, WO2010/054384, WO2010/054401 , WO2010/054405 and WO2010/054406). The siRNAs disclosed and utilized in the Examples are synthesized via standard solid phase procedures.
EXAMPLE 1
Mouse In Vivo Evaluation of Efficacy
LNPs utilizing Compounds 1-176, in the nominal compositions described immediately above, are evaluated for in vivo efficacy. The siRNA can target the mRNA transcript for the firefly (Photinus pyralis) luciferase gene (Accession # Ml 5077). The primary sequence and chemical modification pattern of the luciferase siRNA is displayed above. The in vivo luciferase model employs a transgenic mouse in which the firefly luciferase coding sequence is present in all cells. ROSA26- LoxP-Stop-LoxP-Luc (LSL- Luc) transgenic mice licensed from the Dana Farber Cancer Institute are induced to express the Luciferase gene by first removing the LSL sequence with a recombinant Ad-Cre virus (Vector Biolabs). Due to the organo-tropic nature of the virus, expression is limited to the liver when delivered via tail vein injection. Luciferase expression levels in liver are quantitated by measuring light output, using an IVIS imager (Xenogen) following administration of the luciferin substrate (Caliper Life Sciences). Pre-dose luminescence levels is measured prior to administration of the RDVs. Luciferin in PBS (15mg/mL) is intraperitoneally (IP) injected in a volume of 150 μΐ^. After a four minute incubation period mice are anesthetized with isoflurane and placed in the IVIS imager. The RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 0.2 mL. Final dose levels can range from 0.1 to 0.5 mg/kg siRNA. PBS vehicle alone is dosed as a control. Mice are imaged 48 hours post dose using the method described above. Changes in luciferin light output directly correlate with luciferase mRNA levels and represent an indirect measure of luciferase siRNA activity. In vivo efficacy results are expressed as % inhibition of luminescence relative to pre-dose luminescence levels. EXAMPLE 2
In vitro ApoE binding; assay
LNPs are incubated at 37°C in 90% rhesus serum at a final LNP concentration of 4ug/mL. Incubation is for 20 minutes with orbital rotation. After incubation, the samples are diluted 1 :20 in PBS and 100 iL of each diluted sample is aliquoted to wells of an anti-PEG antibody coated 96-well plate (Life Diagnostics Cat. No. P-0001PL. After incubation at room temperature for 1 hour, the plate is washed 5X with 300uL PBS. After washing, 50uL of 0.2% Triton X-100 is added to each well and the plate incubated at 37°C for 10 minutes, followed by shaking on a plate shaker for 1 minute at 750 rpm. Samples are frozen prior to performing the ApoE ELISA and stem loop PCR analysis of samples.
An ApoE ELISA assay is performed to quantitate ApoE bound to the LNPs after incubation in rhesus serum. Anti-ApoE antibody (Milipore, Cat No. AB947) is diluted 1 : 1000 in PBS and 100 xL of diluted antibody is added to each well of a polystyrene high binding plate. The plate with antibody is incubated overnight at 4°C, after which the plate is washed 2X with 200μΕ of PBS. Next, 200μΕ of buffer containing 1% BSA and 0.05% Tween-20 in PBS
(Incubation Buffer) is added to each well followed by incubation at room temperature for 1 hour. Plates are washed 5X with PBS containing 0.05% Tween-20. Frozen Triton lysis test samples are thawed and diluted 1 :6 with incubation buffer and 100 μΕ of test sample is aliquoted to wells of the ApoE antibody plate. Incubation is for 1 hour at room temperature followed by a 5X wash with PBS containing 0.05% Tween-20. After washing, ΙΟΟμί of biotinylated anti-ApoE antibody (Mabtech, Cat. ANo. E887-biotin), diluted 1 :500 in incubation buffer, is added to each well and incubated for 1 hour at room temperature, followed by a 5X wash with 0.05% Tween-20 in PBS. 100 xL per well, of Streptavidin-HPR (Thermo, Cat. No. TS- 125-HR), is then added and incubated for 1 hour at room temperature. After washing 5X with 0.05% Tween-20 in PBS, ΙΟΟμΙ, of TMB Substrate (Thermo, Cat. No. 34028) is added to each well, followed by incubation at room temperature for 20 minutes in the dark. The colorimetric reaction is stopped with ΙΟΟμί of TMB Stop Solution (KPL, Cat. No. 50-85-04) and absorbance at 450nm is determined. An ApoE standard curve is prepared by diluting rhesus Recombinant ApoE in incubation buffer with 0.03%> Triton X-100 with concentrations ranging from 100 ng/mL to 0.78 ng/mL. ApoE standards are evaluated in the ELISA in parallel to the test samples. A rhesus serum only (no LNP) control is utilized to obtain a background subtraction for non-LNP dependent ApoE signal in the ELISA.
Stem Loop RT-PCR Protocol
To normalize to the ApoE bound to the amount of LNP bound to the anti-PEG antibody plate, the amount of siRNA retained in the anti-PEG antibody well is quantitated by stem-loop PCR and related to the number of siRNAs encapsulated per LNP, to give an approximate measure of total LNP particles bound per well.
Preparation of the Spiked Standard Curve Samples:
The standard curve is prepared using the molecular weight of the siRNA (13693 g/mol for ApoB 17063) to calculate the copy number. The high standard should contain 1011 copies per 3μ1. A 10-fold serial dilution is performed across a row of an assay plate until the lowest standard contains 102 copies per 3μ1. One could dilute 0.2% Triton X-100 1 :80 in water and pipette 20 μΐ^ of the diluted Triton X-100 into 10 wells of a 96 well plate. 30μΕ of the serial diluted standard curve and mix is added to each well of the plate. 10 μΐ^ οϊ the spiked standard curve is used in the reverse transcription reaction.
Stem-Loop RT-PCR - test samples and standard curve:
Triton lysates from the PEG antibody plate capture is diluted 1 to 2000 in nuclease free water. 10μΕ of 'RT-Primer Mix' (Applied Biosystem's TaqMan MicroRNA Reverse Transcription Kit Cat. No. 4366596) is added to each well of a 96-well Micro-Amp QPCR plate (ABI Cat# N801-0560).
Figure imgf000064_0001
ApoB RT-primer (l OuM) 0.6 200 nM
1 Ox buffer 2
Water 7.4
ApoB RT primer sequence: 5' GTCGTATCCAGTGCAGGGTCCGAGGTA
TTCGCACTGGATACGACCTTTAACA3'(SEQ.ID.NO.: l l)
Ι ΟμΙ, of each test sample (diluted 1 to 2000) or spiked standard curve (above) is aliquoted into the 96-well plate. The plate is covered with a mat (ABI Cat. No. N801-0550), to minimize evaporation. The plate is briefly centrifuged at 800 rpm for 1 minute. Next, the plate is run on a thermocycler using the following cycling parameters:
Figure imgf000065_0001
Next, Ι ΟμΙΙ, of 'RT Mix' is added to each well (Applied Biosystem's TaqMan MicroRNA Reverse Transcription Kit Cat. No. 4366596)
Figure imgf000065_0002
The RT cycling reaction is composed of \ 0 L test sample, Ι ΟμΙ^ of RT primer mix and 10 μΐ., of RT Mix components for a total volume of 3Q\ L. The final concentration of the RT-primer in the total 30 μΐ, total RT mix is 200nM. The plate is then sealed with the same plate mat, briefly centrifuged at 800 rpm for 1 minute, then run on the thermocycler using the following cycling parameters:
Figure imgf000066_0001
Next, 15 xL of Fast Enzyme / primer-probe mix is added to each well of a new
Fast 96-well plate (Applied Biosystem's TaqMan Fast Universal PCR Master Mix, Cat. No. 4352042)
Figure imgf000066_0002
ApoB primers and probe sequence:
17063DC F3 GGCGCGAAATTTCAGGAATTGT (SEQ.ID.NO.: 12)
17063DC Pr2 CACTGGATACGACCTTTAACA (SEQ.ID.NO.: 13)
Universal R2 AGTGCAGGGTCCGAG (SEQ.ID.NO.: 14)
5 μΐ, of each RT reaction is added to the Fast Enzyme Mix plate. The plate is centrifuged for 1 minute at 1000 rpm and the QPCR analysis is performed on an ABI7900 with Fast Block. Cycling parameters is: 1 cycle - 95°C for 20 seconds, followed by 40 Cycles - 95°C for 1 seconds, 60°C for 20 seconds.
The QPCR result is utilized to calculate the siRNA concentration in the PEG antibody capture plate Triton lysates. Based on an estimate of 500 siRNA per LNP particle, the number of LNPs retained in each well of the anti-PEG antibody plate can be calculated. Using the ApoE concentration per well, as determined by the ApoE ELISA and the number of LNP particles per well, an approximate ApoE molecules bound per LNP particle can be calculated.
EXAMPLE 3
Heparin Sepharose HI-TRAP™ Binding Assay
Lipid nanoparticles (LNP) with neutral surface charge are not retained after injection onto heparin sepharose with IX Dulbecco's phosphate buffered saline (DPBS) as the running buffer but elute in the column void volume. Serum apolipoprotein E (ApoE) exhibits high affinity binding with heparin sulfate and it can be shown that LNPs bind to heparin sepharose to an extent dependent on their intrinsic ability to bind ApoE (depending on both lipid nanoparticle composition and ApoE concentration) after incubation with purified and/or recombinant human ApoE or serum samples. Lipid nanoparticles with surface bound ApoE bind to heparin sepharose with high affinity can be eluted only at high salt (1M NaCl).
A heparin sepharose binding assay is developed to assess serum ApoE binding to lipid nanoparticles based on the high affinity interaction that ApoE-LNP complexes exhibit toward heparin sepharose.
Incubations
Lipid nanoparticles are incubated at 37°C for 20 min at a final siRNA concentration of 50 μg/mL with various concentrations of either purified or recombinant human apolipoprotein E or 0.1-50% rat/mouse/rhesus monkey/human serum in IX Dulbecco's phosphate buffered saline (DPBS). After incubation with ApoE or serum LNP samples are diluted 10-fold using IX DPBS and analyzed by heparin sepharose chromatography. Peak area of retained LNP (after subtraction of appropriate blank signals) is compared to total peak area of LNP control without ApoE and/or serum incubation to determine the percentage of the LNP which undergoes shift to high affinity heparin interaction after incubation with ApoE/serum.
Heparin Sepharose HI-TRAP™ Chromatographic Conditions
A heparin sepharose HI-TRAP™ chromatography column (GE Healthcare; 1 mL bed volume) is equilibrated with either IX or 2X Dulbecco's PBS; the higher 2X salt concentration is used for LNPs with higher intrinsic retention on heparin sepharose (presumably due to higher positive surface charge).
Mobile Phase A: IX or 2X DPBS
Mobile Phase B: 1M NaCl in 10 mM sodium phosphate buffer, pH 7.0
100% A delivered isocratically for 10 min followed by step gradient to 100% B; hold for additional 10 min; step gradient back to 100% A and reequilibrate for additional 10 min prior to injection of next sample
Flow rate: 1 mL/min
Sample injection volume: 50 μL.
Detection: UV @260 nm
EXAMPLE 4
Rat In Vivo Evaluation of Efficacy and Toxicity
LNPs utilizing compounds in the nominal compositions described above, are evaluated for in vivo efficacy and increases in alanine amino transferase and aspartate amino transferase in Sprague-Dawley (Crl:CD(SD) female rats (Charles River Labs). The siRNA targets the mRNA transcript for the ApoB gene (Accession # NM 019287). The primary sequence and chemical modification pattern of the ApoB siRNA is displayed above. The RDVs (containing siRNA) in PBS vehicle are tail vein injected in a volume of 1 to 1.5 mL. Infusion rate is approximately 3 ml/min. Five rats are used in each dosing group. After LNP
administration, rats are placed in cages with normal diet and water present. Six hours post dose, food is removed from the cages. Animal necropsy is performed 24 hours after LNP dosing. Rats are anesthetized under isoflurane for 5 minutes, then maintained under anesthesia by placing them in nose cones continuing the delivery of isoflurane until ex-sanguination is completed. Blood is collected from the vena cava using a 23 gauge butterfly venipuncture set and aliquoted to serum separator vacutainers for serum chemistry analysis. Punches of the excised caudate liver lobe is taken and placed in RNALater (Ambion) for mRNA analysis. Preserved liver tissue is homogenized and total RNA isolated using a Qiagen bead mill and the Qiagen miRNA-Easy RNA isolation kit following the manufacturer's instructions. Liver ApoB mRNA levels are determined by quantitative RT-PCR. Message is amplified from purified RNA utilizing a rat
ApoB commercial probe set (Applied Biosystems Cat # RN01499054_ml). The PCR reaction is performed on an ABI 7500 instrument with a 96-well Fast Block. The ApoB mRNA level is normalized to the housekeeping PPIB (NM 011149) mRNA. PPIB mRNA levels are determined by RT-PCR using a commercial probe set (Applied Biosytems Cat. No. Mm00478295_ml). Results are expressed as a ratio of ApoB mRNA/ PPIB mRNA. All mRNA data is expressed relative to the PBS control dose. Serum ALT and AST analysis is performed on the Siemens Advia 1800 Clinical Chemistry Analyzer utilizing the Siemens alanine aminotransferase (Cat# 03039631) and aspartate aminotransferase (Cat# 03039631) reagents.
EXAMPLE 5
Determination of Cationic Lipid Levels in Rat/Monkey Liver
Liver tissue is weighed into 20-ml vials and homogenized in 9 v/w of water using a GenoGrinder 2000 (OPS Diagnostics, 1600 strokes/min, 5min). A 50 aliquot of each tissue homogenate is mixed with 300 μΐ^ of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 μΕ of each supernatant is then transferred to separate wells of a 96-well plate and 10 μΐ samples were directly analyzed by LC/MS-MS.
Standards are prepared by spiking known amounts of a methanol stock solution of compound into untreated rat liver homogenate (9 vol water/weight liver). Aliquots (50 μυ) each standard/liver homogenate is mixed with 300 μΐ^ of extraction/protein precipitating solvent (50/50 acetonitrile/methanol containing 500 nM internal standard) and the plate is centrifuged to sediment precipitated protein. A volume of 200 μΐ, of each supernatant is transferred to separate wells of a 96-well plate and 10 μΐ of each standard is directly analyzed by LC/MS-MS.
Absolute quantification versus standards prepared and extracted from liver homogenate is performed using an Aria LX-2 HPLC system (Thermo Scientific) coupled to an API 4000 triple quadrupole mass spectrometer (Applied Biosystems). For each run, a total of 10 μΐ, sample is injected onto a BDS Hypersil C8 HPLC column (Thermo, 50 x 2mm, 3 μη ) at ambient temperature.
Mobile Phase A: 95% H20/5% methanol/10 mM ammonium
formate/0. l%formic acid Mobile Phase B: 40% methanol/60% n-propanol/10 mM ammonium formate/0. l%formic acid The flow rate is 0.5 mL/min and gradient elution profile is as follows: hold at 80% A for 0.25 min, linear ramp to 100% B over 1.6 min, hold at 100% B for 2.5 min, then return and hold at 80% A for 1.75 min. Total run time is 5.8 min. API 4000 source parameters is CAD: 4, CUR: 15, GS1 : 65, GS2: 35, IS: 4000, TEM: 550, CXP: 15, DP: 60, EP: 10. EXAMPLE 6
Rhesus Monkey In Vivo Evaluation of ApoB Efficacy
LNPs utilizing compounds in the nominal compositions described above, are evaluated for in vivo efficacy in male or female Macaca mulatta (rhesus) monkeys. The siRNA targets the mRNA transcript for the ApoB gene (Accession # XM 001097404). The primary sequence and chemical modification pattern of the ApoB siRNA is displayed above. The RDVs (containing siRNA) in PBS vehicle are administered by intravenous injection in the saphenous vein at an injection rate of 20 mL/minute to a dose level of 0.25 mg/kilogram siRNA. The injection volumes are from 1.9 to 2.1 niL/kilogram and monkeys can range in weight from 2.5 to 4.5 kilograms. The RDV or PBS control is administered to three monkeys. At multiple days post dose, 1 mL blood samples are drawn from the femoral artery for serum chemistry analysis. Monkeys are fasted overnight prior to blood draws. As a measure of efficacy, LDL-C is monitored as a downstream surrogate marker of ApoB mRNA reduction.
EXAMPLE 7
Rhesus Monkey In Vivo Evaluation of β-catenin Efficacy
On study day -7 predose liver biopsy samples (~0.5-l gram/sample) are collected from male rhesus monkeys by laparoscopic surgical resection (resection of one biopsy sample from outer edge of one randomly selected liver lobe per monkey). A 5 mm tissue punch is used to sample three non-adjacent ~50 mg samples from each predose biopsy. Samples are preserved in RNAlater™ (Ambion) for later CTNNB1 mRNA analysis.
On study day 0 monkeys are administered suspensions of the lipid nanoparticle
(LNP) test articles in phosphate buffered saline (0.05-0.1 mg siRNA/mL) via single-dose intravenous bolus injection at target doses of 0.67, 1.34 or 3.34 mg siRNA/m . For dosing purposes, body surface area (m2) is estimated from body weight according to the established allometric scaling relationship given below (1):
BSA (m2)= 0.11 * BW(in kg) 0 65
On study days 2 and 7, at 48 hours and 168 hrs post LNP administration, liver biopsy samples (~0.5-l gram/sample) are collected from monkeys by laparoscopic surgical resection (2 separate randomly selected liver lobes were resected per monkey). A 5 mm tissue punch is used to sample three non-adjacent ~50 mg samples per each 48 hr and 168 hr surgical biopsy sample. Samples are preserved in RNAlater™ (Ambion) for later CTNNBl mRNA analysis.
CTNNBl mRNA levels are measured by relative quantitative RT-PCR using a primer/probe set validated for CTNNBl and normalized against mRNA levels of peptidylprolyl isomerase B (also known as PPIB or cyclophilin B) and RNA levels of 18S ribosomal RNA (18S rRNA) . Change in CTNNBl mRNA liver expression are measured as the difference in PCR threshold cycle number (AACt) between post-dose samples and each corresponding monkey's predose liver samples.
Calculation of CTNNBl mRNA knockdown (with respect to pretreatment levels) is calculated from A Ct using the following relationship:
mRNA (% knockdown)= 100- (100/2" Ct)
(1) FDA Guidance Document: "Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers" July 2005, US Department of Health and Human Services, Food and Drag Administration- Center for Drug Evaluation and Research (CDER)
EXAMPLE 8
Rhesus Monkey In Vivo Evaluation of ALT Increases
Alanine aminotransferase (ALT) is measured in serum that is harvested from clotted monkey whole blood after centrifugation. A Roche Modular System automated chemistry analyzer measures the enzymatic activity of ALT in the serum by using International Federation of Clinical Chemistry standardized procedures and reagents. The analyzer's computer uses absorbance measurements to calculated ALT activity in the sample as compared to a standard curve. The ALT activity is reported in International Units per Liter (IU/L).

Claims

WHAT IS CLAIMED IS:
1. A cationic lipid of Formula A:
Figure imgf000072_0001
A wherein:
Rl and R2 are independently selected from H, (Ci -C6)alkyl, heterocyclyl, and polyamine, wherein said alkyl, heterocyclyl and polyamine are optionally substituted with one to three substituents selected from R', or Rl and R2 can be taken together with the nitrogen to which they are attached to form a monocyclic heterocycle with 4-7 members optionally containing, in addition to the nitrogen, one or two additional heteroatoms selected from N, O and S, said monocyclic heterocycle is optionally substituted with one to three substituents selected from R';
R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C1-C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R'; R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1-C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
Ql and Q2 are each, independently, a bond, -OC(O)-, -C(0)0-, -SC(O)-, -C(0)S-, -OC(S)-, -S- S-, -C(R")=N-, -N=C(R")-, -C(R")=N-0-, -0-N=C(R")-, -C(0)(NR")-, -N(R")C(0)-, C(S)(NR")- , -N(R")C(0)-, -N(R")C(0)N(R")-, -OC(0)0-, OSi(R")20-, -C(0)(CR"2)C(0)0-, or - OC(0)(CR"2)C(0)-, with the proviso that when either Ql or Q2 is a bond then the other is not a bond;
R' is independently selected from halogen, R", OR", SR", CN, C02R" or CON(R")2;
R" is independently selected from H and (Ci-C6)alkyl, wherein said alkyl is optionally substituted with halogen and OH; n is 0, 1 , 2, 3, 4 or 5; or any pharmaceutically acceptable salt or stereoisomer thereof.
2. A cationic lipid of Formula A according to Claim 1 ,
wherein:
R1 and R2 are each methyl; n is 0; R3 is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C]-Ci6 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R'; Q and Q2 are each, independently, a bond or -C(0)0-, with the proviso that when either Ql Q2 is a bond then the other is not a bond; or any pharmaceutically acceptable salt or stereoisomer thereof.
3. A cationic lipid of Formula A according to Claim 1 ,
wherein:
Rl and R2 are each methyl; n is 2;
I S is independently selected from (C4-C20)alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R4 is independently selected from (C1-C16 )alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R1;
R5 is independently selected from (C4-C8) alkyl or alkenyl, said alkyl or alkenyl optionally substituted with one to three substituents selected from R';
R6 is independently selected from (C1 -C2 )alkyl, said alkyl optionally substituted with one to three substituents selected from R';
Ql and Q2 are each, independently, a bond or -C(0)0-, with the proviso that when either Ql Q2 is a bond then the other is not a bond; or any pharmaceutically acceptable salt or stereoisomer thereof.
4. A cationic lipid which is selected from: methyl (9Z)-19-(dimethylamino)octacos-9-enoate (Compound 1); methyl 8-{2-[9-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 2); methyl (9Z)-19-(dimethylamino)heptacos-9-enoate (Compound 3);
methyl (9Z)-19-(dimethylamino)hexacos-9-enoate (Compound 4);
methyl (9Z)-19-(dimethylamino)pentacos-9-enoate (Compound 5);
methyl (9Z)-21-(dimethylamino)triacont-9-enoate (Compound 6);
methyl (9Z)-21-(dimethylamino)nonacos-9-enoate (Compound 7);
methyl (9Z)-21-(dimethylamino)octacos-9-enoate (Compound 8);
methyl (9Z)-21-(dimethylamino)heptacos-9-enoate (Compound 9);
methyl (1 lZ)-19-(dimethylamino)octacos-l 1-enoate (Compound 10);
methyl (7Z)-19-(dimethylamino)octacos-7-enoate (Compound 11);
methyl 8- {2-[9-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 12); methyl 8- {2-[9-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 13); methyl 8- {2-[9-(dimethylamino)pentadecyl]cyclopropyl}octanoate (Compound 14); methyl 8- {2-[l l-(dimethylamino)icosyl]cyclopropyl}octanoate (Compound 15); methyl 8- {2-[l l-(dimethylamino)nonadecyl]cyclopropyl}octanoate (Compound 16); methyl 8-{2-[l l-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 17); methyl 8- {2-[l l-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 18); methyl 10-{2-[7-(dimethylamino)hexadecyl]cyclopropyl}decanoate (Compound 19); methyl 6-{2-[l l-(dimethylamino)icosyl]cyclopropyl}hexanoate (Compound 20); ethyl (7Z)-17-(dimethylamino)hexacos-7-enoate (Compound 21);
ethyl (7Z)-17-(dimethylamino)pentacos-7-enoate (Compound 22);
ethyl (7Z)-17-(dimethylamino)tetracos-7-enoate (Compound 23);
ethyl (7Z)-17-(dimethylamino)tricos-7-enoate (Compound 24);
ethyl (9Z)-17-(dimethylamino)hexacos-9-enoate (Compound 25);
ethyl (5Z)-17-(dimethylamino)hexacos-5-enoate (Compound 26);
ethyl (9Z)-19-(dimethylamino)octacos-9-enoate (Compound 27);
ethyl (9Z)-19-(dimethylamino)heptacos-9-enoate (Compound 28);
ethyl (9Z)-19-(dimethylamino)hexacos-9-enoate (Compound 29);
ethyl (9Z)-19-(dimethylamino)pentacos-9-enoate (Compound 30);
ethyl (9Z)-21-(dimethylamino)triacont-9-enoate (Compound 31);
ethyl (9Z)-21-(dimethylamino)nonacos-9-enoate (Compound 32);
ethyl (9Z)-21-(dimethylamino)octacos-9-enoate (Compound 33);
ethyl (9Z)-21-(dimethylamino)heptacos-9-enoate (Compound 34); ethyl 6-{2-[9-(dimethylamino)octadecyl]cyclopropyl}hexanoate (Compound 35); ethyl 6- {2-[9-(dimethylamino)heptadecyl]cyclopropyl}hexanoate (Compound 36);
ethyl 6-{2-[9-(dimethylamino)hexadecyl]cyclopropyl}hexanoate (Compound 37);
ethyl 6- {2-[9-(dimethylamino)pentadecyl]cyclopropyl}hexanoate (Compound 38);
ethyl 8- {2-[7-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 39);
ethyl 4- {2-[l l-(dimethylamino)icosyl]cyclopropyl}butanoate (Compound 40);
ethyl 8- {2-[9-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 41);
ethyl 8-{2-[9-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 42);
ethyl 8-{2-[9-(dimethylamino)hexadecyl]cyclopropyl}octanoate (Compound 43);
ethyl 8-{2-[9-(dimethylamino)pentadecyl]cyclopropyl}octanoate (Compound 44);
ethyl 8-{2-[l l-(dimethylamino)icosyl]cyclopropyl}octanoate (Compound 45);
ethyl 8-{2-[l l-(dimethylamino)nonadecyl]cyclopropyl}octanoate (Compound 46);
ethyl 8-{2-[l l-(dimethylamino)octadecyl]cyclopropyl}octanoate (Compound 47);
ethyl 8-{2-[l l-(dimethylamino)heptadecyl]cyclopropyl}octanoate (Compound 48);
methyl (9Z)-19-[(dimethylamino)methyl]octacos-9-enoate (Compound 49);
methyl 8-(2- {9-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 50); methyl (9Z)-19-[(dimethylamino)methyl]heptacos-9-enoate (Compound 51);
methyl (9Z)-19-[(dimethylamino)methyl]hexacos-9-enoate (Compound 52);
methyl (9Z)-19-[(dimethylamino)methyl]pentacos-9-enoate (Compound 53);
methyl (9Z)-21-[(dimethylamino)methyl]triacont-9-enoate (Compound 54);
methyl (9Z)-21-[(dimethylamino)methyl]nonacos-9-enoate (Compound 55);
methyl (9Z)-21-[(dimethylamino)methyl]octacos-9-enoate (Compound 56);
methyl (9Z)-21-[(dimethylamino)methyl]heptacos-9-enoate (Compound 57);
methyl (HZ)-19-[(dimethylamino)methyl]octacos-l l-enoate (Compound 58);
methyl (7Z)-19-[(dimethylamino)methyl]octacos-7-enoate (Compound 59);
methyl 8-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 60); methyl 8-(2-{9-[(dimethylamino)methyl]hexadecyl}cyclopropyl)octanoate (Compound 61); methyl 8-(2-{9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)octanoate (Compound 62); methyl 8-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)octanoate (Compound 63); methyl 8-(2-{l l-[(dimethylamino)methyl]nonadecyl}cyclopropyl)octanoate (Compound 64); methyl 8-(2-{l l-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 65); methyl 8-(2-{l l-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 66); methyl 10-(2-{7-[(dimethylamino)methyl]hexadecyl}cyclopropyl)decanoate (Compound 67); methyl 6-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)hexanoate (Compound 68); ethyl (7Z)-17-[(dimethylamino)methyl]hexacos-7-enoate (Compound 69);
ethyl (7Z)-17-[(dimethylamino)methyl]pentacos-7-enoate (Compound 70);
ethyl (7Z)-17-[(dimethylamino)methyl]tetracos-7-enoate (Compound 71);
ethyl (7Z)-17-[(dimethylamino)methyl]tricos-7-enoate (Compound 72);
ethyl (9Z)-17-[(dimethylamino)methyl]hexacos-9-enoate (Compound 73);
ethyl (5Z)-17-[(dimethylamino)methyl]hexacos-5-enoate (Compound 74);
ethyl (9Z)-19-[(dimethylamino)methyl]octacos-9-enoate (Compound 75);
ethyl (9Z)-19-[(dimethylamino)methyl]heptacos-9-enoate (Compound 76);
ethyl (9Z)-19-[(dimethylamino)methyl]hexacos-9-enoate (Compound 77);
ethyl (9Z)-19-[(dimethylamino)methyl]pentacos-9-enoate (Compound 78);
ethyl (9Z)-21-[(dimethylamino)methyl]triacont-9-enoate (Compound 79);
ethyl (9Z)-21-[(dimethylamino)methyl]nonacos-9-enoate (Compound 80);
ethyl (9Z)-21-[(dimethylamino)methyl]octacos-9-enoate (Compound 81);
ethyl (9Z)-21 - [(dimethyl amino)methyl]heptacos-9-enoate (Compound 82);
ethyl 6-(2-{9-[(dimethylamino)methyl]octadecyl}cyclopropyl)hexanoate (Compound 83); ethyl 6-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)hexanoate (Compound 84); ethyl 6-(2-{9-[(dimethylamino)methyl]hexadecyl}cyclopropyl)hexanoate (Compound 85); ethyl 6-(2-{9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)hexanoate (Compound 86); ethyl 8-(2-{7-[(dimethylamino)methyl]hexadecyl}cyclopropyl)octanoate (Compound 87); ethyl 4-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)butanoate (Compound 88); ethyl 8-(2-{9-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 89); ethyl 8-(2-{9-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 90); ethyl 8-(2- {9-[(dimethylamino)methyl]hexadecyl}cyclopropyl)octanoate (Compound 91); ethyl 8-(2-{9-[(dimethylamino)methyl]pentadecyl}cyclopropyl)octanoate (Compound 92); ethyl 8-(2-{l l-[(dimethylamino)methyl]icosyl}cyclopropyl)octanoate (Compound 93); ethyl 8-(2-{l l-[(dimethylamino)methyl]nonadecyl}cyclopropyl)octanoate (Compound 94); ethyl 8-(2-{l l-[(dimethylamino)methyl]octadecyl}cyclopropyl)octanoate (Compound 95); ethyl 8-(2-{l l-[(dimethylamino)methyl]heptadecyl}cyclopropyl)octanoate (Compound 96); methyl (9Z)-19-[2-(dimethylamino)ethyl]octacos-9-enoate (Compound 97);
methyl 8-(2-{9-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 98); methyl (9Z)-19-[2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 99);
methyl (9Z)-19-[2-(dimethylamino)ethyl]hexacos-9-enoate (Compound 100); methyl (9Z)-19-[2-(dimethylamino)ethyl]pentacos-9-enoate (Compound 101);
methyl (9Z)-21-[2-(dimethylamino)ethyl]triacont-9-enoate (Compound 102);
methyl (9Z)-21-[2-(dimethylamino)ethyl]nonacos-9-enoate (Compound 103);
methyl (9Z)-21-[2-(dimethylamino)ethyl]octacos-9-enoate (Compound 104);
methyl (9Z)-21-[2-(dimethylamino)ethyl]heptacos-9-enoate (Compound 105);
methyl (1 lZ)-19-[2-(dimethylamino)ethyl]octacos-l 1-enoate (Compound 106);
methyl (7Z)-19-[2-(dimethylamino)ethyl]octacos-7-enoate (Compound 107);
methyl 8- (2- {9-[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 108); methyl 8- (2- {9-[2-(dimethylamino)ethyl]hexadecyl} cyclopropyl)octanoate (Compound 109); methyl 8- (2- {9-[2-(dimethylamino)ethyl]pentadecyl}cyclopropyl)octanoate (Compound 110); methyl 8- [2- {] 11- ^2-(dimethylamino)ethyl]icosyl}cyclopropyl)octanoate (Compound 1 1 1); methyl 8- (2- {l 11- "2-(dimethylamino)ethyl]nonadecyl}cyclopropyl)octanoate (Compound 112); methyl 8- (2-{l L l- ;2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 113); methyl 8- (2-{1 11- ;2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 1 14); methyl 10 -(2- V- ^2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)decanoate (Compound 115); methyl 6- (2-{] 11- ^2-(dimethylamino)ethyl]icosyl}cyclopropyl)hexanoate (Compound 116); ethyl (7Z) -17- [2- (dimethylamino)ethyl]hexacos-7-enoate (Compound 1 17);
ethyl (7Z) -17- [2- (dimethylamino)ethyl]pentacos-7-enoate (Compound 118);
ethyl (7Z) -17- [2- (dimethylamino)ethyl]tetracos-7-enoate (Compound 119);
ethyl (7Z) -17- [2- (dimethylamino)ethyl]tricos-7-enoate (Compound 120);
ethyl (9Z) -17- [2- (dimethylamino)ethyl]hexacos-9-enoate (Compound 121);
ethyl (5Z) -17- [2- (dimethylamino)ethyl]hexacos-5-enoate (Compound 122);
ethyl (9Z) -19- [2- (dimethylamino)ethyl]octacos-9-enoate (Compound 123);
ethyl (9Z) -19- [2- (dimethylamino)ethyl]heptacos-9-enoate (Compound 124);
ethyl (9Z) -19- [2- (dimethylamino)ethyl]hexacos-9-enoate (Compound 125);
ethyl (9Z) -19- [2- (dimethylamino)ethyl]pentacos-9-enoate (Compound 126);
ethyl (9Z) -21- [2- (dimethylamino)ethyl]triacont-9-enoate (Compound 127);
ethyl (9Z) -21- [2- (dimethylamino)ethyl]nonacos-9-enoate (Compound 128);
ethyl (9Z) -21- [2- (dimethylamino)ethyl]octacos-9-enoate (Compound 129);
ethyl (9Z) -21- [2- (dimethylamino)ethyl]heptacos-9-enoate (Compound 130);
ethyl 6-(2-{9- 'dimethylamino)ethyl]octadecyl}cyclopropyl)hexanoate (Compound 131); ethyl 6-(2-{9- '2- ^dimethylamino)ethyl]heptadecyl} cyclopropyl)hexanoate (Compound 132); ethyl 6-(2-{9- ;2- ^dimethylamino)ethyl]hexadecyl } cyclopropyl)hexanoate (Compound 133); ethyl 6-(2-{9-[2-(dimethylamino)ethyl]pentadecyl}cyclopropyl)hexanoate (Compound 134); ethyl 8-(2-{7-[2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)octanoate (Compound 135); ethyl 4-(2-{l l-[2-(dimethylamino)ethyl]icosyl}cyclopropyl)butanoate (Compound 136); ethyl 8-(2-{9-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 137); ethyl 8-(2-{9-[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 138); ethyl 8-(2-{9-[2-(dimethylamino)ethyl]hexadecyl}cyclopropyl)octanoate (Compound 139); ethyl 8-(2-{9-[2-(dimethylamino)ethyl]pentadecyl}cyclopropyl)octanoate (Compound 140); ethyl 8-(2- {l l-[2-(dimethylamino)ethyl]icosyl}cyclopropyl)octanoate (Compound 141); ethyl 8-(2- {l l-[2-(dimethylamino)ethyl]nonadecyl}cyclopropyl)octanoate (Compound 142); ethyl 8-(2- {l l-[2-(dimethylamino)ethyl]octadecyl}cyclopropyl)octanoate (Compound 143); ethyl 8-(2- {l l -[2-(dimethylamino)ethyl]heptadecyl}cyclopropyl)octanoate (Compound 144); (2Z)-non-2-en-l -yl 10-(dimethylamino)nonadecanoate (Compound 145);
(2-hexylcyclopropyl)methyl 10-(dimethylamino)nonadecanoate (Compound 146);
(2Z)-undec-2-en-l-yl 8-(dimethylamino)heptadecanoate (Compound 147);
(2Z)-hept-2-en-l-yl 12-(dimethylamino)henicosanoate (Compound 148);
(2-octylcyclopropyl)methyl 8-(dimethylamino)heptadecanoate (Compound 149);
(2-butylcyclopropyl)methyl 12-(dimethylamino)henicosanoate (Compound 150);
(2Z)-non-2-en-l-yl 10-[(dimethylamino)methyl]nonadecanoate (Compound 151);
(2Z)-undec-2-en-l-yl 8-[(dimethylamino)methyl]heptadecanoate (Compound 152);
(2Z)-hept-2-en-l-yl 12-[(dimethylamino)methyl]henicosanoate (Compound 153);
(2-hexylcyclopropyl)methyl 10-[(dimethylamino)methyl]nonadecanoate (Compound 154); (2-octylcyclopropyl)methyl 8-[(dimethylamino)methyl]heptadecanoate (Compound 155); (2-butylcyclopropyl)methyl 12-[(dimethylamino)methyl]henicosanoate (Compound 156); (2Z)-non-2-en-l -yl 10-[2-(dimethylamino)ethyl]nonadecanoate (Compound 157);
(2Z)-undec-2-en-l-yl 8-[2-(dimethylamino)ethyl]heptadecanoate (Compound 158);
(2Z)-hept-2-en-l-yl 12-[2-(dimethylamino)ethyl]henicosanoate (Compound 159);
(2-hexylcyclopropyl)methyl 10-[2-(dimethylamino)ethyl]nonadecanoate (Compound 160); (2-octylcyclopropyl)methyl 8-[2-(dimethylamino)ethyl]heptadecanoate (Compound 161); (2-butylcyclopropyl)methyl 12-[2-(dimethylamino)ethyl]henicosanoate (Compound 162); methyl (19Z,22Z)-9-(dimethylamino)octacosa-19,22-dienoate (Compound 163);
ethyl (18Z,21Z)-8-(dimethylamino)heptacosa-18,21-dienoate (Compound 164);
methyl 9-(dimethylamino)-16-(2-octylcyclopropyl)hexadecanoate (Compound 165);
ethyl 8-(dimethylamino)-15-(2-octylcyclopropyl)pentadecanoate (Compound 166); methyl (19Z,22Z)-9-[(dimethylamino)methyl]octacosa-19,22-dienoate (Compound 167);
ethyl (18Z,21Z)-8-[(dimethylamino)methyl]heptacosa-18,21-dienoate (Compound 168);
methyl 9-[(dimethylamino)methyl]-16-(2-octylcyclopropyl)hexadecanoate (Compound 169); ethyl 8-[(dimethylamino)methyl]-15-(2-octylcyclopropyl)pentadecanoate (Compound 170); methyl (19Z,22Z)-9-[2-(dimethylamino)ethyl]octacosa-19,22-dienoate (Compound 171);
ethyl (18Z,21Z)-8-[2-(dimethylamino)ethyl]heptacosa-18,21-dienoate (Compound 172);
methyl 9-[2-(dimethylamino)ethyl]-16-(2-octylcyclopropyl)hexadecanoate (Compound 173); ethyl 8-[2-(dimethylamino)ethyl]-15-(2-octylcyclopropyl)pentadecanoate (Compound 174); dimethyl (9Z)-19-(dimethylamino)heptacos-9-enedioate (Compound 175); and
1 -methyl 18-[(2Z)-non-2-en-l-yl] 9-(dimethylamino)octadecanedioate (Compound 176); or any pharmaceutically acceptable salt or stereoisomer thereof.
5. An LNP composition which comprises, a cationic lipid of Formula A according to Claim 1 , cholesterol, DSPC and PEG-DMG.
6. The use of a cationic lipid according to Claim 1 for the preparation of lipid nanoparticles.
7. The use of a cationic lipid according to Claim 1 as a component in a lipid nanoparticle for the delivery of oligonucleotides.
8. The use according to Claim 9 wherein the oligonucleotides are siRNA.
PCT/US2013/023359 2012-02-01 2013-01-28 Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery WO2013116126A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261593597P 2012-02-01 2012-02-01
US61/593,597 2012-02-01

Publications (1)

Publication Number Publication Date
WO2013116126A1 true WO2013116126A1 (en) 2013-08-08

Family

ID=48905726

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/023359 WO2013116126A1 (en) 2012-02-01 2013-01-28 Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery

Country Status (1)

Country Link
WO (1) WO2013116126A1 (en)

Cited By (130)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014152211A1 (en) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
WO2015034928A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Chimeric polynucleotides
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
JP2015520733A (en) * 2012-04-19 2015-07-23 サーナ・セラピューティクス・インコーポレイテッドＳｉｒｎａ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． Novel diester and triester-based low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
CN105153246A (en) * 2015-08-05 2015-12-16 广州嘉德乐生化科技有限公司 Preparation method of sucrose fatty acid ester and milk beverage composition of sucrose fatty acid ester
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
WO2017070613A1 (en) 2015-10-22 2017-04-27 Modernatx, Inc. Human cytomegalovirus vaccine
WO2017112943A1 (en) 2015-12-23 2017-06-29 Modernatx, Inc. Methods of using ox40 ligand encoding polynucleotides
WO2017111172A1 (en) * 2015-12-25 2017-06-29 協和発酵キリン株式会社 Compounds as cationic lipids
WO2017120612A1 (en) 2016-01-10 2017-07-13 Modernatx, Inc. Therapeutic mrnas encoding anti ctla-4 antibodies
WO2017201332A1 (en) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucleotides encoding acyl-coa dehydrogenase, very long-chain for the treatment of very long-chain acyl-coa dehydrogenase deficiency
WO2018081459A1 (en) 2016-10-26 2018-05-03 Modernatx, Inc. Messenger ribonucleic acids for enhancing immune responses and methods of use thereof
WO2018144775A1 (en) 2017-02-01 2018-08-09 Modernatx, Inc. Immunomodulatory therapeutic mrna compositions encoding activating oncogene mutation peptides
WO2018213789A1 (en) 2017-05-18 2018-11-22 Modernatx, Inc. Modified messenger rna comprising functional rna elements
WO2018232006A1 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Polynucleotides encoding coagulation factor viii
WO2019036670A2 (en) 2017-08-18 2019-02-21 Modernatx, Inc. Efficacious mrna vaccines
WO2019104152A1 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders
WO2019104195A1 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits for the treatment of propionic acidemia
WO2019104160A2 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding phenylalanine hydroxylase for the treatment of phenylketonuria
CN109952285A (en) * 2016-11-08 2019-06-28 罗地亚经营管理公司 The method of decarboxylation assimilation for fatty acid or derivative of fatty acid
WO2019136241A1 (en) 2018-01-05 2019-07-11 Modernatx, Inc. Polynucleotides encoding anti-chikungunya virus antibodies
WO2019200171A1 (en) 2018-04-11 2019-10-17 Modernatx, Inc. Messenger rna comprising functional rna elements
WO2019226650A1 (en) 2018-05-23 2019-11-28 Modernatx, Inc. Delivery of dna
WO2020003006A2 (en) 2018-06-28 2020-01-02 Crispr Therapeutics Ag Compositions and methods for genomic editing by insertion of donor polynucleotides
WO2020023390A1 (en) 2018-07-25 2020-01-30 Modernatx, Inc. Mrna based enzyme replacement therapy combined with a pharmacological chaperone for the treatment of lysosomal storage disorders
WO2020047201A1 (en) 2018-09-02 2020-03-05 Modernatx, Inc. Polynucleotides encoding very long-chain acyl-coa dehydrogenase for the treatment of very long-chain acyl-coa dehydrogenase deficiency
WO2020056239A1 (en) 2018-09-14 2020-03-19 Modernatx, Inc. Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
WO2020056155A2 (en) 2018-09-13 2020-03-19 Modernatx, Inc. Polynucleotides encoding branched-chain alpha-ketoacid dehydrogenase complex e1-alpha, e1-beta, and e2 subunits for the treatment of maple syrup urine disease
WO2020056147A2 (en) 2018-09-13 2020-03-19 Modernatx, Inc. Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease
WO2020061295A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. High-purity peg lipids and uses thereof
WO2020061284A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. Peg lipids and uses thereof
WO2020069169A1 (en) 2018-09-27 2020-04-02 Modernatx, Inc. Polynucleotides encoding arginase 1 for the treatment of arginase deficiency
WO2020072324A1 (en) * 2018-10-01 2020-04-09 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
WO2020097409A2 (en) 2018-11-08 2020-05-14 Modernatx, Inc. Use of mrna encoding ox40l to treat cancer in human patients
WO2020227642A1 (en) 2019-05-08 2020-11-12 Modernatx, Inc. Compositions for skin and wounds and methods of use thereof
WO2020227615A1 (en) 2019-05-08 2020-11-12 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2020263985A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Messenger rna comprising functional rna elements and uses thereof
WO2020263883A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Endonuclease-resistant messenger rna and uses thereof
WO2021016075A1 (en) 2019-07-19 2021-01-28 Flagship Pioneering Innovations Vi, Llc Recombinase compositions and methods of use
WO2021061707A1 (en) 2019-09-23 2021-04-01 Omega Therapeutics, Inc. Compositions and methods for modulating apolipoprotein b (apob) gene expression
WO2021061815A1 (en) 2019-09-23 2021-04-01 Omega Therapeutics, Inc. COMPOSITIONS AND METHODS FOR MODULATING HEPATOCYTE NUCLEAR FACTOR 4-ALPHA (HNF4α) GENE EXPRESSION
WO2021183720A1 (en) 2020-03-11 2021-09-16 Omega Therapeutics, Inc. Compositions and methods for modulating forkhead box p3 (foxp3) gene expression
WO2021195218A1 (en) 2020-03-24 2021-09-30 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing gaucher therapeutics
WO2021195214A1 (en) 2020-03-24 2021-09-30 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing factor ix therapeutics
WO2021216572A1 (en) 2020-04-20 2021-10-28 Massachusetts Institute Of Technology Lipid compositions for delivery of sting agonist compounds and uses thereof
WO2021229502A1 (en) 2020-05-15 2021-11-18 Crispr Therapeutics Ag Messenger rna encoding cas9 for use in genome-editing systems
WO2021236930A1 (en) 2020-05-20 2021-11-25 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and uses thereof
WO2021236980A1 (en) 2020-05-20 2021-11-25 Flagship Pioneering Innovations Vi, Llc Coronavirus antigen compositions and their uses
WO2021243290A1 (en) 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods relating thereto
WO2021243301A2 (en) 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc. Trem compositions and methods relating thereto
WO2021247507A1 (en) 2020-06-01 2021-12-09 Modernatx, Inc. Phenylalanine hydroxylase variants and uses thereof
WO2021252354A1 (en) 2020-06-12 2021-12-16 University Of Rochester ENCODING AND EXPRESSION OF ACE-tRNAs
WO2022023284A1 (en) 2020-07-27 2022-02-03 Anjarium Biosciences Ag Compositions of dna molecules, methods of making therefor, and methods of use thereof
WO2022032154A2 (en) 2020-08-06 2022-02-10 Modernatx, Inc. Compositions for the delivery of payload molecules to airway epithelium
WO2022051629A1 (en) 2020-09-03 2022-03-10 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and uses thereof
WO2022104131A1 (en) 2020-11-13 2022-05-19 Modernatx, Inc. Polynucleotides encoding cystic fibrosis transmembrane conductance regulator for the treatment of cystic fibrosis
WO2022140702A1 (en) 2020-12-23 2022-06-30 Flagship Pioneering, Inc. Compositions of modified trems and uses thereof
WO2022162027A2 (en) 2021-01-27 2022-08-04 Curevac Ag Method of reducing the immunostimulatory properties of in vitro transcribed rna
EP4046629A1 (en) 2021-02-19 2022-08-24 ModernaTX, Inc. Lipid nanoparticle compositions and methods of formulating the same
WO2022204380A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits and uses thereof
WO2022204370A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles and polynucleotides encoding ornithine transcarbamylase for the treatment of ornithine transcarbamylase deficiency
WO2022204371A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding glucose-6-phosphatase and uses thereof
WO2022204390A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding phenylalanine hydroxylase and uses thereof
WO2022204369A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2022212784A1 (en) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Thanotransmission polypeptides and their use in treating cancer
WO2022212711A2 (en) 2021-04-01 2022-10-06 Modernatx, Inc. Methods for identification and ratio determination of rna species in multivalent rna compositions
WO2022223556A1 (en) 2021-04-20 2022-10-27 Anjarium Biosciences Ag Compositions of dna molecules encoding amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase, methods of making thereof, and methods of use thereof
WO2022232286A1 (en) 2021-04-27 2022-11-03 Generation Bio Co. Non-viral dna vectors expressing anti-coronavirus antibodies and uses thereof
WO2022232289A1 (en) 2021-04-27 2022-11-03 Generation Bio Co. Non-viral dna vectors expressing therapeutic antibodies and uses thereof
WO2022240806A1 (en) 2021-05-11 2022-11-17 Modernatx, Inc. Non-viral delivery of dna for prolonged polypeptide expression in vivo
WO2022246020A1 (en) 2021-05-19 2022-11-24 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2022266083A2 (en) 2021-06-15 2022-12-22 Modernatx, Inc. Engineered polynucleotides for cell-type or microenvironment-specific expression
WO2022271776A1 (en) 2021-06-22 2022-12-29 Modernatx, Inc. Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
WO2023283359A2 (en) 2021-07-07 2023-01-12 Omega Therapeutics, Inc. Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression
WO2023287751A1 (en) 2021-07-12 2023-01-19 Modernatx, Inc. Polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits for the treatment of propionic acidemia
WO2023009547A1 (en) 2021-07-26 2023-02-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and uses thereof
WO2023009499A1 (en) 2021-07-27 2023-02-02 Modernatx, Inc. Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease type 1a (gsd1a)
WO2023015261A1 (en) 2021-08-04 2023-02-09 Modernatx, Inc. Mrnas encoding chimeric metabolic reprogramming polypeptides and uses thereof
US11590229B2 (en) 2011-12-07 2023-02-28 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
WO2023044006A1 (en) 2021-09-17 2023-03-23 Flagship Pioneering Innovations Vi, Llc Compositions and methods for producing circular polyribonucleotides
WO2023056044A1 (en) 2021-10-01 2023-04-06 Modernatx, Inc. Polynucleotides encoding relaxin for the treatment of fibrosis and/or cardiovascular disease
WO2023069397A1 (en) 2021-10-18 2023-04-27 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2023077148A1 (en) 2021-11-01 2023-05-04 Tome Biosciences, Inc. Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo
WO2023077170A1 (en) 2021-11-01 2023-05-04 Modernatx, Inc. Polynucleotides encoding integrin beta-6 and methods of use thereof
WO2023081526A1 (en) 2021-11-08 2023-05-11 Orna Therapeutics, Inc. Lipid nanoparticle compositions for delivering circular polynucleotides
WO2023086465A1 (en) 2021-11-12 2023-05-19 Modernatx, Inc. Compositions for the delivery of payload molecules to airway epithelium
WO2023097003A2 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and their uses
WO2023096963A1 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovations Vi, Llc Varicella-zoster virus immunogen compositions and their uses
WO2023096990A1 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovation Vi, Llc Coronavirus immunogen compositions and their uses
WO2023115013A1 (en) 2021-12-17 2023-06-22 Flagship Pioneering Innovations Vi, Llc Methods for enrichment of circular rna under denaturing conditions
WO2023122745A1 (en) 2021-12-22 2023-06-29 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2023122764A1 (en) 2021-12-22 2023-06-29 Tome Biosciences, Inc. Co-delivery of a gene editor construct and a donor template
WO2023122789A1 (en) 2021-12-23 2023-06-29 Flagship Pioneering Innovations Vi, Llc Circular polyribonucleotides encoding antifusogenic polypeptides
WO2023135273A2 (en) 2022-01-14 2023-07-20 Anjarium Biosciences Ag Compositions of dna molecules encoding factor viii, methods of making thereof, and methods of use thereof
WO2023150753A1 (en) 2022-02-07 2023-08-10 University Of Rochester Optimized sequences for enhanced trna expression or/and nonsense mutation suppression
WO2023154818A1 (en) 2022-02-09 2023-08-17 Modernatx, Inc. Mucosal administration methods and formulations
WO2023159197A1 (en) 2022-02-18 2023-08-24 Modernatx, Inc. Mrnas encoding checkpoint cancer vaccines and uses thereof
WO2023161350A1 (en) 2022-02-24 2023-08-31 Io Biotech Aps Nucleotide delivery of cancer therapy
WO2023177655A1 (en) 2022-03-14 2023-09-21 Generation Bio Co. Heterologous prime boost vaccine compositions and methods of use
WO2023177904A1 (en) 2022-03-18 2023-09-21 Modernatx, Inc. Sterile filtration of lipid nanoparticles and filtration analysis thereof for biological applications
WO2023183909A2 (en) 2022-03-25 2023-09-28 Modernatx, Inc. Polynucleotides encoding fanconi anemia, complementation group proteins for the treatment of fanconi anemia
WO2023183616A1 (en) 2022-03-25 2023-09-28 Senda Biosciences, Inc. Novel ionizable lipids and lipid nanoparticles and methods of using the same
WO2023196399A1 (en) 2022-04-06 2023-10-12 Modernatx, Inc. Lipid nanoparticles and polynucleotides encoding argininosuccinate lyase for the treatment of argininosuccinic aciduria
WO2023196634A2 (en) 2022-04-08 2023-10-12 Flagship Pioneering Innovations Vii, Llc Vaccines and related methods
WO2023201204A1 (en) 2022-04-11 2023-10-19 Modernatx, Inc. Detection of mrna purity in a mixture
WO2023205744A1 (en) 2022-04-20 2023-10-26 Tome Biosciences, Inc. Programmable gene insertion compositions
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
WO2023215831A1 (en) 2022-05-04 2023-11-09 Tome Biosciences, Inc. Guide rna compositions for programmable gene insertion
WO2023220083A1 (en) 2022-05-09 2023-11-16 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods of use for treating proliferative disorders
WO2023220729A2 (en) 2022-05-13 2023-11-16 Flagship Pioneering Innovations Vii, Llc Double stranded dna compositions and related methods
WO2023225524A1 (en) 2022-05-17 2023-11-23 Modernatx, Inc. Preparation of highly concentrated mrna
WO2023225670A2 (en) 2022-05-20 2023-11-23 Tome Biosciences, Inc. Ex vivo programmable gene insertion
WO2023239756A1 (en) 2022-06-07 2023-12-14 Generation Bio Co. Lipid nanoparticle compositions and uses thereof
WO2023248125A1 (en) 2022-06-20 2023-12-28 Crispr Therapeutics Ag Cd117-targeting nanoparticles for use in drug delivery
WO2023250119A1 (en) 2022-06-24 2023-12-28 Modernatx, Inc. Methods of producing rna
WO2023250112A1 (en) 2022-06-22 2023-12-28 Flagship Pioneering Innovations Vi, Llc Compositions of modified trems and uses thereof
WO2024026254A1 (en) 2022-07-26 2024-02-01 Modernatx, Inc. Engineered polynucleotides for temporal control of expression
WO2024030856A2 (en) 2022-08-01 2024-02-08 Flagship Pioneering Innovations Vii, Llc Immunomodulatory proteins and related methods
WO2024035952A1 (en) 2022-08-12 2024-02-15 Remix Therapeutics Inc. Methods and compositions for modulating splicing at alternative splice sites
WO2024040222A1 (en) 2022-08-19 2024-02-22 Generation Bio Co. Cleavable closed-ended dna (cedna) and methods of use thereof
WO2024044147A1 (en) 2022-08-23 2024-02-29 Modernatx, Inc. Methods for purification of ionizable lipids
WO2024049979A2 (en) 2022-08-31 2024-03-07 Senda Biosciences, Inc. Novel ionizable lipids and lipid nanoparticles and methods of using the same
WO2024077191A1 (en) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Nucleic acid molecules encoding trif and additionalpolypeptides and their use in treating cancer
WO2024097664A1 (en) 2022-10-31 2024-05-10 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2024097639A1 (en) 2022-10-31 2024-05-10 Modernatx, Inc. Hsa-binding antibodies and binding proteins and uses thereof
WO2024102799A1 (en) 2022-11-08 2024-05-16 Flagship Pioneering Innovations Vi, Llc Compositions and methods for producing circular polyribonucleotides
WO2024102677A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Circular rna compositions
WO2024102762A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Lipids and lipid nanoparticle compositions for delivering polynucleotides
WO2024102730A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Lipids and nanoparticle compositions for delivering polynucleotides

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003094971A1 (en) * 2002-05-10 2003-11-20 Johns Hopkins Singapore Pte Ltd Cationic lipids for intracellular delivery of bioactive substances
WO2011153493A2 (en) * 2010-06-03 2011-12-08 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003094971A1 (en) * 2002-05-10 2003-11-20 Johns Hopkins Singapore Pte Ltd Cationic lipids for intracellular delivery of bioactive substances
WO2011153493A2 (en) * 2010-06-03 2011-12-08 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DATABASE PUBCHEM 2005, retrieved from http://pubchem.ncbi.nlm.nih.gov/summary/summary.cgi?cid=599141 accession no. 99141. *
MONTIER ET AL.: "Progress in Cationic Lipid-Mediated Gene Transfection: A Series of Bio- Inspired Lipids as an Example.", CURRENT GENE THERAPY, vol. 8, 2008, pages 296 - 312 *
WETZER ET AL.: "Reducible cationic lipids for gene transfer.", BIOCHEM J, vol. 356, 2001, pages 747 - 756 *

Cited By (145)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11612657B2 (en) 2011-12-07 2023-03-28 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
US11590229B2 (en) 2011-12-07 2023-02-28 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
US11633480B2 (en) 2011-12-07 2023-04-25 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
US11633479B2 (en) 2011-12-07 2023-04-25 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
US11679158B2 (en) 2011-12-07 2023-06-20 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
JP2015520733A (en) * 2012-04-19 2015-07-23 サーナ・セラピューティクス・インコーポレイテッドＳｉｒｎａ Ｔｈｅｒａｐｅｕｔｉｃｓ，Ｉｎｃ． Novel diester and triester-based low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
WO2014152211A1 (en) 2013-03-14 2014-09-25 Moderna Therapeutics, Inc. Formulation and delivery of modified nucleoside, nucleotide, and nucleic acid compositions
WO2015034925A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Circular polynucleotides
WO2015034928A1 (en) 2013-09-03 2015-03-12 Moderna Therapeutics, Inc. Chimeric polynucleotides
WO2015051214A1 (en) 2013-10-03 2015-04-09 Moderna Therapeutics, Inc. Polynucleotides encoding low density lipoprotein receptor
WO2016014846A1 (en) 2014-07-23 2016-01-28 Moderna Therapeutics, Inc. Modified polynucleotides for the production of intrabodies
CN105153246A (en) * 2015-08-05 2015-12-16 广州嘉德乐生化科技有限公司 Preparation method of sucrose fatty acid ester and milk beverage composition of sucrose fatty acid ester
WO2017070613A1 (en) 2015-10-22 2017-04-27 Modernatx, Inc. Human cytomegalovirus vaccine
WO2017112943A1 (en) 2015-12-23 2017-06-29 Modernatx, Inc. Methods of using ox40 ligand encoding polynucleotides
EP4039699A1 (en) 2015-12-23 2022-08-10 ModernaTX, Inc. Methods of using ox40 ligand encoding polynucleotides
JPWO2017111172A1 (en) * 2015-12-25 2018-10-18 協和発酵キリン株式会社 Compounds as cationic lipids
US20190008975A1 (en) * 2015-12-25 2019-01-10 Kyowa Hakko Kirin Co., Ltd. Compound as cationic lipid
US10525138B2 (en) 2015-12-25 2020-01-07 Kyowa Hakko Kirin Co., Ltd. Compound as cationic lipid
WO2017111172A1 (en) * 2015-12-25 2017-06-29 協和発酵キリン株式会社 Compounds as cationic lipids
WO2017120612A1 (en) 2016-01-10 2017-07-13 Modernatx, Inc. Therapeutic mrnas encoding anti ctla-4 antibodies
WO2017201332A1 (en) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucleotides encoding acyl-coa dehydrogenase, very long-chain for the treatment of very long-chain acyl-coa dehydrogenase deficiency
WO2018081459A1 (en) 2016-10-26 2018-05-03 Modernatx, Inc. Messenger ribonucleic acids for enhancing immune responses and methods of use thereof
CN109952285A (en) * 2016-11-08 2019-06-28 罗地亚经营管理公司 The method of decarboxylation assimilation for fatty acid or derivative of fatty acid
WO2018144775A1 (en) 2017-02-01 2018-08-09 Modernatx, Inc. Immunomodulatory therapeutic mrna compositions encoding activating oncogene mutation peptides
EP4253544A2 (en) 2017-05-18 2023-10-04 ModernaTX, Inc. Modified messenger rna comprising functional rna elements
WO2018213789A1 (en) 2017-05-18 2018-11-22 Modernatx, Inc. Modified messenger rna comprising functional rna elements
WO2018232006A1 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Polynucleotides encoding coagulation factor viii
WO2019036670A2 (en) 2017-08-18 2019-02-21 Modernatx, Inc. Efficacious mrna vaccines
WO2019104160A2 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding phenylalanine hydroxylase for the treatment of phenylketonuria
WO2019104195A1 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits for the treatment of propionic acidemia
WO2019104152A1 (en) 2017-11-22 2019-05-31 Modernatx, Inc. Polynucleotides encoding ornithine transcarbamylase for the treatment of urea cycle disorders
WO2019136241A1 (en) 2018-01-05 2019-07-11 Modernatx, Inc. Polynucleotides encoding anti-chikungunya virus antibodies
WO2019200171A1 (en) 2018-04-11 2019-10-17 Modernatx, Inc. Messenger rna comprising functional rna elements
WO2019226650A1 (en) 2018-05-23 2019-11-28 Modernatx, Inc. Delivery of dna
US11332760B2 (en) 2018-06-28 2022-05-17 Crispr Therapeutics Ag Compositions and methods for genomic editing by insertion of donor polynucleotides
WO2020003006A2 (en) 2018-06-28 2020-01-02 Crispr Therapeutics Ag Compositions and methods for genomic editing by insertion of donor polynucleotides
WO2020023390A1 (en) 2018-07-25 2020-01-30 Modernatx, Inc. Mrna based enzyme replacement therapy combined with a pharmacological chaperone for the treatment of lysosomal storage disorders
WO2020047201A1 (en) 2018-09-02 2020-03-05 Modernatx, Inc. Polynucleotides encoding very long-chain acyl-coa dehydrogenase for the treatment of very long-chain acyl-coa dehydrogenase deficiency
WO2020056155A2 (en) 2018-09-13 2020-03-19 Modernatx, Inc. Polynucleotides encoding branched-chain alpha-ketoacid dehydrogenase complex e1-alpha, e1-beta, and e2 subunits for the treatment of maple syrup urine disease
WO2020056147A2 (en) 2018-09-13 2020-03-19 Modernatx, Inc. Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease
WO2020056239A1 (en) 2018-09-14 2020-03-19 Modernatx, Inc. Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
WO2020061295A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. High-purity peg lipids and uses thereof
WO2020061284A1 (en) 2018-09-19 2020-03-26 Modernatx, Inc. Peg lipids and uses thereof
WO2020069169A1 (en) 2018-09-27 2020-04-02 Modernatx, Inc. Polynucleotides encoding arginase 1 for the treatment of arginase deficiency
CN113164379A (en) * 2018-10-01 2021-07-23 阿尔尼拉姆医药品有限公司 Biodegradable lipids for delivery of active agents
EP4218722A3 (en) * 2018-10-01 2023-10-11 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
JP7387745B2 (en) 2018-10-01 2023-11-28 アルニラム・ファーマシューティカルズ・インコーポレーテッド Biodegradable lipids for the delivery of active substances
CN113164379B (en) * 2018-10-01 2024-04-16 阿尔尼拉姆医药品有限公司 Biodegradable lipids for delivery of active agents
WO2020072324A1 (en) * 2018-10-01 2020-04-09 Alnylam Pharmaceuticals, Inc. Biodegradable lipids for the delivery of active agents
JP2022508511A (en) * 2018-10-01 2022-01-19 アルニラム・ファーマシューティカルズ・インコーポレーテッド Biodegradable lipids for delivery of active substances
WO2020097409A2 (en) 2018-11-08 2020-05-14 Modernatx, Inc. Use of mrna encoding ox40l to treat cancer in human patients
WO2020227615A1 (en) 2019-05-08 2020-11-12 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2020227642A1 (en) 2019-05-08 2020-11-12 Modernatx, Inc. Compositions for skin and wounds and methods of use thereof
WO2020263985A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Messenger rna comprising functional rna elements and uses thereof
WO2020263883A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Endonuclease-resistant messenger rna and uses thereof
WO2021016075A1 (en) 2019-07-19 2021-01-28 Flagship Pioneering Innovations Vi, Llc Recombinase compositions and methods of use
WO2021061815A1 (en) 2019-09-23 2021-04-01 Omega Therapeutics, Inc. COMPOSITIONS AND METHODS FOR MODULATING HEPATOCYTE NUCLEAR FACTOR 4-ALPHA (HNF4α) GENE EXPRESSION
WO2021061707A1 (en) 2019-09-23 2021-04-01 Omega Therapeutics, Inc. Compositions and methods for modulating apolipoprotein b (apob) gene expression
WO2021183720A1 (en) 2020-03-11 2021-09-16 Omega Therapeutics, Inc. Compositions and methods for modulating forkhead box p3 (foxp3) gene expression
WO2021195214A1 (en) 2020-03-24 2021-09-30 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing factor ix therapeutics
WO2021195218A1 (en) 2020-03-24 2021-09-30 Generation Bio Co. Non-viral dna vectors and uses thereof for expressing gaucher therapeutics
WO2021216572A1 (en) 2020-04-20 2021-10-28 Massachusetts Institute Of Technology Lipid compositions for delivery of sting agonist compounds and uses thereof
WO2021229502A1 (en) 2020-05-15 2021-11-18 Crispr Therapeutics Ag Messenger rna encoding cas9 for use in genome-editing systems
WO2021236930A1 (en) 2020-05-20 2021-11-25 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and uses thereof
WO2021236980A1 (en) 2020-05-20 2021-11-25 Flagship Pioneering Innovations Vi, Llc Coronavirus antigen compositions and their uses
WO2021243301A2 (en) 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc. Trem compositions and methods relating thereto
WO2021243290A1 (en) 2020-05-29 2021-12-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods relating thereto
WO2021247507A1 (en) 2020-06-01 2021-12-09 Modernatx, Inc. Phenylalanine hydroxylase variants and uses thereof
WO2021252354A1 (en) 2020-06-12 2021-12-16 University Of Rochester ENCODING AND EXPRESSION OF ACE-tRNAs
WO2022023284A1 (en) 2020-07-27 2022-02-03 Anjarium Biosciences Ag Compositions of dna molecules, methods of making therefor, and methods of use thereof
WO2022032154A2 (en) 2020-08-06 2022-02-10 Modernatx, Inc. Compositions for the delivery of payload molecules to airway epithelium
WO2022051629A1 (en) 2020-09-03 2022-03-10 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and uses thereof
WO2022104131A1 (en) 2020-11-13 2022-05-19 Modernatx, Inc. Polynucleotides encoding cystic fibrosis transmembrane conductance regulator for the treatment of cystic fibrosis
WO2022140702A1 (en) 2020-12-23 2022-06-30 Flagship Pioneering, Inc. Compositions of modified trems and uses thereof
WO2022162027A2 (en) 2021-01-27 2022-08-04 Curevac Ag Method of reducing the immunostimulatory properties of in vitro transcribed rna
EP4046629A1 (en) 2021-02-19 2022-08-24 ModernaTX, Inc. Lipid nanoparticle compositions and methods of formulating the same
WO2022204369A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2022204390A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding phenylalanine hydroxylase and uses thereof
WO2022204371A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding glucose-6-phosphatase and uses thereof
WO2022204370A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles and polynucleotides encoding ornithine transcarbamylase for the treatment of ornithine transcarbamylase deficiency
WO2022204380A1 (en) 2021-03-24 2022-09-29 Modernatx, Inc. Lipid nanoparticles containing polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits and uses thereof
WO2022212784A1 (en) 2021-03-31 2022-10-06 Flagship Pioneering Innovations V, Inc. Thanotransmission polypeptides and their use in treating cancer
WO2022212711A2 (en) 2021-04-01 2022-10-06 Modernatx, Inc. Methods for identification and ratio determination of rna species in multivalent rna compositions
WO2022223556A1 (en) 2021-04-20 2022-10-27 Anjarium Biosciences Ag Compositions of dna molecules encoding amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase, methods of making thereof, and methods of use thereof
WO2022232286A1 (en) 2021-04-27 2022-11-03 Generation Bio Co. Non-viral dna vectors expressing anti-coronavirus antibodies and uses thereof
WO2022232289A1 (en) 2021-04-27 2022-11-03 Generation Bio Co. Non-viral dna vectors expressing therapeutic antibodies and uses thereof
WO2022240806A1 (en) 2021-05-11 2022-11-17 Modernatx, Inc. Non-viral delivery of dna for prolonged polypeptide expression in vivo
WO2022246020A1 (en) 2021-05-19 2022-11-24 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase for the treatment of methylmalonic acidemia
WO2022266083A2 (en) 2021-06-15 2022-12-22 Modernatx, Inc. Engineered polynucleotides for cell-type or microenvironment-specific expression
WO2022271776A1 (en) 2021-06-22 2022-12-29 Modernatx, Inc. Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
WO2023283359A2 (en) 2021-07-07 2023-01-12 Omega Therapeutics, Inc. Compositions and methods for modulating secreted frizzled receptor protein 1 (sfrp1) gene expression
WO2023287751A1 (en) 2021-07-12 2023-01-19 Modernatx, Inc. Polynucleotides encoding propionyl-coa carboxylase alpha and beta subunits for the treatment of propionic acidemia
WO2023009547A1 (en) 2021-07-26 2023-02-02 Flagship Pioneering Innovations Vi, Llc Trem compositions and uses thereof
WO2023009499A1 (en) 2021-07-27 2023-02-02 Modernatx, Inc. Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease type 1a (gsd1a)
WO2023015261A1 (en) 2021-08-04 2023-02-09 Modernatx, Inc. Mrnas encoding chimeric metabolic reprogramming polypeptides and uses thereof
WO2023044006A1 (en) 2021-09-17 2023-03-23 Flagship Pioneering Innovations Vi, Llc Compositions and methods for producing circular polyribonucleotides
WO2023056044A1 (en) 2021-10-01 2023-04-06 Modernatx, Inc. Polynucleotides encoding relaxin for the treatment of fibrosis and/or cardiovascular disease
WO2023069397A1 (en) 2021-10-18 2023-04-27 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2023077170A1 (en) 2021-11-01 2023-05-04 Modernatx, Inc. Polynucleotides encoding integrin beta-6 and methods of use thereof
WO2023077148A1 (en) 2021-11-01 2023-05-04 Tome Biosciences, Inc. Single construct platform for simultaneous delivery of gene editing machinery and nucleic acid cargo
WO2023081526A1 (en) 2021-11-08 2023-05-11 Orna Therapeutics, Inc. Lipid nanoparticle compositions for delivering circular polynucleotides
WO2023086465A1 (en) 2021-11-12 2023-05-19 Modernatx, Inc. Compositions for the delivery of payload molecules to airway epithelium
WO2023097003A2 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovations Vi, Llc Immunogenic compositions and their uses
WO2023096963A1 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovations Vi, Llc Varicella-zoster virus immunogen compositions and their uses
WO2023096990A1 (en) 2021-11-24 2023-06-01 Flagship Pioneering Innovation Vi, Llc Coronavirus immunogen compositions and their uses
WO2023115013A1 (en) 2021-12-17 2023-06-22 Flagship Pioneering Innovations Vi, Llc Methods for enrichment of circular rna under denaturing conditions
WO2023122745A1 (en) 2021-12-22 2023-06-29 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2023122764A1 (en) 2021-12-22 2023-06-29 Tome Biosciences, Inc. Co-delivery of a gene editor construct and a donor template
WO2023122789A1 (en) 2021-12-23 2023-06-29 Flagship Pioneering Innovations Vi, Llc Circular polyribonucleotides encoding antifusogenic polypeptides
WO2023135273A2 (en) 2022-01-14 2023-07-20 Anjarium Biosciences Ag Compositions of dna molecules encoding factor viii, methods of making thereof, and methods of use thereof
WO2023150753A1 (en) 2022-02-07 2023-08-10 University Of Rochester Optimized sequences for enhanced trna expression or/and nonsense mutation suppression
WO2023154818A1 (en) 2022-02-09 2023-08-17 Modernatx, Inc. Mucosal administration methods and formulations
WO2023159197A1 (en) 2022-02-18 2023-08-24 Modernatx, Inc. Mrnas encoding checkpoint cancer vaccines and uses thereof
WO2023161350A1 (en) 2022-02-24 2023-08-31 Io Biotech Aps Nucleotide delivery of cancer therapy
WO2023177655A1 (en) 2022-03-14 2023-09-21 Generation Bio Co. Heterologous prime boost vaccine compositions and methods of use
WO2023177904A1 (en) 2022-03-18 2023-09-21 Modernatx, Inc. Sterile filtration of lipid nanoparticles and filtration analysis thereof for biological applications
WO2023183909A2 (en) 2022-03-25 2023-09-28 Modernatx, Inc. Polynucleotides encoding fanconi anemia, complementation group proteins for the treatment of fanconi anemia
WO2023183616A1 (en) 2022-03-25 2023-09-28 Senda Biosciences, Inc. Novel ionizable lipids and lipid nanoparticles and methods of using the same
WO2023196399A1 (en) 2022-04-06 2023-10-12 Modernatx, Inc. Lipid nanoparticles and polynucleotides encoding argininosuccinate lyase for the treatment of argininosuccinic aciduria
WO2023196634A2 (en) 2022-04-08 2023-10-12 Flagship Pioneering Innovations Vii, Llc Vaccines and related methods
WO2023201204A1 (en) 2022-04-11 2023-10-19 Modernatx, Inc. Detection of mrna purity in a mixture
WO2023205744A1 (en) 2022-04-20 2023-10-26 Tome Biosciences, Inc. Programmable gene insertion compositions
WO2023215831A1 (en) 2022-05-04 2023-11-09 Tome Biosciences, Inc. Guide rna compositions for programmable gene insertion
WO2023215498A2 (en) 2022-05-05 2023-11-09 Modernatx, Inc. Compositions and methods for cd28 antagonism
WO2023220083A1 (en) 2022-05-09 2023-11-16 Flagship Pioneering Innovations Vi, Llc Trem compositions and methods of use for treating proliferative disorders
WO2023220729A2 (en) 2022-05-13 2023-11-16 Flagship Pioneering Innovations Vii, Llc Double stranded dna compositions and related methods
WO2023225524A1 (en) 2022-05-17 2023-11-23 Modernatx, Inc. Preparation of highly concentrated mrna
WO2023225670A2 (en) 2022-05-20 2023-11-23 Tome Biosciences, Inc. Ex vivo programmable gene insertion
WO2023239756A1 (en) 2022-06-07 2023-12-14 Generation Bio Co. Lipid nanoparticle compositions and uses thereof
WO2023248125A1 (en) 2022-06-20 2023-12-28 Crispr Therapeutics Ag Cd117-targeting nanoparticles for use in drug delivery
WO2023250112A1 (en) 2022-06-22 2023-12-28 Flagship Pioneering Innovations Vi, Llc Compositions of modified trems and uses thereof
WO2023250119A1 (en) 2022-06-24 2023-12-28 Modernatx, Inc. Methods of producing rna
WO2024026254A1 (en) 2022-07-26 2024-02-01 Modernatx, Inc. Engineered polynucleotides for temporal control of expression
WO2024030856A2 (en) 2022-08-01 2024-02-08 Flagship Pioneering Innovations Vii, Llc Immunomodulatory proteins and related methods
WO2024035952A1 (en) 2022-08-12 2024-02-15 Remix Therapeutics Inc. Methods and compositions for modulating splicing at alternative splice sites
WO2024040222A1 (en) 2022-08-19 2024-02-22 Generation Bio Co. Cleavable closed-ended dna (cedna) and methods of use thereof
WO2024044147A1 (en) 2022-08-23 2024-02-29 Modernatx, Inc. Methods for purification of ionizable lipids
WO2024049979A2 (en) 2022-08-31 2024-03-07 Senda Biosciences, Inc. Novel ionizable lipids and lipid nanoparticles and methods of using the same
WO2024077191A1 (en) 2022-10-05 2024-04-11 Flagship Pioneering Innovations V, Inc. Nucleic acid molecules encoding trif and additionalpolypeptides and their use in treating cancer
WO2024097664A1 (en) 2022-10-31 2024-05-10 Flagship Pioneering Innovations Vi, Llc Compositions and methods for purifying polyribonucleotides
WO2024097639A1 (en) 2022-10-31 2024-05-10 Modernatx, Inc. Hsa-binding antibodies and binding proteins and uses thereof
WO2024102799A1 (en) 2022-11-08 2024-05-16 Flagship Pioneering Innovations Vi, Llc Compositions and methods for producing circular polyribonucleotides
WO2024102677A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Circular rna compositions
WO2024102762A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Lipids and lipid nanoparticle compositions for delivering polynucleotides
WO2024102730A1 (en) 2022-11-08 2024-05-16 Orna Therapeutics, Inc. Lipids and nanoparticle compositions for delivering polynucleotides

Similar Documents

Publication Publication Date Title
AU2022203946B2 (en) Novel diester and triester based low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
WO2013116126A1 (en) Novel low molecular weight, biodegradable cationic lipids for oligonucleotide delivery
AU2013240051B2 (en) Diether based biodegradable cationic lipids for siRNA delivery
AU2018202688B2 (en) Novel low molecular weight cationic lipids for oligonucleotide delivery
EP2635265A2 (en) Novel low molecular weight cyclic amine containing cationic lipids for oligonucleotide delivery

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13743807

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13743807

Country of ref document: EP

Kind code of ref document: A1