WO2011157294A1 - Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto - Google Patents

Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto Download PDF

Info

Publication number
WO2011157294A1
WO2011157294A1 PCT/EP2010/058495 EP2010058495W WO2011157294A1 WO 2011157294 A1 WO2011157294 A1 WO 2011157294A1 EP 2010058495 W EP2010058495 W EP 2010058495W WO 2011157294 A1 WO2011157294 A1 WO 2011157294A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
dicer
polynucleotide
expression
cancer
Prior art date
Application number
PCT/EP2010/058495
Other languages
French (fr)
Inventor
Stefano Piccolo
Graziano Martello
Silvio Bicciato
Michelangelo Cordenonsi
Sirio Dupont
Original Assignee
Universita' Degli Studi Di Padova
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universita' Degli Studi Di Padova filed Critical Universita' Degli Studi Di Padova
Priority to PCT/EP2010/058495 priority Critical patent/WO2011157294A1/en
Publication of WO2011157294A1 publication Critical patent/WO2011157294A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/323—Chemical structure of the sugar modified ring structure
    • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA

Definitions

  • cancer cells use global downregulation of the miRNA network to induce epithelial plasticity and foster invasive and metastatic behaviors.
  • miR-103/107 targeting Dicer, was found to play a causal role in these events.
  • miR-103/107 are both, generated by and regulators of Dicer: this mutual feedback relationship allows to scale-down Dicer levels but is also intrinsically incompatible with complete depletion, maintaining sufficient Dicer for growth control and other cellular functions.
  • precursors of siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA molecules. Both types of these siRNA precursors may contain a stretch of base pairs without any mismatch.
  • the current model for maturation of mammalian miRNAs is nuclear cleavage of the primary rniRNA (pri-miRNA) which liberates a 60-70 nt stem loop intermediate, known as the mi RNA precursor or pre-miRNA.
  • the mature about 18-23 nt long mi R A is yielded from one arm of the stem loop precursor (B artel, Cell (2004), 116: 281-297; Lee. EMBO J (2002), 21: 4663-4670; Zeng and Cullen.
  • the polynucleotide which decreases or suppresses expression of Dicer to be inhibited in context of the present invention comprises or consists of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 103.1), SEQ ID NO: 2 (mature nr!R- 103.2), SEQ ID NO: 3 (mature miR-107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 5 (seed sequence of miR-107), SEQ ID NO: 6 (consensus sequence of SEQ ID NOs.
  • the polynucleotide to be inhibited in context of the present invention may comprise or consist of a polynucleotide being at least 25%, 30%, 35%, 40%>, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 103.1 ), SEQ ID NO: 2 (mature miR-103.2), SEQ ID NO: 3 (mature miR- 107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs.
  • SEQ ID NO: 5 seed sequence of miR- 107
  • SEQ ID NO: 6 Consensus sequence of SEQ ID NOs. 1 to 3
  • SEQ ID NO: 7 pre-miR- 103.1
  • SEQ ID NO: 8 pre-miR-103.2
  • SEQ I D NO: 9 pre-miR-107
  • SEQ ID NO: 7 pre-miR- 103.1
  • SEQ ID NO: 8 pre-miR- 103.2
  • SEQ ID NO: 9 pre-miR-107 and comprise the nucleic acid sequence as shown in SEQ I D NO: 4 (seed sequence of SEQ I D NOs. 1 to 3) or SEQ ID NO: 5 (seed sequence of miR- 107) or any other seed sequence as shown in Table 1 herein.
  • a polynucleotide comprising the nucleic acid sequence of a sequence provided herein may also be a polynucleotide consisting of said nucleic acid sequence.
  • a test to determine hybridization between an miRNA and an mRNA may be a Luciferase Assay as also described in technical bulletins by Promega (C8021 (psiCHECK-2 Vector), El 960 (Dual-Luciferase® Reporter Assay System)).
  • reporter gene assays in which common reporter genes are used such as fluorescent proteins (e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP), or luminescent proteins (e.g., Renilla or firefly luciferase, or ⁇ -galactosidase encoded by the lacZ gene).
  • fluorescent proteins e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP
  • luminescent proteins e.g., Renilla or firefly luciferase, or ⁇ -galactosidase encoded by the lacZ gene.
  • degradation of mRNA or the level of the respective translation product can easily be examined by methods known in the art.
  • qPCR examples include qPCR, RT-PCR, qRT-PCR.
  • RT-qPCR Light Cycler®, TaqMan® Platform and Assays, Northern blot, dot blot, microarrays, next generation sequencing (VanGuilder, Biotechniques (2008), 44: 619-26; Elvidge, Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010), 1 1 : 31-46).
  • the level of expressed Dicer in order to determine whether a polynucleotide decreases or suppresses expression of Dicer or a biologically active derivative thereof (e.g., by hybridizing to the mRNA of Dicer and thereby inducing degradation or preventing translation of Dicer mRNA), the level of expressed Dicer can be easily detected.
  • a polynucleotide is to be assessed as decreasing or suppressing expression of Dicer or a biologically active derivative thereof if the detected level of expressed Dicer in a test sample which was contacted with a polynucleotide to be tested is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% lower than the Dicer expression level of a control sample which was not contacted 'with the polynucleotide.
  • a Western blot analysis can be performed for Dicer protein detection (Dupont, Cell (2009) 136: 123-135).
  • composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention may contain the inhibitor in an amount of about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto are to be prevented.
  • the composition comprises the inhibitor in an amount of about 1 ⁇ g/kg body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight.
  • compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose, i.e. about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto are to be prevented.
  • a suitable dose i.e. about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto are to be prevented.
  • the composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention comprises the inhibitor in an amount of about 1 ⁇ g/kg body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight.
  • Administration of the composition may be effected or administered by different ways, e.g.
  • compositions described herein comprising an inhibitors of a polynucleotide or polynucleotides being capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof as described herein may be used to treat or prevent cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject.
  • a given compound can be assessed as an inhibitor to be employed in context of the present invention if it is able to prevent hybridization of a polynucleotide to be inhibited in context of the present invention with the mRNA (e.g., the 3'UTR thereof) of Dicer or a biologically derivative thereof.
  • a polynucleotide to be inhibited in context of the present invention is capable of decreasing or suppressing the expression of Dicer or a biologically derivative thereof such as it amounts to an expression level of 50% compared to the normal expression level (i.e. without said polynucleotide), and the expression level increases by applying an inhibitor as described herein such that the expression level of Dicer or a biologically derivative thereof increases to an amount of 75% compared to the normal expression level (i.e. without said polynucleotide), the effect of said polynucleotide is reversed by the inhibitor by 50%.
  • the hybridization of said nucleic acid to be employed as an inhibitor in context of the present invention to a polynucleotide to be inhibited in context of the present invention may be over the entire length of said polynucleotide to be inhibited or only over a part of the sequence of said polynucleotide to be inhibited, e.g., over at least 25%, at least 35%, at least 45%, at least 55%, at least 65%, at least 75%, at least 85% or at least 95% of the sequence of said polynucleotide to be inhibited, one embodiment of the present invention, the inhibitor to be employed in context of the present invention may be an antisense oligonucleotide which is complementarv to a polynucleotide to be inhibited in context of the present invention.
  • the present invention relates to a composition
  • a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 4, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
  • the present invention relates to a composition
  • a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 6, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
  • nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is an miRCURY LNA microRNA inhibitor.
  • the inhibitor (i. e. in case of a nucleic acid inhibitor) of the polynucleotide to be inhibited in context of the present invention may be cloned into a vector.
  • vector as used herein particularly refers to plasmids, cosmids, viruses, bacteriophages and other vectors commonly used in genetic engineering.
  • these vectors are suitable for the transformation of cells, like fungal cells, cells of microorganisms such as yeast or prokaryotic cells.
  • such vectors are suitable for stable transformation of bacterial cells, for example to transcribe the polynucleotide of the present invention.
  • a nucleic acid inhibitor in case of a nucleic acid inhibitor of a polynucleotide to be inhibited in context of the present invention has been cloned may be miR-Vec, a retroviral expression vector (Voorhoeve, Cell (2006), 124: 1 169-1 181).
  • the present invention also relates to a compound binding to a polynucleotide described herein, i.e. to a polynucleotide which is capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof as described herein, for use in diagnosing or predicting the progression of diseases or disorders such as cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject.
  • diseases or disorders such as cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject.
  • G Expression of a miR-103/107-insensitive Dicer cDNA rescues mature miRNA expression, here exemplified by mi R- 1 5a.
  • the effects of miR-107 on mature miR-15a levels were compared in parental and MDA-MB-231 cells stably expressing a miR- 103/107-insensitive form of Dicer (+Dicer).
  • miR- 1 5a expression was measured by qRT-PCR and normalized to snRNA-U6b loading control. Relative values are shown as mean and SD.
  • FIG. 7 The miR-200 family members are inhibited by miR-103/107 to promote mesenchymal traits.
  • Figure 1 1 Effects of miR-103/107 or Dicer manipulations on migration, proliferation, dicer levels and cell cycle distribution
  • pri-miR- 103/107 expression promotes migration of non-metastatic 168FARN breast cancer cells.
  • Stable cell lines expressing shGFP, pri-miR- 103 or pri-miR- 107 from retroviral expression vectors were compared in transwell migration assays. The graph shows the absolute quantitations of ceils migrated through the filter.
  • siDicer corresponds to lane 4 (6 nM). Note the increased motility promoted by miR- 107 and siDicer. as well as the loss of epithelial morphology.
  • Figure 12 Effects of AntagomiR-103/107 administration and correlations between the genetic status of Dicer, pri-miR-103/107 levels and metastasis free survival
  • AntagomiR-103/1 07 administration in the fat-pad of wild-type mice has no effects on mammary gland structure and morphology.
  • Top panels representative whole mount eosin stainings of delipidated fat-pads explanted from mice treated with AntagomiR- 103/107 of AntagomiR-MUT. No defects are apparent in the overall morphology of the gland, nor in the number of the Terminal End Buds (not shown).
  • Bottom panels representative histological H&E-stained sections of the same tissues, showing no obvious differences in the differentiation of ductal cells.
  • the "Dicer+/-” group of patients displays a copy number compatible with heterozigosity at the Dicer locus, while the “Dicer+/+” has wild-type gene copy number.
  • the log-rank test p values reflect the significance of the association between Dicer heterozygosity and metastatic relapse.
  • FIG. 1 C Panels show immunoblotting of MDA-MB-231 cells transfected with miR- 107 as in Figure 1 C.
  • Lam in B serves as loading control.
  • miR-107 overexpression causes downregulation of mature miR- 15/ 16, of the miR- 17-92 cluster and of the let-7 family (see Figure 3F and Table 2), but their direct established targets (BCL2, c-Myc and K-Ras, respectively), are not upregulated.
  • Table 2 Expression of mature miRNAs in MDA-MB-23 1 transfected with miR- 107-MUT or miR-107, as quantitated by using Taqman Human miRNA microarray (see Supplemental Experimental Procedures for details). Results are given as the difference between the Cycle thresholds of a given miRNA and the snRNA-U6 (Delta Ct). Relative quantitation was
  • Example 1 Biological assays in mammalian cells
  • the sequences of the siRNA were: 5'-UCC AGA GCU GCU UCA AGC ATT-3 ' and 5'-UGC UUG AAG CAG CUC UGG ATT-3 '.
  • miR- 107 5' -AGC AGC AUU GUA CAG GGC UAU CA-3' and S'-AUA GCC CUG UAC AAU GCU GCC UU-3';
  • miR-107-MUT 5'-AUA GCC CUG UAC AuU cCg GaC UU-3' and 5'-AuC cGg AaU GUA CAG GGC UAU CA-3'; miR-200b: 5'-AUC AUU ACC AGG CAG UAU UAG A-3' and 5'-UAA UAC UGC CUG GUA AUG AUG A-3 '.
  • Example 2 Experimental models of metastasis and Antagomi -treatment
  • AntagomiRs were designed as described in Krutzfeldt, Nature (2005), 438: 685-689, and purchased from Fidelity System. Sequences were as follows:
  • U20S, HCT1 16chr3 cells were cultured in DM EM 10%FCS, MDA-MB231 and SUM149 cells in DMEM/F 12 10% PCS. HepG2 in MEM 10%FCS supplemented with NEA. 67NR, 168FARN, 4T07 and 4T1 mouse mammary tumor cells were cultured as previously described (Aslakson, Cancer Res (1992), 52: 1399- 1405). DNA transfections were performed with Transit-LTl reagent (MirusBio); for siRNA transfections, Lipofectamine-RNAiMax (Invitrogen) were used in all cell lines.
  • the sequences of the siRNA were: 5'-UCC AGA GCU GCU UCA AGC ATT- 3 ' and 5'-UGC UUG AAG CAG CUC UGG ATT-3'.
  • pri-miRs were cloned in the miR-Vec expression vector (Voohoeve, loc cit). miRNA expression was confirmed by qPCR. Control shGFP was as previously described (Adorno, Cell (2009), 137: 87-98).
  • human Dicer cDNA (gift from P. Provost) was subcloned in pRRLsin . ppts . hCMV . gfppre (gift from L. Naldini). For Dicer knockdown in SUM- 149 cells, pLKO.
  • the full-lenght 4,2 Kb human Dicer 3 'UTR was PGR amplified from MDA-MB-231 cells, cloned into a CMV-luciferase expression plasmid (Martello, loc cit) and sequence-verified. All predicted miR-103/107 seed-pairing sites were mutated by changing them to unique restriction sites (see list of primers). Cells were transfected with Dicer 3' UTR reporters using Transit-LTl (MirusBio) and harvested after 48 hours.
  • Luciferase reporters 25ng/cm2 were cotransfected with CMV -beta-gal (40ng/cm2) to normalize for transfection efficiency by CPRG (Roche) colorimetic assay. Each sample was transfected in triplicate. Each experiment was repeated at least twice.
  • Tissues for histological examination were fixed in 4% buffered formalin, dehydrated and embedded in paraffin by standard methods.
  • serial sections of the lungs were cut at a distance of 70 mm from each other, were first stained with Hematoxylin and Eosin (H&E) and then processed for human cytokeratin expression (see below).
  • H&E Hematoxylin and Eosin
  • serial sections of the lungs were cut at a distance of 70 mm from each other and stained with H&E.
  • Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded tissue using an indirect immunoperoxidase technique (Bond Polymer Refine Detection; Vision BioSystems, UK). Sections mounted on silanized slides will be dewaxed in xylene, dehydrated in ethanol, boiled in 0.01 M citrate buffer (pH 6.0) for 20 min. in a microwave oven and then incubated with 3% hydrogen peroxide for 5 min. After washing with PBS, they were be incubated in 10% normal BSA for 5 min, followed by incubation for 45 min.
  • Example 9 Antibodies and Western Blotting ⁇ -LaminB (C20) and ⁇ -Dicer (SC-30226) were obtained from SantaCruz; a-beta-catenin was obtained from Sigma. To monitor endogenous gene responses, cells were harvested by sonication in Ub-lysis buffer as in described (Dupont, Cell (2009), 136: 123-135). Proteins were loaded according to Bradford quantification, ran in commercial 4-12% or 10% Nupage MOPS acrylamide gels (Invitrogen) and transferred onto PVDF membranes (ImmobilonP) by wet electrophoretic transfer.
  • blots were blocked one hour at RT with 0,5% non-fat dry milk (BioRad) in PBSw (0,05% Tween) and incubated over night, at 4 °C with primary antibodies. Secondary antibodies were incubated 50 min at RT. Washes after antibody incubations were done on an orbital shaker, three times 10 min, with IX PBS 0,05% Tween20. Blots were developed with Pico or Dura SuperSignal West chemiluminescent reagents (Pierce).
  • Poly(A) + -RNA was retrotranscribed with M-MLV Reverse Transcriptase (Invitrogen) and oligo-d(T) primers following total RNA purification with Trizol (Invitrogen).
  • Real-time PGR messengerRNAs were performed on a RotorGene 3000 (Corbett) using the FastStart SYBR Green Master Mix (Roche). The primers are listed m the table below.
  • Detection of the mature form of miRNAs was performed using the Taqman microRNA assay kit (Applied Biosystem) according to the manufacturer's instructions. U6 small nuclear RNA was used as an internal control.
  • Detection of 70 nt precursors miRNA was performed using the methods and primers described in Schmittegen, Nucleic Acid Res (2004), 32: e43.
  • the case series consisted of 69 women with primary resectable invasive estrogen receptor- positive breast cancer, histologically node-negative, and with no radiologic or clinical evidence of distant metastasis, a synchronous bilateral tumor, or a concomitant second primary tumor. These cases, with a minimum potential of 10 years of follow-up (i.e. the time elapsed from the date of surgery to the date of the last updating of the patient records), underwent surgery at the Istituto Nazionale Tumori (INT) of Milan during the period from January 1990 to December 1998. Patients were treated with mastectomy or quadrantectomy plus radiotherapy, and ail of them underwent axillary node dissection (median number of examined nodes, 18).
  • INT Istituto Nazionale Tumori
  • This assay is an adaptation of the proven DASL (cDNA-mediated Annealing, Selection, Extension, and Ligation) assay.
  • 800 ng of total RNA were retrotranscribed, annealed with a miRNA-specific oligonucleotide pool consistsing of a universal PCR priming site at the 5' end, an address sequence complementary to a capture sequence on the BeadArray and a microRNA-specific sequence at the 3' end.
  • the probes were hybridized on miRNA expression profiiing_v2 BeadChips, containing 1,146 sequences for detecting 95% of miRNAs described in the miRBase database (vl4.0).
  • Raw data were normalized using the Robust Spline Normalization algorithm implemented in the lumi R package. Probes with a detection p-value ⁇ 0.01 in less than 10% of samples were filtered out.
  • miR-103 and miR-107 are intronic microRNA, their primary transcripts could be mapped on Affymetrix arrays (Baskerville, RNA (2005), 11 : 241-247; Lee. Pancreatology (2009), 9: 293-301 ; Wang, J Neurosci (2008), 28: 1213-1223).
  • Affymetrix arrays Baskerville, RNA (2005), 11 : 241-247; Lee. Pancreatology (2009), 9: 293-301 ; Wang, J Neurosci (2008), 28: 1213-1223.
  • ⁇ is the score of Pri-miR-103/107 genes in each sample i, ju p and ⁇ ⁇ are the estimated mean and standard deviation of P ; , over the entire dataset,
  • Tumors were then classified as "miR-103/107 High” if the score was equal to or above a threshold and as “miR-103/107 Low” if the score was below the threshold, i.e. the score S F for each sample i was compared with the selected threshold to classify any sample as "miR- 103/107 High” or "miR-103/107 Low”. This classification was applied to log2 expression values obtained using RMA on datasets described in the table above.
  • Dicer Low Dicer Low
  • ⁇ and j D1CER and & mtkR are the estimated mean and standard deviation of Dicer calculated over the entire dataset (Adorno, loc cit).
  • the data-driven procedure described above was adopted to select the threshold providing the best separation between survival curves. Briefly, multiple quantiles of go i cER va j ues were evaluated considering quantiles corresponding to probabilities from 0.5 to 0.2, thus selecting the threshold for low expression among lower quantiles, excluding very extreme values. The quantile giving the best separation, i.e.
  • Retroviral transduction of either pri-miR-103 or pri-miR-107 expression vectors caused further inhibition of the wild-type 3' UTR reporter ( Figure IB, compare lane 5 with lanes 6 and 7), but not of the corresponding seed-mutant reporter.
  • Dicer protein was specifically downregulated (about 50-60% reduction) by expressing pri-miR-103 or pri-miR-107 ( Figure 1C, left panel and Figure 8A).
  • pri-miR-103 or pri-miR-107 Figure 1C, left panel and Figure 8A.
  • Figure 1C, left panel and Figure 8A To exclude any potentially confounding effect from the viral expression system - or from flanking sequences of the pri-miR constructs - cells - cells were also transiently transfected with the mature form of miR-107 or, as control, a mutant miR-107 that contained three mismatches in the seed-binding sequence (miR-107-MUT).
  • Dicer protein levels were downregulated by mature miR-107, but not miR-107-MUT ( Figure 1 C, right panel and Figure 8B).
  • miR103/107 affect Dicer levels acting on its 3'UTR, as lentiviral expression of Dicer lacking the 3'UTR was insensitive to miR-107 ( Figure 8C).
  • miR-103/107 restrict miRNA processing at the level of Dicer, then the levels of miR- 103/107 should directly correlate with the abundance of Dicer substrate, i.e. the 70 nt precursor miRNAs (pre-miRNAs). Indeed, pre-miRNAs, but not pri -miRNAs, accumulate in miR-107 expressing MDA-MB-231 cells ( Figure 8H).
  • miR-103/107 lead to inhibition of miRNA biogenesis through Dicer downregulation.
  • Example 16 Inverse correlation between miR-103/107 and Dicer levels in cancer ceil lines
  • Example 17 Clinical association of miR-103/107 expression to breast cancer metastasis and poor-prognosis
  • Mature miR-103/107 levels were measured in a collection of breast cancer patients treated in our Institution with annotated clinical history. Patients were divided in two groups, with respectively high or low levels of miR-103/107 (Figure 2C, see Examples 13 and 14). Remarkably, when tested using the Kaplan-Meier survival analysis, the "miR-103/107 High " group displayed a significant higher probability to develop metastasis when compared to the "Low” group ( Figure 2D). In line with the biochemical characterization of Dicer as target of miR-103/107, the "high” group tumors showed reduced level of Dicer protein when compared to the "Low” group, as assayed by immunohistochemisty (Figure 2E-H).
  • miR-103 and miR- 107 are intronic miRNAs contained in three PANK (Pantothenate kinase) loci of the human genome (i.e. , PANK1 , 2 and 3 corresponding to pri-miR-107, pri-miR- 103- 2 and pri-miR- 103-1, respectively).
  • PANK Purothenate kinase loci of the human genome
  • Example 18 miR-103/107 downregulatc Dicer to promote cell migration and invasion in vitro
  • miR-103/107 Induction of migratory capacity by miR-103/107 relies on attenuation of Dicer. First, it is phenocopied in shDicer SUM 149 cells (reducing Dicer to about 40% its normal levels). Second, it is rescued by coexpression of a miR-insensitive Dicer transgene that restores Dicer protein to level near-to-endogenous ( Figure 3 A, lanes 4 and 5, see immunoblots in Figure 11C). Similar results were obtained in wound-healing assays with another, more aggressive cell line, MDA-MB-231 cells ( Figures 3C and 3D). Thus, miR-103/107 empowers cell motility through Dicer inhibition.
  • Dicer overexpressing 4T1 cell clones were selected from a lentivirally infected cell population ( Figure 13C).
  • Dicer-4T1 derived tumors were deprived of metastatic capacity when compared to lesions from mock-infected cells ( Figures 5G-I).
  • the data reveals a functional pathway in aggressive tumors, whereby endogenous miR-103/107 is instrumental to attenuate Dicer levels below a threshold for metastasis protection.
  • Example 21 miR-103/107 promote Epithelial-to-Mesenchymal-Transition (EMT)
  • E- Cadherin and ZO-1 in NMuMg cells, a well-established model system for the study of EMT (Miettinen, J Cell Biol (1994), 127: 2021-2036). Immunofluorescence showed that these proteins were strongly downregulated in cells expressing miR- 107 ( Figure 6B). EMT was also validated by gene expression analysis: in the presence of miR- 107, expression of E- Cadherin mRNA was downregulated whereas the mesenchymal markers vimentin, IC AM- 1 and fibronectin mRNAs were significantly increased ( Figures 6C-F).
  • epithelial plasticity and required for maintenance of mesenchymal gene expression.
  • Example 22 miR-103/107 control mesenchymal traits by regulating the expression of the miR-200 family of miRNAs.
  • the miR-200 targets ZEBl and ZEB2 were monitored. These genes were found to be downregulated (Figure 7F) in AntagorniR- 103/107 treated cells to about 50%, mimicking the effect of mature miR-200 overexpression (see Figure 71). In agreement, it was found in context of the present invention that overexpression of miR-107 downregulates miR-200 and upregulates ZEBl and ZEB2 mRNA levels ( Figure 7G and 7H).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biotechnology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to compositions comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof for use in treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. Furthermore, the present invention also relates to methods of treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto.

Description

COMPOSITIONS FOR USE IN TREATING OR PREVENTING CANCER, BREAST CANCER, LUNG CANCER, OVARIAN CANCER, METASTASIS, HEART FAILURE, CARDIAC REMODELLING, DILATED CARDIOMYOPATHY,
AUTOIMMUNE DISEASES, OR DISEASES OR DISORDERS RELATED THERETO
The present invention relates to compositions comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof, for use in treating or preventing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. Furthermore, the present invention also relates to methods of treating, preventing or diagnosing cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. microRNAs (also abbreviated as miRNAs or miRs) are an evolutionariiy conserved group of small RNAs of typically 18-24 nucleotides in length that are capable of inhibiting gene expression. miRNAs are transcribed by RNA Polymerase II as longer precursors (pri- and pre-miRNAs) and then processed into mature miRNAs by the sequential action of Drosha and Dicer endonucleases (Bartel, Cell (2009), 136: 215-233; Filipowicz, Nat Rev Genet (2008), 9: 102-114). Mature miRNAs operate via sequence-specific interactions with the 3'-UTR of cognate mRNA targets, causing suppression of translation and mRNA decay (Ambros, Nature (2004), 431 : 350-355; Bartel, loc cit). miRNAs coordinate the expression of entire sets of genes, shaping the mammalian transcriptome (Bartel, loc cit). Loss of miRNA biosynthesis as in Dicer knockouts is lethal, owing to mitotic catastrophe and severely defective stem cell proliferation and differentiation (Bernstein, Nat Genet (2003), 35 : 215-217; Fuagawa, Nat Cell Biol (2004), 6: 784-791 ; Tang, Genes Dev (2007), 21 : 644-648). There are some suggestions that the multigene regulatory capacity of miRNAs is dysregulated and exploited in cancer: miRNA loci are targeted by genetic and epigenetic defects, and miRNA "signatures" have been found informative for tumor classification and clinical outcome (Calin, Nat Rev Cancer (2006), 6: 857-866; Ventura, Cell (2009), 136: 586-591).
Although several miRNAs are upregulated in specific tumors (Voliana, Proc Natl Acad Sci U S A (2006), 103: 2257-2261), a global reduction of miRNA abundance appears a general trait of human cancers, playing a causal role in the transformed phenotype (Kumar. Nat Genet (2007), 39: 673-677; Lu, Nature (2005), 435: 834-838; Ozen, Oncogene (2008), 27: 1 788- 1789).
However, little is known on the underlying mechanisms or the phenotypic advantages afforded to cells by reduced miRNA expression and on the clinical relevance of this phenomenon and influencing global miRNA abundance in affected patients is hardly possible.
This technical problem has been solved by the embodiments provided herein and the solutions provided in the claims.
The present invention sheds light on these questions as here a group of polynucleotides, miR- 103.1, miR- 103.2 and miR- 107 (hereinafter also referred to as miR-103/107 or microRNA family miR-103/107), was identified whose expression is associated with metastasis and poor- outcome in breast cancer patients. As was surprisingly found in the present invention, polynucleotides such as miR-103/107 inhibit the expression of Dicer, causing global microRNA downregulation. miR-103/107 foster the acquisition of mesenchymal characteristics and are relevant for breast cancer cell migration and metastatic dissemination. In other words, in context of the present invention, it was surprisingly found that cancer cells use global downregulation of the miRNA network to induce epithelial plasticity and foster invasive and metastatic behaviors. In breast cancer. miR-103/107, targeting Dicer, was found to play a causal role in these events.
In summary, in context of the present invention it was surprisingly shown that high levels of miR-103/107 attenuate Dicer expression in metastatic cells. This empowers invasive and metastatic properties without major impact on primary tumor growth. Thus, distinct cellular functions are differentially sensitive to Dicer fluctuations. miR- 103/107 keep Dicer below a threshold required for metastasis protection. Conversely, the miRNA network sustaining tumor growth operates safely at lower Dicer levels (Kumar, Genes Dev (2009), 23 : 4562- 4569). An appeal of this system is its embedded robustness: miR-103/107 are both, generated by and regulators of Dicer: this mutual feedback relationship allows to scale-down Dicer levels but is also intrinsically incompatible with complete depletion, maintaining sufficient Dicer for growth control and other cellular functions.
As already indicated above, in accordance with the present invention it was shown that high levels of miR-103/107 earmark primary breast tumors with metastatic capacity. Escaping miRNA control in cancer cells as attained upon Dicer downregulation may allow the phenotypic emergence of more aggressive genetic variants, accelerating; cancer progression.
In accordance with the present invention, a signi ficant finding was the association of the miR- 103/107-Dicer pair with Epithelial-to-Mesenchymal-Transition (EMT). In normal tissues, the EMT program is used to assist epithelial plasticity while it is exploited opportunistically in cancer to habilitate metastasis (Polyak, Nat Rev Cancer (2009), 9: 265-273). Thus, the ability of miR-103/107 to turn on this program apparently represents a leading mechanism by which miR- 103/107 foster breast cancer metastasis.
Furthermore, in context of the present invention, expression of miR-103/107, but not Dicer mR A, was validated in human primary breast tumors as a prognostic marker. This finding is consistent with miR-103/107 targeting Dicer translation and also endows miR-103/107 with a better patients' stratification capacity over Dicer transcripts. Accordingly, it may be speculated that tumors regulate Dicer by other means, including genetic inactivation. As has been shown previously, low levels of Dicer are associated with poor survival in a fraction of lung and ovarian cancer patients and animal models (Kumar, 2009, e cit; Karube Cancer Sci (2005), 96: 11 1-1 15; Merritt, N Engl J Med (2008), 359: 2641-2650).
In the present invention it was further found that, similarly to elevated miR-103/107, heterozygous loss of Dicer also instills metastatic propensity in breast cancer patients. Yet, this result is not apparent from the analysis of Dicer mRNA levels because this genetic lesion occurs in a relatively minor fraction of patients, complicating the assignments of reliable cutoff values for patients' correlations in large datasets.
In sum, as was found in context of the present invention, AntagomiR-miR- 103/107, inhibiting miR-103/107, shows that inhibition of miR-103/107 by RNA-based therapeutics turns out clinically useful in the treatment of breast cancer.
Hence, in accordance with the present invention, inhibition of polynucleotides such as miR- 103/107 decreasing or suppressing the expression of Dicer as shown in detail herein is useful for treating or preventing diseases such as cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, or diseases or disorders related thereto.
Furthermore, given the impact of Dicer deletion in the development of cardiac remodeling (da Costa, Circulation (2008), 1 18: 1567-1576), heart failure, dilated cardiomyopathy (Chen, Proc Natl Acad Sci U S A (2008), 105: 21 11-21 16) and autoimmunity (Liston, J Exp Med (2008), 205: 1993-2004), inhibition of polynucleotides decreasing or suppressing the expression of Dicer as shown in the present invention in detail herein may also be useful for treating diseases such as heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto.
Accordingly, the present invention provides for compositions comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof for use in treating or preventing a disease or disorder in a subject. In context of the present invention, the disease or disorder may be cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. In one embodiment, the diseases or disorders to be treated in context of the present invention are breast cancer or metastasis. Furthermore, the present invention also provides for a method for treating or preventing a disease or disorder in a subject, said method comprising administering an effective amount of a composition comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof. In this context, the disease or disorder may be cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or related diseases or disorders. In one embodiment, the diseases or disorders to be treated in context of the present invention are breast cancer or metastasis.
Generally, in accordance with the present invention, when referring to a polynucleotide to be inhibited in context of the present invention, said polynucleotide is capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof as described and exemplified in detail herein.
As could be demonstrated in the present invention, the expression of Dicer can be decreased or suppressed by polynucleotides described herein, e.g., by hybridizing to the mRNA of Dicer. Thereby, for instance, degradation of or prevention of translation of Dicer mRNA can be induced, both resulting in suppression or decreasing of expression of Dicer. Accordingly, as also described herein in detail, inhibition of the polynucleotides described herein which inhibit or suppress expression of Dicer results in an increase of expression of Dicer. As described and exemplified in detail in the present invention, inhibition of the polynucleotides to be inhibited in context of the present invention is particularly useful in the treatment or prevention of cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto.
In one embodiment of the present invention, the polynucleotide to be inhibited in context of the present invention, i.e. which is capable of decreasing or suppressing expression of Dicer or a biological] y active derivative thereof, may be a microRNA (also abbreviated herein as miR A or miR) or a precursor thereof, a mimic microRNA or a precursor thereof, an siRNA or a precursor thereof, a long non-coding RNA or a precursor thereof, an snRNA (small/short hairpin RNA) or a precursor thereof, an stRNA (small temporal RNA) or a precursor thereof, an fRNA (functional RNA) or a precursor thereof, an snRNA (small nuclear RNA) or a precursor thereof, a snoRNA (small nucleolar RNA) or a precursor thereof, a piRNA (piwi- interacting RNA) or a precursor thereof, a tasiRNA (trans-acting small/short interfering RNA) or a precursor thereof, an aRNA (antisense RNA) or a precursor thereof, or a small non- coding RNA or a precursor thereof. As used herein, "precursors" of the polynucleotide to be inhibited in context of the present invention, i.e. which is capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof, may be forms of the respective polynucleotides as they occur during maturation of the respective polynucleotides. For example, in context of the present invention, precursors of a microRNA or a mimic microRNA may be primary miRNAs (pri-miRNAs) or precursor miRNAs (pre- miRNAs) as occurring during maturation of miRNAs. Both are single transcripts (i.e. ssRNA) that fold into a characteristic intramolecular secondary structure, the so-called "hairpin loop", which contains a stretch of about 18 to 23 base pairs, which may be interrupted by mismatches. In context of the present invention, precursors of siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA molecules. Both types of these siRNA precursors may contain a stretch of base pairs without any mismatch. The current model for maturation of mammalian miRNAs is nuclear cleavage of the primary miRNA (pri-miRNA) which liberates a 60-70 nt stem loop intermediate, known as the direct miRNA precursor or pre- miRNA. The mature about 18-23 nt long miRNA is yielded from one arm of the stem loop precursor (Bartel, Cell (2004), 116: 281-297; Lee, EMBO J (2002), 21 : 4663^670; Zeng and Cullen. RNA (2003), 9: 112-123). In a preferred embodiment of the present invention, the polynucleotide to be inhibited in accordance with the present invention is a microRNA or a precursor thereof or a mimic microRNA or a precursor thereof. The polynucleotides to inhibited in context of the present invention may be of any length. Preferably, the polynucleotide is about 15 to about 100 nucleotides in length, more preferably about 18 to about 27 nucleotides and most preferably about 20 to about 24 nucleotides.
In a specific embodiment of the present invention, the polynucleotide to be inhibited in context of the present invention, i.e. being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof, may be selected from the group consisting of:
(a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 (i.e. mature miR- 103.1 /MIOOOO 109 : agcagcauuguacagggcuauga);
(b) polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2 (i.e. mature miR- 103.2/MI0000108 : agcagcauuguacagggcuauga);
(c) polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3 (i.e. mature miR- 107/MI0000114: agcagcauuguacagggcuauca) ;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4 (i.e. the seed sequence of miR- 103.1, miR- 103.2 and miR- 107: gcagca);
(e) a polynucleotide which is at least 25% identical to the polynucleotide of any of (a) to (d); and (f) a polynucleotide which is at least 25% identical to the polynucleotide of any of (a) to (d) and which comprises the nucleotide sequence of SEQ ID NO: 4 (i.e. the seed sequence of miR- 103.1, miR- 103.2 and miR-107: gcagca).
According to the present invention, identity levels of polynucleotides refer to the entire length of the nucleotide sequence of the referred to SEQ ID NOs. and is assessed pair-wise, wherein each gap is to be counted as one mismatch. For example, the term "identity" may be used herein in the context of a polynucleotide to be inhibited in context of the present invention which has a nucleic acid sequence with an identity of at least 25%, 30%, 35 >, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 ( mature miR- 103.1), SEQ ID NO: 2 ( mature miR- 103.2), SEQ ID NO: 3 ( mature miR- 107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 5 (seed sequence of miR-107), SEQ ID NO: 6 (consensus sequence of SEQ I NOs. 1 to 3), SEQ ID NO: 7
1 m Ι Λ ccn Tin jn- c -„- _™, Ϊ? _ Ι m \ ¾cn m rrv Q / n-o_m; i? _ i Π \ ™- o« ^+v^r
SEQ ID NO. or consensus or seed sequence as shown in Table 1 herein, respectively, preferably over the entire length. Furthermore, in the context of the present invention, a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence with an identity of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99%> to a polynucleotide comprising or consisting of the nucleotide sequence of any consensus or seed sequence as shown in Table 1 herein, including one, two or more nucleotide(s) of the corresponding mature- or pre-miR-sequence at the 5 "-end and/or the 3 '-end of the respective consensus or seed sequence. For example, in the context of the present invention, a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence with an identity of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence AGCAGCAU (i.e. the seed sequence of SEQ ID NO: 1 including one nucleotide of the corresponding mature sequence at the 5 "-end and one nucleotide of the corresponding mature sequence at the 3'- end; SEQ ID NO: 1 1). If two nucleic acid sequences being compared by sequence comparisons differ in identity, then the term "identity" refers to the shorter sequence and to the part of the longer sequence that matches said shorter sequence. Therefore, when the sequences which are compared do not have the same length, the degree of identity preferably either refers to the percentage of nucleotide residues in the shorter sequence which are identical to consecutive nucleotide residues contained in the longer sequence or to the percentage of consecutive nucleotides contained in the longer sequence which are identical to the nucleotide sequence of the shorter sequence. Of course, as described above, a gap as "part of consecutive nucleotides" is to be counted as a mismatch. In this context, the skilled person is readily in the position to determine that part of a longer sequence that "matches" the shorter sequence. Also, these definitions for sequence comparisons (e.g., establishment of "identity" values) are to be applied for all sequences described and disclosed herein.
Table 1 : miRNAs, mi R Base ID ( lniRBase: http://www.mirbase.org, version 15), and mature
Figure imgf000009_0001
Identity, moreover, means that there is preferably a functional and/or structural equivalence between the corresponding nucleotide sequences. Nucleic acid sequences having the given identity levels to the particular nucleic acid sequences of the polynucleotides to be inhibited in context of and described in the present invention may represent derivatives/variants of these invention, the biological function of a polynucleotide described herein to be inhibited in context of the present invention is the ability to decrease or suppress expression of Dicer or a biologically active derivative thereof, e.g., by hybridizing to the mRNA of Dicer, thereby inducing degradation or preventing translation of the Dicer mRNA. Whether the expression of Dicer or a biologically active derivative thereof has been decreased or suppressed can be easily tested by methods well known in the art and as also described herein. Examples of such methods suitable to determine whether the expression of Dicer or a biologically active derivative is decreased or suppressed are polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for proteins in solutions and on gels, blots and microarrays, such as immuno staining, as well as immunoprecipitation, ELISA, microarrays, and mass spectrometry. To determine whether a given polynucleotide hybridizes to the mRNA of Dicer can also be tested by methods well known in the art and as also described herein. Examples of such methods suitable to determine whether a given polynucleotide hybridizes to another nucleic acid (e.g., the mRNA of Dicer or a biologically active derivative thereof) are reporter gene assays in which commonly used reporter genes are fluorescent proteins such as GFP, eGFP, YFP, eYFP, BFP, eBFP, luminescent proteins such as the enzymes Renilla or firefly luciferase, and β-galactosidase encoded by the lacZ gene (Inui, Nat Rev Mol Cell Biol (2010), 11 : 252-63; Bartel, Cell (2004), 116: 281-297). Whether the mRNA of Dicer is degraded or its translation is prevented can also be tested by methods known in the art and as also described herein. Examples for methods suitable to determine whether an mRNA is degraded are qPCR, RT-PCR. qRT-PCR, RT-q CR. Light Cycler®, TaqMan® Platform and Assays, Northern blot, dot blot, microarrays, next generation sequencing (VanGuilder, Biotechniques (2008), 44(5): 619-26; Elvidge, Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010), 11 : 31-46; Kafatos, NAR (1979), 7: 1541-1552). The polynucleotides to be inhibited in context of the present invention may be either naturally occurring variations, for instance sequences from other varieties, species, etc., or mutations, and said mutations may have formed naturally or may have been produced by deliberate mutagenesis. Furthermore, the variations may be synthetically produced sequences. The allelic variants may be naturally occurring variants or synthetically produced variants or variants produced by recombinant DNA, RNA, PNA, GNA, TNA or LNA techniques known in the art. Deviations from the above-described nucleic acid sequences may have been produced, e.g., by deletion, substitution, addition, insertion of nucleotides and/or by recombination. The term "addition" refers to adding at least one nucleic acid residue to one or both ends of the given sequence, whereas "insertion" refers to inserting at least one nucleic acid residue within a given nucleotide sequence. The term "deletion" refers to deleting or removal of at least one nucleic acid residue in a given nucleotide sequence. The term "substitution" refers to the replacement of at least one nucleic acid residue in a given nucleotide sequence. These definitions as used here apply mutatis mutandis for all sequences provided and described in the present invention.
The polynucleotides to be inhibited in context of the present invention (i.e. polynucleotides which decreases or suppresses expression of Dicer) may be nucleic acid analogues such as DNA molecules. RNA molecules, oligonucleotide thiophosphates, substituted ribo- oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol-conjugated) polynucleotides. Furthermore, in context of the present invention, the term "polynucleotide" as well as the term "nucleic acid molecule" may refer to nucleic acid analogues such as DNA molecules, RNA molecules, oligonucleotide thiophosphates, substituted ribo-oligonucleotides, LNA molecules, PNA molecules, GNA (glycol nucleic acid) molecules, TNA (threose nucleic acid) molecules, morpholino polynucleotides, or antagomir (cholesterol-conjugated) polynucleotides or hybrids thereof or any modification thereof as known in the art (see, e.g., US 5,525,71 1, US 4,71 1 ,955, US 5,792,608 or EP 302175 for examples of modifications). Nucleic acid residues comprised by the polynucleotides to be inhibited in context of the present invention may be naturally occurring nucleic acid residues or artificially produced nucleic acid residues. Examples for nucleic acid residues are adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), xanthine (X), and hypoxanthine (HX). In context of the present invention, thymine (T) and uracil (U) may be used interchangeably depending on the respective type of polynucleotide. For example, as the skilled person is aware of, a thymine (T) as part of a DNA corresponds to an uracil (U) as part of the corresponding transcribed mRNA. The polynucleotides to be inhibited in context of the present invention may be single- or double-stranded, linear or circular, natural or synthetic, and, if not indicated otherwise, without any size limitation. For instance, the polynucleotide to be inhibited in context of the present invention may be a microRNA (miRNA) or a precursor thereof, a mimic microRNA or a precursor thereof, an siRNA or a precursor thereof, a long non-coding RNA or a precursor thereof, an snRNA (small/short hairpin RNA) or a precursor thereof, an stRNA (small temporal RNA) or a precursor thereof, an fRNA (functional RNA) or a precursor thereof, an snRNA (small nuclear RNA) or a precursor thereof, a snoRNA (small nucleolar RNA) or a precursor thereof, a piRNA (piwi-interacting RNA) or a precursor thereof, a tasiRNA (trans-acting small/short interfering RNA) or a precursor thereof, an aRNA (antisense RNA) or a precursor thereof, or a small non-coding RNA or a precursor thereof , genomic DNA, cDNA, mRNA, ribozymal or a DNA encoding the before mentioned RNAs or chimeroplasts (Gamper, Nucleic Acids Research (2000), 28, 4332 - 4339). As already described, as used herein, "precursors" of the polynucleotides to be inhibited in context of the present invention may be forms of the respective polynucleotides as they occur during maturation of the respective polynucleotides. For example, in context of the present invention, precursors of a microRNA or a mimic microRNA may be primary mi RNAs (pri- miRNAs) or precursor mi RNAs (pre-miRNAs) as occurring during maturation of mi RNAs. Both are single transcripts (i.e. ssRNA) that fold into a characteristic intramolecular secondary structure, the so-called "hairpin loop", which contains a stretch of about 18 to 23 base pairs, which is often interrupted by mismatches. In context of the present invention, precursors of siRNAs may be long dsRNA molecules or shorter "hairpin loop" ssRNA molecules. Both types of these siRNA precursors may contain a stretch of base pairs without any mismatch. The current model for maturation of mammalian miRNAs is nuclear cleavage of the primary rniRNA (pri-miRNA) which liberates a 60-70 nt stem loop intermediate, known as the mi RNA precursor or pre-miRNA. The mature about 18-23 nt long mi R A is yielded from one arm of the stem loop precursor (B artel, Cell (2004), 116: 281-297; Lee. EMBO J (2002), 21: 4663-4670; Zeng and Cullen. RNA (2003), 9: 112-123). Said polynucleotides may be in the form of a plasmid or of viral DNA or RNA. Preferably, the polynucleotide to be inhibited in context of the present invention is a microRNA or a mimic microRNA.
In one embodiment, the polynucleotide which decreases or suppresses expression of Dicer to be inhibited in context of the present invention comprises or consists of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 103.1), SEQ ID NO: 2 (mature nr!R- 103.2), SEQ ID NO: 3 (mature miR-107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 5 (seed sequence of miR-107), SEQ ID NO: 6 (consensus sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 7 (pre-miR- 103.1), SEQ ID NO: 8 (pre-miR- 103.2), SEQ ID NO: 9 (pre-miR- 107), or any other SEQ ID NO. or consensus or seed sequence as shown in Table 1 herein. Furthermore, a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of the consensus or seed sequences as shown in Table 1 including one, two or more nucleotide(s) of the corresponding mature- or pre-miR sequence at the 5' -end and/or the 3 '-end of the respective consensus or seed sequence. For example, a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence comprising or consisting of the nucleotide sequence CAAGCAGCAUUGUACAGGGCUAU (i.e. the consensus sequence of SEQ ID NO: 7 including two nucleotides of the corresponding pre-miR sequence at the 5 '-end; SEQ ID NO: 12) or AGCAGCAUU (i.e. the seed sequence of SEQ ID NO: 3 including one nucleotide of the corresponding mature sequence at the 5'- end and one nucleotide of the corresponding mature sequence at the 3" -end: SEQ ID NO: 13). Polynucleotides to be inhibited in context of the present invention (i.e. polynucleotides which decrease or suppress expression of Dicer) may also comprise or consist of the nucleotide sequence shown in any one of SEQ ID NO: 1 (mature miR- 103.1), SEQ ID NO: 2 (mature miR-103.2), SEQ ID NO: 3 (mature miR- 107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 5 (seed sequence of miR- 107), SEQ ID NO: 6 (consensus sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 7 (pre-miR- 103.1), SEQ ID NO: 8 (pre-miR- 103.2), SEQ ID NO: 9 (pre-miR- 107), or any other SEQ ID NO. or consensus or seed sequence as shown in Table 1 herein, respectively, wherein one, two, three, four, five or more nucleotides are added, deleted or substituted. Furthermore, a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence comprising or consisting of the nucleotide sequence of any one of the consensus or seed sequences as shown in Table 1 including one, two or more nucleotide(s) of the corresponding mature- or pre-miR sequence at the 5 '-end and/or the 3 '-end of the respective consensus or seed sequence, wherein one, two, three, four, five or more nucleotides are added, deleted or substituted. For example, a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence comprising or consisting of the nucleotide sequence AGCAGCAA (i.e. the consensus sequence of SEQ ID NO: 2 including one nucleotide of the corresponding mature sequence at the 5 '-end and one nucleotide of the corresponding mature sequence at the 3 '-end, wherein the nucleotide at the 3 '-end has been substituted by A; SEQ ID NO: 14). Preferably, said addition, deletion or substitution of one, two, three, four, five or more nucleotides is not effected within the seed sequence of a polynucleotide as shown in Table 1 herein. More preferably, said addition, deletion or substitution of one, two, three, four, five or more nucleotides is not effected within the seed- or consensus sequence of a polynucleotide as shown in Table 1 herein. Also, the polynucleotide to be inhibited in context of the present invention may comprise or consist of a polynucleotide being at least 25%, 30%, 35%, 40%>, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% identical to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 103.1 ), SEQ ID NO: 2 (mature miR-103.2), SEQ ID NO: 3 (mature miR- 107), SEQ ID NO: 4 (seed sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 5 (seed sequence of miR- 107), SEQ ID NO: 6 (consensus sequence of SEQ ID NOs. 1 to 3), SEQ ID NO: 7 (pre-miR- 103.1), SEQ ID NO: 8 (pre-miR-103.2), SEQ I D NO: 9 (pre-miR-107), or any other SEQ ID NO. or consensus or seed sequence as shown in Table 1 herein. Furthermore, a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence with an identity of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%), 80%), 85%o, 90%), 95%>, 97%>, 98 > or 99% to a polynucleotide comprising or consisting of the nucleotide sequence of any one of the consensus or seed sequences as shown in Table 1 including one. two or more nucleotide(s) of the corresponding mature- or pre-mi R sequence at the 5 '-end and/or the 3 '-end of the respective consensus or seed sequence. For example, a polynucleotide to be inhibited in context of the present invention may have a nucleic acid sequence with an identity of at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence CAAGCAGCAUUGUACAGGGCUAUCAAA (i.e. the consensus sequence of SEQ ID NO: 9 including two nucleotides of the corresponding pre-mi R sequence at the 5 '-end and two nucleotides of the corresponding pre-miR sequence at the 3 ' -end; SEQ ID NO: 15). Additionally, a polynucleotide to be inhibited in context of the present invention may also have a nucleic acid sequence with an identity of at least 25%>, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% or 99% to a polynucleotide comprising or consisting of the nucleotide sequence of any one of SEQ ID NO: 1 (mature miR- 103.1), SEQ I D NO: 2 (mature miR-103.2), SEQ ID NO: 3 (mature miR- 107), SEQ ID NO: 6 (consensus sequence of SEQ I D NOs. 1 to 3), SEQ ID NO: 7 (pre-miR- 103.1), SEQ ID NO: 8 (pre-miR- 103.2), SEQ ID NO: 9 (pre-miR-107) and comprise the nucleic acid sequence as shown in SEQ I D NO: 4 (seed sequence of SEQ I D NOs. 1 to 3) or SEQ ID NO: 5 (seed sequence of miR- 107) or any other seed sequence as shown in Table 1 herein.
Generally, as used herein, a polynucleotide comprising the nucleic acid sequence of a sequence provided herein may also be a polynucleotide consisting of said nucleic acid sequence.
In context of the determination whether two given nucleic acid molecules are able to hybridize, e.g., whether a polynucleotide to be inhibited in context of the present invention hybridizes to an mRNA of Dicer or a biologically active derivative thereof, or whether an inhibitor described in and used in accordance with the present invention hybridizes to a polynucleotide to be inhibited in context of the present invention, the hybridization may occur and be detected under physiological or artificial conditions, under stringent or non-stringent conditions. Said hybridization conditions may be established according to conventional protocols described, for example, in Sambrook, Russell "Molecular Cloning, A Laboratory Manual", Cold Spring I Iarbor Laboratory, N.Y. (2001); Ausubel. "Current Protocols in Molecular Biology", Green Publishing Associates and Wiley Interscience, N.Y. (1989), or Higgins and flames (Eds.) "Nucleic acid hybridization, a practical approach" IRL Press Oxford, Washington DC. (1985). The setting of conditions is well within the skill of the artisan and can be determined according to protocols described in the art. Thus, the detection of only specifically hybridizing sequences will usually require stringent hybridization and washing conditions such as O. lxSSC, 0.1% SDS at 65 °C. Non-stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may be set at 6xSSC, 1% SDS at 65 °C. As is well known in the art, the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility. In accordance to the invention described herein, low stringent hybridization conditions for the detection of homologous or not exactly complementary sequences may, for example, be set at 6 x SSC, 1% SDS at 65°C. As is well known in the art, the length of the probe and the composition of the nucleic acid to be determined constitute further parameters of the hybridization conditions. Polynucleotides to be inhibited in context of the present invention which hybridize to the mRNA of Dicer or a biologically active derivative thereof also comprise fragments of the above described polynucleotides which are to be inhibited in context of the present invention. Such fragments preferably are polynucleotides which are able to decrease or suppress expression of Dicer or a biologically active derivative thereof. Furthermore, a hybridization complex refers to a complex between two nucleic acid sequences by virtue of the formation of hydrogen bonds between complementary G and C bases and between complementary A and T (or U, respectively) bases; these hydrogen bonds may be further stabilized by base stacking interactions. A hybridization complex may be formed in solution (e.g., Cot or Rot analysis) or between one nucleic acid sequence present in solution and another nucleic acid sequence immobilized on a solid support (e.g. , membranes, filters, chips, pins or glass slides to which, e.g., cells have been fixed). The terms complementary or complementarity refer to the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing. For example, the sequence "A-G-T (or U, respectively)" binds to the complementary sequence "T (or U, respectively)-C-A". Complementarity between two single-stranded molecules may be "partial", in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between single-stranded molecules. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands.
In order to determine whether two nucleic acid molecules hybridize, e.g., whether a given polynucleotide hybridizes to the mRNA of Dicer or a biologically active derivative thereof as described herein, thereby inducing degradation or preventing translation of said mRNA of Dicer or a biologically active derivative thereof, or whether an inhibitor described in and used in accordance with the present invention hybridizes to a polynucleotide to be inhibited in context of the present invention, various tests known in the art and also described herein may be applied. In this context, the hybridization may occur and be tested under physiological conditions or under artificial conditions as known in the art and also described herein. For example, a test to determine hybridization between an miRNA and an mRNA may be a Luciferase Assay as also described in technical bulletins by Promega (C8021 (psiCHECK-2 Vector), El 960 (Dual-Luciferase® Reporter Assay System)). In context of the present invention, general examples of methods suitable to determine whether a polynucleotide hybridizes to another nucleic acid (e.g., the 3 'UTR of the mRNA of Dicer) are reporter gene assays in which common reporter genes are used such as fluorescent proteins (e.g., GFP, eGFP, YFP, eYFP, BFP, or eBFP), or luminescent proteins (e.g., Renilla or firefly luciferase, or β-galactosidase encoded by the lacZ gene). Furthermore, degradation of mRNA or the level of the respective translation product (to test whether the translation of the mRNA was prevented) can easily be examined by methods known in the art. Examples for methods suitable to examine degradation or stabilization of mRNA are qPCR, RT-PCR, qRT-PCR. RT-qPCR, Light Cycler®, TaqMan® Platform and Assays, Northern blot, dot blot, microarrays, next generation sequencing (VanGuilder, Biotechniques (2008), 44: 619-26; Elvidge, Pharmacogenomics (2006), 7: 123-134; Metzker, Nat Rev Genet (2010), 1 1 : 31-46). Examples for methods suitable to examine whether the translation of a mRNA has been prevented or decreased are polyacrylamide gel electrophoresis and related blotting techniques such as Western Blot paired with chromogenic dye-based protein detection techniques (such as silver or coomassie blue staining) or with fluorescence- and luminescence-based detection methods for proteins in solutions and on gels, blots and microarrays, such as immunostaining, as well as immunoprecipitation, ELISA, microarrays, and mass spectrometry (Western Blot (Burnettc. Anal Biochem (1981) 1 12: 195-203) or ELISA (Crowther, JA. The ELISA Guidebook. Humana Press; Totowa, NJ: 2001).
In accordance with the present invention, in order to determine whether a polynucleotide decreases or suppresses expression of Dicer or a biologically active derivative thereof (e.g., by hybridizing to the mRNA of Dicer and thereby inducing degradation or preventing translation of Dicer mRNA), the level of expressed Dicer can be easily detected. In context of the present invention, a polynucleotide is to be assessed as decreasing or suppressing expression of Dicer or a biologically active derivative thereof if the detected level of expressed Dicer in a test sample which was contacted with a polynucleotide to be tested is at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70% or at least 80% lower than the Dicer expression level of a control sample which was not contacted 'with the polynucleotide. For example, a Western blot analysis can be performed for Dicer protein detection (Dupont, Cell (2009) 136: 123-135).
Furthermore, in one embodiment, the polynucleotide to be inhibited in context of the present invention may hybridize to the 3'UTR (untranslated region) of the mRNA of Dicer or a biologically active derivative thereof or to fragments of said 3'UTR. Hybridization between a polynucleotide to be inhibited in context of the present invention and the 3'UTR of the mRNA of Dicer or a biologically active derivative thereof can easily be tested as described hereinabove. Preferably, by hybridizing to the 3'UTR of the mRNA of Dicer or a biologically active derivative thereof or to fragments of said 3'UTR, the polynucleotide to be inhibited in context of the present invention induces degradation of or prevents translation of said mRNA of Dicer or a biologically derivative thereof. Generally, in context of the present invention, when referring to Dicer, reference is made to Gen Bank Accession No. NM_177438, Version No. NMJ 77438.2. The sequence of the 3'UTR of Dicer mRNA is shown in SEQ ID NO: 10 herein. In one embodiment, the polynucleotide to be inhibited in context of the present invention is able to hybridize to a nucleic acid sequence comprising nucleotides 1032 to 1039, 1033 to 1039, 1532 to 1539, 1533 to 1539, 1632 to 1639, 1633 to 1639, 2489 to 2495, 2837 to 2843, 2970 to 2976, 4108 to 4115, 4109 to 41 15, 4160 to 4166 and/or 4160 to 4177 of SEQ ID NO: 10, preferably thereby inducing degradation of or prevention of translation of the mRNA of Dicer or a biologically derivative thereof.
As used herein, a biologically active derivative of Dicer means that is has the same biological function as Dicer, i, e. it is capable of processing pre-miRNA to mature miRNA. That is, if a compound is capable of lowering the ratio of pre-miR A. mature miRNA by at least 10%, at least 20%, at least 30%), at least 40%), or at least 50%>, then it may be considered as having biological Dicer activity. Methods for determining the amounts of pre-miRNA and mature miRNA are known in the art (e.g., Benes, Methods (2010), 50:244-249; Schmittgen, Methods (2008), 44: 31-38). The nucleic acid sequence of the 3'UTR of the mRNA of a Dicer derivative in context of the present invention may be at least 75%>, more preferably at least 80%), more preferably 85%>, more preferably 90%, more preferably 95%> and most preferably 98% identical to SEQ ID NO: 10.
As already mentioned, the present invention relates to a composition comprising an inhibitor of a polynucleotide or polynucleotides described herein, i. e. which are capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof for use in treating or preventing cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject.
In accordance with the present invention, the subject to be treated or in which cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto is to be prevented may be mammalian. In a preferred embodiment of the present invention, the subject is human.
Generally, in context of the present invention, the composition to be used in context of the present invention may comprise an inhibitor which inhibits one, two, three or more of the polynucleotides to be inhibited in context of the present invention. Also, the composition may comprise two, three or more inhibitors, wherein each of the inhibitors is capable of inhibiting one, two, three or more of the polynucleotides to be inhibited in context of the present invention.
The composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention may contain the inhibitor in an amount of about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto are to be prevented. In a preferred embodiment of the present invention, the composition comprises the inhibitor in an amount of about 1 μg/kg body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight.
The composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention may further comprise a pharmaceutically acceptable carrier. Accordingly, the present invention also relates to a pharmaceutical composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention and further comprising a pharmaceutically acceptable carrier, excipient and/or diluent. Generally, examples of suitable pharmaceutical carriers arc well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Compositions comprising such carriers can be formulated by well known conventional methods. These pharmaceutical compositions can be administered to the subject at a suitable dose, i.e. about 1 ng/kg body weight to about 100 mg/kg body weight of the subject which is to be treated or in which cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto are to be prevented. In a preferred embodiment of the present invention, the composition comprising an inhibitor of a polynucleotide or polynucleotides to be inhibited in context of the present invention comprises the inhibitor in an amount of about 1 μg/kg body weight to about 20 mg/kg body weight, more preferably 1 mg/kg body weight to about 10 mg/kg body weight. Administration of the composition may be effected or administered by different ways, e.g. , enterally, orally (e.g., pill, tablet (buccal, sublingual, orally, disintegrating, capsule, thin film, liquid solution or suspension, powder, solid crystals or liquid), rectally (e.g., suppository, enema), via injection (e.g., intravenously, subcutaneously, intramuscularly, intraperitoneally, intradermally) via inhalation (e.g., intrabronchially), topically, vaginally, epicutaneously, or intranasally. The dosage regimen will be determined by the attending physician and clinical factors. As is well Icnown in the medical arts, dosages for any one patient depends upon many factors, includin the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. The compositions comprising an inhibitor or inhibitors of a polynucleotide or polynucleotides to be inhibited in context of the present invention may be administered locally or systemically. Administration will preferably be parenterally, e.g., intravenously. The composition may also be administered directly to the target site, e.g., by biolistic delivery to an internal or external target site or by catheter to a site in an artery. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like. Furthermore, also doses below or above of the exemplar}' ranges described hereinabove are envisioned, especially considering the aforementioned factors.
As already mentioned, the compositions described herein comprising an inhibitors of a polynucleotide or polynucleotides being capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof as described herein may be used to treat or prevent cancer, particularly breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject.
In context of the present invention, an inhibitor of a polynucleotide or polynucleotides to be inhibited in accordance with the present invention may be a nucleic acid molecule, a polypeptide or any other compound capable of inhibiting the polynucleotides to be inhibited in context of the present invention. In one embodiment of the present invention, an inhibitor to be employed in context of the present invention is a nucleic acid molecule capable of hybridizing to the polynucleotide to be inhibited in context of the present invention. Methods for determining and evaluating hybridization between nucleic acid molecules are described herein above and below. Preferably, in accordance with the present invention, by hybridizing to a polynucleotide to be inhibited in context of the present invention, the inhibitor prevents said polynucleotide to be inhibited in context of the present invention from decreasing or suppressing expression of Dicer or a biologically derivative thereof, e.g., by hybridization of said polynucleotide with the niR A (e.g., the 3'UTR thereof) of Dicer or a biologically derivative thereof. Methods for determining and evaluating the capability of a polynucleotide to decrease or suppress the expression of Dicer or a biologically active derivative thereof as well as methods for determining or evaluating whether the expression level of Dicer is decreased or suppressed are well known in the art and are also described herein above and below. Accordingly, a given compound can be assessed as an inhibitor to be employed in context of the present invention if it is able to prevent hybridization of a polynucleotide to be inhibited in context of the present invention with the mRNA (e.g., the 3'UTR thereof) of Dicer or a biologically derivative thereof. Accordingly, in context of the present invention, an inhibitor may be able to at least partially reverse the effect of a polynucleotide to be inhibited in context of the present invention on the expression of Dicer or a biologically active derivative thereof. For example, the inhibitor to be employed in context of the present invention may be capable of reversing the effect of a polynucleotide as described hereinabove on Dicer-expression by 50% or more, preferably by 60% or more, more preferably by 70% or more, more preferably by 80% or more, more preferably by 90% or more, more preferably by 95% or more, more preferably by 98% or more, and most preferably by 99% or more. That is, e.g., if a polynucleotide to be inhibited in context of the present invention is capable of decreasing or suppressing the expression of Dicer or a biologically derivative thereof such as it amounts to an expression level of 50% compared to the normal expression level (i.e. without said polynucleotide), and the expression level increases by applying an inhibitor as described herein such that the expression level of Dicer or a biologically derivative thereof increases to an amount of 75% compared to the normal expression level (i.e. without said polynucleotide), the effect of said polynucleotide is reversed by the inhibitor by 50%.
In one embodiment of the present invention, the inhibitor of a polynucleotide to inhibited in accordance with the present invention is a nucleic acid molecule which is capable of hybridizing to said polynucleotides to be inhibited, preferably under stringent conditions as described herein, thereby preventing said polynucleotide from hybridizing to the mRNA (e.g., the 3'UTR thereof) of Dicer or a biologically active derivative thereof. The hybridization of said nucleic acid to be employed as an inhibitor in context of the present invention to a polynucleotide to be inhibited in context of the present invention may be over the entire length of said polynucleotide to be inhibited or only over a part of the sequence of said polynucleotide to be inhibited, e.g., over at least 25%, at least 35%, at least 45%, at least 55%, at least 65%, at least 75%, at least 85% or at least 95% of the sequence of said polynucleotide to be inhibited, one embodiment of the present invention, the inhibitor to be employed in context of the present invention may be an antisense oligonucleotide which is complementarv to a polynucleotide to be inhibited in context of the present invention. Preferably, in accordance with the present invention, an inhibitor to be employed in context of the present invention is an antisense oligonucleotide which comprises or consists of a nucleic acid molecule having a sequence complementary to any of the sequences as shown in Table 1 hereinabove, e.g., to any one of SEQ ID NOs. 1 to 9. Generally, inhibitors of miRNAs or siRNAs are well known in the art and customized miRNA- or siRNA-inhibitors are commercially available. For example, inhibitors of polynucleotides to be inhibited in context of the present invention may be nucleic acid molecules such as AntagomiRs (Kriitzfeldt, Nature (2005), 438: 685-689) or any other 2'-0-methy!-RNA oligonucleotide having phosphorothioates bonds and a cholesterol tail, miRCURY LNA™ microRNA inhibitors (Exiqon), in vivo LNA™ miR inhibitors (Exiqon), miR-decoys or miR-sponges (Ebert, Nat Methods (2007), 4: 721-726; Bond, Nat Med (2008), 14: 1271-1277), or nucleases specifically cleaving the polynucleotide to be inhibited in context if the present invention, (e.g., zinc finger nucleases such as CompoZr® from Sigrna-Aldrich). or the like which are capable of inhibiting a polynucleotide to be inhibited in context of the present invention as described hereinabove, e.g., by hybridizing to said polynucleotide or cleaving said polynucleotide, respectively. For example, in context of the present invention, an AntagomiR-inhibitor for the mature sequence of miR- 103.1 and/or miR- 103.2 (SEQ ID NOs. 1 or 2, respectively), could be as follows (all bases 2'-0-methylated; * represents a phosphorothioate linkage; Choi represents covalently linked cholesterol): 5'-U*U*CAUAGCCCUGUACAAUGCUG*C*U*U*-Chol- T*-3'. The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 1, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 2, thereby preventing hybridization of said polynucleotide with the mRNA. of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 3, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 4, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 5, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 6, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 7, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 8, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
The present invention relates to a composition comprising a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in SEQ ID NO: 9, thereby preventing hybridization of said polynucleotide with the mRNA of Dicer, for use in treating or preventing breast cancer or metastasis in a human subject.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is an AntagomiR.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is a 2'-0-methyl-RNA oligonucleotide having phosphorothioates bonds and a cholesterol tail.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is an miRCURY LNA microRNA inhibitor.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is an in vivo LNA miR inhibitor.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is an miR-decoy or miR-sponge.
In context of the composition of the preceding paragraphs, a nucleic acid molecule which hybridizes under stringent conditions with the polynucleotide consisting of the nucleic acid sequence shown in any one of SEQ ID NOs: 1 to 9 is a zinc finger nuclease.
Furthermore, in accordance with the present invention, the inhibitor (i. e. in case of a nucleic acid inhibitor) of the polynucleotide to be inhibited in context of the present invention may be cloned into a vector. The term "vector" as used herein particularly refers to plasmids, cosmids, viruses, bacteriophages and other vectors commonly used in genetic engineering. In a preferred embodiment, these vectors are suitable for the transformation of cells, like fungal cells, cells of microorganisms such as yeast or prokaryotic cells. In a particularly preferred embodiment, such vectors are suitable for stable transformation of bacterial cells, for example to transcribe the polynucleotide of the present invention.
Accordingly, in one aspect of the invention, the vector as provided is an expression vector. Generally, expression vectors have been widely described in the literature. As a rule, they may not only contain a selection marker gene and a replication-origin ensuring replication in the host selected, but also a promoter, and in most cases a termination signal for transcription. Between the promoter and the termination signal there is preferably at least one restriction site or a polylinker which enables the insertion of a nucleic acid sequence/molecule desired to be expressed.
It is to be understood that when the vector provided herein is generated by taking advantage of an expression vector known in the prior art that already comprises a promoter suitable to be employed in context of this invention, for example expression of an inhibitor (i.e. in case of a nucleic acid inhibitor) of a. polynucleotide as described hereinabove, the nucleic acid construct i c
Figure imgf000026_0001
intrs t ai if! fl ni flnnpr flip rpcnltina C"mnn¾eS OPl O e P o ote*" suitable to be employed in context of this invention. The skilled person knows how such insertion can be put into practice. For example, the promoter can be excised either from the nucleic acid construct or from the expression vector prior to ligation.
As a non-limiting example, the vector into which an inhibitor (i. e. in case of a nucleic acid
Figure imgf000026_0002
of the present invention (i.e. which decreases or suppresses Dicer-expression) is cloned is an adenoviral, adeno-associated viral (AAV), retroviral, or nonviral minicircle-vector. Further examples of vectors suitable to comprise the inhibitor (i.e. in case of a nucleic acid inhibitor) of a polynucleotide to be inhibited in context of the present invention to form the vector described herein are known in the art. For example, a vector into which an inhibitor (i.e. in case of a nucleic acid inhibitor) of a polynucleotide to be inhibited in context of the present invention has been cloned may be miR-Vec, a retroviral expression vector (Voorhoeve, Cell (2006), 124: 1 169-1 181).
In an additional embodiment, the inhibitor (in case of a nucleic acid inhibitor or the coding nucleic acid sequence of a peptide inhibitor) of a polynucleotide to inhibited in context of the present invention and/or the vector into which the polynucleotide described herein is cloned may be transduced, transformed or transfected or otherwise introduced into a host cell. For example, the host cell is a eukaryotic or a prokaryotic cell, for example, a bacterial cell. As a non-limiting example, the host cell is preferably a mammalian cell. The host cell described herein is intended to be particularly useful for generating the inhibitor of a polynucleotide to be inhibited in context of the present invention. Generally, the host cell described hereinabove may be a prokaryotic or eukaryotic cell, comprising an inhibitor of the polynucleotide to be inhibited in context of the present invention or the vector described herein or a cell derived from such a cell and containing the nucleic acid construct or the vector described herein. In a preferred embodiment, the host cell comprises, i.e. is genetically modified with nucleic acid sequence of the inhibitor of the polynucleotide to be inhibited in context of the present invention or the vector described herein in such a way that it contains the nucleic acid sequence of the inhibitor of a polynucleotide to be inhibited in context of the present invention integrated into the genome. For example, such host cell described herein may be a bacterial, yeast, or fungus cell. In one particular aspect, the host cell is capable to transcribe the nucleic acid sequence of an inhibitor of a polynucleotide which decreases or suppresses expression of Dicer or a biologically active derivative thereof in context of the present invention. An overview of examples of different corresponding expression systems to be used for generating the host cell described herein is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter (Methods in Enzymology 153 (1987), 516-544), in Sawers (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), and in Griffiths (Methods in Molecular Biology 75 (1997), 427-440). The transformation or genetically engineering of the host cell with a polynucleotide to be inhibited in context of the present invention or vector described herein can be carried out by standard methods, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, NY, USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990.
Furthermore, as already mentioned and in context of the present invention, expression of miR- 103/107, but not Dicer mRNA, was validated in human primary breast tumors as a prognostic marker. That is, in accordance with the present invention, the polynucleotides to be inhibited in context of the present invention may also serve as diagnostic or prognostic markers themselves and detection of said polynucleotides, e.g., by using compounds binding thereto, will be useful in diagnosing or predicting the progression of diseases or disorders such as cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject. As has been surprisingly found in the present invention and as described and exemplified in detail herein, patients expressing high amounts of polynucleotides (such as miR- 103/107) as described herein, i.e. which are capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof, display a significant higher probability to develop metastasis when compared to patients expressing low amounts of polynucleotides (such as miR- 103/107) as described herein, i.e. which are capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof.
Accordingly, the present invention also relates to a compound binding to a polynucleotide described herein, i.e. to a polynucleotide which is capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof as described herein, for use in diagnosing or predicting the progression of diseases or disorders such as cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject. Furthermore, the present invention also relates to pharmaceutical compositions comprising a compound binding to a polynucleotide as described herein for use in diagnosis of diseases or disorders such as cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto. In one embodiment of the present invention, the compound binding to the polynucleotide described herein is a nucleic acid molecule as described in context of an inhibitor of said polynucleotide capable of hybridizing to said polynucleotide as described hereinabove. Hybridization of such a binding nucleic acid molecule to said polynucleotide described herein can be easily detected by the skilled person using methods well know7n in the art and as also described herein. In another embodiment, said binding compound is an antibody or a fragment thereof (such as F(ab) or F(ab)2 fragments) specifically binding to said polynucleotide as described herein, i.e. which is capable of decreasing or suppressing expression of Dicer or a biologically derivative thereof. Binding of an antibody or a fragment thereof to a polynucleotide can be easily detected by the skilled person using methods well known in the art such as ELISA, EIA or similar methods.
Also, the present invention relates to a method for diagnosing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject, said method comprising the steps of: (a) obtaining a biological sample from a subject;
(b) contacting said sample with a compound binding to a polynucleotide being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof; and
(c) detecting binding of said compound and said polynucleotide,
wherein the polynucleotide capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof is a polynucleotide as described hereinabove in the context of polynucleotides to be inhibited. Preferably, in context of the present invention, the biological sample of (a) contains a polynucleotide as described herein, i. e. which is capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof. Examples for biological samples in context of the present invention are blood, serum, plasma, saliva, sperm fluid, vaginal fluid or the like. In one embodiment, the method is an in vitro method.
Figure imgf000029_0001
Figure 1: miR-103/107 target Dicer
(A) Schematic representation of the 3'UTR of Dicer. Rectangles show predicted miR-103/107 target sequences. Below, sequences of mature miR-103 and miR-107 aligned to one of these target sites, revealing evolutionary conservation in the seed-pairing sequence between amphibians (Xenopus, Xtr), birds (Gallus, Gga) and mammals (human, Hsa and mouse, Mmu).
(B) Schematic representation of the reporters for miR-103/107 activity against the Dicer 3'UTR. The CMV promoter drives constitutive transcription of a chimeric mRNA containing the firefly luciferase coding sequence fused to the full length Dicer 3'UTR (Lux-Dicer 3'-WT) or to the same UTR mutated in all the miR-103/107 seed pairing sequences (Lux-Dicer 3'-MUT). Below, the predicted miR-103/107 binding sites in the 3'UTR of Dicer mRNA are responsive to endogenous (compare lane 1 with lane 5) and overexpressed miR-103 or miR-107 in human U20S cells. Luciferase reporters were transfected in parental (-) or in stable cell lines expressing pri-miR-103, pri- miR-107 or, as a control, the unrelated pri-miR-154. Absolute values are shown as mean and SD. (C) Downregulation of endogenous Dicer protein expression by miR-103/107 as assayed by immunoblotting. LaminB serves as loading control. Controls are shGFP (U20S) or scrambled siRNA (MDA-MB-231). Mature miR- 107-MUT bears mutations in the seed sequence and is inactive compared to wild-type.
(D) and (E) Endogenous requirement of miR-103/107 as Dicer inhibitors, in (D), bars show expression of the Dicer 3'UTR reporters in cells depleted of endogenous miR-103/107 by treatment with AntagomiR. Values relative to AntagomiR-MUT treated cells are shown as mean and SD. Effectiveness and specificity of AntagomiR treatments on endogenous miR-103/107 expression are shown in Figure S ID. In (E), endogenous Dicer protein levels are upregulated in miR- 103/107-depleted cells.
(F) In line with its effect on Dicer, overexpression of miR-107 causes a global reduction of mature miRNAs endogenously expressed in MDA-MB-231 cells. Dots show the ratio of miRNAs expression levels in miR-107 vs. miR-107- MUT transfected cells. Global miRNAs expression was measured with TaqMan Human miRNA Array and normalized to snRNA-U6b loading control. See Table 2 for expression values.
(G) Expression of a miR-103/107-insensitive Dicer cDNA rescues mature miRNA expression, here exemplified by mi R- 1 5a. The effects of miR-107 on mature miR-15a levels were compared in parental and MDA-MB-231 cells stably expressing a miR- 103/107-insensitive form of Dicer (+Dicer). miR- 1 5a expression was measured by qRT-PCR and normalized to snRNA-U6b loading control. Relative values are shown as mean and SD.
Figure 2: Clinical association of miR-103/107 with metastasis in breast cancer patients
(A) and (B) Top panels: Expression of miR-103/107 increases in cellular models of metastasis progression, as assayed by qRT -PCR. Values relative to the non metastatic, less aggressive line (67NR and SW480, respectively) are normalized to snRNA-U6b and shown as mean and SD. Lower panels: western blot for Dicer showing the inverse correlation between Dicer protein levels and miR-103/107 expression. LaminB serves as loading control. See also Figure 9 for levels of pri-miR- 103/107 in the same samples. (C) and ( D) Mature miR-103/107 levels predict metastasis proclivity in breast cancer patients. (C) Box plots showing the expression levels of mature miR- 103 and miR-107 in breast cancer samples from the "Milan-INT" patients' dataset. Samples were divided in two groups with coherent low or high expression of both genes. "Low" and "High" are the names of the two groups of patients. Each box represents median and 75th and 25th percentile values. (D) Kaplan-Meier graph representing the probability of metastasis-free survival in breast cancer patients from the "Milan-INT" dataset stratified as in (C). The log-rank test p value reflects the significance of the association between high miR-103/107 levels and metastasis.
(E, F, G and H) Immunohistochemistry (IHC) for Dicer protein expression in primary human breast cancers samples from the "Milan-INT" dataset (analyzed above). Panels show representative pictures of Dicer staining in normal breast tissue (E), or cancer tissues with low (F) or high (G) levels of miR-103/107 ("Low" and "High" groups, respectively). N indicates mammary ducts with normal morphology (used as internal positive controls for Dicer IHC), while T indicates tumor cells. (H) Percentage of breast cancer samples (n=20), from the "Low" and "High" groups, that display Dicer staining in the cancer tissue comparable to the adjacent normal tissue (as shown in F).
(I) and (L) Kaplan-Meier graphs representing the probability of metastasis-free survival in breast cancer patients from the "London" dataset (see Examples 12 to 14) stratified according to low or high pri-miR-103/107 expression levels (I) or to low and high Dicer expression levels (L). The log-rank test p values reflect the significance of the association between high pri-miR-103/107 and metastatic relapse, but fail to show any association for Dicer. See Figure 10 for similar results obtained from other four independent breast cancer datasets.
Figure 3: miR-103/107 outbalance Dicer to promote cell migration and invasion
(A) and (B) miR-103/107 expression promotes migration in SUM 149 breast cancer cells by attenuating Dicer levels. Stable cell lines expressing shGFP (lane 1), pri-miR- 103 (lane 2), pri-miR-107 (lane 3) and shDicer (lane 4) from retroviral expression vectors were compared in transwell migration assays. Lane 5 shows the effect of a miR-insensitive Dicer transgene on migration of cells already expressing pri-miR-107. (A) absolute quantifications of cells migrated through the transwell. (B) representative pictures of cells migrated through the filter, stained with crystal-violet, taken at the same magnification
(C) and (D) miR-107 promotes migration of parental MDA-MB-231 breast cancer cells (Control), but not of cells expressing miR-insensitive Dicer (+Dicer). Graph in (D) shows the absolute number of cells invading the wound for which representative pictures are provided in (C).
(E) Wound-healing assay as in (C) showing how only partial knockdown of Dicer (lanes 6-8) mimics gain-of-miR-107 to promote cell migration. MDA- MB-2 1 cells were transfected with two-fold serial dilutions of Dicer siRNA, ranging from 25 nM (lane 2) to 0.2 nM (lane 9). Graphs show the absolute number of cells invading the wound.
(F) Immunoblotting of cells transfected as in (E). siDicer high (25 nM) corresponds to lane 2, siDicer low (0.8 nM) to lane 7. Note comparable depletion between the latter and miR-107. β-catenin (b-cat) serves as loading control.
(G) Endogenous miR- 103/107 promote cell migration through Dicer downregulation. Depletion of endogenous miR- 103/107 by treatment with AntagomiR- 103/107 reduces the migration of 4T1 cells (lanes 1 and 2), without having effect on proliferation and cell cycle (see Figure 1 IE). Stable expression of Dicer similarly opposes cell migration (lane 3). In contrast, migration of Dicer-depleted cells (shDicer), is not reduced by treatment with AntagomiR- 103/107 (compare lanes 4 and 5), Graphs show the absolute quantitations of cells invading transwell filters. Data are represented as mean and SD. See also Figure 1 1.
Figure 4: miR-107 induces metastatic dissemination.
(A) and (B) Lung colonization assays of SUM149 derivatives after injection in the tail vein of SCID mice (8 mice per cell line). 4 weeks after injection lungs were analyzed for the presence of metastatic nodules. (A) Quantification of metastatic nodules formed by the indicated SUM 149 derivatives. Analyses were carried out on histological sections of the lungs (4 sections per lung) stained with the anti-cytokeratin antibodies AE1/AE3. Data are represented as mean and SD. (B) Representative pictures of metastases embedded in the lung parenchyma. Macrometastases were observed only in mice injected with cells expressing pri-miR-107 or shDicer.
(C) SCID mice were orthotopically injected in the fat pad with SUM 149- shGFP or SUM149-miR-107 cells. The rates of primary tumor growth were not significantly different, showing, if anything, a reduced proliferation of SUM149-miR-107 in vivo. Data are represented as mean and SD.
(D) and (E) Pri-miR-107 promotes distant metastatic dissemination of breast cancer cells from the orthotopic site. Lungs of mice injected in (C) were expianted after 12 weeks and scored for the presence of metastases as in (A).
(E) Right panel : representative metastatic focus of SUM149-miR-107 cells embedded in the lung parenchyma. Graphs in (D) provide a quantification of metastatic dissemination measured as the percentage of sections displaying at least one metastasis out of n=8 SUM149-shGFP injected mice, and n=8 SUM149-miR-107 injected mice. Four-to-six serial sections were sampled and analyzed for each mouse.
Figure 5: Endogenous requirement of miR-103/107 for metastatic dissemination.
(A) The onset and growth rates of orthotopic 4T1 primary tumors were not significantly different in the presence (antagomiR-MUT) or absence (AntagomiR- 103/107) of miR-103/107 expression. Data are represented as mean and SD.
(B) AntagomiR- 103/107 inhibits miR-103 and miR-107 expression in 4T1 - derived primary tumors formed upon orthotopic injection (fat pad) in SCID mice. Panels show expression levels of the indicated microRNAs as measured by qRT-PCR on representative primary tumors (expianted from mice dubbed #8 to #1 1), normalized to snRNA-U6b loading control. Data are represented as mean and SD of replicas.
(C) Depletion of miR-103/107 reduces metastatic colonization. Lungs of mice injected in (A) were expianted after 21 days and scored for the presence of metastases. Metastatic burden was measured as the average number of metastatic foci per histological section (H&E stained), quantifying 10 to 12 serial sections for each mouse, on n=10 mice for each regimen. P value obtained using a one-sided Student's t-test.
i I) ) and (E) Pictures show representative H&E sections of the lung parenchyma from 4T1 tumor-bearing mice treated with AntagomiR-MUT (D) or AntagomiR- 103/107 (E). M, metastatic nodule.
(F) In vivo depletion of miR- 103/107 enhances miRNA maturation. Bars show the comparison between expression of the indicated mature miRNAs in antagomiR-MUT- vs antagomiR.-103/107-treated 4T1 pooled primary tumors (n=3 for each treatment), as measured by tjRT-PCR. Relative values are shown as mean and SD. See Figure 12B for expression levels of the corresponding pre-miRNAs.
(G) Raising Dicer expression reduces metastatic lung colonization. SCID mice were orthotopically injected in the fat pad with control-4Tl cells or two independent Dicer-expressing lines (n=6 mice for each cell-line). Lungs were explanted after 20 days and scored for the presence of metastases as in (C).
(H) and (I) representative H&E sections of the lung parenchyma from mice bearing tumors originating from control-4Tl cells (H) or Dicer-expressing 4T1 cells (I). See also Figure 12.
Figure 6: miR-103/107 induce epithelial plasticity.
(A) Morphology of MCF10A cells transiently transfected with mature miR- 107 or the control miRNA (miR-107-MUT). Note the loss of cell-cell adhesion and acquisition of spindle morphology in cells expressing miR- 107.
(B) NMuMG cells were transiently transfected with control miRNA (miR- 107- MUT) or miR- 107, and, after 3 days, analyzed for epithelial characters. Panels show the bright field morphology of transfected cells (upper panels), and the immunofluorescence for the adherent junction marker E-Cadherin (continuous arrows, middle panels) or for the tight junction marker ZO-1 (continuous arrows, lower panels). Nuclei are stained with DAPI (dashed arrows).
(C-F) Expression of the epithelial marker E-cadherin (C) and of the mesenchymal markers Vimentin (D), Fibronectin (E) and ICAM-1 (F) was examined by qRT-PCR in NMuMG cells. Graphs show relative expression levels, normalized to GAPDH. Stable expression of pri-miR-107 by retroviral transduction, transient transfection of mature miR-107 or shRNA knockdown of Dicer (shDicer) upregulate mesenchymal while inhibit epithelial markers. miR-107-MUT and shGFP are negative controls. TGF-beta treatment (TGFp i 200pM for 3 days) serves as positive control for EMT induction. Data are shown as mean and SD.
(G) Transient transfection of mature miR-107 increases the expression of the mesenchymal markers Vimentin, Fibronectin and ICAM-1 in MDA-MB-231 cells, as quantified by qRT-PCR. Expression values were given as relative to those of miR-107-MUT treated cells. Data are shown as mean and SD.
(H) Pri-miR-103/107 are required to support mesenchymal gene expression in MDA-MB-231 cells. Cells were treated for 5 days with AntagomiR-MUT or AntagomiR- 103/107, and analyzed for mesenchymal markers by qRT-PCR. For each marker, expression values were given as relative to those of AntagomiR-MUT treated cells. Data are shown as mean and SD.
(I) Pri-miR- 1 03 expression correlate with mesenchymal traits in a panel of breast cancer cell-lines. Heatmaps depicts the relative changes of standardized expression values of E-cadherin, Vimentin and pri-miR-103 for each cell line. Dark panels (first row, 5 panels from the right; second row, 1 1 panels from the left; and third row, 1 1 panels from the left) indicate low expression while light panels (first row, 1 1 panels from the left; second row, five panels from the right; and third row, 1 1 panels from the right) indicate high expression.
Figure 7: The miR-200 family members are inhibited by miR-103/107 to promote mesenchymal traits.
(A) A model for the miR- 103/107-Dicer-miR-200 pathway in EMT control.
(B) and (C) transfection of miR-200b reverts the EMT induced by pri-miR-107 in NMuMG, as assayed by cell morphology (B) and by qRT-PCR for the expression of epithelial (E-cadherin) or mesenchymal markers (Vimentin, ZEB 1 and ZEB2) (C). Graphs show relative expression levels.
(D) Transwell migration assays of MDA-MB-231 cells treated with antagomiR- 103/107, alone or in combination with a mix of antagomiRs targeting the entire miR-200 family (antagomiR-200). AntagomiR-MUT serves as negative control. Depletion of miR-103/107 inhibits MDA-MB-231 cell migration and but has no effect in cells depleted of miR-200 family. See Figure S6A for controls of antagomiR-200 effects.
( E-Hj miR-103/107 regulate the expression and activity of the miR-200 family. (E) Expression of mature miR-200 family members (miR-429, miR-200b and miR-200c) in MDA-MB-231 cells treated as in (D). Graphs show quantification of gene expression by qRT-PCR. For each marker, expression values were given as relative to those of antagomiR-MUT treated cells. (F) qRT-PCR analysis for the expression of the miR.-200 direct targets ZEB 1 and ZEB2 in MDA-MB-231 cells treated with AntagomiR-MUT or AntagomiR- 103/107. (G) and (H) Panels show qRT-PCR for mature miR-200 family members (G) and for their targets ZEB l and ZEB2 (H) in MDA-MB-231 cells transiently transfected with miR-107-MUT or miR-107. Co-expression, of a miR-insensitive form of Dicer transgene opposes the effects of miR-107. See Figure 1 3 B for pre-miRNA levels upon miR- 1 07 transfection.
(I) and (L) Forced expression of miR-200b inhibits the effects of gain-of-mir- 107 on gene expression and cell migration. MDA-MB-23 1 cells were transiently transfected with the indicated combinations of miRNAs and assayed for ZEB2 expression by qRT-PCR (I) or for cell migration by transwell assay (L). Data are shown as mean and SD. See also Figure 13.
"lire 8: Effects of* experimental manipulations of miR-103/107 and Dicer levels
(A) Downregulation of endogenous Dicer protein by pri-miR- 103/107 in MCF10A (immortalized mammary cell line) and MDA-MB-231 (metastatic breast cancer cell line), as assayed by immunoblotting. β-catenin serves as loading control. Controls are stable cell lines expressing shGFP or the unrelated pri-miR-154.
(B) Downregulation of endogenous Dicer protein by transient transfection of miR-103/107 in human epithelial cell lines (the colon cancer cell line HCT1 16 and the hepatoma cell line HepG2) and in the mouse skin cancer cell line B9, as assayed by immunoblotting. LaminB serves as loading control. Mature miR- 107-MUT bears mutations in the seed sequence and is inactive, therefore serving as negative control. (C) Analysis of Dicer protein expression in MDA-MB-231 parental cells and in cells stably expressing a Dicer transgene lacking the 3'UTR and thus insensitive to miR-103/107 (+Dicer). Where indicated, cells where transfected with miR-107 or, as a control, miR-107-MUT. LaminB serves as loading control.
(D) Treatment of MDA-MB-231 cells with AntagomiR-103/107 inhibits miR- 103 and miR-107 expression. Panels show expression levels of the indicated microRNAs as measured by qRT-PCR. normalized to snRNA-U6b loading control. Data are represented as mean and SD of replicas.
(E) A scheme representing the predicted effects of Dicer downregulation: in normal cells (left), Dicer efficiently processes pre-miRNAs into mature miRNAs; in cells with lowered Dicer expression (right), mature miRNA levels decrease, while pre-miRNAs accumulate.
(F) Downregulation in Dicer levels reflects into downregulation of its enzymatic activity, mature mi R- 15a and let-7b levels were analyzed by qRT- PCR in MDA-MB-231 cells transiently transfected with control siRNA, with different doses of Dicer siRNA (0.8, 1.6, 3.2, and 6.25 nM, respectively; see immunoblots in Figure 3F for the corresponding levels of Dicer downregulation) or with miR-107. Where indicated, cells were treated with antagomiR-MUT or AntagomiR- 103/107 (in the last case, leading to upregulation of Dicer levels). Progressive attenuation of Dicer protein result in a decreased capacity of miRNA maturation, phenocopied by miR-107 overexpression. Oppositely, upregulation of Dicer by AntagomiR- 103/107 results in upregulation of mature miRNA levels.
(G) Expression of a miR- 103/107-insensitive Dicer transgene rescues mature miRNA expression, here exemplified by miR-335. Mature miR-107-MUT (black columns) or miR-107 (white columns) were transiently transfected in MDA-MB-231 cells, either parental or expressing Dicer (+Dicer), and endogenous mature miR-335 levels were assayed by qRT-PCR. Relative values are shown as mean and SD.
( H i miR-107 overexpression causes accumulation of 70nt precursors miRNAs. On the left panel, the expression levels of the indicated pre-miRNAs has been measured by qRT-PCR from MDA-MB-231 cells transfected with miR- 1 07- MUT (black bars) or miR-107 (white bars). Conversely, detection of pri- miRNAs with dedicated primers are not affected by miR-107 overexpression (right panel) nor by miR- 103/107 inhibition (data not shown). Relative values are shown as mean and SD.
Figure 9: Expression of miR- 103 and miR-107 primary transcripts in cellular models
(A) and (B) Expression of miR- 103 and miR-107 primary transcripts (pri- miRNAs, coming from the PANK genes) and their mature forms in cellular models of metastasis progression, as assayed by qRT -PCR. Values are relative to the non metastatic, less aggressive cell lines (67NR and SW480, respectively) and are shown as mean and SD. Pri-miR- 103 levels are the sum of pri-miR- 103.1 /PANK3 and pri-miR-103.2/PANK2 levels.
Figure 10: Probability of metastasis-free survival in breast cancer patients according to pri-miR-103/107 expression levels
(A) to (H) Kaplan-Meier graphs representing the probability of metastasis-free survival in breast cancer patients from the "Rotterdam", "TransBIG", "Uppsala" and "New York" datasets (see Examples 12 to 14) stratified according to coherent low or high pri-miR-103/107 expression levels (A, C, E, G) or to low and high Dicer expression levels (B, D, F, H). Continuous line is low pri-miR-103/107 (left panels) or high Dicer (right panels); dashed line is high pri-miR-103/107 (left panels) or low Dicer (right panels). The log-rank test p values reflect the significance of the association between high pri-miR- 103/107 and metastatic relapse, but fail to show any association for Dicer.
Figure 1 1 : Effects of miR-103/107 or Dicer manipulations on migration, proliferation, dicer levels and cell cycle distribution
(A) pri-miR- 103/107 expression promotes migration of non-metastatic 168FARN breast cancer cells. Stable cell lines expressing shGFP, pri-miR- 103 or pri-miR- 107 from retroviral expression vectors were compared in transwell migration assays. The graph shows the absolute quantitations of ceils migrated through the filter.
(B) SUM149-shGFP or -miR-107 were plated at low density (2500 cells per 10 cm dish), grown for 10 days, fixed and stained with crystal violet. No significant differences were detected in the number of colonies formed by these cell lines, indicating similar proliferation rates.
(C) Top: Dicer immunoblotting of SUM 149 breast cancer cells stably expressing shGFP or pri-miR-107, alone or in combination with a miR- insensitive Dicer transgene. Bottom: Dicer immunoblotting of SUM 149 cells stably expressing shGFP or shDicer. GAPDH serves as a loading control.
(D) Cell-cycle profiling of shGFP- and pri-miR- 1 07-expressing SUM 149 cells. DNA content was analyzed by flow-cytometry of cells stained with PI. The fraction of cells in the GO/G1 phase and the mitotic index (G2/S) are also given.
(E) Cell-cycle profiling of antagomiR-treated cells, performed as in (D).
(F) Wound-healing assay showing that only partial knockdown of Dicer (lanes 6-8) mimics gain-of-miR-107 (lane 9) to promote cell migration. NMuMG cells were transfected with two-fold serial dilutions of Dicer siRNA, ranging from 25 nM (lane 2) to 0.4 nM (lane 8). Confluent cells were scratched with a pipette tip and fixed after 24hrs. Graphs show the absolute number of cells invading the wound. Data are given as mean and SD of experimental replicas.
( G I Dicer immunoblotting of cells transfected as in (F). si Dicer 6 nM corresponds to lane 4. Note comparable depletion between siDicer and miR- 107. β-catenin serves as loading control.
( H Representative pictures of the scratch assays quantitated in (F). siDicer corresponds to lane 4 (6 nM). Note the increased motility promoted by miR- 107 and siDicer. as well as the loss of epithelial morphology.
Figure 12: Effects of AntagomiR-103/107 administration and correlations between the genetic status of Dicer, pri-miR-103/107 levels and metastasis free survival
(A) AntagomiR-103/1 07 administration in the fat-pad of wild-type mice has no effects on mammary gland structure and morphology. Top panels: representative whole mount eosin stainings of delipidated fat-pads explanted from mice treated with AntagomiR- 103/107 of AntagomiR-MUT. No defects are apparent in the overall morphology of the gland, nor in the number of the Terminal End Buds (not shown). Bottom panels: representative histological H&E-stained sections of the same tissues, showing no obvious differences in the differentiation of ductal cells.
(B) in vivo depletion of miR103/107 enhances pre-miRNA processing, causing their downregulation. This parallels the enhancement of mature miRNA levels shown in Figure 5F. Bars show the comparison between expression of the indicated 70nt precursor-miRNAs (pre-miRNAs) in AntagomiR-MUT- and AntagomiR- 103/107-treated 4T1 pooled primary tumors (n=3 for each treatment), as measured by qRT-PCR. Relative values are shown as mean and SD.
(C) Top: AntagomiR-103/107 increases endogenous Dicer protein in 4T1 cells, as judged by Western Blot. Bottom: Increased Dicer levels in 4T1 cells lentivirally transduced with a Dicer expression construct lacking its 3 'UTR. Lam in B serves as a loading control.
(D) Kaplan-Meier graph representing the probability of metastasis-free survival in breast cancer patients from the "Rotterdam" dataset (Examples 12 to 14) stratified according to gene copy number at the Dicer genomic locus. The "Dicer+/-" group of patients displays a copy number compatible with heterozigosity at the Dicer locus, while the "Dicer+/+" has wild-type gene copy number. The log-rank test p values reflect the significance of the association between Dicer heterozygosity and metastatic relapse.
(E) Levels of pri-miR- 103/107 are prognostic of metastatic relapse only in patients with no genomic alterations of the Dicer locus. Patients of the "Dicer+/+" group from the analysis shown in (D) have been stratified according to coherent low (dotted line) or high (dashed line) pri-miR- 103/107 expression levels. The solid line is the same as in (D), and represent the survival curve of the totality of the "Dicer+/+" patients. The log-rank test p values reflect the significance of the association between high pri-miR-103/107 levels and metastatic relapse. Importantly, in the "Dicer+/-" group the pri-miR- 103/107 levels are not prognostic (not shown, P=0.22). Figure 13: Effects of AntagomiR-200 and miR-107 on endogenous miRNA levels and target genes
(A) Effects of AntagomiR-200 on endogenous miRNA levels. qRT-PCR of mature miRNAs in MDA-MB-231 eel Is treated with AntagomiR-200 oligos (see Example 2): the miR-200 family members are downregulated, but not miR-103 and miR- 107 (here serving as specificity controls).
(B) Forced expression of miR-107 in MDA-MB-231 cells causes accumulation of the 70nt precursors (pre-miRNAs) of the miR-200 family, reflecting decreased Dicer levels and activity. Expression levels of precursors for miR- 429, miR-200b and miR-200c have been measured by qRT-PCR and normalized to snRNA-U6b loading control. Bars show pre-miRNAs levels in miR- 1 07 (white columns) and miR-107-MUT (black columns) transfected cells. Values relative to miR- 107-MUT-trated cells are shown as mean and SD. Of note, in the same conditions, the expression levels of primary transcripts (pri-miRNAs) of the miR-200 family are not upregulated (data not shown).
(C) Panels show immunoblotting of MDA-MB-231 cells transfected with miR- 107 as in Figure 1 C. Lam in B serves as loading control. miR-107 overexpression causes downregulation of mature miR- 15/ 16, of the miR- 17-92 cluster and of the let-7 family (see Figure 3F and Table 2), but their direct established targets (BCL2, c-Myc and K-Ras, respectively), are not upregulated.
Table 2: Expression of mature miRNAs in MDA-MB-23 1 transfected with miR- 107-MUT or miR-107, as quantitated by using Taqman Human miRNA microarray (see Supplemental Experimental Procedures for details). Results are given as the difference between the Cycle thresholds of a given miRNA and the snRNA-U6 (Delta Ct). Relative quantitation was
^alr-nl atpri n c (miR-107-MUT_Average DeltaCt- miR-107_Average DeltaCt)
miR-107-
MUT
Average miR- 107
Detector Delta Ct Average Delta Ct Relative quantitation hsa-let-7a-4373169 7.845 9.169 0.40
hsa-let-7b-4395446 7.26 9.277 0.25
hsa-let-7c-4373167 12.462 12.308 1.1 1 hsa-let-7d-4395394 7.988 9.332 0.39
hsa-let-7e-4395517 5.397 5.954 0.68
hsa-let-7f-4373164 12.442 13.248 0.57 hsa-lei-7g-4395393 6.787 7.694 0.53 hsa-miR- 100-4373160 2.915 3.977 0.48 hsa-miR-101-4395364 13.636 13.784 0.90 hsa-miR- 106a-4395280 2.269 3.334 0.48 hsa-miR-106b-4373155 6.995 9.184 0.22 hsa-miR- 10a-4373153 10.637 1 1.394 0.59 hsa-miR- 125a-3p-4395310 13.794 14.137 0.79 hsa-miR- 125a-5p-4395309 7.332 8.33 0.50 hsa-miR- 125b-4373148 4.894 5.797 0.53 hsa-miR- 126-4395339 8.685 10.226 0.34 hsa-miR- 128-4395327 12.18 13.132 0.52 hsa-miR- 130a-4373145 8.751 10.932 0.22 hsa-miR- 130b-4373144 9.969 1 1.3 0.40 hsa-miR- 132-4373143 8.108 11.075 0.13 hsa-miR- 135b-4395372 10.421 12.232 0.28 hsa-miR- 138-4395395 3.587 6.247 0.16 hsa-miR- 139-5p-4395400 10.844 12.835 0.25 hsa-miR- 140-3p-4395345 11.41 12.168 0.59 hsa-miR- 140-5p-4373374 7.214 8.546 0.40 hsa-miR-142-3p-4373136 10.954 13.495 0.17 hsa-miR- 146a-4373132 6.246 7.795 0.34 hsa-miR-146b-5p-4373178 1 1.019 12.815 0.29 hsa-miR- 148a-4373130 10.257 i.Ztu 0.25 hsa-miR- 148b-4373129 1 4. 1 6 15.125 0.51 hsa-miR- 149-4395366 9.141 11.735 0.17 hsa-miR-152-4395170 13.051 13.237 0.88 hsa-miR- 155-4395459 17.183 12.72 22.05 hsa-miR- 15a-4373123 12.171 12.95 0.58 hsa-miR-15b-4373122 7.027 8.821 0.29 hsa-miR- 16-4373121 4.198 5.669 0.36 hsa-miR- 17-4395419 2.251 3.262 0.50 hsa-miR-181a-4373117 10.257 10.658 0.76 hsa-miR-181c-4373115 15.794 18.196 0.19 hsa-miR- 182-4395445 12.597 13.437 0.56 hsa-miR- i I .D 1 0 16.889 U.U3 hsa-miR- 185-4395382 12.023 15.847 0.07 hsa-miR- 186-4395396 8.254 9.352 0.47 hsa-miR- 18a-4395533 7.967 9.86 0.27 hsa-miR- 191-4395410 4.475 6.139 0.32 hsa-miR- 192-4373108 11.863 12.512 0.64 hsa-miR-193a-5p-4395392 1 1.499 12.311 0.57 hsa-miR- 193b-4395478 9.406 9.999 0.66 hsa-miR- 194-4373106 14.028 13.377 1.57 hsa-miR- 195-4373105 9.495 13.567 0.06 hsa-miR-197-4373102 1 1.466 12.582 0.46 hsa-miR- 19a-4373099 5.664 6.516 0.55 hsa-miR- 19b-4373098 2.855 3.419 0.68 hsa-miR-200b-4395362 13.498 14.268 0.59 hsa-miR-200c-4395411 13.628 15.172 0.34 hsa-miR-204-4373094 13.295 17.844 u.u4 hsa-miR-20a-4373286 3.856 4.472 0.65 hsa-miR-20b-4373263 10.566 12.031 0.36 hsa-miR-21-4373090 4.502 5.49 0.50 hsa-miR-218-4373081 8.826 10.095 0.41 hsa-miR-221-4373077 4.341 7.042 0.15 hsa-miR-222-4395387 1.257 2.998 0.30 hsa-miR-223-4395406 14.258 16.866 0.16 hsa-miR-224-4395210 9.926 11.796 0.27 hsa-miR-24-4373072 2.287 4.41 0.23 hsa-miR-25-4373071 8.064 10.12 0.24 hsa-miR-26a-4395166 6.88 7.549 0.63 hsa-miR-26b-4395167 8.052 9.318 0.42 hsa-miR-27a-4373287 5.291 6.665 0.39 hsa-miR-27b-4373068 7.536 9.51 0.25 hsa-miR-28-3p-4395557 8.955 9.812 0.55 hsa-miR-28-5p-4373067 9.999 11.427 0.37 hsa-miR-29a-4395223 1.684 3.536 0.28 hsa-miR-29b-4373288 9.546 13.198 0.08 hsa-miR-29c-4395171 9.701 11.663 0.26 hsa-miR-301a-4373064 9.076 10.262 0.44 hsa-miR-301b-4395503 11.592 11.966 0.77 hsa-miR-30b-4373290 D.zu8 6.596 r\ o
KJ. O
: i ϋ i l i l t *. . *\ r » / 4.22 5.656 0.37 hsa-miR-320-4395388 5.723 6.73 0.50 hsa-miR-323-3p-4395338 14.301 14.226 1.05 hsa-miR-324-3p-4395272 9.924 12.631 0.15 hsa-miR-324-5p-4373052 9.782 13.61 1 0.07 hsa-miR-328-4373049 13.572 14.855 0.41 hsa-miR-330-3p-4373047 14.622 16.681 0.24 hsa-miR-331-3p-4373046 6.285 8.646 0.19 hsa-miR-331-5p-4395344 1 1.807 15.954 0.06 hsa-miR-335-4373045 13.197 14.279 0.47 hsa-miR-339-3p-4395295 12.034 12.749 0.61 hsa-miR-339-5p-4395368 11.92 16.18 0.05 hsa-miR-340-4395369 12.01 1 13.695 0.31 hsa-miR-342-3p-4395371 15.498 15.811 0.80 hsa-miR-345-4395297 7.788 9.861 0.24 hsa-miR-34a-4395168 9.642 11.067 0.37 hsa-miR-361-5p-4373035 1 1.18 12.243 0.48 hsa-miR-365-4373194 10.223 11.325 0.47 hsa-miR-374a-4373028 8.898 10.411 0.35 hsa-miR-374b-4381045 7.126 8.362 0.42 hsa-miR-422a-4395408 11.983 12.61 0.65 hsa-miR-423-5p-4395451 14.334 15.12 0.58 hsa-miR-425-4380926 10.081 11.174 0.47 hsa-miR-429-4373203 15.584 19.265 0.08 hsa-miR-449a-4373207 13.942 12.829 2.16 hsa-miR-450a-4395414 14.888 14.272 1.53 hsa-miR-454-4395434 7.078 8.554 U.JO
hsa-miR-455-3p-4395355 12.342 12.626 0.82
hsa-miR-455-5p-4378098 12.094 14.39 0.20
hsa-miR-483-5p-4395449 15.488 14.642 1.80
hsa-miR-484-4381032 6.83 8.225 0.38
hsa-miR-486-5p-4378096 10.443 13.559 0.12
hsa-miR-489-4395469 1 1.234 1 1.235 1.00
hsa-miR-491-5p-4381053 1 1.135 12.168 0.49
hsa-miR-494-4395476 9.561 9.303 1.20
hsa-miR-503-4373228 12.715 14.714 0.25
hsa-miR-519a-4395526 1 1.853 12.282 0.74
hsa-miR-522-4395524 13.128 14.016 0.54
hsa-miR-532-5p-4380928 10.889 14.015 0.11
hsa-miR-574-3p-4395460 7.329 7.899 0.67
hsa-miR-576-3p-4395462 14.769 18.074 0.10
hsa-miR-579-4395509 14.057 14.4 0.79
hsa-miR-590-5p-4395176 9.541 11.896 0.20
hsa-miR-597-4380960 13.582 13.694 0.93
hsa-miR-598-4395179 9.351 1 1.506 0.22
hsa-miR-652-4395463 10.235 13.559 0.10
hsa-miR-671-3p-4395433 14.356 14.662 0.81
hsa-miR-885-5p-4395407 16.164 13.98 4.54
hsa-miR-886-5p-4395304 9.046 12.095
Figure imgf000044_0001
hsa-miR-92a-4395169 7.277 0.52
hsa-miR-93-4373302 5.585 7.454 0.27
hsa-miR-9-4373285 1 1.08 15.819 0.04
hsa-miR-98-4373009 12.655 12.943 0.82
hsa-miR-99a-4373008 4.127 5.121 0.50
The Examples illustrate the invention.
Example 1: Biological assays in mammalian cells
For Transfection procedures and luciferase assays see Example 4 and Martello, Nature (2007), 449: 183-188. For wound-healing experiments, cells were plated in 6-well plates, transfected as indicated and cultured to confiuency. Ceils were serum-starved and scraped with a P200 tip (time 0), and the number of migrating cells were counted from pictures (five fields) taken at the indicated time points.
Transwell migration/invasion assays were performed in 24 well PET inserts (Costar 8.0 mm pore size). Cells were plated and transfected with miRNA as indicated. The day after, 100.000 cells were plated in serum-free media in transwell inserts (at least 3 replicas for each sample). Medium containing 1 % FBS served as chemoattractant in the lower chamber. Cells in the upper part of the transwell were removed with a cotton swab; migrated cells were fixed in 4% PFA and stained with 0.5% Crystal Violet. Filters were photographed and the total number of cells counted. Each experiment was repeated at least 3 times independently.
For Dicer knockdown the sequences of the siRNA were: 5'-UCC AGA GCU GCU UCA AGC ATT-3' and 5'-UGC UUG AAG CAG CUC UGG ATT-3 '. As for mature miRNAs: miR- 107: 5' -AGC AGC AUU GUA CAG GGC UAU CA-3' and S'-AUA GCC CUG UAC AAU GCU GCC UU-3'; miR-107-MUT: 5'-AUA GCC CUG UAC AuU cCg GaC UU-3' and 5'-AuC cGg AaU GUA CAG GGC UAU CA-3'; miR-200b: 5'-AUC AUU ACC AGG CAG UAU UAG A-3' and 5'-UAA UAC UGC CUG GUA AUG AUG A-3 '.
Example 2: Experimental models of metastasis and Antagomi -treatment
Mice were housed in Specific Pathogen Free (SPF) animal facilities and treated in conformity with institutional guidelines. For xenograft studies of breast cancer metastasis, cells (500.000 cells/mouse for 4T1 cells, 1.000.000 cells/mouse for SUM 149 cells) were unilaterally injected into the mammar fat pad. or in the tail vein, of SCID female mice, age-matched between 5 and 7 weeks. After the indicated periods, mice were sacrificed and their lungs explanted for histological analyses.
AntagomiRs were designed as described in Krutzfeldt, Nature (2005), 438: 685-689, and purchased from Fidelity System. Sequences were as follows:
"AntagomiR-103/107": 5'-U*U*CAUAGCCCUGUACAAUGCUG*C*U*U*-Chol-3'; "AntagomiR-MUT": 5'-U*U*CAUAaCCCUGUAaAAUcaUc*a*U*U*-Chol-3', "AntagomiR-200a": 5'-G*A*ACATCGTTACCAGCCAGTGT*T*A*G*-Chol-3', "AntagomiR-200b": 5*-C*C*C ATCCTTACCCGGCAG TCTT*A*G *A*-Chol-3', all the bases are 2'-0-Methylated, * represents a phosphorothioate linkage and 'Choi' represents linked cholesterol tail. For AntagomiR-200, a 1 : 1 mixture of the two oiigos was used.
After 4 days of AntagomiR treatment, 4T1 cells were orthotopical injected in SCID mice (500.000 cells/mouse). After three days. 100 μΐ of AntagomiR-103/107 or control AntagomiR-MUT solutions (diluted in PBS at 2 mg/ml), were injected intratumorally three times per week for two weeks. Example 3: Cell cultures, plasmids and viral infections
U20S, HCT1 16chr3 cells were cultured in DM EM 10%FCS, MDA-MB231 and SUM149 cells in DMEM/F 12 10% PCS. HepG2 in MEM 10%FCS supplemented with NEA. 67NR, 168FARN, 4T07 and 4T1 mouse mammary tumor cells were cultured as previously described (Aslakson, Cancer Res (1992), 52: 1399- 1405). DNA transfections were performed with Transit-LTl reagent (MirusBio); for siRNA transfections, Lipofectamine-RNAiMax (Invitrogen) were used in all cell lines. For Dicer knockdown the sequences of the siRNA were: 5'-UCC AGA GCU GCU UCA AGC ATT- 3' and 5'-UGC UUG AAG CAG CUC UGG ATT-3'. Mature miR- 107: 5' -AGC AGC AUU GUA CAG GGC UAU CA-3' and 5'- AUA GCC CUG UAC AAU GCU GCC UU-3 ' ; miR- 107-MUT: 5'-AUA GCC CUG UAC AuU cCg GaC UU-3' and 5'-AuC cGg AaU GUA CAG GGC UAU CA-3' ; mature miR- 200b: 5'-AUC AUU ACC AGG CAG UAU UAG A-3' and 5'-UAA UAC UGC CUG GUA AUG AUG A-3' . pri-miRs were cloned in the miR-Vec expression vector (Voohoeve, loc cit). miRNA expression was confirmed by qPCR. Control shGFP was as previously described (Adorno, Cell (2009), 137: 87-98). human Dicer cDNA (gift from P. Provost) was subcloned in pRRLsin . ppts . hCMV . gfppre (gift from L. Naldini). For Dicer knockdown in SUM- 149 cells, pLKO. l and the oligonucleotides -CCG GAG GAA GAG GCT GAC TAT GAA GCT CGA GCT TCA TAG TCA GCC TCT TCC TTT TTT G-3' and 5'-AAT TCA AAA AAG GAA GAG GCT GAC TAT GAA GCT CGA GCT TCA TAG TCA GCC TCT TCC T-3' were used. For Dicer depletion in mouse 4T1 cells, pSuper shDicer plasmid described in Kumar. 2007, loc cit, were used. Protocols for retroviral and lentiviral vectors were as previously described (Adorno, loc cit). To obtain clonal cell lines, 4T1 cells were infected with the Dicer lentivirus; two clones expressing 4-5 fold the endogenous levels of Dicer were derived by serial dilution of this population.
Example 4: Lucif erase assays
For luciferase assays, the full-lenght 4,2 Kb human Dicer 3 'UTR was PGR amplified from MDA-MB-231 cells, cloned into a CMV-luciferase expression plasmid (Martello, loc cit) and sequence-verified. All predicted miR-103/107 seed-pairing sites were mutated by changing them to unique restriction sites (see list of primers). Cells were transfected with Dicer 3' UTR reporters using Transit-LTl (MirusBio) and harvested after 48 hours. Luciferase reporters (25ng/cm2) were cotransfected with CMV -beta-gal (40ng/cm2) to normalize for transfection efficiency by CPRG (Roche) colorimetic assay. Each sample was transfected in triplicate. Each experiment was repeated at least twice.
Primers used for mutagenesis of Dicer 3'UTR
Figure imgf000047_0001
Example 5: Immunofluorescent localizations
Two days after siRNA transfection, cells were trypsinized and replated on Collagen I coated Permanox chamber slides (Nunc), treated as indicated and fixed lOmin at RT with 4% PFA in PBS. Slides were permeabilized 10 min at RT with PBS 0,3% TritonXlOO, blocked one hour at RT with PBST (PBS, 0,1% Triton) 10% goat serum (GS), and incubated overnight at 4°C with primary antibodies in PBST 2% GS: a-Ecad 1 :200 BD-Biosciences, (cat. 610181) in GS 2%; a-zol 1 : 100 (Invitrogen, cat. 339100) in GS 2%. Secondary antibodies goat anti-rabbit Alexa555 or goat anti-mouse Alexa-488 were incubated 1 ,5 hours at RT diluted 1:200 in PBST 2% GS. Hoechst staining (Sigma) was used to mark nuclei. Images were obtained with a Leica Axiopian microscope equipped with a DC500 CCD camera. Each experiment was performed at least twice, considering 10 independent fields for each sample with comparable results. Figures show representative fields. Example 6: Cell -cycle analysis
For cell-cycle analysis, cells were plated in 6cm dishes, transfected or treated as indicated in the Figures, trypsinized, washed in PBS, and fixed with ice-cold 70% ethanol while vortexing. Cells were rehydrated in PBS and stained 30min at RT with propidium iodide (50mg/ml PI, 0,5mg/ml RNAse in PBS) prior to flow-cytometric analysis. Every experiment was repeated at least 2 times independently, with two replicas for each sample.
Example 7: Measurement of tumor size
Primary tumor growth in the injected site was monitored by repeated caliper measurements, and tumor volume was calculated using the formula: tumor volume (mm5) = D x d2/2, where "D" and "d" are the longest and the shortest diameters, respectively.
Example 8: Histology and immunohistochemistry
Tissues for histological examination were fixed in 4% buffered formalin, dehydrated and embedded in paraffin by standard methods. For the experiments depicted in Figure 4, serial sections of the lungs were cut at a distance of 70 mm from each other, were first stained with Hematoxylin and Eosin (H&E) and then processed for human cytokeratin expression (see below). For the experiments described in Figure 5, serial sections of the lungs were cut at a distance of 70 mm from each other and stained with H&E.
Immunohistochemical staining was performed on formalin-fixed, paraffin-embedded tissue using an indirect immunoperoxidase technique (Bond Polymer Refine Detection; Vision BioSystems, UK). Sections mounted on silanized slides will be dewaxed in xylene, dehydrated in ethanol, boiled in 0.01 M citrate buffer (pH 6.0) for 20 min. in a microwave oven and then incubated with 3% hydrogen peroxide for 5 min. After washing with PBS, they were be incubated in 10% normal BSA for 5 min, followed by incubation for 45 min. with monoclonal mouse anti-human Cytokeratin, AE1/AE3 (1:200, BioGenex), or by overnight incubation with rabbit anti-Dicer polyclonal antibody (1:600, affinity purified, gift from Filipowicz lab). After washing, sections were incubated with labelled polymer (Bond Polymer Refine Detection) and diaminobenzidine. The sections were then counterstained with hematoxylin, dehydrated, cleared, and mounted.
Example 9: Antibodies and Western Blotting α-LaminB (C20) and α-Dicer (SC-30226) were obtained from SantaCruz; a-beta-catenin was obtained from Sigma. To monitor endogenous gene responses, cells were harvested by sonication in Ub-lysis buffer as in described (Dupont, Cell (2009), 136: 123-135). Proteins were loaded according to Bradford quantification, ran in commercial 4-12% or 10% Nupage MOPS acrylamide gels (Invitrogen) and transferred onto PVDF membranes (ImmobilonP) by wet electrophoretic transfer. In general, blots were blocked one hour at RT with 0,5% non-fat dry milk (BioRad) in PBSw (0,05% Tween) and incubated over night, at 4 °C with primary antibodies. Secondary antibodies were incubated 50 min at RT. Washes after antibody incubations were done on an orbital shaker, three times 10 min, with IX PBS 0,05% Tween20. Blots were developed with Pico or Dura SuperSignal West chemiluminescent reagents (Pierce).
Example 10: qRT-PC
Poly(A)+-RNA was retrotranscribed with M-MLV Reverse Transcriptase (Invitrogen) and oligo-d(T) primers following total RNA purification with Trizol (Invitrogen). Real-time PGR messengerRNAs were performed on a RotorGene 3000 (Corbett) using the FastStart SYBR Green Master Mix (Roche). The primers are listed m the table below.
Detection of the mature form of miRNAs was performed using the Taqman microRNA assay kit (Applied Biosystem) according to the manufacturer's instructions. U6 small nuclear RNA was used as an internal control.
Global mi RNA profiling was performed using TaqMan® Human MicroRNA Array Set v2.0, according to the manufacturer's instructions.
Detection of 70 nt precursors miRNA (pre-miRNA) was performed using the methods and primers described in Schmittegen, Nucleic Acid Res (2004), 32: e43.
QPCR PRIMERS SEQUENCE
human E-Cadherin F 5'-CCCACCACGTACAAGGGTC-3'
human E-Cadherin R 5!-CTGGGGTATTGGGGGCATC-3'
human Fibronectin F 5'-GAGGGGACCTGCAGCCACAA-3'
human Fibronectin R 5 ' -TTCGC A ACCTGCGGG A AA A A- 3 ' human GAPDH F 3 -AUt ALA i UL. 1 LAUACAC-J human GAPDH R 5 '-GCCCAATACGACCAAATCC-3 ' human ICAM1 F 5 -GGCCCCCTACC AGCTCCAGA-3 ' human IC AMI R 5 -GACTGGGAACAGCCCGTCCA-3 ' human SIP1 F 5 '- AAC ACCCCTGGCACAACAAC-3 ' human SIP 1 R 5 -GGTCTGGATCGTGGCTTCTG-3 ' human Vimentin F 5 '- ACTACGTCC ACCCGCACCTA-3 ' human Vimentin R 5 '-C AGCGAGAAGTCC ACCGAGT-3 ' human ZEB 1 F 5 '-TTC A A ACCC AT AG TGGTTGCT- ' human ZEB 1 R 5 '-TGGGGAGATACCAAACC AACTG-3 ' human Pank 1 F 5 '-TGATGTCCCTCCCCCTACCT-3 ' human Pankl R 5 '-TCACGGGC ATTTTCAAGAGC-3 ' human Pank 2 F 5 -TGGTTTGCATTAAGCCTGTGTG-3 ' human Pank2 R 5 -GCCCTTCCAAAAACTGCTTG-3 '
5 -ATGCCTTCCACTTCCCAACA-3 ' human Pank3 R 5 -GGCTCAACCCCACTCCAGAT-3 ' mouse E-Cadherin F 5 -CAGCCTTCTTTTCGGAAGACT-3 ' mouse E-Cadherin R 5 '-GGTAGACAGCTCCCTATGACTG-3 ' mouse Fibronectin F 5 -ATGTGG ACCCCTCCTG AT AGT-3 ' mouse Fibronectin R 5 -GCCCAGTGATTTC AGC AAAGG-3 ' mouse GAPDH F 5 '- ATCCTGCACC ACCAACTGCT-3 ' mouse GAPDH R 5 '-GGGCCATCCAC AGTCTTCTG-3 ' mouse ICAM1 F 5 -TTCCAGCTACCATCCCAAAG- ' mouse ICAM1 R 5 AGCTTC AGAGGCAGGAAACA-3 ' mouse SIP1 F 5 '-CACACATACATGCCCC AAGA-3 ' mouse SIP1 R 5 -TCCTAATGCCAGTCCTCACC-3' mouse Vimentin F 5 '-CGTCC AC ACGC ACCT AC AG-3 ' mouse Vimentin R 5 -GGGGGATGAGGAATAGAGGCT-3 * mouse ZE B 1 F 5 '-TCTCCCTTTCCCC AGTTTTT-3 ' mouse ZEB 1 R 5 -TTTGGCTTGCTAAGGGAATG-3 ' mouse Pankl F 5 '-C ACCCCTCACC ACTGTCATGT-3 ' mouse Pankl R 5 '-GGTTTGCTGCCCTTCATACG-3 ' mouse Pank2 F 5 ACC AGGTCGT ATTTGTCGGC-3 ' mouse Pank2 R 5 -AACAGTGCTTTCAGCTGCCC-3 '
mouse Pank3 F 5 "-CTGACACACGGTTCCAGCAC-3 '
mouse Pank3 R 5 '- ACCC AGGTCTGCTCC AGTCA-3 '
Example 11: Milan-INT dataset
The case series consisted of 69 women with primary resectable invasive estrogen receptor- positive breast cancer, histologically node-negative, and with no radiologic or clinical evidence of distant metastasis, a synchronous bilateral tumor, or a concomitant second primary tumor. These cases, with a minimum potential of 10 years of follow-up (i.e. the time elapsed from the date of surgery to the date of the last updating of the patient records), underwent surgery at the Istituto Nazionale Tumori (INT) of Milan during the period from January 1990 to December 1998. Patients were treated with mastectomy or quadrantectomy plus radiotherapy, and ail of them underwent axillary node dissection (median number of examined nodes, 18). None of the women received systemic post-operative therapy until new disease manifestation was documented. Patient and tumor characteristics are summarized in Table 3. Women underwent follow-up examinations at the INT outpatient clinic at planned 4- to 6-month intervals during the first 5 years and at 12 months intervals thereafter. In addition to a routine clinical examination, disease assessment included mammography, chest roentgenogram, skeletal survey, and liver ultrasonography. Primary treatment failure, considered for computing disease-free survival time, was defined as the first documented evidence of distant metastasis (occurring in 34 cases: 11 in bone, 8 in visceral sites, 4 in soft tissues, 7 in multiple sites, 4 in sites non otherwise specified in patient records). This study was approved by INT Institutional Review Board, and all patients provided written informed consent to donate to INT the tissue that was left over after diagnostic procedures were completed.
Samples used for molecular studies were selected, carefully avoiding necrotic areas, fat and normal tissue and immediately snap-frozen in liquid nitrogen and stored at -80°C until used. All tumor samples were evaluated by a pathologist and an adjacent section was stained and used for defining the percentage of tumor cells. Only specimens with more than 70% of tumor cells were included in the study. Total RNA was extracted from 100 mg of tissue using Trizol (Life Technologies, Frederick, MD, USA) following the manufacturer's instructions. Integrity of the RNA was checked on the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). miRNA profiling was performed in the Functional Genomics core facility at INT using the miRNA expression profiling kit (Illumina, S. Diego, CA). This assay is an adaptation of the proven DASL (cDNA-mediated Annealing, Selection, Extension, and Ligation) assay. 800 ng of total RNA were retrotranscribed, annealed with a miRNA-specific oligonucleotide pool consistsing of a universal PCR priming site at the 5' end, an address sequence complementary to a capture sequence on the BeadArray and a microRNA-specific sequence at the 3' end. After PCR amplification and fluorescent labeling, the probes were hybridized on miRNA expression profiiing_v2 BeadChips, containing 1,146 sequences for detecting 95% of miRNAs described in the miRBase database (vl4.0). Raw data were normalized using the Robust Spline Normalization algorithm implemented in the lumi R package. Probes with a detection p-value < 0.01 in less than 10% of samples were filtered out.
Tab: e 3: Clinical and gene expression data for the Milan-INT dataset.
Tumor Histotype
distant Relapse-
Tumor (ILC=invasive
relapse free
ID Age Size lobular carcinoma, mir-103 mir-107 as first survival
(mm) IDC=invasive
event (months)
ductal carcinoma)
147 0 185 43 2.5 IDC 13.43 11.01
152 0 120 49 1 IDC 13.00 10.63
191 0 172 45 z IDC 12.82 9.86
198 0 170 65 2.5 IDC+ILC 13.72 10.81
205 0 180 44 3 Other 13.07 10.53
213 0 122 68 4.5 IDC 12.92 10.15
224 0 117 53 1.7 IDC 13.71 1 1.10
225 0 124 41 1 .4 IDC 12.82 10.09
227 0 148 44 1.5 IDC 12.70 10.00
232 0 159 50 2,3 IDC 13.41 1 1.48
254 0 160 51 2 IDC 13.05 1 1 .41
264 0 127 37 2.7 ILC 13.52 1 1.20
268 Π 1 1 1 1 1
l i i 68 ILC n i n 10.58
271 0 163 43 1 .8 IDC 12.92 10.61
276 0 165 59 2 IDC 13.22 10.19
295 0 152 51 3 ILC 13.00 10.27
303 0 158 57 1 .8 IDC 13.66 1 1 1 /1
H . i4
310 0 152 47 2 IDC 13.43 10.68
312 0 1 18 63 1 .2 IDC+ILC 13.41 10.69
330 0 135 82 4 Other 13.21 10.69
334 0 145 52 1.8 IDC 13.72 1 1.24
340 0 1 12 rr
J J Δ IDC 13.88 i i.U l
344 0 131 48 1 .7 IDC 13.01 10.59
346 0 1 1 1 40 2 IDC 13.01 10.67
350 0 136 45 2 IDC 13.05 10.06
352 0 112 52 1.4 IDC- 13.01 10.57
383 0 140 49 1 .6 IDC 13.19 9.79 400 0 1 16 74 2 Other Ι Δ.9Δ 10.53
418 0 137 49 1 IDC 13.05 1 1.32
419 0 159 45 3 IDC 12.79 9.54
445 0 98 75 1.5 IDC 12.72 9.76
450 0 122 48 Δ IDC 13.60 10.70
463 0 114 42 1.3 IDC+ILC 12.86 10.64
471 0 1 14 63 1.7 IDC 12.99 1 1.71
477 0 102 69 2 Other 12.93 10.76
614 1 11 65 2.5 IDC 13.78 10.80
618 1 11 61 3.5 IDC 12.90 9.92
620 1 24 41 ΝΑ ILC 12.96 10.80
624 1 33 37 2.1 ILC 12.82 9.54
629 1 30 30 9 IDC 13.19 9.97
630 1 22 48 3.2 IDC 13.32 10.78
635 1 33 39 2.4 IDC 13.56 12.28
637 1 21 61 2.7 IDC 13.42 1 1.32
638 1 16 53 2 IDC 12.94 11.10
639 1 31 67 2.4 IDC 13.69 12.19
644 1 20 58 1.8 IDC 13.59 11.08
647 1 11 67 2.3 ILC 13.33 1 1.05
648 1 9 69 3.9 IDC 13.68 11.76
649 1 26 70 1.8 IDC 13.63 11.20
652 1 Ι Δ 37 3.6 IDC 13.86 11.92
654 1 19 55 3.8 IDC 13.29 10.47
656 1 26 40 1.3 IDC 13.49 10.44
659 1 32 78 2.3 IDC 13.61 10.81
660 1 13 50 1.5 IDC 12.61 10.49
661 1 10 66 2 IDC 12.97 10.32
662 1 19 60 1.7 IDC 13.72 11.22
664 1 24 59 2.5 IDC 13.44 10.61
667 1 30 70 3 IDC 13.79 12.02
672 1 10 62 2.1 IDC 13.42 11.30
673 1 22 39 2.5 IDC 13.50 11.12
674 1 1 1 53 0.7 IDC 12.74 10.56
676 1 13 45 2.5 IDC+ILC 13.03 10.60
678 1 9 69 1.8 ILC 13.71 10.78
679 1 16 64 ΝΑ ILC 13.01 10.97
680 1 16 60 1.3 ILC 12.87 10.59
682 1 20 56 1.8 IDC 12.72 10.98
687 1 16 61 2.6 ILC 13.06 10.63
688 1 30 69 1.5 IDC 13.81 1 1.54
690 1 35 78 3.5 IDC 13.86 1 1.99
Example 12: Breast cancer datasets
Since miR-103 and miR-107 are intronic microRNA, their primary transcripts could be mapped on Affymetrix arrays (Baskerville, RNA (2005), 11 : 241-247; Lee. Pancreatology (2009), 9: 293-301 ; Wang, J Neurosci (2008), 28: 1213-1223). To evaluate miR- 103/107 association to metastasis or outcome in breast cancer patients, different gene expression datasets were collected. For each data set, it was tested if the expression levels of pri-miR- 103/107 transcripts could classify patients into clinically distinct groups. Each dataset has been processed independently from the other to preserve the original differences among the various studies (e.g., patient cohort, microarray platform, sample processing protocol, etc.). Breast cancer gene expression datasets with clinical information were downloaded from Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/GEO).
Breast cancer datasets analyzed in this study
Figure imgf000054_0001
The table reports the complete list of the datasets used in this study and their sources. In all studies, raw data (e.g., CEL files) were available for all samples and detailed clinical information could be acquired for any analyzed sample. Since CEL files were available for Affymetrix microarray s, expression values were generated from fluorescence signals using the RMA algorithm. Specifically, intensity levels have been background adjusted, normalized using quantile normalization, and log2 expression values calculated using median polish summarization (Irizarry, Biostatistics (2003), 4: 249-264).
The DNA templates for Pri-miR-107 is traceable to probeset 226649_at in the HGU133B and HG-U133plus2 platforms, while Pri-miR- 103.1 and Pri-miR-103.2 are interrogated by probesets 218809_at and 218433_at, respectively, in the HG-U133A and HG-U133plus2 GeneChips. Dicer gene is interrogated by the same 4 reliable probesets in HG-U133A and HG-Ui33plus2 arrays (206061_s_at, 212888_at, 213229_at, and 216260_at). All probesets have been re-annotated using custom GeneAnnot-based Chip Definition Files version 1.5.0 (Ferrari, BMC Bioinformatics (2007), 8: 446), thus enhancing the reconstruction of gene-level expression signals when the same gene is interrogated by more than one probeset.
For what concerns 313 samples of Rotterdam dataset, copy number data obtained with Affymetrix SNP arrays were available as well. Copy number data were retreived from GEO database (GSE 10099) and analyzed using LSCN procedure as described in (Bicciato, Nucleic Acid Res (2009), 37: 5057-5070) to estimate copy number gain or loss at selected gene loci in individual samples.
Example 13: Classification of breast cancer patients
Classification pri-miR-103/107 High or pri-miR-103/107 Low.
To identify two groups of samples with either high or low expression scores of miR-103/107, a classification rule was defined based on summarizing the standardized expression levels of Pri-miRs into a score SF defined as follows:
S = ^ - where P, = S W^03A + 5 + s ^<^
σ is the score of Pri-miR-103/107 genes in each sample i, jup and σρ are the estimated mean and standard deviation of P;, over the entire dataset,
S =——— is the score for each Pri-miR-103/107 gene g in each sample z, xf is the expression value of the selected gene g (e.g., Pri-miR- 103.1, Pri-miR-103.2 and Pri- miR-107) in sample i, and fis and σ8 are the estimated mean and standard deviation of gene g calculated over the entire dataset (Adorno, loc cit).
Tumors were then classified as "miR-103/107 High" if the score was equal to or above a threshold and as "miR-103/107 Low" if the score was below the threshold, i.e. the score SF for each sample i was compared with the selected threshold to classify any sample as "miR- 103/107 High" or "miR-103/107 Low". This classification was applied to log2 expression values obtained using RMA on datasets described in the table above.
Since the selection of an arbitrary threshold may strongly influence the outcome of the statistical analysis, an entirely data-driven procedure was adopted to select the threshold providing the best separation between survival curves. In details, the threshold of Sp was defined as a specific quantile of the Sp distribution calculated in each dataset. To classify samples as "miR-103/107 High", all quantiles of Sp were evaluated in the quantile range corresponding to probabilities from 0.5 to 0.8, i.e. the optimal threshold was selected for high expression among higher quantiles, but excluding extreme values. For all quantiles, p-values from the log-rank test were quantified and the quantile giving the best separation, i.e. the lowest p-value between survival curves of "miR-103/107 High" and "miR-103/107 Low" groups, was selected as Sp score threshold. Samples were finally classified as "miR- 103/107 High" if the single sample score was equal to or above the selected threshold and as "miR- 103/107 Low" if the sample score was below the threshold. This approach leaded to defining a Sp score threshold of 0.74, 0.8, 0.61 , 0.76 and 0.53 quantiles for London, Uppsala, New York, TransBlG and Rotterdam datasets with a number of samples classified as "miR- 103/107 High" equal to 43, 50, 32, 48 and 147, respectively. The same approach was used to classify samples from Milan-INT dataset leading to a Sp score threshold of 0.67 quantiles with 23 samples classified as "miR- 103/107 High".
Classification Dicer Low or Dicer High
The same classification rale was adopted when using the standardized expression levels of Dicer. As described for Pri -miR- 103/107, the standardized score accounting for Dicer expression was computed over Dicer expression values. Then tumors were classified as" Dicer Low" ("Dicer High") if the score was equal to or below (above) a selected threshold. Considering a single gene, the Dicer score in each sample i was defined as:
^DICER _ DICER
g DICER _ _j_— _ ± where x. !CLR is the expression value of Dicer in sample i
σ and j D1CER and &mtkR are the estimated mean and standard deviation of Dicer calculated over the entire dataset (Adorno, loc cit). Again, to avoid an arbitrary selection of the threshold that may influence the results of the statistical analysis, the data-driven procedure described above was adopted to select the threshold providing the best separation between survival curves. Briefly, multiple quantiles of goicER vajues were evaluated considering quantiles corresponding to probabilities from 0.5 to 0.2, thus selecting the threshold for low expression among lower quantiles, excluding very extreme values. The quantile giving the best separation, i.e. the lowest log-rank p-value, between survival curves of "Dicer Low" and "Dicer High" groups was selected as threshold of sDICER. Then samples were classified as "Dicer Low" if the score was equal to or below the selected threshold and as "Dicer High" if the score was above the selected threshold. Thresholds selected (and number of samples classified as "Dicer Low") corresponded to 0.25 (41), 0.34 (85), 0.2 (17), 0.28 (56) and 0.22 (69), for London, Uppsala, New York, TransBIG and Rotterdam datasets, respectively
Example 14: Statistical analysis
To evaluate the prognostic value of the pri-miR-103/107 classification, using the Kaplan- Meier method (Adorno, loc cit), the probabilities that patients would remain free of metastases (London, New York and Rotterdam datasets) and free of cancer disease (Uppsala and TransBIG dataset) were estimated according to whether they belong to "High" or "Low" group. Specifically, survival analysis was performed using the survival package of R and the Kaplan-Meier plots were drawn using the survfit function of the same package. Comparisons between Kaplan-Meyer curves were carried out using the log-rank test. In details, p-values were calculated according to the log-rank test of the survdiff function, i.e. testing the null hypothesis of no difference against the two-sided alternative. All the p-values were significant at a level =0.05 when comparing "miR-103/107 High" and "miR- 103/107 Low" groups as defined using the above classification scheme. Specifically the computed p-values for London, Uppsala, New York, TransBIG and Rotterdam datasets were respectively 0.0009, 0.0082, 0.0126, 0.005 and 0.0196.
The same statistical analysis was repeated to verify if Dicer levels had a similar prognostic association with metastases free and disease free survival in London, Uppsala, New York, TransBIG and Rotterdam datasets. Briefly, log-rank was applied to test the null hypothesis of no difference against the two-sided alternative. No p-value was found significant at a level a=0.05 when comparing "Dicer High" and "Dicer Low" groups as defined using the above described classification scheme: the computed p-value for London, Uppsala, New York, TransBIG and Rotterdam datasets were respectively 0.3193, 0.3655, 0.4334, 0.076 and 0.1041.
To compare expression levels of pri-miR-103/107 in breast tumors that subsequently metastasized, samples from London dataset were first binary stratified based on their clinical outcome (no metastatic event =0; metastatic events 1) and then the expression levels of Pri- miR-103/107 genes retrospectively tested for an association between signal intensity and sample outcome. In this analysis, the comparisons were performed using an unpaired two-side t-test with unequal variance. The test returned a t-statistic of 3.53, indicating higher, and statistically significant (p-value=0.00074), miR-103/107 levels in tumors that metastasized. The same analysis repeated on Dicer returned a non-significant p-value of 0.54662.
Example 15: miR-103/107 target Dicer
To test if miR-103/107 target Dicer, first reporter constructs were generated in which the full- length 3'UTR of Dicer, either wild-type or mutant in the miR-103/107 binding sites, was tiuncu uu wiiali eaui ui uic luuuci asc upcii-i cauuig name
Figure imgf000058_0001
- A i ui -iviu i , respectively, Figure IB). The activity of these two reporters was compared in human U20S cells: the wild-type reporter showed a reduced expression compared to its mutant version, as expected if the endogenous miR-103/107 were pairing to the predicted binding sites (Figure I B. compare lanes 1 and 5). Retroviral transduction of either pri-miR-103 or pri-miR-107 expression vectors caused further inhibition of the wild-type 3' UTR reporter (Figure IB, compare lane 5 with lanes 6 and 7), but not of the corresponding seed-mutant reporter. As control, forced expression of the unrelated pri-miR-154 or shGFP had no effect on luciferase expression (Figure IB, lane 8). Collectively, these data indicate that miR-103/107 target the Dicer 3'UTR.
Next, it was monitored to what extent miR-103/107 affect the endogenous levels of Dicer protein. In multiple cell lines, Dicer protein was specifically downregulated (about 50-60% reduction) by expressing pri-miR-103 or pri-miR-107 (Figure 1C, left panel and Figure 8A). To exclude any potentially confounding effect from the viral expression system - or from flanking sequences of the pri-miR constructs - cells were also transiently transfected with the mature form of miR-107 or, as control, a mutant miR-107 that contained three mismatches in the seed-binding sequence (miR-107-MUT). Dicer protein levels were downregulated by mature miR-107, but not miR-107-MUT (Figure 1 C, right panel and Figure 8B). miR103/107 affect Dicer levels acting on its 3'UTR, as lentiviral expression of Dicer lacking the 3'UTR was insensitive to miR-107 (Figure 8C).
Next, it was tested whether miR-103/107 are causal for Dicer downregulation in a loss-of- function experimental setting. For this, AntagomiR reagents were used (Krutzfeldt, loc cit) to silence endogenous miR-103/107 (AntagomiR- 103/107); as a control, a mutant version of this reagent carrying six mismatches (AntagomiR-MUT) (Figure 8D) was used; cf. also Example 2. As shown in Figure ID, treatment of MDA-MB-231 cells with AntagomiR- 103/ 107 specifically promoted expression of the Dicer 3'UTR-wild-type reporter and. crucially, upregulated endogenous Dicer protein, as assayed by immunoblotting (Figure I E). Thus, Dicer levels are limited by endogenous miR-103/107.
Subsequently, the effects of the miR- 103/107-Dicer interaction on miRNA biosynthesis were investigated by comparing miRNAs levels in MDA-MB-231 cells expressing miR-107 or miR-107-MUT. As assayed quantitatively by qPCR, mature miRNAs were globally downregulated in the presence of miR-107. This is phenocopied by Dicer knock-down (Figures IF, 8E, 8F and Table 2). Sustaining Dicer expression by means of a miR- 107- insensitive transgene rescues this effect (Figure 1G, Figure 8G and data not shown).
If miR-103/107 restrict miRNA processing at the level of Dicer, then the levels of miR- 103/107 should directly correlate with the abundance of Dicer substrate, i.e. the 70 nt precursor miRNAs (pre-miRNAs). Indeed, pre-miRNAs, but not pri -miRNAs, accumulate in miR-107 expressing MDA-MB-231 cells (Figure 8H).
In sum, miR-103/107 lead to inhibition of miRNA biogenesis through Dicer downregulation.
Example 16: Inverse correlation between miR-103/107 and Dicer levels in cancer ceil lines
First, the endogenous levels of miR-103/107 and Dicer protein was compared in a well- established cellular model of mammary tumor progression, consisting of four distinct cell lines, 67NR, 168FARN, 4T07 and 4T1 , all derived from a single primary tumor, and whose activity as xenografts reflects the sequence of multistep progression toward metastasis (Aslakson, loc cit). In the present invention, it was found that miR-103/107 expression levels increased from the non-aggressive cells (67NR, 168FARN) to metastatic lines (4T07 and 4T1 ), Conversely, endogenous Dicer protein levels decreased in metastatic lines (Figure 2A). To determine whether the expression of miR-103/107 increases with enhanced metastatic propensity in another cellular context, SW480 and SW620 human colon cancer cell lines were analyzed. SW480 and SW620 are derived from the primary tumor and a metastasis of the same patient, respectively (Leibovitz, Cancer Res (1976), 36: 4562-4569). As shown in Figure 2B, an inverse correlation between miR-103/107 and Dicer level could also be observed in this case.
Example 17: Clinical association of miR-103/107 expression to breast cancer metastasis and poor-prognosis
Mature miR-103/107 levels were measured in a collection of breast cancer patients treated in our Institution with annotated clinical history. Patients were divided in two groups, with respectively high or low levels of miR-103/107 (Figure 2C, see Examples 13 and 14). Remarkably, when tested using the Kaplan-Meier survival analysis, the "miR-103/107 High" group displayed a significant higher probability to develop metastasis when compared to the "Low" group (Figure 2D). In line with the biochemical characterization of Dicer as target of miR-103/107, the "high" group tumors showed reduced level of Dicer protein when compared to the "Low" group, as assayed by immunohistochemisty (Figure 2E-H). miR-103 and miR- 107 are intronic miRNAs contained in three PANK (Pantothenate kinase) loci of the human genome (i.e. , PANK1 , 2 and 3 corresponding to pri-miR-107, pri-miR- 103- 2 and pri-miR- 103-1, respectively). Expressions of PANK genes paralleled that of miR- 103/107 in the series of cell lines described above (Figure 9); this co-expression is in line with a previous analysis in normal human tissues (Baskerville. RNA (2005), 1 1 : 241-247).
P ANK/pri-miR- 103/107 expression was used as an approximation of miR-103/107 levels to interrogate several public gene expression datasets for which a wealth of molecular and associated clinical data is available (summing up to more than 1000 breast cancer patients, see Example 12. For each dataset, tumors were divided in two groups, with respectively high or low levels of pri-miR- 103/107 (see Examples 13 and 14 for details). In agreement with previous analyses on mature miR-103/107 described herein, the group expressing higher levels of pri-miR- 103/107 displayed a significant higher probability to develop metastasis and poor-outcome when compared to the "Low" group (Figures 21 and 10). Taken together, these results show that high miR-103/107 expression is suitable to identify those associated to adverse and metastatic disease. When breast cancer patients' stratification was repeated based on high- or low- Dicer mRNA levels, a significant association with metastasis or outcome could not be detected (Figures 2L and 10).
Example 18: miR-103/107 downregulatc Dicer to promote cell migration and invasion in vitro
It was assayed how gain- or loss-of-function of either miR-103/107 or Dicer impacted on cell migration, a hallmark of metastatic capacity. First 168FARN and SUM 149 were assayed. These cells are tumorigenic but display poor migratory capacities and contain relatively low levels of miR-103/107 (see Figure 2A and data not shown). As assayed in transwell migration assays, ai ing muv-i uj/ i u / m uiesc ucn lines lilucascu iiilgiculuii uy o- i u , vViicitas overexpression of comrol-shGFP had no effect (Figure 3 A compare lane 1 with lanes 2 and 3, Figure 3B). See Figure 1 1A for results on 168FARN cells.
Induction of migratory capacity by miR-103/107 relies on attenuation of Dicer. First, it is phenocopied in shDicer SUM 149 cells (reducing Dicer to about 40% its normal levels). Second, it is rescued by coexpression of a miR-insensitive Dicer transgene that restores Dicer protein to level near-to-endogenous (Figure 3 A, lanes 4 and 5, see immunoblots in Figure 11C). Similar results were obtained in wound-healing assays with another, more aggressive cell line, MDA-MB-231 cells (Figures 3C and 3D). Thus, miR-103/107 empowers cell motility through Dicer inhibition.
While complete loss of Dicer is detrimental for cell survival (Fukagawa, loc cit), in the present invention it is shown that miR-103/107 enhances motility with no effect on cell proliferation (Figure 1 IB and 1 ID). Different degrees of Dicer downregulation may reconcile these findings, as Dicer protein is only partially downregulated by miR-103/107. To address this, MDA-MB-231 cells were transfected with increasing doses of Dicer siRNA, inducing a range of depletions, from negligible to more quantitative knockdown (Figure 3F and data not shown). As a result, full Dicer-knockdown impaired cell viability, and, consequently, secondarily reduced cell migration if compared to control cells (Figure 3E, compare lane 1 with lanes 2-4). However, partial attenuation of Dicer to levels similar to those achieved by miR-103/107 (i.e. 50% - 60% reduction) potently fostered cell migration (Figure 3E, lanes 6-8 and 10 and Figure 3F). Similar results were obtained with immortalized mouse mammary epithelial cells NMuMg (Figure 11F-H). These findings show that cell migration is exquisitely sensitive to the levels of Dicer, and that the degree of Dicer downregulation imposed by miR-103/107 is sufficient to unleash aggressive cell behaviors.
Next, it was tested if endogenous levels of miR-103/107 are required for cell migration in the highly metastatic tumor cell line 4T1. For this, miR-103/107 were silenced by treatment with AntagomiR- 103/107 as shown above. This leads to a five-fold reduction in migratory properties similar to that one obtained by increasing Dicer expression (Figure 3G, lanes 1-3). Loss-of-Dicer renders 4T1 cells insensitive to loss of miR-103/107, indicating that Dicer is epistatic to miR-103/107 (Figure 3G, compare lanes 1 and 2 with lanes 4 and 5). Taken together, the data are indicative that the balance between miR-103/107 and Dicer is critical to control cancer cell motility.
Example 19: Expression of miR-107 endows metastatic potential
It was assayed if miR-103/107 could foster metastasis in vivo. For this, SUM 149 cells were used that form non-metastatic primary tumors in vivo after injection in the mouse mammary gland (Ma, Nature (2007), 449: 682-688), but retain residual lung colonization capacity when delivered through the tail vein. Notably, expression of pri-miR-107, but not shGFP (control), strongly promoted metastatic colonization (Figure 4 A, compare lane 1 and 2, and Figure 4B). In agreement with previous in vitro characterization described herein, this is phenocopied by partial depletion of Dicer (Figure 4A lane 3, and 4B). Conversely, rescuing Dicer expression (Figure 1 1C) abolished the pro-metastatic effects of miR-107 (Figure 4A, lane 4, and 4B). Thus, Dicer serves as metastasis suppressor downstream of miR-103/107.
Next, control (shGFP) and miR-107 expressing SUM149 cells were implanted in the mammary fat pad of immunocompromized mice. As already shown in vitro hereinabove, gain-of-miR-107 does not foster proliferation in vivo, not even within the competitive tumor microenviroment (Figure 4C). After 12 weeks, host mice were sacrificed and examined for the presence of metastatic lesions in the lung. Although no macroscopic metastases were detected, the staining of histological sections with anti-cytokeratin antibodies revealed the presence of micrometastic foci in the lungs explanted from mice bearing the SUM149-miR- 107 xenografts, whereas almost none were found in mice injected with control cells (Figures 4D and 4E). Thus, once overexpressed, miR- 107 is a prometastatic factor that unleashes the ability to initiate distant dissemination in otherwise non-metastatic cells.
Example 20: Silencing of miR-103/107 inhibits metastasis
4T1 cells were injected into the mammary fat pad of recipient mice and tumors treated either with antagomiR- 103/107 or antagomiR-ML'T (see Example 2). As shown in Figure 5A, the onset and size of primary tumors was comparable in the two groups of mice (p-value>0.05), despite the quantitative loss of endogenous mature miR-103/107 in AntagomiR- 103/107 treated primary tumors (Figure 5B). However, while the AntagomiR-MUT receiving cells invaded the lung parenchyma, silencing of miR-103/107 efficiently reduced metastatic colonization (Figures 5C, 5D and 5E). This occurred without detectable detrimental effects on normal mammary glands (Figure 13 A). Thus, endogenous miR-103/107 is critical for metastatic dissemination of breast cancer cells.
Furthermore, control and miR- 103/107-depleted primary tumors were compared for expression of a number of miRNAs. Silencing of miR-103/107 enhanced global miRNA processing, as revealed by the increased levels of mature miRNAs (Figure 5F) and concomitant reduction of the 70 nt miRNA precursors (Figure 13B). This shows that Dicer is limiting in metastatic tumors.
Two Dicer overexpressing 4T1 cell clones were selected from a lentivirally infected cell population (Figure 13C). Dicer-4T1 derived tumors were deprived of metastatic capacity when compared to lesions from mock-infected cells (Figures 5G-I). In sum, the data reveals a functional pathway in aggressive tumors, whereby endogenous miR-103/107 is instrumental to attenuate Dicer levels below a threshold for metastasis protection.
Array CGH profiling of breast cancers was queried. As a result, it was found that some tumors display a reduced copy number of the Dicerl locus, compatibly with Dicer heterozygosity; intriguingly, this subset of tumors also display an increased propensity to develop metastasis (Figure 13D). This provides a genetic proof-of-principle that selective pressure for Dicer downreguiation exists in aggressive breast cancer. pri-miR- 103/107 expression levels are able to stratify patients according to outcome only in Dicer +/+ tumors, but not upon Dicer heterozygosity (Figure 13E). In other words, Dicer heterozygous tumors lost selective pressure for miR- 103/107 upregulation, supporting the notion that these molecules are indeed in the same pathway.
Example 21: miR-103/107 promote Epithelial-to-Mesenchymal-Transition (EMT)
To understand the nature of aggressive cell behaviors leading to metastatic dissemination empowered by the miR- 103/107-Dicer axis, cell proliferation, growth after serum starvation, resistance to apoptotic stimuli and anoikis was monitored in immortalized mammary cell lines (MCFIOA. NMuMG) and tumor cell lines (SUM149, MDA-MB231 ). In all these assays, no significant difference was found between control cells and those transfected with miR- 107 (data not shown), supporting previous measurements of the growth rates of cancer cells in vitro and in vivo upon gain or loss of miR-103/107 (Figures 4C, 5A, 1 IB, 1 ID, 1 IE).
In contrast, a change in cellular shape promoted by overexpression of miR- 107 could be observed, whereby the cobblestone-like appearance of epithelial cells switched to a spindle-, fibroblast-like morphology with extensive cellular scattering and formation of lamellipodia (Figures 6 A, 6B). These are hallmarks of epithelial-to-mesenchymal transitions (EMT). EMT is a pivotal cellular program to induce rapid changes in the shape and motility of epithelial cells, normally used during morphogenesis and tissue repair. EMT is also aberrantly activated in cancer cells to promote their malignant and stem cell-characteristics (Polyak. Nat Rev Cancer (2009), 265-273).
Next, the localization of adherent and tight junction markers was examined, such as E- Cadherin and ZO-1 in NMuMg cells, a well-established model system for the study of EMT (Miettinen, J Cell Biol (1994), 127: 2021-2036). Immunofluorescence showed that these proteins were strongly downregulated in cells expressing miR- 107 (Figure 6B). EMT was also validated by gene expression analysis: in the presence of miR- 107, expression of E- Cadherin mRNA was downregulated whereas the mesenchymal markers vimentin, IC AM- 1 and fibronectin mRNAs were significantly increased (Figures 6C-F). In agreement with the role of Dicer downreguiation as mediator of miR- 107 effects, lowering Dicer levels by shRNA similarly caused reduction of E-Cadherin and induction of vimentin. Thus, the ability to induce EMT parallels with the previously shown induction of cell motility by miR-107 or Dicer downregulation (see Figure 1 IF).
Subsequently, the effects of gain- and loss-of-miR- 103/107 in MDA-MB-231 were monitored. Gain of miR-107 massively induced expression of fibronectin, vimentin and ICAM (Figure 6G), while antagomiR-mediated depletion of endogenous miR- 103/107 reduced expression of the same genes (Figure 6H).
In line with such endogenous role of miR- 103/107 in EMT, it was found in the present invention that high vs. low levels of pri-miR-103 arc associated to mesenchymal vs. epithelial phenotypes in a panel of breast cancer cell lines previously stratified accordin to expression profiles and metastatic capacity (Charafe-Jauffret, Cancer Res (2009), 69: 1302-1313) (Figure 61). 'Ί / 1 Π 7 i c cn"f¥i nt » *t
Figure imgf000065_0001
epithelial plasticity and required for maintenance of mesenchymal gene expression.
Example 22: miR-103/107 control mesenchymal traits by regulating the expression of the miR-200 family of miRNAs.
In order to define the identity of key miRNAs acting as downstream mediators of the miR- 103/107-Dicer axis, focus was laid on the miR-200 family (Figure 7 A) as previous studies showed that these miRNAs display properties opposite to those of miR-103/107: they are required to suppress EMT and migration while their attenuation unleashes mesenchymal gene expression (Inui, Nat Rev Mol Biol (2010), 1 1 : 252-263 ; Polyak, loc cit).
If members of the miR-200 family are functionally relevant downstream of miR-103/107, then miR-200 should oppose miR-107. Confirming this hypothesis, transfection of miR-200b in NMuMG cells reverted the EMT induced by miR-107 as assayed by morphology and gene expression (Figure 7B and 7C). Migration of MDA-MB-231 cells was inhibited by Antagomi R- 103 / 107 but this has no effect in miR-200-depleted cells (by means of antagomiR-200, targeting the whole miR-200 family) (Figure 7D). Biochemically, mature miR-200 levels were increased by AntagorniR- 103/107 (Figure 7E). To confirm that this extent of miR-200 upregulation was biologically effective, the miR-200 targets ZEBl and ZEB2 were monitored. These genes were found to be downregulated (Figure 7F) in AntagorniR- 103/107 treated cells to about 50%, mimicking the effect of mature miR-200 overexpression (see Figure 71). In agreement, it was found in context of the present invention that overexpression of miR-107 downregulates miR-200 and upregulates ZEBl and ZEB2 mRNA levels (Figure 7G and 7H). Importantly, these effects are potently rescued by adding-back Dicer (Figure 7G and 7H), Crucially, expression of miR-200 blocks the phenotypic effects of miR- 107, as assayed by expression of ZEB2 and cell migration (Figures 71 and 7L), indicating that inhibition of miR-200 is critical for maintenance of mesenchymal and motile properties by the miR- 103/107-Dicer axis.

Claims

Claims
1. Composition comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof, for use in treating or preventing a disease or disorder in a subject.
2. The composition according to claim 1, wherein said disease or disorder is cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto.
3. The composition according to claim 1 or 2, wherein said polynucleotide to be inhibited is capable of hybridizing to the mRNA of Dicer or a biologically active derivate thereof.
4. The composition according to any one of claims 1 to 3, wherein said polynucleotide to be inhibited is selected from the group consisting of microRNA, siRNA, mimic microRNA, long non-coding RNAs, snRNA (small/short hairpin RNA), stRNA (small temporal RNA), fRNA (functional RNAs), snRNA. (small nuclear RNA), snoRNA (small nucleolar RNAs), piRNA (piwi-interacting RNA), tasiRNA (trans-acting small/short interfering RNA), aRNA (antisense RNA) and a precursor of such polynucleotides.
5. The composition according to any one of claims 1 to 4, wherein said polynucleotide to be inhibited is about 15 to about 100, preferably about 18 to about 27 nucleotides, and most preferably 20 to 24 nucleotides in length.
6. The composition according to any one of claims 1 to 5, wherein said polynucleotide to be inhibited is selected from the group consisting of: (a) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1 ;
(b) polynucleotide comprising the nucleotide sequence of SEQ ID NO: 2;
(c) polynucleotide comprising the nucleotide sequence of SEQ ID NO: 3;
(d) a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 4;
(e) a polynucleotide which is at least 25% identical to the polynucleotide of any of (a) to (d); and
(f) a polynucleotide which is at least 25% identical to the polynucleotide of any of (a) to (d) and which comprises the nucleotide sequence of SEQ ID NO: 4.
The composition according to claim 6 which comprises one, two, three inhibitors of one, two, three or more of any one of polynucleotides (a) to (f).
8. The composition according to any one of claims 1 to 7, wherein said polynucleotide to be inhibited hybridizes to the 3'-UTR of the mRNA of Dicer or a biologically active derivative thereof.
9. The composition according to any one claims 1 to 8, wherein the composition contains about 1 ng/kg body weight to about 10 mg/kg body weight of said inhibitor.
10. The composition according to any one of claims 1 to 9, further comprising a pharmaceutically acceptable carrier.
11. The composition according to any one of claims 1 to 10, which is prepared to be administered orally, rectally, via injection, via inhalation, topically or vaginally.
12. The composition of any one of claims 1 to 1 1, wherein said inhibitor is capable of hybridizing to said polynucleotide to be inhibited.
13. The composition of any one of claims 1 to 12, wherein said inhibitor is selected from the group consisting of AntagomiRs, miRCURY LNA™ microRNA inhibitors, in vivo LNA™ miR inhibitors, miR-decoys or miR-sponges, or nucleases specifically cleaving said polynucleotide to be inhibited.
14. Method for treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto in a subject, said method comprising administering an effective amount of a composition comprising an inhibitor of a polynucleotide, said polynucleotide to be inhibited being capable of decreasing or suppressing expression of Dicer or a biologically active derivative thereof.
15. The composition according to anv one of claims 1 to 13 or the method according to claim 14, wherein said subject is human.
PCT/EP2010/058495 2010-06-16 2010-06-16 Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto WO2011157294A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/EP2010/058495 WO2011157294A1 (en) 2010-06-16 2010-06-16 Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/EP2010/058495 WO2011157294A1 (en) 2010-06-16 2010-06-16 Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto

Publications (1)

Publication Number Publication Date
WO2011157294A1 true WO2011157294A1 (en) 2011-12-22

Family

ID=43536598

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2010/058495 WO2011157294A1 (en) 2010-06-16 2010-06-16 Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto

Country Status (1)

Country Link
WO (1) WO2011157294A1 (en)

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
WO2014081507A1 (en) 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Terminally modified rna
WO2014093924A1 (en) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
WO2014113089A2 (en) 2013-01-17 2014-07-24 Moderna Therapeutics, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
WO2017127750A1 (en) 2016-01-22 2017-07-27 Modernatx, Inc. Messenger ribonucleic acids for the production of intracellular binding polypeptides and methods of use thereof
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
WO2017201350A1 (en) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucleotides encoding interleukin-12 (il12) and uses thereof
WO2017218704A1 (en) 2016-06-14 2017-12-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
WO2018002762A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of amyotrophic lateral sclerosis (als) and other related disorders
WO2018002812A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of myotonic dystrophy type 1 (dm1) and other related disorders
WO2018002783A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of friedreich ataxia and other related disorders
WO2018007980A1 (en) 2016-07-06 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of pain related disorders
WO2018007976A1 (en) 2016-07-06 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of pain related disorders
WO2018081459A1 (en) 2016-10-26 2018-05-03 Modernatx, Inc. Messenger ribonucleic acids for enhancing immune responses and methods of use thereof
WO2018089540A1 (en) 2016-11-08 2018-05-17 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
WO2018144775A1 (en) 2017-02-01 2018-08-09 Modernatx, Inc. Immunomodulatory therapeutic mrna compositions encoding activating oncogene mutation peptides
WO2018154387A1 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Compositions and methods for gene editing
WO2018154418A1 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders
WO2018154462A2 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of spinocerebellar ataxia type 2 (sca2) and other spinocerebellar ataxia type 2 protein (atxn2) gene related conditions or disorders
EP3409778A1 (en) * 2017-05-31 2018-12-05 Medizinische Hochschule Hannover Lncrnas gadlor 1 and 2 for use in treating and preventing cardiac remodelling
WO2018231990A2 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase
WO2019046809A1 (en) 2017-08-31 2019-03-07 Modernatx, Inc. Methods of making lipid nanoparticles
EP3461904A1 (en) 2014-11-10 2019-04-03 ModernaTX, Inc. Alternative nucleic acid molecules containing reduced uracil content and uses thereof
WO2019102381A1 (en) 2017-11-21 2019-05-31 Casebia Therapeutics Llp Materials and methods for treatment of autosomal dominant retinitis pigmentosa
WO2019123429A1 (en) 2017-12-21 2019-06-27 Casebia Therapeutics Llp Materials and methods for treatment of usher syndrome type 2a
WO2019152557A1 (en) 2018-01-30 2019-08-08 Modernatx, Inc. Compositions and methods for delivery of agents to immune cells
WO2019200171A1 (en) 2018-04-11 2019-10-17 Modernatx, Inc. Messenger rna comprising functional rna elements
WO2019241315A1 (en) 2018-06-12 2019-12-19 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
WO2020061457A1 (en) 2018-09-20 2020-03-26 Modernatx, Inc. Preparation of lipid nanoparticles and methods of administration thereof
WO2020086742A1 (en) 2018-10-24 2020-04-30 Obsidian Therapeutics, Inc. Er tunable protein regulation
WO2020098806A1 (en) * 2018-11-16 2020-05-22 南京迈西可生物科技有限公司 Method for identifying 2'-o-methylation modification in rna molecule, and application thereof
WO2020160397A1 (en) 2019-01-31 2020-08-06 Modernatx, Inc. Methods of preparing lipid nanoparticles
WO2020185632A1 (en) 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Human carbonic anhydrase 2 compositions and methods for tunable regulation
WO2020263985A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Messenger rna comprising functional rna elements and uses thereof
WO2020263883A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Endonuclease-resistant messenger rna and uses thereof
WO2021046451A1 (en) 2019-09-06 2021-03-11 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
CN112646892A (en) * 2020-12-30 2021-04-13 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Group of piRNA biomarkers for early diagnosis of breast cancer and application thereof
WO2021155274A1 (en) 2020-01-31 2021-08-05 Modernatx, Inc. Methods of preparing lipid nanoparticles
CN113498437A (en) * 2019-02-26 2021-10-12 首尔大学校产学协力团 Pharmaceutical composition for preventing or treating cancer comprising terminal uridine acyltransferase 4/7 expression regulator
WO2022020811A1 (en) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Lipidnanoparticle comprising modified nucleotides
WO2022032087A1 (en) 2020-08-06 2022-02-10 Modernatx, Inc. Methods of preparing lipid nanoparticles
CN114657178A (en) * 2020-12-03 2022-06-24 南京大学 Application of miR-103-3p in sperms in preparation of depression detection products and anti-depression drugs
WO2022150712A1 (en) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Expression constructs and uses thereof
US11407997B2 (en) 2017-02-22 2022-08-09 Crispr Therapeutics Ag Materials and methods for treatment of primary hyperoxaluria type 1 (PH1) and other alanine-glyoxylate aminotransferase (AGXT) gene related conditions or disorders
WO2022233880A1 (en) 2021-05-03 2022-11-10 Curevac Ag Improved nucleic acid sequence for cell type specific expression
US11559588B2 (en) 2017-02-22 2023-01-24 Crispr Therapeutics Ag Materials and methods for treatment of Spinocerebellar Ataxia Type 1 (SCA1) and other Spinocerebellar Ataxia Type 1 Protein (ATXN1) gene related conditions or disorders
US11584932B2 (en) 2016-11-01 2023-02-21 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
WO2023212618A1 (en) 2022-04-26 2023-11-02 Strand Therapeutics Inc. Lipid nanoparticles comprising venezuelan equine encephalitis (vee) replicon and uses thereof
WO2024026482A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Lipid nanoparticle compositions comprising surface lipid derivatives and related uses
WO2024026475A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Compositions for delivery to hematopoietic stem and progenitor cells (hspcs) and related uses
WO2024026487A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Lipid nanoparticle compositions comprising phospholipid derivatives and related uses

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009045469A2 (en) * 2007-10-02 2009-04-09 Amgen Inc. Increasing erythropoietin using nucleic acids hybridizable to micro-rna and precursors thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009045469A2 (en) * 2007-10-02 2009-04-09 Amgen Inc. Increasing erythropoietin using nucleic acids hybridizable to micro-rna and precursors thereof

Non-Patent Citations (70)

* Cited by examiner, † Cited by third party
Title
ADORNO, CELL, vol. 137, 2009, pages 87 - 98
AMBROS, NATURE, vol. 431, 2004, pages 350 - 355
ASLAKSON, CANCER RES, vol. 52, 1992, pages 1399 - 1405
BARTEL, CELL, vol. 116, 2004, pages 281 - 297
BARTEL, CELL, vol. 136, 2009, pages 215 - 233
BASKERVILLE, RNA, vol. 11, 2005, pages 241 - 247
BENES, METHODS, vol. 50, 2010, pages 244 - 249
BERNSTEIN, NAT GENET, vol. 35, 2003, pages 215 - 217
BICCIATO, NUCLEIC ACID RES, vol. 37, 2009, pages 5057 - 5070
BILLMAN-JACOBE, CURRENT OPINION IN BIOTECHNOLOGY, vol. 7, 1996, pages 500 - 4
BITTER, METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 516 - 544
BONCI, NAT MED, vol. 14, 2008, pages 1271 - 1277
BOOMINATHAN LAKSHMANANE: "The tumor suppressors p53, p63, and p73 are regulators of MicroRNA processing complex", PLOS ONE, vol. 5, no. 5, E10165, May 2010 (2010-05-01), pages 1 - 13, XP002622407, ISSN: 1932-6203 *
BURNETTE, ANAL BIOCHEM, vol. 112, 1981, pages 195 - 203
CALIN, NAT REV CANCER, vol. 6, 2006, pages 857 - 866
CHARAFE-JAUFFRET, CANCER RES, vol. 69, 2009, pages 1302 - 1313
CHEN, PROC NATL ACAD SCI U S A, vol. 105, 2008, pages 2111 - 2116
CHENG ANGIE M. ET AL.: "Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis", NUCLEIC ACIDS RESEARCH, vol. 33, no. 4, 2005, pages 1290 - 1297, XP002622400, ISSN: 0305-1048 *
CHENG ANGIE M. ET AL: "Supplementary data 1: Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis", 2005, XP002622401, Retrieved from the Internet <URL:http://nar.oxfordjournals.org/content/suppl/2005/03/03/33.4.1290.DC1/Supdata1.pdf> [retrieved on 20110214] *
CHENG ANGIE M. ET AL: "Supplementary data 2: Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis", 2005, XP002622402, Retrieved from the Internet <URL:http://nar.oxfordjournals.org/content/suppl/2005/03/03/33.4.1290.DC1/Supdata2.pdf> [retrieved on 20110214] *
COSTA, CIRCULATION, vol. 118, 2008, pages 1567 - 1576
DUPONT, CELL, vol. 136, 2009, pages 123 - 135
EBERT, NAT METHODS, vol. 4, 2007, pages 721 - 726
ELVIDGE, PHARMACOGENOMICS, vol. 7, 2006, pages 123 - 134
FERRARI, BMC BIOINFORMATICS, vol. 8, 2007, pages 446
FILIPOWICZ, NAT REV GENET, vol. 9, 2008, pages 102 - 114
FUAGAWA, NAT CELL BIOL, vol. 6, 2004, pages 784 - 791
GAMPER, NUCLEIC ACIDS RESEARCH, vol. 28, 2000, pages 4332 - 4339
GRIFFITHS, METHODS IN MOLECULAR BIOLOGY, vol. 75, 1997, pages 427 - 440
GUO YONG ET AL.: "Distinctive MicroRNA profiles relating to patient survival in esophageal squamous cell carcinoma", CANCER RESEARCH, vol. 68, no. 1, January 2008 (2008-01-01), pages 26 - 33, XP002622408, ISSN: 0008-5472 *
HOCKNEY, TRENDS IN BIOTECHNOLOGY, vol. 12, 1994, pages 456 - 463
INUI, NAT REV MOL BIOL, vol. 11, 2010, pages 252 - 263
INUI, NAT REV MOL CELL BIOL, vol. 11, 2010, pages 252 - 63
IRIZARRY, BIOSTATISTICS, vol. 4, 2003, pages 249 - 264
KAFATOS, NAR, vol. 7, 1979, pages 1541 - 1552
KARUBE CANCER SCI, vol. 96, 2005, pages 111 - 115
KRUTZFELDT, NATURE, vol. 438, 2005, pages 685 - 689
KRÜTZFELDT, NATURE, vol. 438, 2005, pages 685 - 689
KUMAR, GENES DEV, vol. 23, 2009, pages 4562 - 4569
KUMAR, NAT GENET, vol. 39, 2007, pages 673 - 677
LEE KWANG-HYUCK ET AL.: "Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer", PANCREATOLOGY, vol. 9, no. 3, 2009, pages 293 - 301, XP002622406, ISSN: 1424-3911 *
LEE, EMBO J, vol. 21, 2002, pages 4663 - 4670
LEE, PANCREATOLOGY, vol. 9, 2009, pages 293 - 301
LEIBOVITZ, CANCER RES, vol. 36, 1976, pages 4562 - 4569
LISTON, J EXP MED, vol. 205, 2008, pages 1993 - 2004
LIU XIQIANG ET AL.: "MicroRNA profiling and head and neck cancer", COMPARATIVE AND FUNCTIONAL GENOMICS, 2009, XP002622409, ISSN: 1531-6912 *
LU, NATURE, vol. 435, 2005, pages 834 - 838
MA, NATURE, vol. 449, 2007, pages 682 - 688
MARTELLO GRAZIANO ET AL.: "A MicroRNA targeting Dicer for metastasis control", CELL, vol. 141, no. 7, June 2010 (2010-06-01), pages 1195 - 1207, XP002622417, ISSN: 0092-8674 *
MARTELLO, NATURE, vol. 449, 2007, pages 183 - 188
MERRITT, N, ENGL J MED, vol. 359, 2008, pages 2641 - 2650
METHODS IN ENZYMOLOGY, vol. 153, 1987, pages 385 - 516
METZKER, NAT REV GENET, vol. 11, 2010, pages 31 - 46
MIETTINEN, J CELL BIOL, vol. 127, 1994, pages 2021 - 2036
OZEN, ONCOGENE, vol. 27, 2008, pages 1788 - 1789
POLYAK, NAT REV CANCER, vol. 9, 2009, pages 265 - 273
SAWERS, APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 46, 1996, pages 1 - 9
SCHMITTEGEN, NUCLEIC ACID RES, vol. 32, 2004, pages E43
SCHMITTGEN, METHODS, vol. 44, 2008, pages 31 - 38
TAKAHASHI YUKARI ET AL.: "MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines", PLOS ONE, vol. 4, no. 8, August 2009 (2009-08-01), XP002622405, ISSN: 1932-6203 *
TANG, GENES DEV, vol. 21, 2007, pages 644 - 648
VANGUILDER, BIOTECHNIQUES, vol. 44, 2008, pages 619 - 26
VANGUILDER, BIOTECHNIQUES, vol. 44, no. 5, 2008, pages 619 - 26
VENTURA, CELL, vol. 136, 2009, pages 586 - 591
VOLIANA, PROC NATL ACAD SCI U S A, vol. 103, 2006, pages 2257 - 2261
VOORHOEVE, CELL, vol. 124, 2006, pages 1169 - 1181
WANG, J NEUROSCI, vol. 28, 2008, pages 1213 - 1223
YAMAKUCHI MUNEKAZU ET AL.: "P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 107, no. 14, April 2010 (2010-04-01), pages 6334 - 6339, XP002622403, ISSN: 0027-8424 *
YAMAKUCHI MUNEKAZU ET AL.: "Supporting information: P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis", April 2010 (2010-04-01), XP002622404, Retrieved from the Internet <URL:http://www.pnas.org/content/suppl/2010/03/12/0911082107.DCSupplemental/pnas.200911082SI.pdf> [retrieved on 20110214] *
ZENG; CULLEN, RNA, vol. 9, 2003, pages 112 - 123

Cited By (64)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (en) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb microRNAs FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION
WO2014081507A1 (en) 2012-11-26 2014-05-30 Moderna Therapeutics, Inc. Terminally modified rna
EP4074834A1 (en) 2012-11-26 2022-10-19 ModernaTX, Inc. Terminally modified rna
WO2014093924A1 (en) 2012-12-13 2014-06-19 Moderna Therapeutics, Inc. Modified nucleic acid molecules and uses thereof
WO2014113089A2 (en) 2013-01-17 2014-07-24 Moderna Therapeutics, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
EP3434774A1 (en) 2013-01-17 2019-01-30 ModernaTX, Inc. Signal-sensor polynucleotides for the alteration of cellular phenotypes
EP3461904A1 (en) 2014-11-10 2019-04-03 ModernaTX, Inc. Alternative nucleic acid molecules containing reduced uracil content and uses thereof
WO2017127750A1 (en) 2016-01-22 2017-07-27 Modernatx, Inc. Messenger ribonucleic acids for the production of intracellular binding polypeptides and methods of use thereof
WO2017180587A2 (en) 2016-04-11 2017-10-19 Obsidian Therapeutics, Inc. Regulated biocircuit systems
WO2017201350A1 (en) 2016-05-18 2017-11-23 Modernatx, Inc. Polynucleotides encoding interleukin-12 (il12) and uses thereof
EP4186518A1 (en) 2016-05-18 2023-05-31 ModernaTX, Inc. Polynucleotides encoding interleukin-12 (il12) and uses thereof
WO2017218704A1 (en) 2016-06-14 2017-12-21 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
WO2018002762A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of amyotrophic lateral sclerosis (als) and other related disorders
US11564997B2 (en) 2016-06-29 2023-01-31 Crispr Therapeutics Ag Materials and methods for treatment of friedreich ataxia and other related disorders
WO2018002783A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of friedreich ataxia and other related disorders
WO2018002812A1 (en) 2016-06-29 2018-01-04 Crispr Therapeutics Ag Materials and methods for treatment of myotonic dystrophy type 1 (dm1) and other related disorders
US11174469B2 (en) 2016-06-29 2021-11-16 Crispr Therapeutics Ag Materials and methods for treatment of Amyotrophic Lateral Sclerosis (ALS) and other related disorders
US11459587B2 (en) 2016-07-06 2022-10-04 Vertex Pharmaceuticals Incorporated Materials and methods for treatment of pain related disorders
US11801313B2 (en) 2016-07-06 2023-10-31 Vertex Pharmaceuticals Incorporated Materials and methods for treatment of pain related disorders
WO2018007980A1 (en) 2016-07-06 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of pain related disorders
WO2018007976A1 (en) 2016-07-06 2018-01-11 Crispr Therapeutics Ag Materials and methods for treatment of pain related disorders
WO2018081459A1 (en) 2016-10-26 2018-05-03 Modernatx, Inc. Messenger ribonucleic acids for enhancing immune responses and methods of use thereof
US11584932B2 (en) 2016-11-01 2023-02-21 The Research Foundation For The State University Of New York 5-halouracil-modified microRNAs and their use in the treatment of cancer
WO2018089540A1 (en) 2016-11-08 2018-05-17 Modernatx, Inc. Stabilized formulations of lipid nanoparticles
WO2018144775A1 (en) 2017-02-01 2018-08-09 Modernatx, Inc. Immunomodulatory therapeutic mrna compositions encoding activating oncogene mutation peptides
US11559588B2 (en) 2017-02-22 2023-01-24 Crispr Therapeutics Ag Materials and methods for treatment of Spinocerebellar Ataxia Type 1 (SCA1) and other Spinocerebellar Ataxia Type 1 Protein (ATXN1) gene related conditions or disorders
WO2018154387A1 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Compositions and methods for gene editing
WO2018154462A2 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of spinocerebellar ataxia type 2 (sca2) and other spinocerebellar ataxia type 2 protein (atxn2) gene related conditions or disorders
US11407997B2 (en) 2017-02-22 2022-08-09 Crispr Therapeutics Ag Materials and methods for treatment of primary hyperoxaluria type 1 (PH1) and other alanine-glyoxylate aminotransferase (AGXT) gene related conditions or disorders
WO2018154418A1 (en) 2017-02-22 2018-08-30 Crispr Therapeutics Ag Materials and methods for treatment of early onset parkinson's disease (park1) and other synuclein, alpha (snca) gene related conditions or disorders
US11920148B2 (en) 2017-02-22 2024-03-05 Crispr Therapeutics Ag Compositions and methods for gene editing
WO2018220038A1 (en) * 2017-05-31 2018-12-06 Medizinische Hochschule Hannover lncRNAs GADLOR 1 AND 2 FOR USE IN TREATING AND PREVENTING CARDIAC REMODELLING
US11208656B2 (en) 2017-05-31 2021-12-28 Medizinische Hochschule Hannover IncRNAs GADLOR 1 and 2 for use in treating and preventing cardiac remodelling
EP3409778A1 (en) * 2017-05-31 2018-12-05 Medizinische Hochschule Hannover Lncrnas gadlor 1 and 2 for use in treating and preventing cardiac remodelling
WO2018231990A2 (en) 2017-06-14 2018-12-20 Modernatx, Inc. Polynucleotides encoding methylmalonyl-coa mutase
WO2019046809A1 (en) 2017-08-31 2019-03-07 Modernatx, Inc. Methods of making lipid nanoparticles
WO2019102381A1 (en) 2017-11-21 2019-05-31 Casebia Therapeutics Llp Materials and methods for treatment of autosomal dominant retinitis pigmentosa
WO2019123429A1 (en) 2017-12-21 2019-06-27 Casebia Therapeutics Llp Materials and methods for treatment of usher syndrome type 2a
WO2019152557A1 (en) 2018-01-30 2019-08-08 Modernatx, Inc. Compositions and methods for delivery of agents to immune cells
WO2019200171A1 (en) 2018-04-11 2019-10-17 Modernatx, Inc. Messenger rna comprising functional rna elements
WO2019241315A1 (en) 2018-06-12 2019-12-19 Obsidian Therapeutics, Inc. Pde5 derived regulatory constructs and methods of use in immunotherapy
WO2020061457A1 (en) 2018-09-20 2020-03-26 Modernatx, Inc. Preparation of lipid nanoparticles and methods of administration thereof
WO2020086742A1 (en) 2018-10-24 2020-04-30 Obsidian Therapeutics, Inc. Er tunable protein regulation
WO2020098806A1 (en) * 2018-11-16 2020-05-22 南京迈西可生物科技有限公司 Method for identifying 2'-o-methylation modification in rna molecule, and application thereof
CN113166808A (en) * 2018-11-16 2021-07-23 梅傲科技(广州)有限公司 Identification of 2 in RNA molecules，Method for O-methylation modification and application thereof
WO2020160397A1 (en) 2019-01-31 2020-08-06 Modernatx, Inc. Methods of preparing lipid nanoparticles
CN113498437A (en) * 2019-02-26 2021-10-12 首尔大学校产学协力团 Pharmaceutical composition for preventing or treating cancer comprising terminal uridine acyltransferase 4/7 expression regulator
WO2020185632A1 (en) 2019-03-08 2020-09-17 Obsidian Therapeutics, Inc. Human carbonic anhydrase 2 compositions and methods for tunable regulation
WO2020263985A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Messenger rna comprising functional rna elements and uses thereof
WO2020263883A1 (en) 2019-06-24 2020-12-30 Modernatx, Inc. Endonuclease-resistant messenger rna and uses thereof
WO2021046451A1 (en) 2019-09-06 2021-03-11 Obsidian Therapeutics, Inc. Compositions and methods for dhfr tunable protein regulation
WO2021155274A1 (en) 2020-01-31 2021-08-05 Modernatx, Inc. Methods of preparing lipid nanoparticles
WO2022020811A1 (en) 2020-07-24 2022-01-27 Strand Therapeutics, Inc. Lipidnanoparticle comprising modified nucleotides
WO2022032087A1 (en) 2020-08-06 2022-02-10 Modernatx, Inc. Methods of preparing lipid nanoparticles
CN114657178B (en) * 2020-12-03 2023-07-21 南京大学 Application of miR-103-3p in sperms in preparation of depression detection products and antidepressant drugs
CN114657178A (en) * 2020-12-03 2022-06-24 南京大学 Application of miR-103-3p in sperms in preparation of depression detection products and anti-depression drugs
CN112646892A (en) * 2020-12-30 2021-04-13 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Group of piRNA biomarkers for early diagnosis of breast cancer and application thereof
CN112646892B (en) * 2020-12-30 2022-02-01 广州医科大学附属第三医院（广州重症孕产妇救治中心、广州柔济医院） Group of piRNA biomarkers for early diagnosis of breast cancer and application thereof
WO2022150712A1 (en) 2021-01-08 2022-07-14 Strand Therapeutics, Inc. Expression constructs and uses thereof
WO2022233880A1 (en) 2021-05-03 2022-11-10 Curevac Ag Improved nucleic acid sequence for cell type specific expression
WO2023212618A1 (en) 2022-04-26 2023-11-02 Strand Therapeutics Inc. Lipid nanoparticles comprising venezuelan equine encephalitis (vee) replicon and uses thereof
WO2024026482A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Lipid nanoparticle compositions comprising surface lipid derivatives and related uses
WO2024026475A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Compositions for delivery to hematopoietic stem and progenitor cells (hspcs) and related uses
WO2024026487A1 (en) 2022-07-29 2024-02-01 Modernatx, Inc. Lipid nanoparticle compositions comprising phospholipid derivatives and related uses

Similar Documents

Publication Publication Date Title
WO2011157294A1 (en) Compositions for use in treating or preventing cancer, breast cancer, lung cancer, ovarian cancer, metastasis, heart failure, cardiac remodelling, dilated cardiomyopathy, autoimmune diseases, or diseases or disorders related thereto
Cesarini et al. ADAR2/miR-589-3p axis controls glioblastoma cell migration/invasion
Pichiorri et al. In vivo NCL targeting affects breast cancer aggressiveness through miRNA regulation
Martello et al. A MicroRNA targeting dicer for metastasis control
Kano et al. miR‐145, miR‐133a and miR‐133b: Tumor‐suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma
US8586726B2 (en) Tissue-specific MicroRNAs and compositions and uses thereof
KINoSHITA et al. Tumor suppressive microRNA-375 regulates lactate dehydrogenase B in maxillary sinus squamous cell carcinoma
JP2019512489A (en) MicroRNA and method of using the same
US20200017856A1 (en) Targeting human satellite ii (hsatii)
Elango et al. MicroRNA expression profiling on paired primary and lymph node metastatic breast cancer revealed distinct microRNA profile associated with LNM
WO2020142629A1 (en) Reverse transcriptase blocking agents and methods of using the same
WO2012006181A2 (en) Compositions and methods for inhibiting oncogenic micrornas and treatment of cancer
US20140154303A1 (en) Treating cancer by inhibiting expression of olfm4, sp5, tob1, arid1a, fbn1 or hat1
Quattrochi et al. MicroRNAs of the mir-17~ 92 cluster regulate multiple aspects of pancreatic tumor development and progression
US20120108655A1 (en) Methods of Diagnosing and Treating Carcinomas
EP3904518A1 (en) Pharmaceutical composition for preventing or treating cancer, comprising tut4/7 expression modulator
EP3677693A1 (en) Transpochimeric gene trancripts (tcgts) as cancer biomarkers
US20130084328A1 (en) Methylated coding and non-coding rna genes as diagnostic and therapeutic tools for human melanoma
WO2014193309A1 (en) Method For Determining Cancer Prognosis
US9404111B2 (en) Inhibitors of miRNAs 221 and 222 for anti-tumor activity in multiple myeloma
Jadaliha Role of long non-coding RNAs in breast cancer progression
Chiacchiarini miR-139-5p-PI3K/AKT/mTORC1 network has a role in supratentorial pediatric Low Grade Gliomas (pLGGs)
Cabello Navarro Epigenetic regulation of resistance to treatments in triple negative and HER2+ breast cancer: miRNAs involved
Huang et al. RBM7 deficiency promotes breast cancer metastasis by coordinating MFGE8 splicing switch and NF-kB pathway
Rezaie et al. An overview of miRNAs role in neurofibromatosis type 2

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10732323

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10732323

Country of ref document: EP

Kind code of ref document: A1