WO2011022809A1 - Fusarium and fusarium mycotoxin biocontrol - Google Patents

Fusarium and fusarium mycotoxin biocontrol Download PDF

Info

Publication number
WO2011022809A1
WO2011022809A1 PCT/CA2010/001253 CA2010001253W WO2011022809A1 WO 2011022809 A1 WO2011022809 A1 WO 2011022809A1 CA 2010001253 W CA2010001253 W CA 2010001253W WO 2011022809 A1 WO2011022809 A1 WO 2011022809A1
Authority
WO
WIPO (PCT)
Prior art keywords
mycoparasitica
graminearum
fusarium
adon
plants
Prior art date
Application number
PCT/CA2010/001253
Other languages
French (fr)
Inventor
Vladimir Vujanovic
Original Assignee
University Of Saskatchewan
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Saskatchewan filed Critical University Of Saskatchewan
Priority to AU2010286276A priority Critical patent/AU2010286276B2/en
Priority to JP2012525827A priority patent/JP2013502902A/en
Priority to UAA201203725A priority patent/UA104050C2/en
Priority to CA2772106A priority patent/CA2772106C/en
Priority to EP10811051.1A priority patent/EP2470659A4/en
Priority to EA201270327A priority patent/EA201270327A1/en
Priority to BRBR112012004160-6A priority patent/BR112012004160A2/en
Publication of WO2011022809A1 publication Critical patent/WO2011022809A1/en
Priority to US13/405,771 priority patent/US20120156173A1/en
Priority to IN2475DEN2012 priority patent/IN2012DN02475A/en
Priority to US14/556,624 priority patent/US20150150921A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/30Microbial fungi; Substances produced thereby or obtained therefrom
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50Isolated enzymes; Isolated proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/145Fungal isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi

Definitions

  • the present invention relates to novel biocontrol agents, related compositions with mycocidal effect and uses thereof.
  • the present agent has a mycocidal effect on fungi of the genus Fusarium.
  • the present invention further relates to the isolated fungal inoculant, genes, proteins and/or organisms as well as uses, methods, compositions, involving the same.
  • Fusarium is a filamentous fungus widely distributed on plants and in the soil. Certain Fusarium species are plant pathogens. For example, Fusarium oxysporum, causes Fusarium wilt disease in more than a hundred species of plants. It does so by colonizing the plant xylem which can result in blockage and breakdown. When this occurs symptoms such as leaf wilting and yellowing appear in the plant eventually leading to the plant's death. This condition was the primary cause of the decline and disappearance of the Gros Michel banana cultivar from markets around the world. Recently a new strain has begun attacking plants of the dominant Cavendish cultivar leading to fears that, in the absence of a solution, this cultivar will too disappear from world markets.
  • Fusarium root rot is a major cause of seedling mortality in forest nurseries and also causes reduced survival after outplanting during the first growing season.
  • the disease is caused by several Fusarium species and is common in many parts of the world. The disease is a particular problem in Western Canada and the United States and also in the North Central and Southern States.
  • Pine pitch canker - caused by the fungus Fusarium circinatum - is a serious disease of pine trees and a threat to the forest industry in particularly in the US and New Zealand. Radiata or Monterey pine is highly susceptible to the disease with mortality rates in mature trees reaching 80% in some areas of California.
  • Fusarium Head Blight also known as 'ear blight' or 'scab'
  • FHB Fusarium Head Blight
  • Corn and maize can be affected by a similar condition known as 'ear rot'. The aforementioned condition can reduce the yield and grade of the crop, and can potentially contaminate the grain with mycotoxins. It is estimated that FHB costs the cereal industry almost $5 billion annually. In recent years, FHB has proved a significant and growing problem for the commercially important wheat and barley crops in Western Canada.
  • Fusarium oxysporum and Fusarium avenaceum have been identified as the two species primarily associated with FHB in Canada wherein yields in some affected fields have been reduced by 30% or more.
  • FHB and ear rot harvested grain is often contaminated with mycotoxins such as deoxinivalenol (DON) trichothecenes associated with feed refusal, general digestive disorders, diarrhea, hemorrhages.
  • DON deoxinivalenol
  • 3 -ADON toxigenic 3-acetyldeoxynivalenol
  • graminearum under both laboratory and field conditions-represents an additional threat for corn, maize and wheat production worldwide.
  • Fusarium spp. can opportunistically infect animals and can be the causative agents of superficial and/or systemic infections in humans. Fusaria are one of the most drug-resistant fungi making Fusaria infections difficult to treat and invasive infections can prove fatal.
  • the present invention relates to a novel ascomyceteous fungus, Sphaerodes mycoparasitia identified as strain IDAC 301008-01 and alternatively as strain SMCD2220-01, that has a mycoparasitic and antimycotoxin effect.
  • mycotoxic proteins have been isolated from S. mycoparasitia strain IDAC 301008-01. Uses, methods, compositions, sequences, and products are also disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS
  • Figure 1 is a micrograph showing Sphaerodes mycoparasitica cultures after two weeks of incubation on (A) Modified Leonian's agar and (B) Potato dextrose agar-upper sides, (C) and (D) - down sides;
  • Figure 2 is a micrograph showing Sphaerodes mycoparasitica ascospore germination, showing single-polar and double-polar germination patterns as well as hyphal anastomosis (arrow) formation pattern;
  • Figure 3 is a micrograph showing Sphaerodes mycoparasitica: (A) Ascoma, (B) Hyaline seta arising from the neck (arrow), (C) Reticulate ascospores (arrows), (D) Smooth ascospore (arrow), (E) Triangular ascospore (arrow), (F) Phialides produced on ascoma surrounding hyphae, (G) Ampulliform phialide arising from the surface of ascoma peridial wall, (H) Formation of mature and starting ascomata, (I) Formation of hook-like structures by S.
  • Figure 4 is a micrograph showing Sphaerodes mycoparasitica ascospores showing the conspicuous wall ornamentation and prominent irregular longitudinal ribs (arrows); (B) shows Sphaerodes quadrangular is ascospores. Bar scales 5 pm;
  • Figure 5(a) is a micrograph showing inhibition of mycelial growth of (A) Fusarium oxysporum and (B) Fusarium graminearum by extracellular proteins recovered from a Sphaerodes mycoparasitica culture; 5(b) is a chart showing the percent inhibition of mycelial growth of A) Fusarium oxysporum and (B) Fusarium graminearum by S. mycoparasitica extracellular proteins;
  • Figure 6 is a FPLC chromatogram showing the fl and f2 extracellular proteins recovered from a Sphaerodes mycoparasitica culture
  • FIG. 7 is micrograph of SDS-PAGE gels of purified extracellular proteins recovered from a Sphaerodes mycoparasitica culture.
  • Lane M contains marker proteins.
  • Lane 1 contains the purified protein from peak fl .
  • Lane 2 contains the purified protein from peak f2;
  • Figure 8 are micrographs showing the inhibition of F. oxysporum spore germination (A- a-b) and F. graminearum spore germination (B- 1-b) by purified proteins fl and £2 compared to controls (A-c and B-c);
  • Figure 9 is a chart showing the level of 3-ADON degradation by Sphaerodes mycoparasitica in potato-dextrose broth analysed by HPLC;
  • Figure 10 is a schematic illustration of a system for growing wheat plants in a container (4 x 4 x 16 cm) with different layers of soil-less growing mixes;
  • Figure 12 are charts showing standard linear curves for (A) Sphaerodes mycoparasitica (in the range of 3.8 x 10 2 to 3.8 x 10 '2 ng in ten-hold decreasing manner); (B) Fusarium graminearum 3-ADCIN (in the range of 2.7 x 10 3 to 2.7 x 10 " ' ng in ten-hold decreasing manner); (C) Trichoderma harzianum T-22 (in the range of 7.0 x 10 2 to 7.0 x 10 "2 ng in ten-hold increasing manner);
  • Figure 13 is a chart showing RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, in the ranges of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner;
  • Figure 14 are charts showing quantities of genomic DNAs for (A) F. graminearum (Fgra); (b) S. mycoparasitica (SM); and (C) Trichoderma harzanium (T-22) monitored in spring wheat roots using genus-specific quantification real-time PCR. All values were means of 6 replicates. Error bars indicate SD;
  • Figure 15 is a chart showing real-time fluorescence curves of tri5 gene sequences amplified by using Tox5- 1/2 primer set from total DNA extracted from dual-culture assays of Fusarium graminearum strains and pre-inoculated Sphaerodes mycoparasitica SMCD2220-01 (SNI) or singly grown F. graminearum 3-ADON and 15-ADON chemotypes;
  • Figure 16 are micrographs of Sphaerodes mycoparasitica ascomata and ascospores: (A) formation of S. mycoparasitica ascomata on a colony of F. avenaceum (Arrows indicate that ascomata were produced near or surrounding the Fusarium culture); (B) production of numerous S. mycoparasitica ostiolated perithecia being produced on a F. oxysporum colony (Arrows indicate pericthecia were formed on the Fusarium isolate); (C) ungerminated dark-brownish reticulated S. mycoparasitica ascospore; (D) germinating ascospore of S. mycoparasitica in F.
  • Figure 17 is a chart showing spore germination patterns of Sphaerodes mycoparasitica biotrophic mycoparasitic fungus with spores isolated from a F. oxysporum colony. Single ( ⁇ ) and two ( ⁇ ) polar germination in a F. avenaceum-f ⁇ trate suspension; and Single ( ⁇ ) and two (E) polar germination in a F. oxysporum-f ⁇ trate suspension.
  • I Id suspension
  • 2 Id suspension plus Id on PDA incubation
  • 3 3d suspension
  • 4 3d suspension plus Id on PDA incubation. Each incubation day for S.
  • Id suspension spores suspended for Id in different suspension treatments
  • Id sus+PDA spores suspended for Id in suspension treatment and then inoculated onto PDA medium for an additional day
  • 3d suspension spores suspended for 3d in different suspension treatments
  • 3d sus+PDA spores suspended for 3d in suspension treatment and then inoculated onto PDA medium for an additional day
  • Figure 19 are charts showing linear mycelial growths of (A) Fusarium graminearum chemotype 3, and (B) Fusarium graminearum chemotype 15 in dual-culture assays challenged with Sphaerodes mycoparasitica in co-inoculation (same day) (""*"") and pre-inoculation (1 day prior to Fusarium inoculation) ( ⁇ • ⁇ » ⁇ ) treatments as well as control (without mycoparasite) ( ⁇ ) for 5 days;
  • Figure 20 are micrographs of interactions between F. graminearum 3-ADON (Fgra3) and 15-ADON (Fgral5) chemotypes on slide culture assays with S. mycoparasitica (S) biotrophic mycoparasitic fungus: (A) Single mycelium of S. mycoparasitica, (B) F. graminearum mycelium with red complex, (C) Absorption of red complex from F. graminearum by S. mycoparasitica (arrow), (D) Excretion of red complex in crystal-forms (arrows) by S. mycoparasitica from mycelium interacting with F. graminearum chemotype 3 only, (E) Formation of series of hook- like structures by S.
  • Figure 22 are charts of the standard curves of Fusarium graminearum chemotype 3 and 15 genomic DNA concentration standards versus cycle threshold (Ct) with PCR reactions performed in triplicate using primer sets;
  • FIG 23 is a schematic illustration of the experimental set-up for dual-culture assays used to acquire F. graminearum chemotype 3-ADON or 15-ADON mycelial plugs for DNAs extraction.
  • the sampling zone (S-zone) indicates the 0.5 x 1.5 cm 2 sample area situated approximately 0.2 cm behind the interaction zone (I-zone).
  • the I-zone represents the interaction or contact zone between F. graminearum (Fgra) and S. mycoparasitica (SM);
  • Figure 24 is a chart showing real-time fluorescence curves of F. graminearum sequences amplified using Fgl6NF/R primer set from total DNA extracted from dual-culture assays of F. graminearum strains and pre-inoculated Sphaerodes mycoparasitica (SM), or singly grown F. graminearum cultures of chemotype 3 and 15;
  • SM Sphaerodes mycoparasitica
  • Figure 25 is a chart showing comparisons between different concentrations of DNA from F. graminearum chemotype 3 and 15 amplified with Tox5-l/2 (tri5 gene specific) and Fgl6NF/R (F. graminearum-speci ⁇ c) primer sets.
  • Fungal DNAs were extracted from 5 d dual-culture assays pre-inoculated with S. mycoparasitica for 1 d. With T-test at P - 0.05, for the comparison between S. mycoparasitica treated and non-treated F. graminearum chemotype 3 and 15 for Tox5-l/2 and Fgl6NF/R primer sets, respectively. (Log 10 transformed for DNA amplified with Tox5-l/2 primers);
  • FIG 27 are charts showing gene expression of different Tri genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) T ⁇ 4 gene; (B) Tri5 gene; (C) Tri6 gene; and (D) Tri 10 gene.
  • B3 S. mycoparasitica + 3-ADON producing F. graminearum
  • F3 Folicur + 3-ADON producing F. graminearum
  • T3 T. harzianum + 3-ADON producing F. graminearum
  • Bl 5 S. mycoparasitica + 15-ADON producing F.
  • Figure 28 are charts showing gene expression of PKS genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) PKS4 and (B) PKSB.
  • B3 S. mycoparasitica + 3-ADON producing F. graminearum
  • F3 Folicur + 3-ADON producing F. graminearum
  • T3 T. harzianum + 3-ADON producing F. graminearum
  • Bl 5 S. mycoparasitica + 15-ADON producing F. graminearum
  • Fl 5 Folicur + 15-ADON producing F.
  • Tl 5 T. harzianum + 15-ADON producing F. graminearum.
  • Figure 29 is a micrograph of thin liquid chromatography (TLC) analysis for zearalenone (ZEA) extracted from six separate treatments.
  • B3 S. mycoparasitica + 3-ADON producing F. graminearum
  • F3 Folicur + 3-ADON producing F. graminearum
  • T3 T. harzianum + 3 -ADON producing F. graminearum
  • Fl 5 Folicur + 15-ADON producing F. graminearum
  • Tl 5 T. harzianum + 15-ADON producing F. graminearum
  • Bl 5 S. mycoparasitica + 15-ADON producing F. graminearum
  • ZEA Standard of zearalenone;
  • Figure 30 is a chart showing the ratio of F. graminearum chemotype challenged with Folicur fungicide to F. graminearum alone control produced for all four different mycotoxins - ZEA, DON, 3 ADON and 15 ADON. Legends indicate F. graminearum 3-ADON chemotype with Folicur ( ⁇ ) and F. graminearum 15-ADON chemotype with Folicur (D);
  • Figure 31 is a chart showing relative AUR gene expression in Fusarium strains after co- culturing with biological and chemical agents.
  • Figure 32 is a chart showing changes in AUR gene expression evidenced by the color of fungal hyphae.
  • Ds #71232B Red and highly virulent, tolerant at 80 0 C for 4 hours
  • Es #4E040B Moderately red and moderately virulent, tolerant 40 0 C for 4 hours
  • Bs #A86608 White and non virulent, susceptible 40 0 C for 4 hours;
  • Figure 33 are charts showing the effects of inoculating a Fr ⁇ wr ⁇ -susceptible barley cultivar with F. graminearum, S. mycoparasitica, and treating F. graminearum-infected barley with different concentrations of S. mycoparasitica on: (A) height of the plants; (b) average number of spikes per plant; and (C) the average weight of 5 spikes;
  • Figure 34 are charts showing the effects of inoculating a Fusarium-susceptible wheat cultivar with F. graminearum, S. mycoparasitica, and treating F. gr amine arum-infected wheat with different concentrations of S. mycoparasitica on: (A) height of the plants; (B) average number of spikes per plant; and (C) the average weight of 5 spikes;
  • Figure 35 is a chart comparing the biocontrol effects of S. mycoparasitica on the severity of Fusarium head blight symptoms with the protection provided by a commercial fungicide
  • Figure 37 is a chart showing the effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR. Treatments were: Fus - F. graminearum; B-Fus - S. mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum;
  • Figures 4OA and 4OB are micrographs of intracellular parasitism by Sphaerodes inside F. equiseti (arrows), and 4OC and 4OD are micrographs of intracellular hyphae produced by Sphaerodes inside F. equiseti with hook-shaped contact structure (arrows).
  • 4OA and 4OB were captured under light microscopy; whereas in 4OC and 4OD hyphae were stained with lactofuchsin and images were captured under fluorescent and confocal laser microscopy, respectively.
  • Scale bars 5 ⁇ m; and
  • Figure 41 is a chart showing average hyphal diameters of parasitized and non-parasitized F. equiseti cells ( ⁇ ) and F.
  • Sphaerodes mycoparasitica (Ascomycetes, Melanosporales), has been isolated from isolates of Fusarium avenaceum, Fusarium graminearum and Fusarium oxysporum originating from wheat or asparagus fields.
  • the species is characterized by a unique combination of ascospore size, shape (fusiform and triangular) and wall ornamentation (reticulate and smooth).
  • conidia are produced from simple phialides on the surface of ascoma peridial wall, on ascoma surrounding hyphae, and on irregularly branched conidiophores arising from hyphae. S.
  • mycoparasitica has a phialidic anamorph and produces simple phialides on the surface of ascoma peridial wall or scattered irregularly on ascoma surrounding the hyphae, and on conidiosphores. S. mycoparasitica forms hook-like structures parasitizing living hyphae of Fusarium.
  • the 1266bp DNA sequence from the large subunit ribosomal RNA gene (LSU) of S. mycoparasitica is given in SEQ ID NO: 1.
  • SSU small subunit ribosomal RNA gene
  • Sphaerodes mycoparasitica may be useful as an anti-fungal agent.
  • S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi.
  • S. mycoparasitica seems particularly useful for treating, ameliorating or otherwise control infections of Fusarium avenaceum, Fusarium graminearum, and/or Fusarium oxysporum and improving plant health or growth.
  • S. mycoparasitica may be used as a prophylactic agent to diminish the chance of a fungal infection, particularly a Fusarium infection, from occurring.
  • S. mycoparasitica may be used for treating plants affected by Fusarium Wilt Disease or Fusarium Head Blight. S. mycoparasitica may be used for hindering such conditions from spreading or as a prophylactic measure to diminish the risk of such conditions from occurring.
  • S. mycoparasitica may be isolated from suitable sources.
  • S. mycoparasitica may be isolated from F. graminearum or F. avenaceum isolates originating from wheat fields by the method described in Vujanovic V, et. al. Can. J. Microbiol. 48(9): 841-847 (2002).
  • S. mycoparasitica is also available deposited with International Depositary Authority of Canada (IDAC301008-01).
  • S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi.
  • S. mycoparasitica may be applied in any suitable manner to the organism in need of treatment.
  • S. mycoparasitica isolates may be used directly or they may be further processed into soil-applied granular-based, peat-based, seed-applied, or anthesis-applied liquid-based inoculants.
  • S. mycoparasitica may be produced via fermentation and formulated into a pesticide composition.
  • a suitable fermentation process includes, selection of fermentation medium (solid state or submerged), concentration of fermentation constituents, oxygen transfer, incubation temperature, time of harvest and post harvest treatments. The aim is to establish the optimum conditions to ensure an abundant, stable, and efficacious mycoparasitic, microbial population.
  • S. mycoparasitica When formulating S. mycoparasitica into a pesticide composition, care should be taken to selected ingredients that: (i) ensure stability during production, processing and storage, (ii) assist application, (iii) protect the pesticide from unfavourable environmental conditions, and (iv) promote pesticidal activity at the target. Exposure to inactivated host/pathogen or its compounds may improve the activity of S. mycoparasitica.
  • the formulations disclosed herein will usually comprise (i) an active ingredient, (ii) carriers - often an inert material used to support and deliver the densely populated active ingredient to the target, and optionally (iii) adjuvants - compounds that: promote and sustain the function of the active ingredient by protection from UV radiation, that ensure rain fastness on the target, and that retain moisture or protect against desiccation, or promote the spread and dispersal of the biopesticide using standard agriculture equipments such as those disclosed by Hynes and Boyetchko (2006, Soil Biology & Biochemistry 38: 845-84).
  • the present invention provides a primer set, SmyITSF/R (SmylTSF is SEQ ID NO: 4 and SmyITSR is SEQ ID NO: 5), useful for identifying S. mycoparasitica.:
  • the present primer is selective for S. mycoparasitica and can be used to assess and quantify the fungus in industrial products, plant materials, seed samples, and environmental samples by using PCR and RT-PCR technologies.
  • the SmyITSF/R primer set can be used for quantitative real-time PCR technology for analyzing gene expression, in fungal pathogens detection, and in quantification of fungi in living plants.
  • the SmyITSF/R primer set was tested with SMCD2220-01, seven Fusarium species, nine different ascomycetous fungal isolates, two zygomycete fungi, and three basidiomycetous fungal strains.
  • this primer set only amplified SMCD2220-01, not the other fungi. Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica, as compared to inoculation with F. graminearum.
  • SmyITSF/R specific primer was used for S. mycoparasitica in combination with F. graminearum-Fgl2NF/R and Trichoderma-TGP4-F/R as a control, within which the primer showed high accuracy in assessing biocontrol-pathogen-plant interactions.
  • the present invention provides an antifungal agent comprising extracellular protein extracts from S. mycoparasitica. Two proteins were isolated from the total protein extract, one having a molecular weight of 13 kDa and one having a molecular weight of 50 kDa. The present invention provides an antifungal agent comprising one or both of these proteins. Conventional molecular biological techniques may be used to isolate, characterize and produce the present proteins. For example, in order to identify the gene(s) for the present proteins, S. mycoparasitica could be challenged with F. oxysporum filtrates and upregulated mRNA isolated by standard Northern Blot. cDNA can be produced from the mRNA by Reverse Transcriptase PCR (RT-PCR). The cDNA can be amplified, purified and inserted into an appropriate vector. This vector may be inserted into an appropriate host cell.
  • RT-PCR Reverse Transcriptase PCR
  • Cloning and expression may focus on isolation of genes coding for antimicrobial proteins by designing primers for identified proteins. Isolated genes may be cloned in suitable expression vectors (yeast or bacteria) with suitable/efficient promoters in order to generate industrial strains for large-scale production of the concerned proteins. These vectors can be purchased from Promega, Invitrogen, Clontech, or other companies. The cloned genes may be tested for their protein expression, and the expressed proteins will be purified (using His-tag or other columns).
  • Purified proteins may be tested against plant-pathogenic fungi for their antifungal activity by disc-plate assay and/or microtitre plate assay methods (e.g., Drummond and Waigh, 2000, Recent Research Developments in Phytochemistry.4:143-152). Then, rDNA technologies, involving gene mutation or addition of enhancers, introns or protein-specific promoters (GA inducible), or addition deletion may be used to enhance the production of proteins.
  • disc-plate assay and/or microtitre plate assay methods e.g., Drummond and Waigh, 2000, Recent Research Developments in Phytochemistry.4:143-152).
  • rDNA technologies involving gene mutation or addition of enhancers, introns or protein-specific promoters (GA inducible), or addition deletion may be used to enhance the production of proteins.
  • Selected genes may be transformed into wheat and barley to create a transgenic lines with antifungal activity against pathogenic fungi using techniques known to those skilled in these arts (e.g., Sanghyun et.al., 200,8 J. Expt. Botany, 59, 2371-2378; Dennis et. al., 2007. Plant Cell Reports. 26: 631-639).
  • S. mycoparasitica has demonstrated an ability to degrade the deoxynivalenol (DON) mycotoxin.
  • the present invention provides a method of degrading acetyldeoxynivalenol, especially 3-acetyldeoxynivalenol.
  • S. mycoparasitica could be challenged with pure DON and upregulated mRNA isolated by standard Northern Blot. Reverse Transcriptase PCR could be used to identify the gene(s) for the upregulated proteins, an appropriate cDNA construct could then be inserted into an appropriate vector for protein production. Further, recombinant DNA Technology could be applied to create transgenetic plants with antimycotoxin properties.
  • the present invention provides antifungal compositions comprising S. mycoparasitica, isolates, cultures, or proteins thereof.
  • the present invention also provides a method of controlling a fungal disease of a plant, and a method for mycotoxin detoxification, which methods comprise applying to the locus of the plant S. mycoparasitica, isolates, cultures, or proteins thereof, collectively hereinafter referred to as the 'antifungal agent'.
  • compositions of the invention may, for example, be applied to the seeds of the plants, to the growth medium (e.g. soil or water), or to the foliage of the plants.
  • the growth medium e.g. soil or water
  • the present invention provides a composition comprising the antifungal agent and an agriculturally acceptable carrier or diluent, which will ensure stability and performance of the final product.
  • Carrier or diluent should compatible with the active ingredient, agriculturally acceptable, have a good absorptive capacity and a suitable bulk density, allowing easy particle dispersion and attachment.
  • compositions herein may be applied, as in aqueous sprays, granules and dust formulations in accordance with established practice in the art.
  • An aqueous spray is usually prepared by mixing a wettable powder or emulsifiable concentrate formulation of a compound of the invention with a relatively large amount of water to form a dispersion.
  • Wettable powders may comprise a finely divided mixture of the antifungal agent, a solid carrier, and a surface-active agent.
  • the solid carrier is usually chosen from among attapulgite clays, kaolin clays, montmorillonite clays, diatomaceous earths, finely divided silica, purified silicates, or combinations thereof.
  • Surfactants which may be useful herein have wetting, penetrating, and/or dispersing ability. They are typically present in an amount of from about 0.5% to about 10% by weight.
  • Surfactants herein may be chosen from, for example, alkylbenzenesulfonates, alkyl sulfates, naphthalenesulfonates and condensed naphthalenesulfonates, sulfonated lignins, and non-ionic surfactants.
  • Emulsifiable concentrates may comprise the antifungal agent of the invention in a liquid carrier, the carrier being a mixture of a water-immiscible solvent and a surfactant.
  • Solvents that may be useful herein include aromatic hydrocarbon solvents such as the xylenes, alkylnaphthalenes, petroleum distillates, terpene solvents, ether-alcohols, organic ester solvents or suitable combinations thereof.
  • compositions of the invention When a composition of the invention is to be applied to plant debris or litter, in order to control of the source of contamination and inoculant dispersion, or to the soil, as for pre-emergence protection, granular formulations or dusts are sometimes more convenient than sprays.
  • the antifungal agents herein are encapsulated into alginate pellets.
  • the pellets may be prepared in any suitable manner. For example, one useful method is described in Harveson et. al., (2002, Plant Disease; Vol. 86, No. 9 1025-1030).
  • compositions herein may comprise other active substances useful in an antifungal agent.
  • the compositions herein may comprise other antifungal agents such as Trichoderma, sulfur, neem oil, rosemary oil, jojoba oil, Bacillus subtilis, allylamines (e.g. terbinafine, antimetabolites (e.g. flucytosine), azoles (e.g. ketoconazole, itraconazole), echinocandins (e.g. caspofungin), polyenes (e.g. amphotericin B), systemic agents (e.g. griseofluvin), or combinations thereof.
  • antifungal agents such as Trichoderma, sulfur, neem oil, rosemary oil, jojoba oil, Bacillus subtilis, allylamines (e.g. terbinafine, antimetabolites (e.g. flucytosine), azoles (e.g. ketoconazole, itraconazole), echinocandins (e.
  • compositions herein may contain from about 0.1% to about 95%, by weight, of the antifungal agent and from about 0.1% to about 95%, by weight, of the carrier and/or surfactant.
  • the direct application to plant seeds prior to planting may be accomplished in some instances by mixing either a powdered solid compound of the invention or a dust formulation with seed to obtain a substantially uniform coating which is very thin and represents only one or two percent by weight or less, based on the weight of the seed.
  • a non-phytotoxic solvent such as methanol is conveniently employed as a carrier to facilitate the uniform distribution of the compound of the invention on the surface of the seed.
  • compositions herein may be useful in the treatment of fungal infections in plants. Consequently, the compositions herein may comprise S. mycoparasitica, isolates, cultures, or proteins thereof and a pharmaceutically acceptable carrier.
  • Significant improvement in percentage of spore germinations were obtained for the spores suspended in Fus ⁇ rium-f ⁇ trates.
  • Trichoderm ⁇ h ⁇ rzi ⁇ num (RootShield ® available from BioWorks Inc., Victor, NY, USA; RootShield is a registered trademark of BioWorks Inc.), Penicillium bil ⁇ ii (JumpStart ® available from Novozymes Biologicals Ltd., Saskatoon, SK, CA; JumpStart is a registered trademark of Philom Bios Inc.), and Ch ⁇ etomium globosum had no impact on germination. Ascospores suspended in F. ⁇ ven ⁇ ceum-f ⁇ tratQ, showed double-polar germination pattern. On the other hand, when suspended in F.
  • the present invention provides a method of sporulating S. mycop ⁇ r ⁇ sitic ⁇ by exposing them to F. ⁇ ven ⁇ ceum or F. oxysporum, or filtrates, extracts, or compositions thereof.
  • the present invention provides a method for producing an antifungal composition comprising S. mycop ⁇ r ⁇ sitic ⁇ or isolates, cultures, genes or proteins thereof.
  • the method comprises:
  • the method may further comprise any of the following optional steps:
  • Myclobutanil-agar (MBA) medium was used for selective isolation of various Fusarium taxa and associated biotrophic mycoparasites from Canadian agriculture fields using the method described in Vujanovic V, et. al. (2002, Can. J. Microbiol. 48(9): 841-847). Sphaerodes was recovered occasionally from F. graminearum and abundantly from F. avenaceum isolates originating from wheat fields in Saskatchewan; it was also isolated from Fusarium oxysporum from asparagus fields in Quebec, Canada. A monosporal, single culture of the mycoparasite was obtained from each Fusarium species according to the method proposed by Harveson & Kimbrough (2001, Int. J Plant Sci. 162(2) :403 -410).
  • Biotrophic interactions between Sphaerodes and Fusarium strains were examined with the slide culture method proposed by Jordan & Barnett (1978, Mycologia 70(2):300-312). Morphological studies of ascomata, ascospores, mycelia, and anamorphic structures were performed after two weeks of incubation (21° C - 22° C) under a Carl Zeiss Axioskop2 with a Carl Zeiss AxioCam ICcI camera. Fungal materials for microscopic observation were mounted in lactofuchsin and lactophenol cotton blue dyes. DNA extraction, amplification and sequencing
  • SMCD 2220-01 on F. avenaceum from wheat SMCD 2220-02 on F. graminearum from wheat
  • SMCD 2220-03 on F. oxysporum from asparagus were cultured on PDA medium at 21 0 C for a week prior to DNA extraction.
  • Genomic DNA was extracted with the DNeasy ® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA; DNEasy is a registered trademark of Qiagen GmbH Corp, Hilden, Fed. Rep. Germany).
  • LSU large subunit rDNA fragments were amplified using primer sets NS1/NS6 using techniques known to those skilled in these arts (e.g., Gardes & Bruns, 1993, Molecular Ecology 2: 113-118; White et ah 1990, PCR Protocols: a guide to methods and application: 315-322. Academic Press, New York) and LS1/LR5 (e.g., Hausner et al. 1993, Canadian Journal of Botany 71 : 52-63; Rehner & Samuels, 1995, Canadian Journal of Botany 73 (Suppl. 1): S816-S823; Zhang & Blackwell, 2002, Mycological Research 106: 148-155).
  • LS1/LR5 e.g., Hausner et al. 1993, Canadian Journal of Botany 71 : 52-63; Rehner & Samuels, 1995, Canadian Journal of Botany 73 (Suppl. 1): S816-S823; Zhang & Blackwell, 2002, My
  • Target regions of fungal genomic DNA samples were amplified using polymerase chain reaction (PCR) in a 25 ⁇ l reaction mixture containing 2.5 ⁇ l of 1 OX buffer, 5 ⁇ l of Q buffer, 0.5 ⁇ l 1OmM dNTPs, l ⁇ l of each primer, 0.13 ⁇ l of 0.625 unit of Taq DNA Polymerase, 2 ⁇ l of extracted fungal DNA, and 12.87 ⁇ l of sterilized ultra-pure Millipore water.
  • the Qiagen Taq PCR core kits were purchased from Qiagen Inc., Mississauga, ON, CA. Purified DNA PCR products were sequenced.
  • Taxonomy Sphaerodes mycoparasitica Vujanovic, sp. nov. ( Figures 1-5) [MycoBank no: MB 515144], in the International Depositary Authority of Canada as Sphaerodes mycoparasitica strain IDAC 301008-01. Coloniae in agaro potato dextrosum lentior crescents, 4.0 cm ad 7d, floccose, pallido-brunneis. Hyphis septatis, ramosis, anastomosantibus, laevibus, palide fulvis, 2.5-5.0 ⁇ m diam compositum.
  • Peridium membranaceous 3-6-layered, 8-10 ⁇ m thick, translucent, pale yellow to light brown, composed by cells of 8-15 ⁇ m diam. disposed in textura angularis.. Asci 8-spored, clavate, 50-75 X 17-25 ⁇ m, rounded at apex, without apical structures, thin-walled and evanescent when mature. Paraphyses absent.
  • S 1 . mycoparasitica strain IDAC 301008-01 has a unique combination of features shown in Figure 3.
  • the ascomata height is generally less than 250 ⁇ m with a conical to cylindrical neck (Figure 3A).
  • the setae length is generally less than 40 ⁇ m ( Figure 3B) and the spore length is generally less than 23 ⁇ m ( Figure 3C).
  • the spores show a conspicuous wall ornamentation and prominent irregular longitudinal ribs indicated by the arrows in Figure 4A.
  • the spores of Sphaerodes quadrangular is shown in Figure 4B for comparison.
  • S. mycoparasitica strain IDAC 301008-01 spores occaisonally show a triangular shape ( Figures 3D and 3E).
  • S. mycoparasitica strain IDAC 301008-01 forms hook-like structures for parasitizing living hyphae of Fusarium ( Figures 31 and 3J).
  • Sphaerodes mycoparasitica (SMCD 2220-01) 21 0 C isolates were cultured in potato dextrose broth (PDB) culture media. About 3 ml of culture were transferred to 250 ml Ehrlenmeyer flasks containing 50 ml PDB growth medium. The flasks were incubated for 7 days on a rotary shaker (150 rpm) at room temperature.
  • PDB potato dextrose broth
  • Disc diffusion assay Antifungal activities of extracellular protein extracts were tested under sterile conditions by radial disc plate diffusion assay as described by Roberts & Selitrennikoff (1986, Biochim. Biophys. Acta, 880: 161-170). The assay of the isolated protein for antifungal activity toward F. oxysporum and F. graminearum was carried out in petri plates containing potato dextrose agar. Mycelial plugs from actively growing fungal plates were placed in the center of the petri plates and sterile filter paper discs (5-mm diameter of Whatman ® filter paper no. 1) were placed on the agar surface at a distance of 0.5 cm away from the rim of the mycelial colony.
  • FPLC Fast protein liquid chromatography
  • Proteins were fractionated through Superdex 75 GL 10/30 column using FPLC AKTA ® purifier system (GE Healthcare, Biosciences AB, CA: AKTA is a registered trademark of GE Healthcare Bio-Sciences AB Ltd., Uppsala, Sweden) according to the manufacturer's instructions.
  • the column was previously equilibrated with sterile water and with 50 niM sodium phosphate buffer, pH 7.0 containing 0.15 M NaCl, followed by protein injection (about 500 ⁇ L) and elution of proteins with the same buffer with flow rate of 1.0 ml/min. Fractions of 0.8 ml were collected in each tube.
  • SDS-PAGE SDS-PAGE (12%) of proteins recovered from FPLC fractions was performed according to the method of Laertunli (1970, Nature 227: 680-685). All peaks giving FPLC fractions were pooled and recovered by precipitation in 1 :4 volume of chilled acetone and kept at -20 0 C overnight. After centrifugation at 12,000 g for 10 min, precipitated proteins (pellets) were dissolved in minimum amount (30 ⁇ L) of assay buffer. Proteins were analyzed by SDS-PAGE having 5% stacking gel (pH 6.8) and
  • Microtitre plate assay Percentage inhibition of spore germination was performed by microtitre plate assay method (Ghosh, 2006, Ann. Bot. 98: 1145-1153; Yadav et al. 2007, J. Med. Microbiol. 56: 637-644) to test the antifungal activity of proteins recovered from FPLC fractions. The possible toxicity of the fractionated proteins was tested by a percentage growth inhibition assay using the F. oxysporum and F. graminearum. The in vitro antifungal activities of fractionated proteins were determined in 96- well microtiter plates.
  • microplate wells 10 ⁇ l of potato dextrose broth (PDB; BD Biosciences, Mississauga, ON, CA) was mixed with 3 ⁇ l of spore suspensions of F. oxysporum and F. graminearum. An aliquot of 7 ⁇ L of different peak containing proteins fractions were added to suspensions in microtitre plates (12-8 wells). Water 25 and buffer were used as negative controls. The microtitre plate was then incubated at room temperature in dark. Observations were made for inhibition in spore germination in both untreated and treated wells after 24 h using inverted and fluorescent microscope.
  • PDB potato dextrose broth
  • the number of germinated and non-germinated spores and percentage of area covered by mycelia in microscope were used to determine the percentage of growth inhibition.
  • the fl and f2 protein-containing peaks had inhibitory effects on spore germination after 24 hrs compared to the control treatment.
  • SMCD 2220-01 Active growing mycelia of S. mycoparasitica
  • PDA Potato 10 Dextrose Broth
  • Wet mycelium 0.1 g were resuspended in 1 ml of PDA medium supplemented 100 ⁇ g/mL 3-ADON (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) and incubated for 10 days.
  • a 0.2cm 2 plug S. mycoparasitica was incubated in ImI PDB containing 3-ADON at a 15 concentration of 100 ⁇ g at RT for 7 days. The sample was analysed for DON degradation by TLC and HPLC assays.
  • 3-ADON was extracted by the method disclosed by Vasavada and Hsieh (1987, Appl. Micro. Biotechnol. 26: 517-521).
  • the spent medium in sampled flasks was filtered through the Whatman ® filter paper avoiding the mycelia.
  • 3-ADON was extracted from the medium by three 10 ml volumes of ethyl acetate.
  • the mixture of the medium and solvent was vigorously shaken and allowed to stand for 5 min for separation of phases.
  • the organic phase was siphoned off and passed through sodium sulfate to remove residual water.
  • the solvent was allowed to evaporate at room temperature. The residue was redissolved in acetonitrile for analysis.
  • TLC Thin layer chromatography
  • a Water's HPLC with : 250 x 4.60 mm id Prodigy 5 ⁇ ODS (3) 10OA, 5 ⁇ micron Ci 8 column (Phenomenex Inc., Torrance, CA USA) and a photodiode-array (PDA) detector was used with a gradient solvent system (water-acetonitrile containing 0.005% (v/v) trifluoracetic acid). The PDA detector measured the UV spectrum (200-600 nm). Samples were dissolved in acetonitrile and 20 ⁇ l was loaded onto the column using an automatic injector.
  • the DON was eluted with solvent as a mobile phase at a rate of 1 ml min '1 3-ADON obtained from Sigma- Aldrich (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) was used as a standard. The results are shown in Figure 9. The sample with S. mycoparasitica contained a much reduced level of 3-ADON.
  • Potato dextrose agar PDA
  • Potato dextrose broth PB
  • Yeast extract MAA
  • Malt extract agar MEA
  • Agar Agar
  • Peptone purchased from BD Biosciences (Mississauga, ON, CA) .
  • Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich Canada Ltd. (Oakville, ON, CA) .
  • mycoparasitica mycoparasitic fungal isolate was separated from their F. oxysporum host, and monosporium cultures were achieved according to methods described by Harveson RM, Kimbrough JW, (2001, Int. J. Plant Sci. 162: 403-410) with few modifications. Mature perithecia were picked up, suspended, and shaked in 2-ml sterilized water blanks. The spores-suspension was then spread on PDA plates. After few minutes, with the assistance of a Carl Zeiss Stemi 1000 dissecting microscope, individual spores were removed and transferred to PDA supplemented with 100 ml/1 of Fusarium filtrate. All fungal isolates were maintained in the culture collection of the Saskatchewan Microbial Collection and Database, Canada (SMCD).
  • SMCD Saskatchewan Microbial Collection and Database, Canada
  • MLA Modified Leonian's Agar
  • Sphaerodes mycoparasitica strain SMCD 2220-01 was found to sporulate on or when inoculated together with Fusarium species, such as F. avenaceum and F. oxysporum. S. mycoparasitica was observed to produce approximately the same amount of ascomata on both F. oxysporum and F. avenaceum. S. mycoparasitica was not found to produce fruiting bodies on other Fusarium or fungal strains such as F. proliferatum, F. sporotrichioides, P. bilaai, T. harzianum, and C. globosum. In the contact zone between these biotrophic mycoparasites and Fusarium species, hook-shaped contact structures were formed. Effects of heat and cold treatments on Sphaerodes spore germination
  • Aqueous ascospore suspensions were heat-shocked at 6O 0 C and 65 °C for 20 min, and cold-treated at 4°C, -2O 0 C, and -70 0 C for 5 min and 20 min.
  • the heat- and cold-shocked spores were then transferred and inoculated onto WA and PDA for 1 day and 3 days. The readings of spore germination were checked daily. Spores not subjected to heat and cold treatments were used as control.
  • Aqueous spore suspensions were transferred and inoculated onto the surface of the following media:
  • Fusarium strains utilized were F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides. Ascospore-inoculated plates were then incubated at room temperature (23 0 C) for 3 days. Spore germination was examined daily.
  • aqueous spore suspensions were suspended in the filtrates of four separate pathogenic Fusarium and three beneficial fungal strains for 1 day and 3 day in the ratio of 1 :2 (1 part of aqueous spore suspension: 2 parts of fungal filtrate), and the filtrate-suspended spores were then transferred and inoculated onto PDA for additional 1 day. Control treatments were suspended with sterilized distilled water or PDB.
  • Germinated ascospores were counted and recorded as a percentage of the total ascospore number. The results are summarized in Table 2. Numbers in each column represented mean of ascospore germination (in %) ⁇ standard deviation. Each incubation day for Sphaerodes was analyzed separately. Means within each column of Sphaerodes for each filtrate-suspension treatment followed by the same letter are not significantly different at P ⁇ 0.05 after Mann- Whitney U test.
  • Fusa ⁇ um strains F. graminearum 3-ADON strain SMCD2243, biotrophic mycoparasite Sphaerodes mycoparasitica SMCD2220-01, and Trichoderma harzianum T-22 (RootShield-'cornmercial product) as a control strain with mycoparasitic properties were maintained on PDA amended with antibiotics. Taxon specific primers
  • Mycelial suspension was filtered through 2 layers of cheesecloth to remove the glassbeads and bigger mycelial clumps. The flow-through was then used as mycelial suspension stock (10°) for serial dilution. S-tock of mycelial suspension was further diluted into a series spanning from 10- 2 , 10- 3 , and 10- 4 . This dilution series were plated on PDA using the pour plate method. The number of CFU (colony forming units) was counted and recorded. Mycelial suspensions were adjusted with sterile water to about 10 '5 - 10 "6 CFU/mL for S. mycoparasitica and T. harzianum, and to about 10 "4 - 10 "5 CFU/mL for F. graminearum.
  • This layer 20 was then overlayed with a second layer 30 (Ig) of either Pro- Mix" mix amended and homogenized with ⁇ 5 to 6 x 10 4 CFU of F. graminearum mycelial suspension or alternatively with Pro-Mix ® mixwith water only.
  • the second layer 30 was followed by a third layer 40 (Ig) of either Sunshine ® peat moss (Sunshine is a registered trademark of Sun Gro Horticulture Canada Ltd., Seba Beach, AB, CA) supplemented and homogenized with ⁇ 5 to 6 x 10 5 CFU of S. mycoparasite or alternatively with T. harzianum mycelial suspension or alternatively with water only.
  • Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica compared to inoculation with F. graminearum alone (Table 3).
  • Table 3 Effects of SMCD2220-01 (SM) and F. graminearum 3-ADON (Fgra) inoculation treatments on root biomass (g), total biomass (g), root length (cm), total length (cm) and seed germination (%) of spring wheat plants
  • the mycoparasite S. mycoparasitica demonstrates both biomass stimulation and bioprotection or biocontrol.
  • the SmyITSF/R primer set was tested with S. mycoparasitica, seven Fusarium species, night different ascomycetous fungal isolates two zygomycete fungi, and three basidiomycetous fungal strains. This primer set only amplified S. mycoparasitica.
  • SM S. mycoparasitica
  • Fa F. avenaceum
  • Fo F. oxysporum
  • Fs F. sporotrichio
  • Figure 13 shows RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, showing the range of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner.
  • Potato dextrose agar (PDA), potato dextrose broth (PDB), yeast extract, malt extract agar (MEA), agar, and peptone were purchased from Difco (Becton Dickinson Diagnostics, Sparks, Maryland). Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich (Oakville, ON, CA) .
  • Fungal strains and growth conditions Four phytopathogenic Fusarium strains (F. avenaceum SMCD 2241, F. oxysporum SMCD 2242, F. proliferatum (Matsush.) Nirenberg SMCD 2244, and F. sporotrichioides Sherb SMCD 2243), three beneficial fungal inoculants: T. harzianum (RootShield ® ), P. bilaii ([JumpStart ® ), and Chaetomium globosum Kunze; and one mycoparasitic fungal strain, S.
  • mycoparasitica were maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study.
  • An isolate of the mycoparasitic fungus, S. mycoparasitica was separated from its F. oxysporum host on myclobutanil agar (MBA) selective medium as previously described and a monosporic culture was achieved by picking up mature perithecia which were then suspended and shaken in 2-mL sterile distilled water blanks to encourage release of ascospores. The ascospore-suspension was then spread on PDA plates.
  • Aqueous spore suspensions (10 ⁇ L) of S. mycoparasitica were transferred and inoculated onto the surface of the following media: 1.5% water agar (WA), PDA, MLA, MEA, Carnation leaf agar (CLA) (Tschanz et al. 1976), 1.5% water agar plus 100 mL/L of Fusarium filtrate, and PDA with 100 mL/L of the Fusarium filtrate. Fusarium filtrates were created using F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides.
  • S. mycoparasitica ascospore-inoculated plates were then incubated at room temperature (23 C) for 3 d, and spore germination was examined daily. All treatments were in three replicates and experiment was repeated twice.
  • PDA Potato dextrose agar
  • Id Sus Id Sus + Id PDA
  • 3d Sus 3d Sus + Id PDA
  • 3d Sus + Id PDA 1 day Fusarium-f ⁇ trate suspension
  • 1 day filtrate suspension 1 day filtrate suspension with an additional day incubation on PDA medium
  • 3 day suspension 3 day filtrate suspension with an additional day incubation on PDA, respectively.
  • No spore germination was observed in the treatments with P. bilaii and C. globosum fungal filtrates.
  • Sph ⁇ erodes ascospores showed the highest number of germinated ascospores in the F. ⁇ ven ⁇ ceum-f ⁇ trate suspension.
  • ascospore germination of S. mycoparasitica in F. avenaceum-f ⁇ trate was significantly higher (89.2%) than in other treatments.
  • the amount of spore germination was increased compared to control. There was no germination recorded for the 1 d suspension in the F. oxysporum-f ⁇ WratQ treatment.
  • Table 5 Percentage spore germination of Sphaerodes mycoparasitica ascospores suspended in different Fusarium and biocontrol fungi filtrates assesed throughout four chronosequences. Control treatments were suspended with sterilized distilled water
  • Spore germination assessments Microscopic assessments of ascospore germination were conducted after incubation for 1 d and 3 d (spore germination was counted on suspensions). Percentage of germinated spores was obtained by scoring the spores on a Petri dish while observing them through the 20Ox and 40Ox objectives of the Carl Zeiss Axioskop2 microscope and systematically choosing 50 spores, starting at the top right corner and continuing to count until 50. Each drop of the ascospore suspension on a growth medium plate was considered as a subunit, and there were three subunits or replicates per plate. The experiments were repeated twice.
  • Fusarium strains All phytopathogenic Fusarium strains: Fusarium graminearum 3- ADON (Fgra3) SMCD 2243, and 15-ADON (Fgral5) SMCD 2244 chemotypes, F. avenaceum (Fave) SMCD 2241, F. oxysporum (Foxy) SMCD 2242, F. proliferatum (Fpro) SMCD 2244, F.
  • sporotrichioides Fspo
  • Fspo sporotrichioides
  • mycoparasitic Sphaerodes mycoparasitica SMCD 2220 strain were retrieved from Saskatchewan Collection and Database (SMCD), maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study.
  • Dual-culture assays Dual-culture assays for examining the degree of hyphal reduction/inhibition or damage to F. graminearum chemotypes were assessed as disclosed in Goh and Vujanovic (2009, Mycologia DOI: 10.3852/69-171). S. mycoparasitica is slow-growing fungus as compared to F. graminearumus 3 and 15 strains. Therefore, S. mycoparasitica was pre- inoculated onto the PDA plates for I d, at 21 0 C in darkness, prior to inoculating Fusarium mycelial plugs. Linear mycelial growth of Fusarium strains for both treatments indicated above was measured and recorded daily for 5 days.
  • F. graminearum-specific (Fgl6NF/R) and trichothecene Tri5 gene-specific (Tox5-l/2) primer sets were used in this study.
  • Standard curves for F. graminearum- and Tri5 gene-primer sets were generated, based on threshold cycles (Ct), by using a series of 10-fold diluted genomic DNAs from F. graminearum (spanning from 2.7 x 10 2 to 2.7 x 10 "2 ng/ ⁇ l for F.
  • Real-time PCR quantification Real-time PCR amplifications on total genomic DNA extracted from the sampling zones (as described above) were performed using MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA). All the real-time PCR reactions were performed by utilizing the real-time PCR MJ white tubes (Bio-Rad Laboratories Inc., Mississauga, ON, CA) in a total volume of 25 ⁇ l.
  • the reaction mixture for all real-time PCR assays were: 12.5 ⁇ l of IQ Supermix (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 1 ⁇ l of each 10 ⁇ M forward/reverse primers (Invitrogen), 9.5 ⁇ l of sterilized UltraPure Millipore water, and 1 ⁇ l of DNA template.
  • Real-time PCR conditions for Fgl6NF/R primer set used were outlined in Nicholson et al. (1998, Physiol. MoI. Plant Pathol. 53: 17-37) with melting curve analysis at 60 to 95 0 C. Parameters for Tox5-l/2 primer set as described in Schnerr et al. (2001, Int. J. Food microbiol.
  • SMCD 2243 Two Fusarium graminearum 3- ADON (SMCD 2243) and 15- ADON (SMCD 2244) chemotypes, Trichoderma harzianum necrotrophic (SMCD 2166) and Sphaerodes mycoparasitica biotrophic (SMCD 2220) mycoparasites were obtained from the Saskatchewan Microbial Collection and Database (SMCD). All strains were maintained on Potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate; Sigma- Aldrich Canada Ltd., Oakville, ON, CA) prior to study initiation.
  • PDA Potato dextrose agar
  • Chemical fungicide control A concentration of 100 ⁇ mol/L tebuconazole was prepared from Folicur ® 432F (43.2% tebuconazole, Bayer CropScience Inc., Saskatoon, SK, CA; Folicur is a registered trademark of Bayer Aktiengesellschaft, Leverkusen, Fed. Rep. Germany). This fungicide preparation was used throughout the study.
  • Dual-culture assay was carried out between F. graminearum and Folicur ® (100 ⁇ mol/L tebuconazole) or biological (T harzianum or S. mycoparasitica) agents on Minimal medium as disclosed by Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179).
  • Inoculated dual-culture plates were incubated at room temperature (23C) in dark conditions for a week.
  • Mycelia of F. graminearum were harvested after a week of inoculation with either chemical or biological agents.
  • RNA from the samples were extracted using Aurum Total RNA mini kit and extracted RNA was treated with DNAse (Bio-Rad Laboratories Inc., Mississauga, ON, CA) according the manufacturer's recommendations. Samples were then stored at -70C till gene expression analysis.
  • TriIO gene was induced ( Figure 27D). Generally, all four Tri genes were repressed significantly when challenged with biotrophic mycoparasitic Sphaerodes mycoparasitica ( Figure 27A - 27D).
  • Real-time Reverse-transcription PCR was performed by using an IScript One-Step RT-PCR kit with SYBR Green on a MiniOpticon Cycler System (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instruction. Primer sets used for amplification and gene expression were summarized in Table 6.
  • Tri4-F TAAACGCCCGCGAAGTTCACA Jiao et al. 2008, FEMS Lett.
  • Tri4-R TGGTGATGGTTCGCTTCGAG 285: 212-219
  • Tr5F AGCGACTACAGGCTTCCCTC
  • Tr5R AA ACC ATCC AGTTCTCC ATCTG
  • TrilO-R CTGCGGCGAGTGAGTTTGACA
  • RT-PCR sample 25 ⁇ L contained 3 ⁇ L of RNA template, 8.85 ⁇ L of nucleae-free water, 12.5 ⁇ L of RT-PCR reaction mixture (2x), 0.5 ⁇ L of IScript RT enzyme mix (50x) (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 0.1 ⁇ L of 50 ⁇ M solutions of both forward and reverse targeted gene-specific primers (Invitrogen Corp., Carslbad, CA, USA).
  • Real-time PCR conditions were performed as outlined by manufacturer's recommendations: 50C for lOmin, 95C for 5min, followed by 40 cycles of denaturing at 95C for 10s and annealing at 55C for 30s, 95C for lmin and 55C for 1 min.
  • PCR reactions were checked for absence of any primer-dimer formation or non-specific PCR amplification by performing melting curve analysis. Contamination of RNA template with residual genomic DNA was eliminated because there was no amplification detected using reverse transcriptase free real-time RT-PCR reaction as template.
  • Tri genes were observed to be more sensitive in F. graminearum chemotype 3 when co- inoculated with Trichoderma necrotrophic mycoparasite, however, in F. graminearum chemotype 15, Tri genes appeared to be more responsive towards treatment with chemical fungicide ( Figures 27A-27D).
  • PKS4 gene for both F. graminearum chemotypes was monitored to be more sensitive towards treatments with Trichoderma necrotrophic mycoparasitic fungus compared to chemical and biotrophic mycoparasitic agents ( Figure 28A). However, PKS13 gene in F. graminearum chemotype 15 was found to demonstrate higher sensitivity towards chemical stimulus ( Figure 28B).
  • Mycotoxins extraction and analyses DON, ZEA, 3-ADON and 15-ADON mycotoxins were extracted from agar mycelial plugs (0.5cm 2 ) cut from the sampling zone located approximately 0.5 cm behind the contact zone between F. graminearum and S. mycoparasitica. The extraction was performed by three 10-ml volumes of ethyl acetate. The samples were sonicated on ice and shaken vigorously in ethyl acetate, and then they were allowed to stand for 5 min for separation of phases. The organic phase was siphoned off and passed through sodium sulfate to remove water. The solvent was allowed to evaporate at room temperature (23 °C) for 3 days.
  • TLC thin liquid chromatography
  • HPLC high performance liquid chromatography
  • the amount of DON produced was between 70 to 90 ug/L. Consequently, it was too low to be detected in TLC analysis.
  • ZEA was high enough to be analyzed with TLC and both F. graminearum chemotypes were observed to produce higher amounts of ZEA toxin under the treatment with Folicur ® compared to other treatments ( Figure 29).
  • HPLC ZEA was found to be reduced when challenged with Folicur ® compared to F. graminearum colony only (Figure 30).
  • DON and 3-ADON was detected to increase for both F. graminearum when inoculated together with Folicur ® ( Figure 30).
  • Folicur ® was monitored to trigger highest amount of 15- ADON under in vitro assay (Figure 30).
  • S. mycoparasitica biotrophic mycoparasite
  • T. harzianum neurotrophic mycoparasite
  • Fungi, media, and culture conditions Fungal strains were obtained from culture collections at University of Saskatchewan (Food and Bioproduct Sciences fungal collection). Strains of the following fungal species were used, plant pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum, , F. proliferation, F. oxysporum, F. arthrosporoides and mycoparasitic Spaeherodes mycoparasitica and Trichoderma harzianum. Fungi were maintained on potato dextrose agar for 2 wks at 21 0 C in darkness. Folicur was also used in this study.
  • F. avenaceum isolates color identification numbers (CIN) were generated with Hex Color Code Chart (http://wu ⁇ v.2crcatcawcbsite.com/build/hex-colors.html#cotorgenerator).
  • CINs are: Ds #71232B: Red and highly virulent, tolerant at 80 0 C for 4 hours; Es #4E040B: Moderately red and moderately virulent, tolerant 40 0 C for 4 hours; Bs #A86608: White and non virulent, susceptible 40 0 C for 4 hours.
  • Three 0.1 g mycelium samples from three replicates of each isolate was mixed and used for DNA extraction and RT-PCR analyses.
  • Auro RT SEQ ID NO: 32
  • Auro RTR SEQ ID NO: 33
  • SEQ ID NO: 33 ATGACRACTTCCCGTGGRCC
  • the specificity of this set of primers was tested by conventional PCR assay using genomic DNA from Fusarium and mycoparasites using the amplification reactions volumes indicated above.
  • the amplification protocol was 1 cycle of 120 s at 94 0 C, 35 cycles of 30 s at 94 0 C (denaturalization), 30 s at 56 0 C (annealing), 45 s at 72 0 C (extension), and 1 cycle of 10 min at
  • the pair of primers used to amplify the ⁇ -tubulin (tub) gene were FGtubf (SEQ ID NO: 34) and Fgtubr (SEQ ID NO: 35).
  • PCR efficiencies of the real time RT-PCR for both genes were checked by performing a 10-fold serial dilution of positive control template to generate a standard curve, and by plotting the Ct as a function of log [10] of template.
  • Presence of aurofusarin was tested and quantified by RT-PCR in pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15ADON), F. avenaceum, F. culmorum, Mycoparasite, F. proliferatum, F. oxysporum, F. arthrosporoides and mycoparasitic, Sphaerodes mycoparasitica and Trichoderma harzianum. Relative gene expression was studied when Fusarium isolates were co-cultured with Folicur ® , Sphaerodes and Trichoderma.
  • the designed RT-PCR primer set was checked for its specificity by conventional PCR on tested fungal species.
  • a single band 157 bp long was amplified in F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum but not in other strains.
  • One week old grown cultures tested for their aurofusarin relative gene expression and ⁇ -tublin gene was used as an internal control.
  • F. graminearum which produces 15ADON showed highest level gene expression followed by F ' .graminearum (3AD0N) and similar kind of expression results were observed with F. avenacum and F. culmorum.
  • Aurofusarin relative gene expression was quantified when each Fusarium species was co-cultured for a week with Sphaerodes, Trichoderma and Folicur R ( Figure 31).
  • S. mycoparasitica was most effective in reducing the aurofusarin relative gene expression followed by Trichoderma and Folicur ( Figure 31).
  • S. mycoparasitica was most affective on F. graminearum producing 15 ADON, but also efficiently reduced the expression level in F. culmorum and F. avenaceum and F. graminearum producing 3 ADON ( Figure 31).
  • Trichoderma was able to somewhat affect F. graminearum producing 15 ADON and F. culmorum, but showed no impact on F.
  • RNA isolation, reverse transcription and real time RT-PCR All the cultures were grown for a week under dark and used for expression studies. Fungal total RNA was isolated using the "Total Quick RNA Cells and Tissues" Kit (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instructions, and stored at -80 °C. DNAse I treatment to remove the chromosomal DNA contamination from the samples was performed using the "Deoxyribonuclease I, Amplification Grade" (Invitrogen Corp., Carlsbad, CA, USA).
  • First strand cDNA was synthesized using the "Iscript RNA PCR Reagent Kit” (Bio-Rad Laboratories Inc., Mississauga, ON, CA). Relative Quantification of aur gene expression was performed in a MiniOpticon Sequence Detection System using the SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Mississauga, ON, CA) and the primer pairs indicated above.
  • the PCR thermal cycling conditions for both genes were as follows: an initial step at 95 0 C for 10 min and 40 cycles at 95 °C for 15 s and at 60 °C for 1 min.
  • SYBR green PCR master mix 12.5 ⁇ l (Bio-Rad Laboratories Inc., Mississauga, ON, CA) was used as the reaction mixture, with the addition of 6.5 ⁇ l of sterile milli-Q water, 1.0 ⁇ l of each primer (5 ⁇ M), and 5 ⁇ l of template cDNA, in a final volume of 25 ⁇ l.
  • appropriate negative controls containing no template were subjected to the same procedure to exclude or detect any possible contamination or carryover.
  • Each sample (triplicate) was amplified twice in every experiment. The results were normalized using the all fungi cDNA amplifications run on the same plate.
  • the tub2 gene is an endogenous control that was used to normalize quantitation of mRNA target for differences in the amount of total cDNA added to each reaction.
  • Real Time RT-PCR analysis is based on the threshold cycle (CT), which is defined as the first amplification cycle at which the fluorescence signal is greater than the minimal detection level, indicating that PCR products become detectable.
  • CT threshold cycle
  • Relative quantitation was the analytical method used in this study. A comparison within a sample is made with the gene of interest (aur) to that of the endogenous control gene ⁇ tub!). Quantitation is relative to the control gene by subtracting the CT of the control gene (tub2) from the CT of the gene of interest (aur) ( ⁇ CT).
  • Each ⁇ CT value (corresponding to each sample) was subtracted by the calibrator value (FpMM ⁇ -lC) to obtain the corresponding ⁇ CT values.
  • ⁇ CT values were transformed to Iog2 (due to the doubling function of PCR) to generate the relative expression levels.
  • S. mycoparasitica SMCD 2220 and F. graminearum 3 -ADON chemotype SMCD 2243 were obtained from the Saskatchewan Microbial Collection and Database (SMCD). These fungal cultures were grown on potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) supplemented with antibiotics prior to the study. Mycelial suspensions of these fungal strains (10 4 for F. graminearum and 10 6 for both biotrophic mycoparasite and antagonistic fungus) were produced for greenhouse experiment, as follows.
  • F. graminearum 3 -ADON chemotype strain was inoculated in potato dextrose broth (PDA, BD Biosciences, Mississauga, ON, CA), incubated at room temperature (-21 0 C) in darkness using shaker (lOOrpm), for a week prior to harvesting the mycelia for greenhouse application.
  • Mycelia of F. graminearnm were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and these mycelia were adjusted to concentration of 10 4 CFU/mL.
  • S. mycoparasitica was inoculated in the best preferment yeast peptone dextrose (YPD) (yeast, 5g; peptone, 1Og; dextrose, 1Og per 1 L of sterile-double distilled water) broth, incubated at room temp in darkness, using shaker at 100 rpm for a week prior to harvesting the mycelia.
  • YPD yeast peptone dextrose
  • Mycelia of S. mycoparasitica were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and the mycelia were adjusted to concentration of 10 4 CFU/mL for greenhouse application.
  • wheat and barley spikes were sprayed with mycelial suspension of S. mycoparasitica at a concentration of 10 6 CFU/mL, antagonistic fungal isolate at a concentration of 10 6 CFU/mL, 65 ⁇ mol/L tebuconazole, or sterile distilled water.
  • the treatments were applied as outlined in Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179) with slight modifications.
  • plants were kept at room temperature and covered with sterile Whirl-Pak ® bags (Whirl-Pak is a registered trademark of Aristotle Corp., Stamford, CT, USA) for overnight to allow fungal growth prior to F. graminearum inoculation. Plants were then inoculated with mycelial suspension of F. graminearum at a concentration of 10 4 CFU/mL. Fusarium graminearum inoculum was sprayed on the spikes and covered with sterile Whirl-Pak ® bags for overnight. The inoculated plants were maintained for an additional 21 days prior to sampling.
  • Percentage of infected spikelets (IS) per spike, FHB index, FDK, and weight of 100 seeds were rated as outlined in Xue et al. (2009).
  • the FHB visual severity scale was determined according to the methods disclosed by Stack and McMullen (http://www.ag.ndsu.edu/pubs/plantsci/smgrains/pplO95w.htm).
  • FIG. 33 The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in barley are shown in Figure 33.
  • the data in Figures 33A, 33B, and 33C show that inoculation of a susceptible barley cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes.
  • inoculation of the barley cultivar with S. mycoparasitica did not affect growth and development.
  • Treatment of F. graminearum-infQctQd barley with S. mycoparasitica at an inoculation level of 10 6 CFU/mL prevented the onset of any Fusarium head blight symptoms.
  • FIG. 34 The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in wheat are shown in Figure 34.
  • the data in Figures 34A, 34B, and 34C show that inoculation of a susceptible wheat cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes.
  • inoculation of the wheat cultivar with S. mycoparasitica did not affect growth and development.
  • Treatment of F. graminearum-infected wheat with S. mycoparasitica at an inoculation level of 10 6 CFU/mL prevented the onset of any Fusarium head blight symptoms.
  • Real-time PCR quantification Total DNA was extracted from the wheat and barly spices with DNeasy ® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA). Extracted total DNAs from spikes of different treatments were employed in real-time PCR quantification. Two different primer sets and PCR conditions used in this study were described in Nicholson et al. (1998) for Fgl6NF/R primer set and Schnerr et al. (2001) for Tox5-l/2 primer set. Total DNA extracted from spring wheat and barley spikes harvested from greenhouse trials were carried out in a MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA).
  • FIG. 37 shows effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR.
  • Treatments were: Fus - F. graminearum; B-Fus - 5 * . mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum. All values obtained were the means of six replicates. Error bars indicate standard deviation of the mean.
  • Means of F. graminearum DNA with Tox 5 primer were log 10 transformed prior to LSD test. Both primer sets were analyzed separately. Values followed by the same letters within each primer set are not significantly different using LSD test at P ⁇ 0.05.
  • PDA potato dextrose agar

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Mycology (AREA)
  • Agronomy & Crop Science (AREA)
  • Environmental Sciences (AREA)
  • Plant Pathology (AREA)
  • Dentistry (AREA)
  • Pest Control & Pesticides (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • Botany (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to a novel ascomyceteous fungus, Sphaerodes mycoparasitia strain IDAC 301008-01, for controlling Fusarium plant pathogens, disease symptoms, and mycotoxins in planta and ex planta. Uses, methods, compositions, sequences, and products are also disclosed herein.

Description

FUSARIUM AND FUSARIUM MYCOTOXIN BIOCONTROL
FIELD QF THE INVENTION
The present invention relates to novel biocontrol agents, related compositions with mycocidal effect and uses thereof. In particular, the present agent has a mycocidal effect on fungi of the genus Fusarium. The present invention further relates to the isolated fungal inoculant, genes, proteins and/or organisms as well as uses, methods, compositions, involving the same.
BACKGROUND TO THE INVENTION
Fusarium is a filamentous fungus widely distributed on plants and in the soil. Certain Fusarium species are plant pathogens. For example, Fusarium oxysporum, causes Fusarium wilt disease in more than a hundred species of plants. It does so by colonizing the plant xylem which can result in blockage and breakdown. When this occurs symptoms such as leaf wilting and yellowing appear in the plant eventually leading to the plant's death. This condition was the primary cause of the decline and disappearance of the Gros Michel banana cultivar from markets around the world. Recently a new strain has begun attacking plants of the dominant Cavendish cultivar leading to fears that, in the absence of a solution, this cultivar will too disappear from world markets.
Fusarium root rot is a major cause of seedling mortality in forest nurseries and also causes reduced survival after outplanting during the first growing season. The disease is caused by several Fusarium species and is common in many parts of the world. The disease is a particular problem in Western Canada and the United States and also in the North Central and Southern States. In addition, Pine pitch canker - caused by the fungus Fusarium circinatum - is a serious disease of pine trees and a threat to the forest industry in particularly in the US and New Zealand. Radiata or Monterey pine is highly susceptible to the disease with mortality rates in mature trees reaching 80% in some areas of California.
Fusarium Head Blight (FHB), also known as 'ear blight' or 'scab', is a disease of wheat, barley, oats and other small cereal grains caused by Fusarium. Corn and maize can be affected by a similar condition known as 'ear rot'. The aforementioned condition can reduce the yield and grade of the crop, and can potentially contaminate the grain with mycotoxins. It is estimated that FHB costs the cereal industry almost $5 billion annually. In recent years, FHB has proved a significant and growing problem for the commercially important wheat and barley crops in Western Canada. In the past Fusarium oxysporum and Fusarium avenaceum have been identified as the two species primarily associated with FHB in Canada wherein yields in some affected fields have been reduced by 30% or more. FHB and ear rot harvested grain is often contaminated with mycotoxins such as deoxinivalenol (DON) trichothecenes associated with feed refusal, general digestive disorders, diarrhea, hemorrhages. The emergence of the toxigenic 3-acetyldeoxynivalenol (3 -ADON) Fusarium graminearum population in North America is a fairly recent phenomenon. It is replacing 15-ADON chemotype. Moreover, the mycotoxin profiles of F. culmorum - similar to F. graminearum under both laboratory and field conditions-represents an additional threat for corn, maize and wheat production worldwide. Currently, there are no effective control measures for FHB and associated mycotoxins. Additionally, there are also no resistant varieties of corn, wheat, barley, oats, or other small grain cereals. Fungicides can be effective but only temporarily suppress the disease.
In addition to being a common plant pathogen, Fusarium spp. can opportunistically infect animals and can be the causative agents of superficial and/or systemic infections in humans. Fusaria are one of the most drug-resistant fungi making Fusaria infections difficult to treat and invasive infections can prove fatal.
SUMMARY OF THE INVENTION
The present invention relates to a novel ascomyceteous fungus, Sphaerodes mycoparasitia identified as strain IDAC 301008-01 and alternatively as strain SMCD2220-01, that has a mycoparasitic and antimycotoxin effect. In addition, mycotoxic proteins have been isolated from S. mycoparasitia strain IDAC 301008-01. Uses, methods, compositions, sequences, and products are also disclosed herein. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is a micrograph showing Sphaerodes mycoparasitica cultures after two weeks of incubation on (A) Modified Leonian's agar and (B) Potato dextrose agar-upper sides, (C) and (D) - down sides;
Figure 2 is a micrograph showing Sphaerodes mycoparasitica ascospore germination, showing single-polar and double-polar germination patterns as well as hyphal anastomosis (arrow) formation pattern;
Figure 3 is a micrograph showing Sphaerodes mycoparasitica: (A) Ascoma, (B) Hyaline seta arising from the neck (arrow), (C) Reticulate ascospores (arrows), (D) Smooth ascospore (arrow), (E) Triangular ascospore (arrow), (F) Phialides produced on ascoma surrounding hyphae, (G) Ampulliform phialide arising from the surface of ascoma peridial wall, (H) Formation of mature and starting ascomata, (I) Formation of hook-like structures by S. mycoparasitica parasitising on living hypha of Fusarium oxysporum (arrows) and (J) Large view of hook-like structure on living hypha of F. avenaceum. Bar scales for (A) and (H) are 50 pm; for (B), (C), (D), (E), (F), (G) and (J) are 10 pm; for (I) 25 pm;
Figure 4 (A) is a micrograph showing Sphaerodes mycoparasitica ascospores showing the conspicuous wall ornamentation and prominent irregular longitudinal ribs (arrows); (B) shows Sphaerodes quadrangular is ascospores. Bar scales 5 pm;
Figure 5(a) is a micrograph showing inhibition of mycelial growth of (A) Fusarium oxysporum and (B) Fusarium graminearum by extracellular proteins recovered from a Sphaerodes mycoparasitica culture; 5(b) is a chart showing the percent inhibition of mycelial growth of A) Fusarium oxysporum and (B) Fusarium graminearum by S. mycoparasitica extracellular proteins;
Figure 6 is a FPLC chromatogram showing the fl and f2 extracellular proteins recovered from a Sphaerodes mycoparasitica culture;
- j - Figure 7 is micrograph of SDS-PAGE gels of purified extracellular proteins recovered from a Sphaerodes mycoparasitica culture. Lane M contains marker proteins. Lane 1 contains the purified protein from peak fl . Lane 2 contains the purified protein from peak f2;
Figure 8 are micrographs showing the inhibition of F. oxysporum spore germination (A- a-b) and F. graminearum spore germination (B- 1-b) by purified proteins fl and £2 compared to controls (A-c and B-c);
Figure 9 is a chart showing the level of 3-ADON degradation by Sphaerodes mycoparasitica in potato-dextrose broth analysed by HPLC;
Figure 10 is a schematic illustration of a system for growing wheat plants in a container (4 x 4 x 16 cm) with different layers of soil-less growing mixes;
Figure 11 is a micrograph of a gel showing SmyITSF/R primers amplified PCR products for S. mycoparasitica (SM), five Fusarium strains (Fa = F. avenaceum, Fo = F. oxysporum, Fs = F. sporotrichioides, Fg3 = F. graminearum chemotype 3, and FgI 5 = F. graminearum chemotype 15), two Trichoderma species (T22 = T. harzianum T22 and Tv = T viride), two Cladosporium species ACC = C. cladosporioides and CM = C. minourae), and Penicillium aurantiogriseurn (PA) were electrophoresed on 1% agarose gel at 100 V for 20 minutes. The size of the band is around 300 to 400 bp;
Figure 12 are charts showing standard linear curves for (A) Sphaerodes mycoparasitica (in the range of 3.8 x 102 to 3.8 x 10'2 ng in ten-hold decreasing manner); (B) Fusarium graminearum 3-ADCIN (in the range of 2.7 x 103 to 2.7 x 10"' ng in ten-hold decreasing manner); (C) Trichoderma harzianum T-22 (in the range of 7.0 x 102 to 7.0 x 10"2 ng in ten-hold increasing manner);
Figure 13 is a chart showing RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, in the ranges of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner;
Figure 14 are charts showing quantities of genomic DNAs for (A) F. graminearum (Fgra); (b) S. mycoparasitica (SM); and (C) Trichoderma harzanium (T-22) monitored in spring wheat roots using genus-specific quantification real-time PCR. All values were means of 6 replicates. Error bars indicate SD;
Figure 15 is a chart showing real-time fluorescence curves of tri5 gene sequences amplified by using Tox5- 1/2 primer set from total DNA extracted from dual-culture assays of Fusarium graminearum strains and pre-inoculated Sphaerodes mycoparasitica SMCD2220-01 (SNI) or singly grown F. graminearum 3-ADON and 15-ADON chemotypes;
Figure 16 are micrographs of Sphaerodes mycoparasitica ascomata and ascospores: (A) formation of S. mycoparasitica ascomata on a colony of F. avenaceum (Arrows indicate that ascomata were produced near or surrounding the Fusarium culture); (B) production of numerous S. mycoparasitica ostiolated perithecia being produced on a F. oxysporum colony (Arrows indicate pericthecia were formed on the Fusarium isolate); (C) ungerminated dark-brownish reticulated S. mycoparasitica ascospore; (D) germinating ascospore of S. mycoparasitica in F. oxysporum-fύtrate suspension showing one polar germ pore: (E) single polar germinating spore of S. mycoparasitica after 3d suspension in a F. oxysporum-fύtrate; (F) ascospore of S. mycoparasitica illustrating two polar germination in F. oxysporum-fύtrate suspension after 3d with an additional Id on PDA; (G) pattern of S. mycoparasitica two polar germination in F. avenaceum-fύtrate suspension with additional Id on PDA: (H) single polar germination in S. mycoparasitica spore suspended 3d in F. avenaceum-fύtrate with Id incubation on PDA; (I) single and double polar germinations demonstrated by S. mycoparasitica ascospores after 3d incubation in a F. avenaceum-fύtrate suspension plus 1 additional day incubation on PDA. Scale bars for (C) to (H) are lOμm and for (I) is 20μm. SM, Fa, and Fo represent S. mycoparasitica, F. avenaceum, and F. oxysporum, respectively;
Figure 17 is a chart showing spore germination patterns of Sphaerodes mycoparasitica biotrophic mycoparasitic fungus with spores isolated from a F. oxysporum colony. Single (■) and two (□) polar germination in a F. avenaceum-fύtrate suspension; and Single (ø) and two (E) polar germination in a F. oxysporum-fύtrate suspension. I = Id suspension, 2 = Id suspension plus Id on PDA incubation, 3 = 3d suspension, and 4 = 3d suspension plus Id on PDA incubation. Each incubation day for S. mycoparasitica was analyzed separately; Figure 18 is a chart showing germination of Sphaerodes mycoparasitica ascospores in filtrates of six Fusarium strains and water suspension treatments at four different incubation days. Suspension in different treatments were: Fave-filtrate = F. avenaceum-fύtrate; Foxy-filtrate = F. oxysporum-fύtrate; Fgra3 -filtrate = F. grαmineαrum chemotype 3 filtrate; Fgra 15 -filtrate = F. grαmineαrum chemotype 15 filtrate; Fpro-filtrate = F. proliferαtum filtrate; Fspo-filtrate = F. sporotrichioides filtrate; and water = control. Day of incubations were: Id suspension = spores suspended for Id in different suspension treatments; Id sus+PDA = spores suspended for Id in suspension treatment and then inoculated onto PDA medium for an additional day; 3d suspension = spores suspended for 3d in different suspension treatments; and 3d sus+PDA = spores suspended for 3d in suspension treatment and then inoculated onto PDA medium for an additional day;
Figure 19 are charts showing linear mycelial growths of (A) Fusarium graminearum chemotype 3, and (B) Fusarium graminearum chemotype 15 in dual-culture assays challenged with Sphaerodes mycoparasitica in co-inoculation (same day) (""*"") and pre-inoculation (1 day prior to Fusarium inoculation) (■•■») treatments as well as control (without mycoparasite) ( ♦ ) for 5 days;
Figure 20 are micrographs of interactions between F. graminearum 3-ADON (Fgra3) and 15-ADON (Fgral5) chemotypes on slide culture assays with S. mycoparasitica (S) biotrophic mycoparasitic fungus: (A) Single mycelium of S. mycoparasitica, (B) F. graminearum mycelium with red complex, (C) Absorption of red complex from F. graminearum by S. mycoparasitica (arrow), (D) Excretion of red complex in crystal-forms (arrows) by S. mycoparasitica from mycelium interacting with F. graminearum chemotype 3 only, (E) Formation of series of hook- like structures by S. mycoparasitica, (F) Parasitism of F. graminearum mycelium by S. mycoparasitica with formation of hook-shaped structures, excretion of crystal-like compounds (arrows), and internal haustorium, (G) Initiation of penetration-peg formation by S. mycoparasitica on F. graminearum, (H) Infected or penetrated and non-infected myclial cells, (I) Branching of haustorium inside Fusarium host, (J) Formation of extensive short branching structures by F. graminearum chemotype 15 only at the contact zone with S. mycoparasitica. Bar scales: (A) to (I) in 5μm, and (J) in 20μm; Figure 21 is a chart showing the differences in diameters between infected and non- infected F. graminearum chemotype 3 (Fgra3) and 15 (Fgral5) host cells in presence of Sphaerodes mycoparasitica on slide culture assays. Basr demarked by different lowercase letters represent significant difference in size of infected vs. non-infected hyphae for the two different F. graminearum chemotypes at P = 0.05 using a T-test;
Figure 22 are charts of the standard curves of Fusarium graminearum chemotype 3 and 15 genomic DNA concentration standards versus cycle threshold (Ct) with PCR reactions performed in triplicate using primer sets; (A) Tox5-l/2, with genomic DNA ranging from 270 ng (Logio = 2.90) to 0.27 ng (Logio = -0.60), readings at 0.005 fluorescence line; (B) Tox5-l/2, with genomic DNA ranging from 30 ng (Logio = 1.48) to 0.03 ng (Logio = -1.52), readings at 0.005 fluorescence line; and (C) Fgl6NF/R, with DNA template ranging from 270 ng (Logio = 2.43) to 0.027 ng (Logio = -1-57); in 10-fold dilution series, readings at 0.025 fluorescence line. Error bars indicate standard deviation for the mean of F. graminearum chemotype 3 and 15 standard curves derived from tri5 gene and F. graminearum specific primer set;
Figure 23 is a schematic illustration of the experimental set-up for dual-culture assays used to acquire F. graminearum chemotype 3-ADON or 15-ADON mycelial plugs for DNAs extraction. The sampling zone (S-zone) indicates the 0.5 x 1.5 cm2 sample area situated approximately 0.2 cm behind the interaction zone (I-zone). The I-zone represents the interaction or contact zone between F. graminearum (Fgra) and S. mycoparasitica (SM);
Figure 24 is a chart showing real-time fluorescence curves of F. graminearum sequences amplified using Fgl6NF/R primer set from total DNA extracted from dual-culture assays of F. graminearum strains and pre-inoculated Sphaerodes mycoparasitica (SM), or singly grown F. graminearum cultures of chemotype 3 and 15;
Figure 25 is a chart showing comparisons between different concentrations of DNA from F. graminearum chemotype 3 and 15 amplified with Tox5-l/2 (tri5 gene specific) and Fgl6NF/R (F. graminearum-speciήc) primer sets. Fungal DNAs were extracted from 5 d dual-culture assays pre-inoculated with S. mycoparasitica for 1 d. With T-test at P - 0.05, for the comparison between S. mycoparasitica treated and non-treated F. graminearum chemotype 3 and 15 for Tox5-l/2 and Fgl6NF/R primer sets, respectively. (Log 10 transformed for DNA amplified with Tox5-l/2 primers);
Figure 26 are micrographs of Fusarium graminearum mycelia at the contact zone with biological and chemical agents: (A) No visible cell changes with Sphaerodes mycoparasitica biotrophic mycoparasite; (B) Cell abruption with Tήchoderma harzianum necrotrophic mycoparasite; (C) 3-ADON chlamydospores formation in chains when challenged with fungicide; (D) 15-ADON chlamydospores formation in clusters when challenged with fungicide. Scale bars indicate: (A) = 5 μm and (B) - (D) = 10 μm;
Figure 27 are charts showing gene expression of different Tri genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) Tή4 gene; (B) Tri5 gene; (C) Tri6 gene; and (D) Tri 10 gene. Legends: B3 = S. mycoparasitica + 3-ADON producing F. graminearum; F3 = Folicur + 3-ADON producing F. graminearum; T3 = T. harzianum + 3-ADON producing F. graminearum; Bl 5 = S. mycoparasitica + 15-ADON producing F. graminearum; Fl 5 = Folicur + 15-ADON producing F. graminearum; and Tl 5 = T. harzianum + 15-ADON producing F. graminearum. Means for three different treatments in F. graminearum chemotype 3 and 15 were analyzed separately with LSD test at P = 0.05. Values are means ± SE of three samples;
Figure 28 are charts showing gene expression of PKS genes for F. graminearum chemotype 3 (3-ADON producer) and F. graminearum chemotype 15 (15-ADON producer) in in vitro assays with three separate treatments: (A) PKS4 and (B) PKSB. Legends: B3 = S. mycoparasitica + 3-ADON producing F. graminearum; F3 = Folicur + 3-ADON producing F. graminearum; T3 = T. harzianum + 3-ADON producing F. graminearum; Bl 5 = S. mycoparasitica + 15-ADON producing F. graminearum; Fl 5 = Folicur + 15-ADON producing F. graminearum; and Tl 5 = T. harzianum + 15-ADON producing F. graminearum. Means for three different treatments in F. graminearum chemotype 3 and 15 were analyzed separately with LSD test at P = 0.05. Values are means ± SE of three samples;
Figure 29 is a micrograph of thin liquid chromatography (TLC) analysis for zearalenone (ZEA) extracted from six separate treatments. Legends: B3 = S. mycoparasitica + 3-ADON producing F. graminearum; F3 = Folicur + 3-ADON producing F. graminearum; T3 = T. harzianum + 3 -ADON producing F. graminearum; Fl 5 = Folicur + 15-ADON producing F. graminearum; Tl 5 = T. harzianum + 15-ADON producing F. graminearum, Bl 5 = S. mycoparasitica + 15-ADON producing F. graminearum. and ZEA = Standard of zearalenone;
Figure 30 is a chart showing the ratio of F. graminearum chemotype challenged with Folicur fungicide to F. graminearum alone control produced for all four different mycotoxins - ZEA, DON, 3 ADON and 15 ADON. Legends indicate F. graminearum 3-ADON chemotype with Folicur (■) and F. graminearum 15-ADON chemotype with Folicur (D);
Figure 31 is a chart showing relative AUR gene expression in Fusarium strains after co- culturing with biological and chemical agents. Legend: 15 ADON - F. graminearum 15 -acetyl- deoxynivalenol chemotype; 3 ADON - F. graminearum 15-αce(y/-deoxynivalenol chemotype; F.cul. - F. culmorum; F.ave. - F. avenaceum ; B - Sphaerodes mycoparasitica (biotrophic mycoparasite); Tricho - Trichoderma harzianum (necrotrophic mycoparasite); FoI - Folicur (tebuconazole) fungicide;
Figure 32 is a chart showing changes in AUR gene expression evidenced by the color of fungal hyphae. Legend: Ds #71232B: Red and highly virulent, tolerant at 800C for 4 hours; Es #4E040B: Moderately red and moderately virulent, tolerant 400C for 4 hours; Bs #A86608: White and non virulent, susceptible 400C for 4 hours;
Figure 33 are charts showing the effects of inoculating a Frøαπwrø-susceptible barley cultivar with F. graminearum, S. mycoparasitica, and treating F. graminearum-infected barley with different concentrations of S. mycoparasitica on: (A) height of the plants; (b) average number of spikes per plant; and (C) the average weight of 5 spikes;
Figure 34 are charts showing the effects of inoculating a Fusarium-susceptible wheat cultivar with F. graminearum, S. mycoparasitica, and treating F. gr amine arum-infected wheat with different concentrations of S. mycoparasitica on: (A) height of the plants; (B) average number of spikes per plant; and (C) the average weight of 5 spikes;
Figure 35 is a chart comparing the biocontrol effects of S. mycoparasitica on the severity of Fusarium head blight symptoms with the protection provided by a commercial fungicide; Figure 36 are charts showing standard curves of Fusarium graminearum chemotype 3 genomic DNA concentration standards versus cycle threshold (Ct) with PCR reactions performed in triplicate using primer sets: (A) Tox5-l/2, with genomic DNA ranging from 270 ng (Logio = 2.90) to 0.27 ng (Logio = -0.60), readings at 0.005 fluorescence line; and (B) Fgl6NF/R, with DNA template ranging from 270 ng (Log10 = 2.43) to 0.027 ng (Log]0 = -1.57); in 10-fold dilution series, readings at 0.025 fluorescence line;
Figure 37 is a chart showing the effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR. Treatments were: Fus - F. graminearum; B-Fus - S. mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum;
Figure 38 are micrographs showing Sphaerodes mycoparasitica-Fusarium spp. mycoparasitism assays: (A-a). Hook-shaped contact structures (arrows); (B-b). Clamp-like clasping cells (arrows), "a" and "b" are diagrammatic drawings for (A) and (B) respectively. Scale bars = 5μm;
Figure 39 are micrographs showing intracellular parasitism, hyphal inhibition response, and anamorphic stages during the Sphaerodes mycoparasitica-Fusarium spp. interactions: (A) Intracellular parasitism by S. mycoparasitica in F. equiseti (arrow); (B) Fusarium hyphal inhibition response when challenged with S. mycoparasitica; deformation of hyphae into rosette- like shapes (arrow); (C) Hyaline S. mycoparasitica anamorphic stages; (D) Sphaerodes mycoparasitica anamorphic stages with adsorption of red pigments from F. culmorum. Scale bars A, C, D = 5μm; B = 20μm;
Figures 4OA and 4OB are micrographs of intracellular parasitism by Sphaerodes inside F. equiseti (arrows), and 4OC and 4OD are micrographs of intracellular hyphae produced by Sphaerodes inside F. equiseti with hook-shaped contact structure (arrows). 4OA and 4OB were captured under light microscopy; whereas in 4OC and 4OD hyphae were stained with lactofuchsin and images were captured under fluorescent and confocal laser microscopy, respectively. Scale bars = 5μm; and Figure 41 is a chart showing average hyphal diameters of parasitized and non-parasitized F. equiseti cells (■ ) and F. culmorum (D) on 1-week slide-cultures with Sphaerodes mycoparasitica biotrophic mycoparasite. Data are means and standard deviations. Same lowercase letters indicate no significant difference between parasitized and non-parasitized hyphae at P = 0.05, with T-test.
DETAILED DESCRIPTION OF THE INVENTION
Sphaerodes mycoparasitica (Ascomycetes, Melanosporales), has been isolated from isolates of Fusarium avenaceum, Fusarium graminearum and Fusarium oxysporum originating from wheat or asparagus fields. The species is characterized by a unique combination of ascospore size, shape (fusiform and triangular) and wall ornamentation (reticulate and smooth). Also, conidia are produced from simple phialides on the surface of ascoma peridial wall, on ascoma surrounding hyphae, and on irregularly branched conidiophores arising from hyphae. S. mycoparasitica has a phialidic anamorph and produces simple phialides on the surface of ascoma peridial wall or scattered irregularly on ascoma surrounding the hyphae, and on conidiosphores. S. mycoparasitica forms hook-like structures parasitizing living hyphae of Fusarium.
The 1266bp DNA sequence from the large subunit ribosomal RNA gene (LSU) of S. mycoparasitica is given in SEQ ID NO: 1.
SEQ ID NO: 1.
1 atagggagaa gaagcactgc gattgcccta gtaacggcga gtgaagcggc agcagcccag
61 atttggaatc tggtcctttt ggggcccgag ttgtaatctg cagaggaagc gtctggtgcg
121 gtgccggcct agttccctgg aacgggacgc cgtagagggt gacagccccg tacggtcggc
181 caccaaacct gtgtgtcgct ccttcgaaga gtcgcgtagt ttgggaatgc tgcgtaaagt
241 gggaggtatg ctcctcctaa ggctaaatac cggccagaga ccgatagcgc acaagtagag
301 tgatcgaaag atgaaaagca ccttgaaaat ggggttaaaa agtacgtgaa attgccaaag
361 gggaagcgct cgtggccaga ctcgtgcctt atggatcatc cggctatttc gccggtgcac
421 tccattaggc tcgggccagc gtcggtcggc gccggtacta aaagacagcg cgaacgtggc
481 tctcttcggg gagtgttata gcgcgctgtg taatgtgctg gcgccgtccg aggaccgcgc
541 atttatgcaa ggacgctggc gtaatggcca ctagcgaccc gtcttgaaac acggaccaag
601 gagtcgccca gagacgcgag tgtgcgggtg acaaacccct gcgcgaagtg aaagcgaacg
661 ctggtgggaa ccctcacggg tgcaccaccg accgatcctg atgtcttcgg atggatttga
721 gtatgagcgt ttctggtcgg acccgaaaga gggtgaacta tgcttgggta gggtgaagcc
781 agaggaaact ctggtggagg ccccgtttgg gttctgacgt gcaaatcgat ccataaacct
841 gggcatagcg gcgaaagact aatcgaacct tctagtagct ggttcgcatt ctctctctcg
901 cacgagagag agaaaacctc tgtgatatca cgattatcag tgaaaaccac accgagaccc
961 aacggagttc ttctggattt cctcatgctt caattaccac gcctagtgga cctacctgga
1021 gcgctacaat aaagtcatac gaaaatctcg aagatcgggg tgacggtgag ggatcctaag
1081 gttctctcgt tgagtgcgtt ggacgggcat ggccgtcagc gatctggggc gaccgttgcc
1141 ggatcataag ggctttagtg cttaggctat tggtattgag gggtctgaag acggtaatct
1201 gaaaccaaag gctttattct aaacccgcgc agcatgggcg tagtaggaag agacagcgaa
1261 gtctag
The 1233bp DNA sequence from the small subunit ribosomal RNA gene (SSU) of S. mycoparasitica is given in SEQ ID NO: 2.
SEQ ID NO: 2
1 agtgcggcat gttgtagcct aagcaattat acagcgaaac tgcgaatggc tcattatata
61 agttatcgtt tatttgatag tgccttacta cttggataac cgtggtaatt ctagagctaa
121 tacatgctga aagccccgac ttacggaggg gcgtatttat tagattaaaa accaatgccc
181 ttcggggctc tttggtgatt catgataact tctcgaatcg cacggccttg cgccggcgat
241 ggttcattca aatttcttcc ctatcaactt tcgatgtttg ggtagtggcc aaacatggtg
301 gcaacgggta acggagggtt agggctcgac cccggagaag gagcctgaga aacggctcct
361 acatccaagg aaggcagcag gcgcgcaaat tacccaatct caactcgagg aggtagtgac
421 aataaatacc gatgcagggc tctttagggt cttgcaattg gaatgagtac aatttaaatc
481 ccttaacgag gaacaattgg agggcaagtc tggtgccagc agccgcggta actccagctc
541 caatagcgta tattaaagtt gttgtggtta aaaagctcgt agttgaacct tgggcctggc
601 cggctggtcc gcctaacagc gtgcactggt gcggccgggt cttcccaccg cggagccgca
661 tgtccttcac tgggcgtgtc ggggaagcgg tacttttact gtgaaaaaat tagagtgctc
721 taagcaggcc tatgctcgaa tacattagca tggaataata gaataggaca gtcgttctat
781 tttgttggtt tctaggacgt ctgtaatgat taacagaaac aatcgggggc gtcagtattg
841 catcgtcaga ggtgaaattc ttagatcgat gcaagactaa ctactgcgaa agcattcgcc
901 aagggtgttt tcattaatca ggaacgaaag ttaggggatc gaagacgatc agataccgtc
961 gtagtcttaa ccataaacta tgccgactag ggatcgggcg gtgtaatttt gacccgctcg
1021 gcacttacga gaaatcttaa gtgcttgggc tccaggggag tatggtcgca aggctgaaac
1081 ttaaagaaat gacgaagggc accaccaagg gtgaacctgc ggcctagttg actcacacgg
1141 gaaactcacg aggtaggaat atgtagatga cggatggagc cttcagaata catatggg ;'ca
1201 tgcgctctta ataccggtat tgaaaatggg cag
Sample cultures of Sphaerodes mycoparasitica have been deposited with Saskatchewan Microbial Collection and Database under the accession number SMCD2220-01, and in the International Depositary Authority of Canada Collection (1015 Arlington Street, Winnipeg, Canada, R3E 3R2) under the accession number IDAC301008-01.
Sphaerodes mycoparasitica may be useful as an anti-fungal agent. S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi. S. mycoparasitica seems particularly useful for treating, ameliorating or otherwise control infections of Fusarium avenaceum, Fusarium graminearum, and/or Fusarium oxysporum and improving plant health or growth.
S. mycoparasitica may be used as a prophylactic agent to diminish the chance of a fungal infection, particularly a Fusarium infection, from occurring.
S. mycoparasitica may be used for treating plants affected by Fusarium Wilt Disease or Fusarium Head Blight. S. mycoparasitica may be used for hindering such conditions from spreading or as a prophylactic measure to diminish the risk of such conditions from occurring.
In the present invention, S. mycoparasitica may be isolated from suitable sources. For example, S. mycoparasitica may be isolated from F. graminearum or F. avenaceum isolates originating from wheat fields by the method described in Vujanovic V, et. al. Can. J. Microbiol. 48(9): 841-847 (2002). S. mycoparasitica is also available deposited with International Depositary Authority of Canada (IDAC301008-01).
S. mycoparasitica may be used to treat, ameliorate, or otherwise control infections of Fusarium fungi. S. mycoparasitica may be applied in any suitable manner to the organism in need of treatment. For example, S. mycoparasitica isolates may be used directly or they may be further processed into soil-applied granular-based, peat-based, seed-applied, or anthesis-applied liquid-based inoculants.
S. mycoparasitica may be produced via fermentation and formulated into a pesticide composition. A suitable fermentation process includes, selection of fermentation medium (solid state or submerged), concentration of fermentation constituents, oxygen transfer, incubation temperature, time of harvest and post harvest treatments. The aim is to establish the optimum conditions to ensure an abundant, stable, and efficacious mycoparasitic, microbial population.
When formulating S. mycoparasitica into a pesticide composition, care should be taken to selected ingredients that: (i) ensure stability during production, processing and storage, (ii) assist application, (iii) protect the pesticide from unfavourable environmental conditions, and (iv) promote pesticidal activity at the target. Exposure to inactivated host/pathogen or its compounds may improve the activity of S. mycoparasitica.
The formulations disclosed herein will usually comprise (i) an active ingredient, (ii) carriers - often an inert material used to support and deliver the densely populated active ingredient to the target, and optionally (iii) adjuvants - compounds that: promote and sustain the function of the active ingredient by protection from UV radiation, that ensure rain fastness on the target, and that retain moisture or protect against desiccation, or promote the spread and dispersal of the biopesticide using standard agriculture equipments such as those disclosed by Hynes and Boyetchko (2006, Soil Biology & Biochemistry 38: 845-84).
Internal Transcribed Spacer ribosomal DNA from S. mycoparasitica was sequenced. A 560bp DNA sequence from the ITS region is given in SEQ ID NO: 3.
SEQ ID NO: 3
1 ttcgtttctt atcgcattgg tgaccagcgg agggtcatta cgaatcggac catttatgtc
61 atggctctgc caaccctgtg aactttatac ttgtacgttg cctcggcgga acctgccttt
121 tcggcaggcc gccggccggc atatacgcaa acgctctgaa aaagctccgc gctctatctg
181 aataataaaa ctttaacgag taaaaacttt tggcaacgga tctcttggct ctggcatcga
241 tgaaaaacgc agcgaaatgc gatacgtaat gtgaattgca gaattcagtg aaccatcgaa
301 tctttgaacg caccttgcgg ccgccggtaa tccggcggcc atgcccgtcc gagcgtcgtt
361 tccaccctcg ggagttctcc tcctaagaaa atttctcccg gccttgggcc agcgcgttgc
421 gcggctgccc gaccaacggc ggcaggaccg gcgatgtcct ctgtgccctg catttatata
481 aaactcgcat tggtccccgg taaggcttgc cttgcaacca acttctttag gtcgacctca
541 gatcggatag ggatacccgc The present invention provides a primer set, SmyITSF/R (SmylTSF is SEQ ID NO: 4 and SmyITSR is SEQ ID NO: 5), useful for identifying S. mycoparasitica.:
SEQ ID NO:4 5'-TCATGGCTCTGCCAACCCTGTAA-S' SEQ ID NO: 5 5'-AATGCAGGGCACAGAGGACATCG-S'
The present primer is selective for S. mycoparasitica and can be used to assess and quantify the fungus in industrial products, plant materials, seed samples, and environmental samples by using PCR and RT-PCR technologies.
The SmyITSF/R primer set can be used for quantitative real-time PCR technology for analyzing gene expression, in fungal pathogens detection, and in quantification of fungi in living plants.
The SmyITSF/R primer set was tested with SMCD2220-01, seven Fusarium species, nine different ascomycetous fungal isolates, two zygomycete fungi, and three basidiomycetous fungal strains.
In PCR, this primer set only amplified SMCD2220-01, not the other fungi. Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica, as compared to inoculation with F. graminearum. In further RT-PCR studies, SmyITSF/R specific primer was used for S. mycoparasitica in combination with F. graminearum-Fgl2NF/R and Trichoderma-TGP4-F/R as a control, within which the primer showed high accuracy in assessing biocontrol-pathogen-plant interactions.
Total extracellular protein extracts from Sphaerodes mycoparasitica demonstrated significant inhibition of Fusarium spore germination. The present invention provides an antifungal agent comprising extracellular protein extracts from S. mycoparasitica. Two proteins were isolated from the total protein extract, one having a molecular weight of 13 kDa and one having a molecular weight of 50 kDa. The present invention provides an antifungal agent comprising one or both of these proteins. Conventional molecular biological techniques may be used to isolate, characterize and produce the present proteins. For example, in order to identify the gene(s) for the present proteins, S. mycoparasitica could be challenged with F. oxysporum filtrates and upregulated mRNA isolated by standard Northern Blot. cDNA can be produced from the mRNA by Reverse Transcriptase PCR (RT-PCR). The cDNA can be amplified, purified and inserted into an appropriate vector. This vector may be inserted into an appropriate host cell.
Cloning and expression may focus on isolation of genes coding for antimicrobial proteins by designing primers for identified proteins. Isolated genes may be cloned in suitable expression vectors (yeast or bacteria) with suitable/efficient promoters in order to generate industrial strains for large-scale production of the concerned proteins. These vectors can be purchased from Promega, Invitrogen, Clontech, or other companies. The cloned genes may be tested for their protein expression, and the expressed proteins will be purified (using His-tag or other columns). Purified proteins may be tested against plant-pathogenic fungi for their antifungal activity by disc-plate assay and/or microtitre plate assay methods (e.g., Drummond and Waigh, 2000, Recent Research Developments in Phytochemistry.4:143-152). Then, rDNA technologies, involving gene mutation or addition of enhancers, introns or protein-specific promoters (GA inducible), or addition deletion may be used to enhance the production of proteins.
Selected genes may be transformed into wheat and barley to create a transgenic lines with antifungal activity against pathogenic fungi using techniques known to those skilled in these arts (e.g., Sanghyun et.al., 200,8 J. Expt. Botany, 59, 2371-2378; Dennis et. al., 2007. Plant Cell Reports. 26: 631-639).
S. mycoparasitica has demonstrated an ability to degrade the deoxynivalenol (DON) mycotoxin. The present invention provides a method of degrading acetyldeoxynivalenol, especially 3-acetyldeoxynivalenol.
S. mycoparasitica could be challenged with pure DON and upregulated mRNA isolated by standard Northern Blot. Reverse Transcriptase PCR could be used to identify the gene(s) for the upregulated proteins, an appropriate cDNA construct could then be inserted into an appropriate vector for protein production. Further, recombinant DNA Technology could be applied to create transgenetic plants with antimycotoxin properties. The present invention provides antifungal compositions comprising S. mycoparasitica, isolates, cultures, or proteins thereof. The present invention also provides a method of controlling a fungal disease of a plant, and a method for mycotoxin detoxification, which methods comprise applying to the locus of the plant S. mycoparasitica, isolates, cultures, or proteins thereof, collectively hereinafter referred to as the 'antifungal agent'.
The compositions of the invention may, for example, be applied to the seeds of the plants, to the growth medium (e.g. soil or water), or to the foliage of the plants.
The present invention provides a composition comprising the antifungal agent and an agriculturally acceptable carrier or diluent, which will ensure stability and performance of the final product. Carrier or diluent should compatible with the active ingredient, agriculturally acceptable, have a good absorptive capacity and a suitable bulk density, allowing easy particle dispersion and attachment.
The compositions herein may be applied, as in aqueous sprays, granules and dust formulations in accordance with established practice in the art. An aqueous spray is usually prepared by mixing a wettable powder or emulsifiable concentrate formulation of a compound of the invention with a relatively large amount of water to form a dispersion.
Wettable powders may comprise a finely divided mixture of the antifungal agent, a solid carrier, and a surface-active agent. The solid carrier is usually chosen from among attapulgite clays, kaolin clays, montmorillonite clays, diatomaceous earths, finely divided silica, purified silicates, or combinations thereof. Surfactants which may be useful herein have wetting, penetrating, and/or dispersing ability. They are typically present in an amount of from about 0.5% to about 10% by weight. Surfactants herein may be chosen from, for example, alkylbenzenesulfonates, alkyl sulfates, naphthalenesulfonates and condensed naphthalenesulfonates, sulfonated lignins, and non-ionic surfactants.
Emulsifiable concentrates may comprise the antifungal agent of the invention in a liquid carrier, the carrier being a mixture of a water-immiscible solvent and a surfactant. Solvents that may be useful herein include aromatic hydrocarbon solvents such as the xylenes, alkylnaphthalenes, petroleum distillates, terpene solvents, ether-alcohols, organic ester solvents or suitable combinations thereof.
When a composition of the invention is to be applied to plant debris or litter, in order to control of the source of contamination and inoculant dispersion, or to the soil, as for pre-emergence protection, granular formulations or dusts are sometimes more convenient than sprays.
In one embodiment the antifungal agents herein are encapsulated into alginate pellets. The pellets may be prepared in any suitable manner. For example, one useful method is described in Harveson et. al., (2002, Plant Disease; Vol. 86, No. 9 1025-1030).
The composition may comprise other active substances useful in an antifungal agent. For example, the compositions herein may comprise other antifungal agents such as Trichoderma, sulfur, neem oil, rosemary oil, jojoba oil, Bacillus subtilis, allylamines (e.g. terbinafine, antimetabolites (e.g. flucytosine), azoles (e.g. ketoconazole, itraconazole), echinocandins (e.g. caspofungin), polyenes (e.g. amphotericin B), systemic agents (e.g. griseofluvin), or combinations thereof.
The compositions herein may contain from about 0.1% to about 95%, by weight, of the antifungal agent and from about 0.1% to about 95%, by weight, of the carrier and/or surfactant. The direct application to plant seeds prior to planting may be accomplished in some instances by mixing either a powdered solid compound of the invention or a dust formulation with seed to obtain a substantially uniform coating which is very thin and represents only one or two percent by weight or less, based on the weight of the seed. In some instances, however, a non-phytotoxic solvent such as methanol is conveniently employed as a carrier to facilitate the uniform distribution of the compound of the invention on the surface of the seed.
The compositions herein may be useful in the treatment of fungal infections in plants. Consequently, the compositions herein may comprise S. mycoparasitica, isolates, cultures, or proteins thereof and a pharmaceutically acceptable carrier.
S. mycoparasitica sporulates in the presence of Fusarium. S. mycoparasitica ascospores proved resistant to germination under different standard laboratory conditions (sterile distilled water, on water agar and commercially available media) and heat or cold-shock treatments. In contrast, spore germination was obtained on general potato dextrose agar medium amended with Fusarium-fύtτales. Significant improvement in percentage of spore germinations were obtained for the spores suspended in Fusαrium-fύtrates. F. αvenαceum and F. oxysporum filtrates induced the highest germination, whereas F. sporotrichioides and F. proliferαtum triggered lower germination frequency. Filtrates of beneficial fungal inoculants: Trichodermα hαrziαnum (RootShield® available from BioWorks Inc., Victor, NY, USA; RootShield is a registered trademark of BioWorks Inc.), Penicillium bilαii (JumpStart® available from Novozymes Biologicals Ltd., Saskatoon, SK, CA; JumpStart is a registered trademark of Philom Bios Inc.), and Chαetomium globosum had no impact on germination. Ascospores suspended in F. αvenαceum-fύtratQ, showed double-polar germination pattern. On the other hand, when suspended in F. oxysporum-fύtrate, significant amount of spores demonstrated a single-polar germination pattern. S. mycopαrαsitiα grown on F oxysporum kept the same mycoparasitic germination patterns in three offspring generations when transferred on F. αvenαceum which indicate a stable genome-regulated expression.
The present invention provides a method of sporulating S. mycopαrαsiticα by exposing them to F. αvenαceum or F. oxysporum, or filtrates, extracts, or compositions thereof.
The present invention provides a method for producing an antifungal composition comprising S. mycopαrαsiticα or isolates, cultures, genes or proteins thereof. The method comprises:
(a) inducing S. mycopαrαsiticα sporulation;
(b) culturing S. mycopαrαsiticα;
(c) harvesting S. mycopαrαsiticα.
The method may further comprise any of the following optional steps:
(d) storing/preserving S. mycopαrαsiticα;
(e) applying S. mycoparasitica;
(f) assessing S. mycoparasitica;
(g) producing S. mycopαrαsiticα proteins;
(h) harvesting S. mycopαrαsiticα proteins; (i) fractionating S. mycoparasitica proteins;
(j) separating S. mycoparasitica proteins;
(k) storing/preserving S. mycoparasitica proteins;
(1) applying S. mycoparasitica proteins;
(m) assessing S. mycoparasitica proteins.
EXAMPLES
Example 1
Sampling, fungal growth and microscopy
Myclobutanil-agar (MBA) medium was used for selective isolation of various Fusarium taxa and associated biotrophic mycoparasites from Canadian agriculture fields using the method described in Vujanovic V, et. al. (2002, Can. J. Microbiol. 48(9): 841-847). Sphaerodes was recovered occasionally from F. graminearum and abundantly from F. avenaceum isolates originating from wheat fields in Saskatchewan; it was also isolated from Fusarium oxysporum from asparagus fields in Quebec, Canada. A monosporal, single culture of the mycoparasite was obtained from each Fusarium species according to the method proposed by Harveson & Kimbrough (2001, Int. J Plant Sci. 162(2) :403 -410). Single ascospore isolates were maintained on Potato dextrose agar (PDA) (Difco, BD Biosciences, Mississauga, ON, CA) supplemented with antibiotics (100 μg I"1 streptomycin sulphate and 13 μg l"1 neomycin sulphate; Sigma-Aldrich Canada Ltd., Oakville, ON, CA) and stored at -80°C in Saskatchewan Microbial Collection and Database (SMCD2220-01) and in the International Depositary Authority of Canada (IDAC301008-01) collections. Fungal growth was assessed on modified Leonian's agar (MLA) and Potato dextrose agar (PDA) media. Biotrophic interactions between Sphaerodes and Fusarium strains were examined with the slide culture method proposed by Jordan & Barnett (1978, Mycologia 70(2):300-312). Morphological studies of ascomata, ascospores, mycelia, and anamorphic structures were performed after two weeks of incubation (21° C - 22° C) under a Carl Zeiss Axioskop2 with a Carl Zeiss AxioCam ICcI camera. Fungal materials for microscopic observation were mounted in lactofuchsin and lactophenol cotton blue dyes. DNA extraction, amplification and sequencing
Three Sphaerodes strains: SMCD 2220-01 on F. avenaceum from wheat, SMCD 2220-02 on F. graminearum from wheat, and SMCD 2220-03 on F. oxysporum from asparagus were cultured on PDA medium at 210C for a week prior to DNA extraction. Genomic DNA was extracted with the DNeasy® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA; DNEasy is a registered trademark of Qiagen GmbH Corp, Hilden, Fed. Rep. Germany). LSU (large subunit) rDNA fragments were amplified using primer sets NS1/NS6 using techniques known to those skilled in these arts (e.g., Gardes & Bruns, 1993, Molecular Ecology 2: 113-118; White et ah 1990, PCR Protocols: a guide to methods and application: 315-322. Academic Press, New York) and LS1/LR5 (e.g., Hausner et al. 1993, Canadian Journal of Botany 71 : 52-63; Rehner & Samuels, 1995, Canadian Journal of Botany 73 (Suppl. 1): S816-S823; Zhang & Blackwell, 2002, Mycological Research 106: 148-155). Target regions of fungal genomic DNA samples were amplified using polymerase chain reaction (PCR) in a 25 μl reaction mixture containing 2.5μl of 1 OX buffer, 5μl of Q buffer, 0.5μl 1OmM dNTPs, lμl of each primer, 0.13μl of 0.625 unit of Taq DNA Polymerase, 2μl of extracted fungal DNA, and 12.87μl of sterilized ultra-pure Millipore water. The Qiagen Taq PCR core kits were purchased from Qiagen Inc., Mississauga, ON, CA. Purified DNA PCR products were sequenced.
Sequence alignment and phylogenetic analyses
Sequences of LSU from this study and sequences retrieved from GenBank were aligned using Clustal X software (version 1.82) (Thompson et al. 1997, Nucleic Acids Research 24: 4876-4882), and edited in Bioedit (Hall, 1999, Nucleic Acids Symposium Series 41 : 95-98). Distance trees were produced with PAUP (Phylogenetic Analysis Using Parsimony) 4.ObIO software (Swofford 2000) using a neighbor-joining approach, and validated using bootstrap analyses with 1,000 repetitions. A fungal distance tree was prepared with sequences showing bootstrap values higher than 50%. Trees were rooted with sequences Xylaria hypoxylon U47841.
Taxonomy: Sphaerodes mycoparasitica Vujanovic, sp. nov. (Figures 1-5) [MycoBank no: MB 515144], in the International Depositary Authority of Canada as Sphaerodes mycoparasitica strain IDAC 301008-01. Coloniae in agaro potato dextrosum lentior crescents, 4.0 cm ad 7d, floccose, pallido-brunneis. Hyphis septatis, ramosis, anastomosantibus, laevibus, palide fulvis, 2.5-5.0 μm diam compositum. Ascomata superficialia vel immersa, pyriformia vel globosa, ostiolata, flavo-brunnea, 250-300 μm longa, 200-280μm diam. Collum nul, conicum vel cylindricum, 30-75μm longum, (0-) 50-70 μm latum ad basim. Peridium membranaceum, cellulis 8-15 μm, e 3-6 stratis, 8-15 μm crassum, textura angulari compositum. Setae rectae vel parum curvae, hyalinae vel dilute flavae, crassitunicatae, 10-40 μm longae, septatae. Asci 8-spori, ovoidei vel clavati, 50-75 X 17-25 μm, superne late rotundati, brevistipitati, tenuitunicati, evanescentes. Paraphysis nullis. Ascosporae unicellulares, irregulariter biseriatae, primum hyalinae, deinde brunneae vel atrobrunneae, crassitunicatae, fusiformes, 18-24 X 9-12 μm, reticulatae, costis protrudentibus, e polo visae polygonales, utrinque umbonatae, foramine germinali praeditae. Phialidis hyalinis, status conidialis.
Culture characteristics: Colonies of Sphaerodes mycoparasitica strain IDAC 301008-01 cultured on MLA grew more rapidly than on PDA, 1.1 cm versus 0.6 cm per day (21-220C), consisting of slightly submerged mycelium and aerial hyphae, granulose due to production of ample number of ascomata. On MLA (Figures IA and 1C) and PDA Figures IB and ID), the cultures produced a woolly mycelium, yellowish to pinky-brownish on both sides. At 370C, no growth was registered. Hyphae were white to pale yellow, 2.5-5.0 μm diam., septate, anastomosis occurred soon after ascospore germination (Figure 2). Colonies on Potato dextrose agar (PDA) spread with abundant, white to pale yellow aerial mycelium and low number of ascomata. Ascomata, perithecial or cleistotecial, scattered or aggregated in small groups, superficial, pyriform to globose, ostiolate (when mature), light to dark yellowish brown, translucent, appearing black due to mass of mature ascospores, 250-300 μm high, 200-280 μm diam. Neck absent to short conical or cylindrical 25-75 μm long, 20-70 gm wide at the base, sometimes surrounded with a crown of short, upright setae, 10-40 μm long. Peridium membranaceous, 3-6-layered, 8-10 μm thick, translucent, pale yellow to light brown, composed by cells of 8-15 μm diam. disposed in textura angularis.. Asci 8-spored, clavate, 50-75 X 17-25 μm, rounded at apex, without apical structures, thin-walled and evanescent when mature. Paraphyses absent. Ascospores irregularly arranged inside the asci, at first hyaline but becoming brown to dark brown, thick- walled, single-celled, fusiform to rarely triangular, 18-24 X 9-12 μm, reticulate to rarely smooth, with irregular transverse sections, and with a strongly umbonate germ pore at each end. Phialides hyaline, ampulliform produced directly on ascomata or on hyphae surrounding ascomata, and on irregularly branched conidiophores.
S1. mycoparasitica strain IDAC 301008-01 has a unique combination of features shown in Figure 3. The ascomata height is generally less than 250 μm with a conical to cylindrical neck (Figure 3A). The setae length is generally less than 40 μm (Figure 3B) and the spore length is generally less than 23 μm (Figure 3C). The spores show a conspicuous wall ornamentation and prominent irregular longitudinal ribs indicated by the arrows in Figure 4A. The spores of Sphaerodes quadrangular is are shown in Figure 4B for comparison. S. mycoparasitica strain IDAC 301008-01 spores occaisonally show a triangular shape (Figures 3D and 3E). The formation of starting and mature ascoma of S. mycoparasitica strain IDAC 301008-01 are shown in Figure 3H. This strain produces simple phialides on the surface of ascoma peridial walls or alternatively, the phialides may be scattered irregularly on ascoma surrounding the hyphae, and on conidiosphores with a distinctive branching pattern (Figures 3F and 3G). S. mycoparasitica strain IDAC 301008-01 forms hook-like structures for parasitizing living hyphae of Fusarium (Figures 31 and 3J).
Example 2
Sphaerodes mycoparasitica (SMCD 2220-01) 210C isolates were cultured in potato dextrose broth (PDB) culture media. About 3 ml of culture were transferred to 250 ml Ehrlenmeyer flasks containing 50 ml PDB growth medium. The flasks were incubated for 7 days on a rotary shaker (150 rpm) at room temperature.
Extracellular protein extraction: Young mycelia were filtered through Whatman® No.l filter paper (Whatman is a registered trademark of Whatman International Ltd., Kent, UK). Filtered culture medium, containing extracellular proteins, and were concentrated by Amicon ultrafiltration centrifuge tube with a 3000 Dalton cut-off membrane by centrifugation at 4000 rpm at 4°C.
Disc diffusion assay: Antifungal activities of extracellular protein extracts were tested under sterile conditions by radial disc plate diffusion assay as described by Roberts & Selitrennikoff (1986, Biochim. Biophys. Acta, 880: 161-170). The assay of the isolated protein for antifungal activity toward F. oxysporum and F. graminearum was carried out in petri plates containing potato dextrose agar. Mycelial plugs from actively growing fungal plates were placed in the center of the petri plates and sterile filter paper discs (5-mm diameter of Whatman® filter paper no. 1) were placed on the agar surface at a distance of 0.5 cm away from the rim of the mycelial colony. An aliquot (60 μL) containing 2.5 μg of extracellular protein was added to a disk. Sterile distilled water and buffer served as controls. The plates were then incubated at room temperature for 4 days and examined for inhibition. The area of the mycelial colony was measured and the inhibition of fungal growth was determined by calculating the % reduction in area of mycelial colony with the controls (Figure 5A). After 4th day of germination, about 30% inhibition of the hyphal extension of F. oxysporum and 35% inhibition of hyphal extension of F. graminearum were observed (Figure 5B)
Fast protein liquid chromatography (FPLC) of extracellular proteins: Proteins were fractionated through Superdex 75 GL 10/30 column using FPLC AKTA® purifier system (GE Healthcare, Biosciences AB, CA: AKTA is a registered trademark of GE Healthcare Bio-Sciences AB Ltd., Uppsala, Sweden) according to the manufacturer's instructions. The column was previously equilibrated with sterile water and with 50 niM sodium phosphate buffer, pH 7.0 containing 0.15 M NaCl, followed by protein injection (about 500 μL) and elution of proteins with the same buffer with flow rate of 1.0 ml/min. Fractions of 0.8 ml were collected in each tube. Upon gel filtration on Superdex® 75 (Superdex is a registered trademark of GE Healthcare Bio-Sciences AB Ltd., Uppsala, Sweden), proteins were resolved into two distinct peaks (fl and f2) and few smaller peaks Figure 6). Samples from all the peak fractions were pooled, precipitated and tested for their antifungal activity.
Sodium dodecyl sulfate-polyactylamide gel electrophoresis (SDS-PAGE): SDS-PAGE (12%) of proteins recovered from FPLC fractions was performed according to the method of Laertunli (1970, Nature 227: 680-685). All peaks giving FPLC fractions were pooled and recovered by precipitation in 1 :4 volume of chilled acetone and kept at -200C overnight. After centrifugation at 12,000 g for 10 min, precipitated proteins (pellets) were dissolved in minimum amount (30 μL) of assay buffer. Proteins were analyzed by SDS-PAGE having 5% stacking gel (pH 6.8) and
12% separating acrylamide gel (pH 8.8) in Tris-glycine buffer (pH 8.3) and appropriate markers. Prior to SDS-electrophoresis, the protein was mixed with an equal volume of sample buffer (60 mM Tris-HCl buffer, 4% SDS, pH 6.8) containing 5% β-mercaptoethanol. A mixture of standard marker proteins (Bio-Rad protein markers, Bio-Rad Laboratories Inc., Mississauga, ON, CA) was used. V All samples were heated for 5 min at 950C and cooled to room temperature before loading on gel. Proteins were visualized by silver staining method (Bio-Rad Silver staining kit, Bio-Rad Laboratories Inc., Mississauga, ON, CA). Proteins molecular masses were estimated by comparison with the mobilities of standard molecular mass markers. Protein bands of molecular weight 13 kDa and 50 kDa were detected in fl and f2 peaks respectively (Figure 7).
Microtitre plate assay: Percentage inhibition of spore germination was performed by microtitre plate assay method (Ghosh, 2006, Ann. Bot. 98: 1145-1153; Yadav et al. 2007, J. Med. Microbiol. 56: 637-644) to test the antifungal activity of proteins recovered from FPLC fractions. The possible toxicity of the fractionated proteins was tested by a percentage growth inhibition assay using the F. oxysporum and F. graminearum. The in vitro antifungal activities of fractionated proteins were determined in 96- well microtiter plates. In microplate wells, 10 μl of potato dextrose broth (PDB; BD Biosciences, Mississauga, ON, CA) was mixed with 3 μl of spore suspensions of F. oxysporum and F. graminearum. An aliquot of 7 μL of different peak containing proteins fractions were added to suspensions in microtitre plates (12-8 wells). Water 25 and buffer were used as negative controls. The microtitre plate was then incubated at room temperature in dark. Observations were made for inhibition in spore germination in both untreated and treated wells after 24 h using inverted and fluorescent microscope. The number of germinated and non-germinated spores and percentage of area covered by mycelia in microscope were used to determine the percentage of growth inhibition. The fl and f2 protein-containing peaks had inhibitory effects on spore germination after 24 hrs compared to the control treatment.
The discharge of spores from sporangia was inhibited by these protein fractions. Secondary branching (mycelia formation) was observed in control treated spores of F. oxysporum (Figure 8A-c) and F. graminearum (Figure 8B-c). No branching was observed in fl and f2 protein- treated spores of F. oxysporum (Figures 8A-a-b) and F. graminearum (Figure 8B-a-b). The size of germ tubes (hyphae) from control-treated spores was more than 100 μm compared to 10-15 μm for protein-treated spores (Figures 8A-a-b; 8B-a-b). Example 3
Active growing mycelia of S. mycoparasitica (SMCD 2220-01) were cultivated on Potato 10 Dextrose Broth (PDB) in a shaking flask at 210C for 3 days and then washed. Wet mycelium (0.1 g) were resuspended in 1 ml of PDA medium supplemented 100 μg/mL 3-ADON (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) and incubated for 10 days.
A 0.2cm2 plug S. mycoparasitica was incubated in ImI PDB containing 3-ADON at a 15 concentration of 100 μg at RT for 7 days. The sample was analysed for DON degradation by TLC and HPLC assays.
Extraction of 3-ADON:
3-ADON was extracted by the method disclosed by Vasavada and Hsieh (1987, Appl. Micro. Biotechnol. 26: 517-521). The spent medium in sampled flasks was filtered through the Whatman® filter paper avoiding the mycelia. 3-ADON was extracted from the medium by three 10 ml volumes of ethyl acetate. The mixture of the medium and solvent was vigorously shaken and allowed to stand for 5 min for separation of phases. The organic phase was siphoned off and passed through sodium sulfate to remove residual water. The solvent was allowed to evaporate at room temperature. The residue was redissolved in acetonitrile for analysis.
Analysis of DON by TLC:
Thin layer chromatography (TLC) was used to analyze the DON. TLC was performed by the method disclosed by Andrea et.al. (2004, J. Basic Microbiol. 44: 147-156). Dried residues were dissolved in 75 μl and loaded onto silica gel TLC plates coated with fluorescent indicator (60 F254, 0.2 mm layer; Merck Frosst Canada Ltd, Kirkland, PQ, CA). The spots were focused in the solvent system with ethyl acetate-toluene (3:1) for 40 5 min. The gel plates were sprayed with 20% aluminum chloride in 95% ethanol. Trichothecenes were visualized as dark spots under short wavelength UV light (254 nm). Chromatograms were photographed using gel documentation system. A known standard control of pure 3-ADON (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) was employed to compare with other treatments. The sample containing S. mycoparasitica showed significantly less 3-ADON than the control sample. High Performance liquid chromatography (HPLC)
A Water's HPLC with : 250 x 4.60 mm id Prodigy 5μ ODS (3) 10OA, 5μ micron Ci8 column (Phenomenex Inc., Torrance, CA USA) and a photodiode-array (PDA) detector was used with a gradient solvent system (water-acetonitrile containing 0.005% (v/v) trifluoracetic acid). The PDA detector measured the UV spectrum (200-600 nm). Samples were dissolved in acetonitrile and 20 μl was loaded onto the column using an automatic injector. The DON was eluted with solvent as a mobile phase at a rate of 1 ml min'1 3-ADON obtained from Sigma- Aldrich (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) was used as a standard. The results are shown in Figure 9. The sample with S. mycoparasitica contained a much reduced level of 3-ADON.
Example 4
Potato dextrose agar (PDA), Potato dextrose broth (PDB), Yeast extract, Malt extract agar (MEA), Agar, and Peptone were purchased from BD Biosciences (Mississauga, ON, CA) . Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich Canada Ltd. (Oakville, ON, CA) .
Fungal strains and growth conditions
Four phytopathogenic Fusarium strains (F. avenaceum, F. sporotrichioides, F. oxysporum, and F. proliferatum); three beneficial fungal inoculants (Trichoderma harzianum (RootShield ), Penicillium bilaii (JumpStart®), and Chaetomium globosum; and one mycoparasitic fungal strain (Sphaerodes mycoparasitica SMCD 2220-01) isolated from F. oxysporum host, were maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study. S. mycoparasitica mycoparasitic fungal isolate was separated from their F. oxysporum host, and monosporium cultures were achieved according to methods described by Harveson RM, Kimbrough JW, (2001, Int. J. Plant Sci. 162: 403-410) with few modifications. Mature perithecia were picked up, suspended, and shaked in 2-ml sterilized water blanks. The spores-suspension was then spread on PDA plates. After few minutes, with the assistance of a Carl Zeiss Stemi 1000 dissecting microscope, individual spores were removed and transferred to PDA supplemented with 100 ml/1 of Fusarium filtrate. All fungal isolates were maintained in the culture collection of the Saskatchewan Microbial Collection and Database, Canada (SMCD).
Spores production
Mycelium plugs from the margin of the active growing monosporial Sphaerodes culture were cut and placed on Modified Leonian's Agar (MLA: Maltose, 6.25g; Malt extract, 6.25g; KH2PO4, 1.25g; Yeast extract, 1.Og; MgSO4JH2O, 0.625g; Peptone, 0.625g; Agar, 2Og, and IL of dH2O. Inoculated MLA plates were incubated at room temperature (230C) in dark condition for a month before collecting the spores for germination assays. With the assistance of dissecting microscope, mature spores exuded from the ascomata and located on the ostiolar opening were harvested by picking up carefully with sterile needles and added to 2 ml tubes in 1 ml sterilized distillated water. The suspension was then filtered through four thin layers of cheesecloth to remove the remaining vegetative cells or mycelia. The density of the spore suspension was counted with a haemocytometer and adjusted to approximately 5-6xlO5 spores per ml in sterilized water. Freshly prepared aqueous spore suspensions were used.
Preparation of the fungal filtrates
Four pathogenic Fusarium strains and three beneficial fungal strains were grown in shake cultures for 7 days at room temperature (23°C) in 500 ml flasks, each with 100 ml PDB medium.
After incubation of 7 days in PDB medium, mycelia were removed by filtering through filter paper and the filtrates were then filter-sterilized. Freshly preparations fungal filtrates were employed for the spore germination tests.
Sphaerodes mycoparasitica strain SMCD 2220-01 was found to sporulate on or when inoculated together with Fusarium species, such as F. avenaceum and F. oxysporum. S. mycoparasitica was observed to produce approximately the same amount of ascomata on both F. oxysporum and F. avenaceum. S. mycoparasitica was not found to produce fruiting bodies on other Fusarium or fungal strains such as F. proliferatum, F. sporotrichioides, P. bilaai, T. harzianum, and C. globosum. In the contact zone between these biotrophic mycoparasites and Fusarium species, hook-shaped contact structures were formed. Effects of heat and cold treatments on Sphaerodes spore germination
Aqueous ascospore suspensions were heat-shocked at 6O0C and 65 °C for 20 min, and cold-treated at 4°C, -2O0C, and -700C for 5 min and 20 min. The heat- and cold-shocked spores were then transferred and inoculated onto WA and PDA for 1 day and 3 days. The readings of spore germination were checked daily. Spores not subjected to heat and cold treatments were used as control.
There was no germination observed in any of the heat and cold treatment groups for 3 days. Additional observations were continued up to 7 days and no spore germination was observed.
Germination on various media
Aqueous spore suspensions were transferred and inoculated onto the surface of the following media:
1.5% water agar (WA), PDA, MLA, MEA, Carnation leaves agar (CLA); 1.5% water agar plus 100 ml/1 oϊ Fusarium filtrate; PDA with 100 ml/1 of Fusarium filtrate.
Fusarium strains utilized were F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides. Ascospore-inoculated plates were then incubated at room temperature (230C) for 3 days. Spore germination was examined daily.
The results are summarized in Table 1. Each incubation day for Sphaerodes was analyzed separately. Numbers in each column represent the mean of ascospore germination (in %) ± standard deviation. Means within each column for each medium treatment followed by the same letter are not significantly different at P < 0.05 after Mann- Whitney U test. Table 1 :: Sporulation of S. mycoparasitica on various media
Figure imgf000033_0001
Effects of fungal filtrates on spore germination
The aqueous spore suspensions were suspended in the filtrates of four separate pathogenic Fusarium and three beneficial fungal strains for 1 day and 3 day in the ratio of 1 :2 (1 part of aqueous spore suspension: 2 parts of fungal filtrate), and the filtrate-suspended spores were then transferred and inoculated onto PDA for additional 1 day. Control treatments were suspended with sterilized distilled water or PDB.
Spore germination
Microscopic assessments of ascospore germination were conducted after incubation for 1 day and 3 days. Percentage of germinated spores was obtained by scoring the spores on the Petri dish through utilizing the 20Ox and 40Ox objectives of the Carl Zeiss Axioskop2 microscope and systematically choosing 50 spores, starting at the top right corner and continuing to count till 50. Each drop of ascospore suspensions on a medium plate was considered as a subunit, and there were three subunits per plate. Each medium plate for each treatment was replicated, there were three replicas per treatments. The experiments were repeated twice. An ascospore was only considered as germinated spore when the germ tube was visibly noticeable. Germinated ascospores were counted and recorded as a percentage of the total ascospore number. The results are summarized in Table 2. Numbers in each column represented mean of ascospore germination (in %) ± standard deviation. Each incubation day for Sphaerodes was analyzed separately. Means within each column of Sphaerodes for each filtrate-suspension treatment followed by the same letter are not significantly different at P < 0.05 after Mann- Whitney U test.
Figure imgf000034_0001
Example 5
Since F. grαmineαrum 3-ADON is the most pathogenic and mycotoxigenic in wheat, 3 -ADON was used to quantifying mycoparasite-Fusαr/wm-wheat root interactions under Phytotron controlled conditions.
Fungal strains and growth
Fusaήum strains: F. graminearum 3-ADON strain SMCD2243, biotrophic mycoparasite Sphaerodes mycoparasitica SMCD2220-01, and Trichoderma harzianum T-22 (RootShield-'cornmercial product) as a control strain with mycoparasitic properties were maintained on PDA amended with antibiotics. Taxon specific primers
Specific primer sets for: F. graminearum-¥g\ 2NFiR (Nicholson et al. 1998. Plant Pathology 53: 17-37.); Trichoderma-TG?4-F IR (Kim and Knudsen 2008. Applied Soil Ecology 40: 100-108); and S. mycoparasitica SMCD2220-01-SmyITSF/R were used in this study.
Mycoparasite/Fusarium/plant interactions
Wheat CDC-TEAL 2001 plants were inoculated with mycotoxigenic and pathogenic Fusarium as well as Trichoderma (control mycoparasite) or Sphaerodes SMCD2220-01, and were subjected to RT-PCR quantification to assess the amount of fungal DNAs in roots of wheat under controlled conditions after 14 days of incubation in Phytotron conditions.
Growth conditions and fungal inoculation
Five mycelial plugs from S. mycoparasitica, T. harzianum, and F. graminearum were cut, transferred and grown in three separate shake cultures for 14 d at room temperature (23 °C) in 500 mL tlasks each with 100 mL of PDB (potato dextrose broth). After incubation of 14 d in PDB medium, the fungal cultures were filtered through a Whatman No. 1 filter paper to remove the liquid medium. The mycelia were then transferred to 50 mL sterile Falcon tubes with 20 sterile glass beads and 40 mL of autoclaved distillated water. The Falcon tubes filled with mycelia materials were then vortex vigorously for 1 min to separate the mycelia into smaller pieces. Mycelial suspension was filtered through 2 layers of cheesecloth to remove the glassbeads and bigger mycelial clumps. The flow-through was then used as mycelial suspension stock (10°) for serial dilution. S-tock of mycelial suspension was further diluted into a series spanning from 10-2, 10-3, and 10-4. This dilution series were plated on PDA using the pour plate method. The number of CFU (colony forming units) was counted and recorded. Mycelial suspensions were adjusted with sterile water to about 10'5 - 10"6 CFU/mL for S. mycoparasitica and T. harzianum, and to about 10"4 - 10"5 CFU/mL for F. graminearum.
Quantification of interactions between mycoparasite-pathogen-wheat roots was conducted on the spring wheat CDC-TEAL 2001. Wheat plants were grown in containers (4 x 4 x 16 cm) with 10 g of different layers of soil-less growing mix (Figure 10). All the seeds were surface-sterilized prior to sowing. The containers 10 were lined with filter paper and packed with 6 g of Pro-Mix® soil-less mix (Sun Gro Horticulture Canada Ltd., Delta, BC, CA; Pro-Mix is a registered trademark of Premier Horticulture Ltd., Riviere-du-Loop, PQ, CA) which comprised the first layer 20. This layer 20 was then overlayed with a second layer 30 (Ig) of either Pro- Mix" mix amended and homogenized with ~5 to 6 x 104 CFU of F. graminearum mycelial suspension or alternatively with Pro-Mix® mixwith water only. The second layer 30 was followed by a third layer 40 (Ig) of either Sunshine® peat moss (Sunshine is a registered trademark of Sun Gro Horticulture Canada Ltd., Seba Beach, AB, CA) supplemented and homogenized with ~ 5 to 6 x 105 CFU of S. mycoparasite or alternatively with T. harzianum mycelial suspension or alternatively with water only. Six spring wheat seeds were then sowed on top of the third layer 40 and topped with a fifth layer 60 of 2 g of Sunshine® peat moss (Figure 10). Spring wheat seeds were germinated and grown under a 16-h photoperiod (22°C day/15°C night) with light intensity of 250 μmol m-2 s-1, watered every 2 d, and fertilized every 14 d using 1300 ppm of NPK (20-20-20) fertilizer. All treatments in the experiment were in three replicates and the experiment was repeated twice.
At the mid-seedling growth, corresponding to Zadok's growth stage 13 (Zadoks et al. 1974, Weed Research 14:415-421), wheat plants with their roots were removed from the pots and washed under running tap water to remove all the soil particles. Washed roots were dried with filter papers. Number of germinated seeds, total biomass, root biomass, total length, and root length were counted and measured. Percentage of seed germination was calculated with the following formula: (Number of germinated seeds in particular treatment/number of germinated seeds in control treatment) x 100%. The roots were then subjected to total DNA extraction with DNeasy Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA). Extracted total DNAs from roots of different treatments were employed in real-time PCR quantification.
Statistical analyses
Root biomass (g), total biomass (g), root length (cm), total length (cm), seed germination (%); and S. mycoparasitica, T harzianum, and F. graminearum genomic DNA quantification from the roots of Spring wheat plants were analyzed by using analysis of variance (ANOVA). Log10 transformations were carried out whenever required to meet the ANOVA requirements. Multiple comparisons for more than two samples were analyzed by utilizing Tukey's studentized range test at P = 0.05 (SPSS 1990).
Wheat growth and fungal inoculation
Root biomass, total biomass, root length, total length, and seed germination of F. graminearum infected spring wheat were significantly increased with the treatments of S. mycoparasitica compared to inoculation with F. graminearum alone (Table 3).
Table 3: Effects of SMCD2220-01 (SM) and F. graminearum 3-ADON (Fgra) inoculation treatments on root biomass (g), total biomass (g), root length (cm), total length (cm) and seed germination (%) of spring wheat plants
Treatment Root biomass Total biomass Root length Total length
(g) (g) (cm) (cm) Seed
germination (%)
Control 0.27 ± 0.06 b 0.56 ± 0.56 b 9.63 ± 0.74 b 31.88 ± 2.39 C NA*
SM 0.32 ± 0.03 ab 0.69 ± 0.69 a 13.88± 1.1 1 a 38.13 ± 2.76 ab 101 ± 2 a
Fgra 0.18 ± 0.03 c 0.38 ± 0.48 c 7.88 ± 1.89 c 23.75 ± 1.98 d 31.25 ± 1.4 c
SM-Fgra 0.27 + 0.03 b 0.54 ± 0.54 b 12.13 ± 1.35 ab 32.13 ± 3.91 be 87.25 ± 2 b
* Values expressed are means of six replicates ± standard deviation of the mean. Values followed by same letters within each column are not significantly different using Tukey's range test (P <0.05).
Table 3, the mycoparasite S. mycoparasitica demonstrates both biomass stimulation and bioprotection or biocontrol.
Conformation of the Sphaerodes-specific primer set
The SmyITSF/R primer set was tested with S. mycoparasitica, seven Fusarium species, night different ascomycetous fungal isolates two zygomycete fungi, and three basidiomycetous fungal strains. This primer set only amplified S. mycoparasitica.
Figure 11 shows SmylTSF/R primers amplified PCR products for S. mycoparasitica (SM), five Fusarium strains (Fa = F. avenaceum, Fo = F. oxysporum, Fs = F. sporotrichioides, Fg3 = F. graminearum chemotype 3, and Fg 15 = F. graminearum chemotype 15), two Trichoderma species (T22 = T. harzianum T22 and Tv = T. viride), two Cladosporium species (CC = C. cladospoήoides and CM = C. minourae), and Penicillium aurantiogriseum (PA) were electrophoresed on 1% agarose gel at 100 V for 20 minutes. The size of the band is around 300 to 400 bp.
Standard curves
The standard curves based on known diluted concentrations of DNAs from S. mycoparasitica, F. graminearum, and T. harzianum were constructed. Standard curves were achieved using a series of 10-fold diluted DNA spanning from 3.8 x 102 to 3.8 x 10-2 ng for S. mycoparasitica, 2.7 x 103 to 2.7 x 10"1 ng for F. graminearum chemotype 3, and 7.0 x 102 to 7.0 x 10"2 ng for T. harzianum. Quantification demonstrated linear relation (r2 = 0.999 for S. mycoparasitica,, r2 = 0.998 for F. graminearum, and r2 = 0.996 for T. harzianum) between logio of fungal genomic DNA (in ng/μl) and real-time PCR threshold cycles (Ct) (threshold fluorescence signal of 0.025 was used for all three fungal isolates) (Figures 12 A, 12B, and 12C).
Figure 13 shows RT-PCR sigmoidal coloured curves for Sphaerodes mycoparasitica (SMCD 2220-01), with 0.025 fluorescence line, showing the range of 3.8 x 102 to 3.8 x 10-2 ng in a ten-hold decreasing manner.
RT-PCR confirmation of the Sphaerodes-biocontrol effects
Real-time PCR, which evaluated quantity of S. mycoparasitica SMCD2220-01 and F. graminearum, confirmed that amounts of F. graminearum DNA detected in treatments with S. mycoparasitica SMCD2220-01 and T harzianum were significantly reduced (Figure 14A). Previously, treatments with mycoparasitic Sphaerodes retispora had been observed to show significant suppression of F. oxysporum in watermelon plants (Harveson et al. 2002, Plant Dis. 86: 1025-1030). The amount of S. mycoparasitica DNA detected was not significantly different between wheat inoculated with F. graminearum or without Fusarium (Fig.14B). The amount of T. harzianum DNA detected in the treatment inoculated with F. graminearum was observed to be significantly reduced, as compared to non-Fusarium treatment (Fig.14C).
In conclusion, during in vitro culture-based studies, only S. mycoparasitica SMCD2220-01 was observed to enhance wheat seed germination and formation of secondary roots, whereas T-22 induced post-emergence damping-off symptoms. Under controlled conditions in pytotron, S. mycoparasitica SMCD2220-01 was able to reduce the quantity of F. graminearum in spring wheat root, as well as improving the survival and growth of the spring wheat seedlings. In contrast to T. harzianum, the amount of S. mycoparasitica SMCD2220-01 DNA detected was not significantly different between wheat inoculated with F. graminearum and without Fusarium. Hence, S. mycoparasitica SMCD2220-01 could be a better biocontrol candidate for the F. graminearum pathogen in wheat.
Example 6
Quantitative RT-PCR results from testing Mycoparasite-FMsαπwrn interaction on Wheat host using growing conditions disclosed herein also confirmed the efficiency of S. mycoparasitica SMCD2220-01 for significantly decreasing an accumulation of genes implicated in Fusarium DON-mycotoxin production.
Strain used: F. graminearum 3-ADON SMCD2243, F. graminearum 15-ADON SMCD2244 and S. mycoparasitica SMCD2220-01 strains.
Primersets used: Tox5-l/2 for Fusarium (Wu et al. 2002. J. Environ Monit. 4:377-382) and SmyITSF/R (disclosed herein) for S. mycoparasitica.
Results are summarized in the Figure 15. Real-time fluorescence curves of tri5 gene sequences amplified by using Tox5-l/2 primer set from total DNA extracted from dual-culture assays of Fusarium graminearum strains and pre-inoculated Sphaerodes mycoparasitica SMCD2220-01 (SM) or singly grown F. graminearum 3-ADON and 15-ADON chemotypes.
Example 7
The effects of filtrates collected from different Fusarium sp. on the germination of Sphaerodes ascospores were assessed in this study. Also assessed were the ascospore germination patterns.
Media, Reagents, and chemicals: Potato dextrose agar (PDA), potato dextrose broth (PDB), yeast extract, malt extract agar (MEA), agar, and peptone were purchased from Difco (Becton Dickinson Diagnostics, Sparks, Maryland). Streptomycin sulphate, Neomycin sulphate, and other reagents of analytic grade were from Sigma-Aldrich (Oakville, ON, CA) .
Fungal strains and growth conditions: Four phytopathogenic Fusarium strains (F. avenaceum SMCD 2241, F. oxysporum SMCD 2242, F. proliferatum (Matsush.) Nirenberg SMCD 2244, and F. sporotrichioides Sherb SMCD 2243), three beneficial fungal inoculants: T. harzianum (RootShield®), P. bilaii ([JumpStart®), and Chaetomium globosum Kunze; and one mycoparasitic fungal strain, S. mycoparasitica were maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study. An isolate of the mycoparasitic fungus, S. mycoparasitica, was separated from its F. oxysporum host on myclobutanil agar (MBA) selective medium as previously described and a monosporic culture was achieved by picking up mature perithecia which were then suspended and shaken in 2-mL sterile distilled water blanks to encourage release of ascospores. The ascospore-suspension was then spread on PDA plates. After a few minutes, a Carl Zeiss Stemi 1000 dissecting microscope was used to identify individual ascospores, which were removed and transferred to PDA supplemented with 100 mL/L of Fusarium filtrate (F. avenaceum and F. oxysporum). All fungal isolates were maintained in the culture collection of the Saskatchewan Microbial Collection and Database, Canada (SMCD).
Ascospore production: Mycelium plugs from the margin of the actively growing monosporic- derived S. mycoparasitica culture were cut and placed on Modified Leonian's Agar (MLA: maltose, 6.25g; malt extract, 6.25g; KH2PO4, 1.25g; yeast extract, l.Og; MgSO4-7H2O, 0.625g; peptone, 0.625g; agar, 2Og, and IL of dH20) (Malloch and Cain 1971). Inoculated Modified Leonian's Agar (MLA) plates were incubated at room temperature (23° C) under darkness conditions for a month before collecting spores for germination assays. Mature ascospores were collected according Goh and Vujanovic (2010).
Preparation of the fungal filtrates: Four pathogenic Fusarium strains and three beneficial fungal strains were grown in shake cultures for 7 d at room temperature (23 C) (with 250 rpm) in 500 mL flasks, each with 100 mL PDB medium prior to fungal filtrates extraction. After incubation, the mycelia were removed by filtering through filter paper (Whatman® Grade No. 1) and the filtrates were then filter-sterilized with 0.02-μm-pore-size nitrocellulose filter (Fisher Scientific Ltd., Nepean, ON, CA). Only fresh preparations of fungal filtrates were employed for the spore germination test in this study.
Effect of heat and cold treatments on S. mycoparasitica spore germination: Heat activation and cold-shock treatments were performed to investigate ascospore germination in S. mycoparasitica. Aqueous ascospore suspensions were heat-shocked at 60 and 65 C for 20 min, and cold-treated at 4, -20, and -70 C for 5 min and 20 min. The heat- and cold-shocked spores (10 μL) were then transferred and inoculated onto water agar (WA) and PDA for 1 d and 3 d. Spore germination was checked daily. Spores not subjected to heat and cold treatments were used as controls. All treatments were in three replicates and experiment was repeated twice.
No germination was observed in all the heat and cold treatments over a 7 d period.
Germination on various media: Aqueous spore suspensions (10 μL) of S. mycoparasitica were transferred and inoculated onto the surface of the following media: 1.5% water agar (WA), PDA, MLA, MEA, Carnation leaf agar (CLA) (Tschanz et al. 1976), 1.5% water agar plus 100 mL/L of Fusarium filtrate, and PDA with 100 mL/L of the Fusarium filtrate. Fusarium filtrates were created using F. avenaceum, F. oxysporum, F. proliferatum, and F. sporotrichioides. S. mycoparasitica ascospore-inoculated plates were then incubated at room temperature (23 C) for 3 d, and spore germination was examined daily. All treatments were in three replicates and experiment was repeated twice.
There was no spore germination on 1.5% WA, PDA, MLA, MEA, and CLA. The effects of 1.5% WA and PDA media amended with 100 mL/L of Fusarium- filtrates on spore germination were examined and are summarized in Table 4.
No germination was recorded on day 3 initially and observations were continued up to 7 d on WA or PDA alone and WA or PDA with either F. proliferatum or F. sporotrichioides. However, when either F. avenaceum or F. oxysporum filtrates were added to WA and PDA, the percentage of ascospore germination in S. mycoparasitica drastically increased after 3 d incubation. On day 3, germination increased on the PDA amended with Fusarium-fύtratQ, compared to growth on WA supplemented with Fusαrium-fύtrate, for S. mycoparasitica Table 4: Percentage germination of Sphaerodes mycoparasitica ascospore on various types of Fusaήum-fύtratQ supplemented media, including water agar and potato dextrose agar checks
S. mycoparasitica Spore germination (%)*
Medium Day 1** Day 3**
Water agar (WA) 0 d 0 α
F. avenaceum-ΨA l l .l ± 1.7 b 35.2 ± 2.6 b
F. oxysporum-ΨA 1.6 ± 1.3 C 18 ± 1.4 C
F. proliferatum-WA 0 d 0 d
F. sporotrichioides-Ψ A 0 d 0 d
Potato dextrose agar (PDA) 0 d 0 d
F. avenaceum-POA 21.5 ± 1.4 a 63.2 ± 2.4 a
F. oxysporum-PDA 2.5 ± 2 C 37.5 ± 2 b
F. proliferatum-PDA 0 d 0 d
F. sporotrichioides-PDA 0 d 0 d
* Numbers in each column represented mean of ascospore germination (in %) ± standard deviation.
** Each incubation day for Sphaerodes was analyzed separately. Means within each column for each medium treatment followed by the same
letter are not significantly different at P < 0.05 after Kruskal-Wallis
test.
Effects of fungal filtrates on spore germination: Fungal filtrates from four different phytopathogenic Fusarium species and three beneficial fungal isolates were employed to study spore germination of S. mycoparasitica, and host specificity response. Aqueous spore suspensions of S. mycoparasitica were suspended in the filtrates of four separate pathogenic Fusarium spp. and three beneficial fungal strains for 1 d and 3 d in the ratio of 1:2 (1 part of aqueous spore suspension: 2 parts of fungal filtrate). Filtrate-suspended spores (10 μL) were then transferred and inoculated onto PDA for an additional day (spore germination was counted on PDA plate). Spore germination was count according to Goh and Vujanovic (2010) after an additional day of inoculation on PDA medium. Control treatments were suspended with sterilized distilled water or PDB. Abbreviations for different treatments at four separate chronosequences throughout the experiment: Id Sus, Id Sus + Id PDA, 3d Sus, and 3d Sus + Id PDA represent 1 day Fusarium-fύtrate suspension, 1 day filtrate suspension with an additional day incubation on PDA medium, 3 day suspension, and 3 day filtrate suspension with an additional day incubation on PDA, respectively. No spore germination was observed in the treatments with P. bilaii and C. globosum fungal filtrates. Both water and PDB suspension controls appeared to trigger approximately 1.8- 3.8% spore germination for S. mycoparasitica, on day 3 with an additional day on PDA only (Table 5). Ascospores of S. mycoparasitica suspended in filtrates of pathogenic F. sporotrichioides and beneficial T. harzianum showed no germination on day 1 in suspension, but low number of ascospore germination was observed after 1 day in suspension followed by an additional day on PDA, and in the other incubation treatments. Ascospores suspended in F. proliferatum-fύtratQ were observed to germinate in low abundance for 1 d, 1 d with an additional day on PDA, 3 d, and 3 d plus an additional day on PDA. Sphαerodes ascospores showed the highest number of germinated ascospores in the F. αvenαceum-fύtrate suspension. In the day 1 suspension treatments, ascospore germination of S. mycoparasitica in F. avenaceum-fύtrate was significantly higher (89.2%) than in other treatments. When ascospores of the S. mycoparasitica were suspended in F. oxysporum-fύtrate, the amount of spore germination was increased compared to control. There was no germination recorded for the 1 d suspension in the F. oxysporum-fλWratQ treatment. However, a low number of ascospores were stimulated in F, oxysporum-fύtτate suspension on the second day. Based on the ascospore germination rate and response, S. mycoparasitica showed high specificity to F. avenaceiim and F. oxysporum.
Table 5: Percentage spore germination of Sphaerodes mycoparasitica ascospores suspended in different Fusarium and biocontrol fungi filtrates assesed throughout four chronosequences. Control treatments were suspended with sterilized distilled water
(SDW) or potato dextrose broth (PDB).
S. mycoparasitica Spore germination (%)*
Treatment** Id Suspension ldSus+ldPDA 3d Suspension 3dSus+ldPD_l~
SDW 0c 0e 0e 2 ±1.2°
PDB 0c 0e 0e 2.8 ± 1.9 c
F. avenaceum-fύtrate 89.2 ± 6.2 a 91 ±8.4a 93.2 ± 6.7 a 94.2 ± 7.9 a
F. oxysporum-filtratQ 0c 81.8±llb 85 ± 7.9 b 91 ± 10a
F. proliferαtum-fύtrate 2.6 ± 3.6 b 3.2 ± 4.6 d 10±7.4c 11.2±8b
I F. sporotrichioides-fύtrzte 0c 3±2.8d 3.4 ± 3.3d 10±5.6b
J^ P. bilαii-fύtτsLte 0c 0e 0e 0c
I T. hαrziαnum-fύtraie 0c 9± 1.1 c 1.6±1.6d 10.4 ± 1.5 b
C. globosum-flltτatQ 0c 0e 0e 0c
10
* Numbers in each column represented mean of ascospore germination (in %) ± standard deviation.
** Each incubation day for S. mycoparasitica was analyzed separately. Means within each column of S.
mycoparasitica for each filtrate-suspension treatment followed by the same letter (in superscript) are not significantly different at P < 0.05 after Kruskal-Wallis test.
15
Spore germination assessments: Microscopic assessments of ascospore germination were conducted after incubation for 1 d and 3 d (spore germination was counted on suspensions). Percentage of germinated spores was obtained by scoring the spores on a Petri dish while observing them through the 20Ox and 40Ox objectives of the Carl Zeiss Axioskop2 microscope and systematically choosing 50 spores, starting at the top right corner and continuing to count until 50. Each drop of the ascospore suspension on a growth medium plate was considered as a subunit, and there were three subunits or replicates per plate. The experiments were repeated twice. An ascospore was only considered germinated when the germ tubes exceeded the width of the ascospore (approximately 12μm). Germinated ascospores were counted and recorded as a percentage of the total ascospore number that was counted.
Ascospores from S. mycoparasitica showed two kinds of germination patterns. Single polar germination was more prevalent in the F. oxysporum-fύtrate suspension (Figures 16 A, 16B, 16D, 16E). A small number of spores from S. mycoparasitica found to produce shorter double-polar germination in the treatment with F. oxyporum-fύtrate at 3 d suspension with additional 1 d on PDA (Figure 16F). In the F. αvenαceum-fύtrate suspension, ascospores of S. mycoparasitica showed higher preference for two-polar germination (Figures 16G). Single polar germination was also found in F. avenaceum-fύtrats suspension; however it was lower than in F. oxysporum-fύtτatQ treatment. Commonly, these single-polar germinated spores produced larger web-like organizations and longer hyphal formation (in F. αvenαceum-fύtτate suspension), which was rarely found in F. oxysporum-fύtrate suspended spores (Figures 16H, 161). The majority of the germinated ascospores in S. mycoparasitica, which was activated through suspension in F. oxysporum-fύtvate were detected to be either at an angle of 90° (Figures 16E, 16F) or between 90° and 180° (Figure 16F) at the tip of the polar germ pores. However, very few spores germinated at an angle of 180° (Figure 16D). Most activated spores (with F. αvenαceum-fύtrate treatment) showed germination at an angle of 180° (Figure 16G).
Example 8
The host specificity of S. mycoparasitica to F. graminaerum 3-ADON and 15-ADON strains were assessed in this study. Media, reagents and chemicals: Potato dextrose agar (PDA), potato dextrose broth (PDB), yeast extract, malt extract agar (MEA), agar, and peptone were purchased from Difco (Becton Dickinson Diagnostics). Streptomycin sulphate, Neomycin sulphate, and other reagents of analytical grade were from Sigma-Aldrich.(Oakville, ON, CA) IQ SYBR Green Supermix for real-time PCR reactions was acquired from Bio-Rad Laboratories (Mississauga, ON, CA).
Fungal strains and growth: All phytopathogenic Fusarium strains: Fusarium graminearum 3- ADON (Fgra3) SMCD 2243, and 15-ADON (Fgral5) SMCD 2244 chemotypes, F. avenaceum (Fave) SMCD 2241, F. oxysporum (Foxy) SMCD 2242, F. proliferatum (Fpro) SMCD 2244, F. sporotrichioides (Fspo) SMCD 224; and one mycoparasitic Sphaerodes mycoparasitica SMCD 2220 strain were retrieved from Saskatchewan Collection and Database (SMCD), maintained on PDA amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate) and used throughout this study.
Spore production and germination assays: Ascospores of S. mycoparasitica were produced on Modified Leonian's agar (MLA), harvested and prepared as previously described. Also, Fusarium spp. filtrates were prepared, S. mycoparasitica spore germination assays in six different Fusarium filtrates were carried out as previously described.
Sphaerodes mycoparasitica spore germination suspended in both F. graminearum chemotype 3 -ADON and 15-ADON filtrates was lower compared to F. avenaceum for the first incubation day, and compared to both F. avenaceum and F. oxysporum for the remaining incubation days (P < 0.05; with Mann- Whitney Test) (Figure 17). No significant differences in germination between F. graminearum, F. proliferatum, and F. sporotrichioides filtrate treatments were observed for the first two incubation days. However, treatments with F. graminearum filtrates showed significantly higher germination rate of S. mycoparasitica compared to F. sporotrichioides filtrate treatment during later incubation time points (Figure 18).
Dual-culture assays: Dual-culture assays for examining the degree of hyphal reduction/inhibition or damage to F. graminearum chemotypes were assessed as disclosed in Goh and Vujanovic (2009, Mycologia DOI: 10.3852/69-171). S. mycoparasitica is slow-growing fungus as compared to F. graminearumus 3 and 15 strains. Therefore, S. mycoparasitica was pre- inoculated onto the PDA plates for I d, at 21 0C in darkness, prior to inoculating Fusarium mycelial plugs. Linear mycelial growth of Fusarium strains for both treatments indicated above was measured and recorded daily for 5 days. Around 0.5 x 1.5 cm2 (sampling zones) located approximately 0.2 cm behind the contact zone between F. graminearum and S. mycoparasitica was excised and subjected to DNA extraction. Each treatment was with three replicates and the experiment was repeated twice. The PDA plate inoculated with F. graminearum only was the positive control. Total genomic DNA was extracted using a DNeasy® Plant Mini Kit. The DNA was eluted once in 50 μl of buffer AE and stored at -2O0C until real-time PCR quantification assays (as described below).
Since S. mycoparasitica demonstrated slower mycelial growth (0.56 cm per day; n = 9) compared to F. graminearum 3-ADON (0.74 cm per day; n=6) and 15-ADON (0.68 cm per day; n=6) chemotypes, the linear growth of F. graminearum mycelia in dual-culture was assessed using the pre-inoculation method. S. mycoparasitica was pre-inoculated on PDA for 1 d followed by F. graminearum inoculation. The pre-inoculation approach demonstrated significant differences (starting day 3) in linear growth suppression of F. graminearum chemotype 3 and 15 compared to the co-inoculation approach (Figures 19A and 19B).
Establishment of mycoparasitism: Fusion biotrophic mycoparasitic interactions between S. mycoparasitica and both F. graminearum chemotype strains, and intracellular parasitism interactions were examined and assessed on slide cultures according the methods described in Goh & Vujanovic (2009).
On day 3 of inoculation on PDA with F. graminearum 3-ADON and 15-ADON, no clamp-like or hook-like structures were formed by Sphaerodes mycoparasitica on Fusarium strains. On day 5 of inoculation, clamp-like and hook-like contact structures as well as Fusarium hyphal cells penetration (with haustoria) were observed (Figures 2OE to 201). Furthermore, on day 3, S. mycoparasitica removed red pigment from the mycelia of F. graminearum 3-ADON on the slide culture (Figures 2OA to 20D). As a result, S. mycoparasitica mycelia adopted reddish color (Figure 20C). Between day 4 and 5, formation of red crystal-like pellets was detected on the surface of mycoparasite hyphae (Figure 20D). The mechanism behind the color changes observed remains unknown. For F. graminearum chemotype 15-ADON, no uptake of red complex or release of red crystal-like structures by S. mycoparasitica hyphae were noted. Nevertheless, flower-like hyphal structures appeared which could indicate possible growth inhibition of 15-ADON F. graminearum (Figure 20J). Significant differences in diameters of infected and non- infected hyphae were seen for both F. graminearum chemotypes (Figure 21).
Primers and standard curves: F. graminearum-specific (Fgl6NF/R) and trichothecene Tri5 gene-specific (Tox5-l/2) primer sets were used in this study. Standard curves for F. graminearum- and Tri5 gene-primer sets were generated, based on threshold cycles (Ct), by using a series of 10-fold diluted genomic DNAs from F. graminearum (spanning from 2.7 x 102 to 2.7 x 10"2 ng/μl for F. graminearum-specific primer set, from 2.7 x 102 to 2.7 x 10"1 ng/μl of 3- ADON strain and 3.0 x 101 to 3.0 x 10"2 ng/μl of 15-ADON strain DNAs for Tox5-J/2 primer set). Ct values were recorded and obtained by the Opticon Monitor software version 3.1 (Bio-Rad Laboratories Inc., Mississauga, ON, CA). Standard curves for different primer sets were constructed by plotting the threshold cycles (Ct) value versus the logarithm (logio) of the concentration of 10-fold serial diluted F. graminearum DNAs as described above. Amplifications with different primer sets on the genomic DNAs of two F. graminearum chemotypes were run in triplicates to obtain the mean and standard deviation of each 10-fold serial dilution.
Real-time PCR quantification: Real-time PCR amplifications on total genomic DNA extracted from the sampling zones (as described above) were performed using MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA). All the real-time PCR reactions were performed by utilizing the real-time PCR MJ white tubes (Bio-Rad Laboratories Inc., Mississauga, ON, CA) in a total volume of 25 μl. The reaction mixture for all real-time PCR assays were: 12.5 μl of IQ Supermix (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 1 μl of each 10 μM forward/reverse primers (Invitrogen), 9.5 μl of sterilized UltraPure Millipore water, and 1 μl of DNA template. Real-time PCR conditions for Fgl6NF/R primer set used were outlined in Nicholson et al. (1998, Physiol. MoI. Plant Pathol. 53: 17-37) with melting curve analysis at 60 to 950C. Parameters for Tox5-l/2 primer set as described in Schnerr et al. (2001, Int. J. Food microbiol. 71 : 53-61). Standard curves for different primer sets with different F. graminearum DNA sources were constructed (Figure 22). Growth suppression or inhibition at the sampling zones (Figure 23) for F. graminearum chemotype 3 and 15 was further confirmed with real-time PCR amplifications with F. graminearum- and tri5 gene-specific primer sets. Sigmoidal curves for the four different treatments (F. graminearum chemotype 3 or 15 only and F. graminearum chemotype 3 or 15 pre-inoculated with S. mycoparasitica) with Fgl6NF/R primer set were generated using Opticon Monitor software version 3.1 and illustrated in Figure 24.
Using Fgl6NF/R primer set, quantity of F. graminearum chemotype 3 DNA in the sampling zones significantly decreased when pre-inoculated with S. mycoparasitica compared to un-inoculated treatment (P = 0.01) (Figure 25). However, DNA of F. graminearum chemotype 15 did considerably but not significantly reduced (P = 0.085 using T-test). Using Tox5-l/2 primer set, amount of tri5 gene fragments diminished appreciably in both F. graminearum chemotype 3 and 15 challenged with S. mycoparasitica (P < 0.05).
Example 9
The effects of S. mycoparasitica (biotrophic mycoparasite) and T. harzianum (necrotrophic mycoparasite) on expression of Tr i and PKS genes by F. graminaerum 3 -ADON and 15-ADON strains were assessed in this study.
Fungal strains and growth: Two Fusarium graminearum 3- ADON (SMCD 2243) and 15- ADON (SMCD 2244) chemotypes, Trichoderma harzianum necrotrophic (SMCD 2166) and Sphaerodes mycoparasitica biotrophic (SMCD 2220) mycoparasites were obtained from the Saskatchewan Microbial Collection and Database (SMCD). All strains were maintained on Potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) amended with antibiotics (100 mg/L streptomycin sulphate and 12 mg/L neomycin sulphate; Sigma- Aldrich Canada Ltd., Oakville, ON, CA) prior to study initiation.
Chemical fungicide control: A concentration of 100 μmol/L tebuconazole was prepared from Folicur® 432F (43.2% tebuconazole, Bayer CropScience Inc., Saskatoon, SK, CA; Folicur is a registered trademark of Bayer Aktiengesellschaft, Leverkusen, Fed. Rep. Germany). This fungicide preparation was used throughout the study.
In vitro assay, sampling and RNA extraction: Dual-culture assay was carried out between F. graminearum and Folicur® (100 μmol/L tebuconazole) or biological (T harzianum or S. mycoparasitica) agents on Minimal medium as disclosed by Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179). Inoculated dual-culture plates were incubated at room temperature (23C) in dark conditions for a week. Mycelia of F. graminearum were harvested after a week of inoculation with either chemical or biological agents. A 0.5-cm2 mycelial plug was cut out approximately 0.5 cm away from the border of interaction and fungal cells were disrupted with liquid nitrogen. Total RNA from the samples were extracted using Aurum Total RNA mini kit and extracted RNA was treated with DNAse (Bio-Rad Laboratories Inc., Mississauga, ON, CA) according the manufacturer's recommendations. Samples were then stored at -70C till gene expression analysis.
During the In vitro studies, both F. graminearum 3-ADON and 15-ADON chemotypes changed mycelia morphology corresponding to each treatment (Figures 26A - 26B). However, the main diagnostic distinction was the tendency of F. graminearum chemotypes to abundantly produce chlamidospores in clusters or chains when exposed to tebuconasole fungicide compared to mycoparasites (Figures 26C - 26D). In the case of F. graminearum chemotype 15 (15-ADON producer), all four trichothecene genes - Tri4, Tri5, Trio, and TriIO in this Fusarium strain were found to be induced in high amounts when treated with chemical tebuconazole compared to treatments that co-inoculated with biological agents (either S. mycoparasitica or T. harzianum) (Figures 27A - 27D). F. graminearum chemotype 3 (3-ADON producer) was observed to demonstrate induction of Tri4, Tri5 and TriIO genes when co-inoculated with necrotrophic mycoparasitic Trichoderma harzianum (Figures 27A, 27B, 27D). When F. graminearum chemotype 3 was treated with Folicur® fungicide, only TriIO gene was being induced (Figure 27D). Generally, all four Tri genes were repressed significantly when challenged with biotrophic mycoparasitic Sphaerodes mycoparasitica (Figure 27A - 27D).
Real-time Reverse-transcription PCR: Real-time RT-PCR was performed by using an IScript One-Step RT-PCR kit with SYBR Green on a MiniOpticon Cycler System (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instruction. Primer sets used for amplification and gene expression were summarized in Table 6.
Table 6: Primer sets used to amplify Tr i4, Tri5, Tri6, TrilO, PKS4, PKSl 3, and β-tubulin by
Real-time PCR.
SEQ ID Gene Primer sequences Reference
Tri4-F: TAAACGCCCGCGAAGTTCACA Jiao et al. 2008, FEMS Lett.
SEQ ID NO: 6/7 Tri4
Tri4-R: TGGTGATGGTTCGCTTCGAG 285: 212-219
Doohan et al. 1999, Appl.
Tr5F: AGCGACTACAGGCTTCCCTC
SEQ ID NO: 8/9 Tri5 Environ. Microbiol. 65:
Tr5R: AA ACC ATCC AGTTCTCC ATCTG
3850-3854
SEQ ID NO: Tri6-1 TCTCTACCAACGGTGGATTCAACC Pinson-Gadais et al. 2008, 10/1 1 TM
Tri6-2 AGCCTTTGGTGCCGACTTCTTG Mycopathol. 165: 51-59.
SEQ ID NO: TrilO-F: TCTGAAC AGGCGATGGTATGG A
12/13 TrilO Jiao et al. 2008
TrilO-R: CTGCGGCGAGTGAGTTTGACA
PKS4-PS.1 Lysøe et al. 2006, Appl.
SEQ ID NO:
14/15 PKS4 GTGGGCTTCGCTAGACCGTGAGTT Environ. Microbiol.
PKS4-PS.2 ATGCCCTGATGAAGAGTTTGAT 72:3924-3932
PKS13-PS.1
SEQ ID NO: CCCCCAACTCGACGTCAAATCTAT
16/17 PKSl 3 Lysøe et al. 2006
PKS13-PS.2
TTCTTCCCGCCGACTTCAAAACA
SEQ ID NO: β- FGtubf GGTCTCG AC AGC AATGGTGTT
Lysøe et al. 2006
18/19 tubulin FGtubr GCTTGTGTTTTTCGTGGCAGT
RT-PCR sample (-25 μL) contained 3 μL of RNA template, 8.85 μL of nucleae-free water, 12.5 μL of RT-PCR reaction mixture (2x), 0.5 μL of IScript RT enzyme mix (50x) (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 0.1 μL of 50 μM solutions of both forward and reverse targeted gene-specific primers (Invitrogen Corp., Carslbad, CA, USA). Real-time PCR conditions were performed as outlined by manufacturer's recommendations: 50C for lOmin, 95C for 5min, followed by 40 cycles of denaturing at 95C for 10s and annealing at 55C for 30s, 95C for lmin and 55C for 1 min. PCR reactions were checked for absence of any primer-dimer formation or non-specific PCR amplification by performing melting curve analysis. Contamination of RNA template with residual genomic DNA was eliminated because there was no amplification detected using reverse transcriptase free real-time RT-PCR reaction as template. Fold change in gene expression for each treatment was normalized to β-tubulin internal reference gene and relative to the expression for the control treatment (Fusarium alone on minimal medium), using the 2"ΔΔCT method proposed by Livak and Schmittgen (2001). ΔΔCT = (CT, target- gene - Cτ, Fgtub)treatment - (CT, target-gene - Cτ, Fgtub)controi, where treatment and control indicate F. graminearum challenged with chemical or biological agent and F. graminearum alone, respectively.
For gene expression analyses based on targeted genes {PKS4 and PKSl 3) that responsible for zearalenone biosynthesis, these two polyketide synthase genes from both F. graminearum chemotypes were detected to be repressed in all chemical or biological treatments (Figures 28A - 28B). Repression of F. graminearum chemotype 15 PKS4 and PKSl 3 genes in the treatment with S. mycoparasitica biotrophic mycoparasite was illustrated to be significantly higher compared to treatments with T. harzianum and tebuconazole fungicide (Figures 28A - 28B).
Tri genes were observed to be more sensitive in F. graminearum chemotype 3 when co- inoculated with Trichoderma necrotrophic mycoparasite, however, in F. graminearum chemotype 15, Tri genes appeared to be more responsive towards treatment with chemical fungicide (Figures 27A-27D).
PKS4 gene for both F. graminearum chemotypes was monitored to be more sensitive towards treatments with Trichoderma necrotrophic mycoparasitic fungus compared to chemical and biotrophic mycoparasitic agents (Figure 28A). However, PKS13 gene in F. graminearum chemotype 15 was found to demonstrate higher sensitivity towards chemical stimulus (Figure 28B).
Mycotoxins extraction and analyses: DON, ZEA, 3-ADON and 15-ADON mycotoxins were extracted from agar mycelial plugs (0.5cm2) cut from the sampling zone located approximately 0.5 cm behind the contact zone between F. graminearum and S. mycoparasitica. The extraction was performed by three 10-ml volumes of ethyl acetate. The samples were sonicated on ice and shaken vigorously in ethyl acetate, and then they were allowed to stand for 5 min for separation of phases. The organic phase was siphoned off and passed through sodium sulfate to remove water. The solvent was allowed to evaporate at room temperature (23 °C) for 3 days. The residue was then re-dissolved in 2 ml of acetonitrile for thin liquid chromatography (TLC) (only ZEA) and high performance liquid chromatography (HPLC) (all mycotoxins) analyses. TLC was performed on Silica gel 60 plates (Merck Frosst Canada Ltd, Kirkland, PQ, CA) in the solvent system with ethyl acetate-toluene (3:1) for 40 min. 3-ADON on the gel plates was sprayed with 20% aluminum chloride in 95% ethanol, detected and analyzed following the protocols disclosed by Vasavada and Hsieh (1987, Appl. Microbiol. Biotech. 26: 517-521). Known standard controls of pure DON, ZEA, 3-ADON and 15-ADON (Sigma- Aldrich Canada Ltd., Oakville, ON, CA) were employed to compare with other treatments. All four mycotoxins were quantified using a Water's 2695 HPLC system with: 250 x 4.60 mm, Luna 5μ micron C18 (2) IOOA column (Phenomenex Inc., Torrance, CA USA) and a photodiode-array (PDA) detector was used with an isocratic solvent system (methanol: water-methano containing 5% (v/v) (90:10) ratio). The PDA detector measured the UV spectrum (190-500 nm). Samples were dissolved in acetonitrile and 10 μl loaded onto the column using automatic injector and mycotoxins were eluted with solvent as a mobile phase at a rate of 0.75 ml min-1 for 25 mins. Peak height method was incorporated to determine the exact amount of DON, ZEA, 3-ADON and 15-ADON against a standard curves. Ratio between mycotoxins extracted from treatments of F. gr amine arum treated with Folicur and F. graminearum only was calculated for HPLC.
The amount of DON produced was between 70 to 90 ug/L. Consequently, it was too low to be detected in TLC analysis. ZEA was high enough to be analyzed with TLC and both F. graminearum chemotypes were observed to produce higher amounts of ZEA toxin under the treatment with Folicur® compared to other treatments (Figure 29). With HPLC, ZEA was found to be reduced when challenged with Folicur® compared to F. graminearum colony only (Figure 30). DON and 3-ADON was detected to increase for both F. graminearum when inoculated together with Folicur® (Figure 30). Folicur® was monitored to trigger highest amount of 15- ADON under in vitro assay (Figure 30).
Example 10
The effects of S. mycoparasitica (biotrophic mycoparasite) and T. harzianum (neurotrophic mycoparasite) on expression of aurofusarin gene by F. graminaerum 3-ADON and 15-ADON strains were assessed in this study.
Fungi, media, and culture conditions: Fungal strains were obtained from culture collections at University of Saskatchewan (Food and Bioproduct Sciences fungal collection). Strains of the following fungal species were used, plant pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum, , F. proliferation, F. oxysporum, F. arthrosporoides and mycoparasitic Spaeherodes mycoparasitica and Trichoderma harzianum. Fungi were maintained on potato dextrose agar for 2 wks at 210C in darkness. Folicur was also used in this study.
Experiments for the impact of red color nuances on aurofusarin gene expression was carried out using previously classified F. avenaceum isolates, based on VCGs and colony colours. F. avenaceum isolates color identification numbers (CIN) were generated with Hex Color Code Chart (http://wuαv.2crcatcawcbsite.com/build/hex-colors.html#cotorgenerator). CINs are: Ds #71232B: Red and highly virulent, tolerant at 800C for 4 hours; Es #4E040B: Moderately red and moderately virulent, tolerant 400C for 4 hours; Bs #A86608: White and non virulent, susceptible 400C for 4 hours. Three 0.1 g mycelium samples from three replicates of each isolate was mixed and used for DNA extraction and RT-PCR analyses.
Fungal DNA Extraction and PCR: Fungal cultures were grown on 1.5 ml PD broth and centrifuged at 10,000 rpm for 5 min. Supernatant was discarded and, subsequently a total DNA of 2-week old cultures representative of each phenotype/VCG was extracted from the pellet with an Ultra Clean microbial DNA Isolation Kit (Qiagen Inc., Mississauga, ON, CA) following manufacture's instructions. The purified DNA was resuspended in 50 μl of elution buffer and stored at -20" C until further analyses. Full length genomic sequences of PKS region (7.2Kb) from Fusarium graminearum were obtained from NCBI Genbank. Six pairs of primers were designed (Table 7).
Table 7: PCR Primers designed from full-length genomic sequences of the PKS region of F. graminearum
SEQ ID Primer Sequence
SEQ ID NO: 20 PKSFl TCGAGTTTCGTGTTGCGTGT
SEQ IS NO. 21 PKSRl AGGTAGTTCGCCATACCCGT
SEQ ID NO: 22 PKSF2 AATTGTGCCCGAGGCAGTAC
SEQ ID NO: 23 PKSR2 CATTGGTTCCGCCCGCAATAG
SEQ ID NO: 24 PKSF3 TGACAACTTCGCTGGTTTGGA
SEQ ID NO: 25 PKSR3 CATAGCTTGGCCAGTGCCATC
SEQ ID NO: 26 PKSF4 GAAGTCATTCGGTGTTGAGC
SEQ ID NO: 27 PKSR4 GCTCTGGATTGGGTATCGCAC
SEQ ID NO: 28 PKSF5 ACTCGAGCATCCGTCGCAATG
SEQ ID NO: 29 PKSR5 AGCAACATCTCCGTCTGGAG
SEQ ID NO: 30 PKSF6 GTTGAACTGTCCATGGCTGA
SEQ ID NO: 31 PKSR6 GAATGAAGGCAATCTGCTGC
All the reactions were carried out in 25-μl volumes containing 2.5 μl of 1OX PCR buffer, 5 μl of Q solution, 1 μl of each primer (10 μM), 0.5 μl of 1OmM dNTPs mix, and 1.25 U of Taq polymerase (Qiagen Inc., Mississauga, ON, CA). Reaction mixtures were mixed gently and were given flash spin prior to PCR on a Eppendorf Master Cycler (ep gradient S). PCR amplicons were purified using the QIAquick® PCR purification kit (Qiagen Inc., Mississauga, ON, CA; QIAquick is a registered trademark of Qiagen GmbH Corp., Hilden, Fed. Rep. Germany) and commercially sequenced (Plant Biotechnology Institute, Saskatoon, SK).
Development of a real time RT-PCR assay for detection and quantification of the aur gene in Fusarium species: All sequences were sequenced, sequences were aligned, several primer sets were designed and tested. One set, named Auro RT (SEQ ID NO: 32) and Auro RTR (SEQ ID NO: 33) was selected based on efficiency to amplify aurofusarin gene.
SEQ ID NO: 32 ACCTCACTGGAATCAGAGCGCAGC
SEQ ID NO: 33 ATGACRACTTCCCGTGGRCC The specificity of this set of primers was tested by conventional PCR assay using genomic DNA from Fusarium and mycoparasites using the amplification reactions volumes indicated above. The amplification protocol was 1 cycle of 120 s at 94 0C, 35 cycles of 30 s at 94 0C (denaturalization), 30 s at 56 0C (annealing), 45 s at 72 0C (extension), and 1 cycle of 10 min at
72 0C.
The pair of primers used to amplify the β-tubulin (tub) gene (the endogenous control gene used to normalize the results) were FGtubf (SEQ ID NO: 34) and Fgtubr (SEQ ID NO: 35).
SEQ ID NO: 34 GGTCTCGACAGCAATGGTGTT
SEQ ID NO: 35 GCTTGTGTTTTTCGTGGCAGT
The PCR efficiencies of the real time RT-PCR for both genes were checked by performing a 10-fold serial dilution of positive control template to generate a standard curve, and by plotting the Ct as a function of log [10] of template.
Presence of aurofusarin was tested and quantified by RT-PCR in pathogenic Fusarium graminearum , F. graminearum (3 ADON), F. graminearum (15ADON), F. avenaceum, F. culmorum, Mycoparasite, F. proliferatum, F. oxysporum, F. arthrosporoides and mycoparasitic, Sphaerodes mycoparasitica and Trichoderma harzianum. Relative gene expression was studied when Fusarium isolates were co-cultured with Folicur®, Sphaerodes and Trichoderma.
The designed RT-PCR primer set was checked for its specificity by conventional PCR on tested fungal species. A single band 157 bp long was amplified in F. graminearum (3 ADON), F. graminearum (15 ADON), F. avenaceum, F. culmorum but not in other strains. One week old grown cultures tested for their aurofusarin relative gene expression and β-tublin gene was used as an internal control. F. graminearum which produces 15ADON showed highest level gene expression followed by F '.graminearum (3AD0N) and similar kind of expression results were observed with F. avenacum and F. culmorum. Aurofusarin relative gene expression was quantified when each Fusarium species was co-cultured for a week with Sphaerodes, Trichoderma and Folicur R (Figure 31). Among all tested, S. mycoparasitica was most effective in reducing the aurofusarin relative gene expression followed by Trichoderma and Folicur (Figure 31). S. mycoparasitica was most affective on F. graminearum producing 15 ADON, but also efficiently reduced the expression level in F. culmorum and F. avenaceum and F. graminearum producing 3 ADON (Figure 31). Similarly, Trichoderma was able to somewhat affect F. graminearum producing 15 ADON and F. culmorum, but showed no impact on F. avenaceum, whereas enhanced the expression in F. graminearum producing 3 ADON (Figure 31). Finally, Folicur® could be able to provoke minor reduction in F. graminearum producing 15 ADON aur gene expression, but with less impact on F. culmorum and F. avenaceum. Inversely, Folicur® increased expression almost 2-fold when compared to F. graminearum producing 3 ADON (Figure 31).
RNA isolation, reverse transcription and real time RT-PCR: All the cultures were grown for a week under dark and used for expression studies. Fungal total RNA was isolated using the "Total Quick RNA Cells and Tissues" Kit (Bio-Rad Laboratories Inc., Mississauga, ON, CA), according to the manufacturer's instructions, and stored at -80 °C. DNAse I treatment to remove the chromosomal DNA contamination from the samples was performed using the "Deoxyribonuclease I, Amplification Grade" (Invitrogen Corp., Carlsbad, CA, USA). First strand cDNA was synthesized using the "Iscript RNA PCR Reagent Kit" (Bio-Rad Laboratories Inc., Mississauga, ON, CA). Relative Quantification of aur gene expression was performed in a MiniOpticon Sequence Detection System using the SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Mississauga, ON, CA) and the primer pairs indicated above. The PCR thermal cycling conditions for both genes were as follows: an initial step at 95 0C for 10 min and 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. SYBR green PCR master mix 12.5 μl (Bio-Rad Laboratories Inc., Mississauga, ON, CA) was used as the reaction mixture, with the addition of 6.5 μl of sterile milli-Q water, 1.0 μl of each primer (5 μM), and 5 μl of template cDNA, in a final volume of 25 μl. In all the experiments, appropriate negative controls containing no template were subjected to the same procedure to exclude or detect any possible contamination or carryover. Each sample (triplicate) was amplified twice in every experiment. The results were normalized using the all fungi cDNA amplifications run on the same plate. The tub2 gene is an endogenous control that was used to normalize quantitation of mRNA target for differences in the amount of total cDNA added to each reaction. Real Time RT-PCR analysis is based on the threshold cycle (CT), which is defined as the first amplification cycle at which the fluorescence signal is greater than the minimal detection level, indicating that PCR products become detectable. Relative quantitation was the analytical method used in this study. A comparison within a sample is made with the gene of interest (aur) to that of the endogenous control gene {tub!). Quantitation is relative to the control gene by subtracting the CT of the control gene (tub2) from the CT of the gene of interest (aur) (ΔCT). Each ΔCT value (corresponding to each sample) was subtracted by the calibrator value (FpMMό-lC) to obtain the corresponding ΔΔCT values. ΔΔCT values were transformed to Iog2 (due to the doubling function of PCR) to generate the relative expression levels.
In total 9 isolates were subjected to RT-PCR analyses for quantitative gene expression analyses. Three kinds of colored samples were used in this study composed of 3 white colored, 3 moderately red colored and 3 dark red colored isolates. White colored isolate was used as control and their expression was normalized and taken as one. As reported moderately red colored isolates were able to tolerate 400C whereas; dark red isolates were able to tolerate 800C. When RT-PCR results observed dark colored isolates expressed almost more than 9 folds enhanced relative gene expression whereas, moderately red colored isolates expressed 4 folds enhanced expression (Figure 32).
Example 11
Greenhouse studies were performed to assess the effects of S. mycoparasitica inoculants on development of Fusarium head blight symptoms and the accumulation of tricothecene mycotoxin gene in wheat and barley spikes.
Fungal isolates and growth: S. mycoparasitica SMCD 2220, and F. graminearum 3 -ADON chemotype SMCD 2243 were obtained from the Saskatchewan Microbial Collection and Database (SMCD). These fungal cultures were grown on potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) supplemented with antibiotics prior to the study. Mycelial suspensions of these fungal strains (104 for F. graminearum and 106 for both biotrophic mycoparasite and antagonistic fungus) were produced for greenhouse experiment, as follows.
F. graminearum 3 -ADON chemotype strain was inoculated in potato dextrose broth (PDA, BD Biosciences, Mississauga, ON, CA), incubated at room temperature (-210C) in darkness using shaker (lOOrpm), for a week prior to harvesting the mycelia for greenhouse application. Mycelia of F. graminearnm were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and these mycelia were adjusted to concentration of 104 CFU/mL.
S. mycoparasitica was inoculated in the best preferment yeast peptone dextrose (YPD) (yeast, 5g; peptone, 1Og; dextrose, 1Og per 1 L of sterile-double distilled water) broth, incubated at room temp in darkness, using shaker at 100 rpm for a week prior to harvesting the mycelia. Mycelia of S. mycoparasitica were transferred into sterilized commercial blender for cutting the mycelial inoculants into small debris and the mycelia were adjusted to concentration of 104 CFU/mL for greenhouse application.
Greenhouse trials: The Fwsαπwm-susceptible wheat CDC-TEAL and barley BOLD cultivars were used to test the efficacy of biotrophic mycoparasite S. mycoparasitica and one potential Fusarium antagonistic fungal isolate as potential biocontrol agent for managing Fusarium head blight diseases. Surface-sterilized wheat and barley seeds were planted in 15-cm diameter pots containing Pro-Mix® soil (Sun Gro Horticulture, Delta, BC, CA) and maintained at 23-25 0C during the day time and 18-20 °C during the night time in a greenhouse with light intensity of 360 μmol m'2 s"1, watered every 2 d, and fertilized every 14 d using 1300 ppm of NPK (20-20- 20) fertilizer. All treatments in the experiment were with three replicates and repeated twice.
At the anthesis stage, wheat and barley spikes were sprayed with mycelial suspension of S. mycoparasitica at a concentration of 106 CFU/mL, antagonistic fungal isolate at a concentration of 106 CFU/mL, 65 μmol/L tebuconazole, or sterile distilled water. The treatments were applied as outlined in Xue et al. (2009, Can. J. Plant Pathol. 31 : 169-179) with slight modifications. Following the inoculation of potential biocontrol agents, plants were kept at room temperature and covered with sterile Whirl-Pak® bags (Whirl-Pak is a registered trademark of Aristotle Corp., Stamford, CT, USA) for overnight to allow fungal growth prior to F. graminearum inoculation. Plants were then inoculated with mycelial suspension of F. graminearum at a concentration of 104 CFU/mL. Fusarium graminearum inoculum was sprayed on the spikes and covered with sterile Whirl-Pak® bags for overnight. The inoculated plants were maintained for an additional 21 days prior to sampling. Percentage of infected spikelets (IS) per spike, FHB index, FDK, and weight of 100 seeds were rated as outlined in Xue et al. (2009). The FHB visual severity scale was determined according to the methods disclosed by Stack and McMullen (http://www.ag.ndsu.edu/pubs/plantsci/smgrains/pplO95w.htm).
The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in barley are shown in Figure 33. The data in Figures 33A, 33B, and 33C show that inoculation of a susceptible barley cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes. However, inoculation of the barley cultivar with S. mycoparasitica did not affect growth and development. Treatment of F. graminearum-infQctQd barley with S. mycoparasitica at an inoculation level of 106 CFU/mL prevented the onset of any Fusarium head blight symptoms. Treatment of F. graminearum-infected barley with lower concentrations of S. mycoparasitica, i.e., 104 CFU/mL and 105 CFU/mL, did not protect against the occurrence of the disease symptoms (Figures 33A - 33C).
The biocontrol effects of different concentrations of S. mycoparasitica of Fusarium head blight symptoms in wheat are shown in Figure 34. The data in Figures 34A, 34B, and 34C show that inoculation of a susceptible wheat cultivar with F. graminearum significantly reduced that height of the plants, average numbers of spikes form per plant, and the average weight of 5 spikes. However, inoculation of the wheat cultivar with S. mycoparasitica did not affect growth and development. Treatment of F. graminearum-infected wheat with S. mycoparasitica at an inoculation level of 106 CFU/mL prevented the onset of any Fusarium head blight symptoms. Treatment of F. graminearum-infected wheat with lower concentrations of S. mycoparasitica, i.e., 104 CFU/mL and 105 CFU/mL, did not protect against the occurrence of the disease symptoms (Figures 34A - 34C).
The data in Figure 35 and Table 8 show that treatment of F. graminearum-infected barley with S. mycoparasitica at an inoculation level of 106 CFU/mL provided a comparable level of protection against the occurrence of Fusarium head blight symptoms, as was provided by the commercial fungicide Folicur®. Table 8: Effect of S. mycoparasitica, Folicur® fungicide and F. graminearum on percentage of infected spikelets, Fusarium head blight index, percentage of Fusarium damaged kernels, and weight of 100 seeds of the barley cultivar BOLD in greenhouse trials. en
Figure imgf000061_0001
Real-time PCR quantification: Total DNA was extracted from the wheat and barly spices with DNeasy® Plant Mini Kit (Qiagen Inc., Mississauga, ON, CA). Extracted total DNAs from spikes of different treatments were employed in real-time PCR quantification. Two different primer sets and PCR conditions used in this study were described in Nicholson et al. (1998) for Fgl6NF/R primer set and Schnerr et al. (2001) for Tox5-l/2 primer set. Total DNA extracted from spring wheat and barley spikes harvested from greenhouse trials were carried out in a MiniOpticon (Bio-Rad Laboratories Inc., Mississauga, ON, CA). All real-time PCR reactions were performed using real-time PCR MJ white tubes (Bio-Rad Laboratories Inc., Mississauga, ON, CA) with a total volume of 25 μl of IQ supermix (Bio-Rad Laboratories Inc., Mississauga, ON, CA), 1 μl of each 10 μM forward/reverse primers (Invitrogen), 3.4 μl of BSA (Bovine Serum Albumin) (1.47 μg/μl) (Ishii and Loynachan 2004), 5.1 μl of sterilized UltraPure Millipore water, and 2 μl of DNA template.
Figure 36 shows standard curves of F. graminearum chemotype 3 genomic DNA concentration standards versus cycle threshold (Ct) with PCR reactions performed in triplicate using primer sets (A) Tox5-l/2, with genomic DNA ranging from 270 ng (Logio = 2.90) to 0.27 ng (Logio = -0.60), readings at 0.005 fluorescence line and (B) Fgl6NF/R, with DNA template ranging from 270 ng (Logio = 2.43) to 0.027 ng (Logio = -1-57); in 10-fold dilution series, readings at 0.025 fluorescence line. Error bars indicate standard deviation for the mean of F. graminearum chemotype 3 standard curves derived from tri5 gene and F. graminearum specific primer sets. Figure 37 shows effects of S. mycoparasitica (B) and Folicur fungicide (FoI) treatments on F. graminearum chemotype 3 -ADON genomic DNA detected in barley spikes employing RT-PCR. Treatments were: Fus - F. graminearum; B-Fus - 5*. mycoparasitica with F. graminearum; Fol-Fus - Folicur fungicide with F. graminearum. All values obtained were the means of six replicates. Error bars indicate standard deviation of the mean. Means of F. graminearum DNA with Tox 5 primer were log 10 transformed prior to LSD test. Both primer sets were analyzed separately. Values followed by the same letters within each primer set are not significantly different using LSD test at P < 0.05. Example 12
In addition to the known Fusarium spp. hosts for S. mycoparasitica (i.e., F. avenaceiim, F. graminearum and F. oxysporum), we surprisingly discovered that F. culmorum and F. equiseti are also mycoparasitised by S. mycoparasitica as disclosed in the following study.
Fungal isolates and growth: Biotrophic mycoparasites S. mycoparasitica SMCD2220, Sphaerodes quadrangular is strain CBSl 12764, Sphaerodes retispora var. retispora strain CBS 994.72, and pathogenic Fusarium strains (F. arthrosporioides SMCD2247, F. culmorum SMCD2248, F. equiseti SMCD2134, F. flocciferum SMCD2135, F. poae SMCD2136, and F. torulosum SMCD2139) were obtained from the Saskatchewan Microbial Collection and Database (SMCD), Saskatchewan, Canada. All fungal isolates were grown and maintained on potato dextrose agar (PDA, BD Biosciences, Mississauga, ON, CA) prior to the study.
Fungal-fungal interactions: For examination of the interaction between isolates of Sphaerodes and Fusarium species, both biotrophic mycoparasite and Fusarium isolates were inoculated and assessed using slide culture assays. Slides were maintained in a sterile humidity chamber and daily observations on the hyphal interactions at the meeting place (contact zone) were performed under a Carl Zeiss Axioskop2 equipped with Carl Zeiss AxioCam ICcI camera with 20 x, 40 x and 10Ox objectives. Formation of biotrophic mycoparasitic contact structures attaching Sphaerodes species to Fusarium hyphae were examined, recorded and compared to drawings from the literature (Jordan & Barnett, 1978, Mycologia 70: 300-312; Rakvidhyasastra & Butler, 1973, Mycologia 65: 580-593; Whaley & Barnett, 1963, Mycologia 55: 199-210). Diameters of both parasitized and non-parasitized Fusarium hyphal cells were measured under light microscopy with a 100χ objective lens. Each treatment used six replications consisted of Sphaerodes or Fusarium alone, and Sphaerodes-Fusarium co-inoculated. The experiment was repeated twice. In the slide-culture assay, Fusarium mycelia infected with Sphaerodes haustoria were stained with lactofuchsin. Stained hyphae of both Fusarium and Sphaerodes in slide-culture were then examined with a Carl Zeiss Axioskop2 fluorescent microscope attached to Carl Zeiss AxioCam ICcI with 40χ and 100χ objectives. Slide-culture assays were also subjected to Zeiss META 510 confocal laser scanning microscopy (CLSM) analysis to observe intracellular mycoparasitism under a C-Apochromat 63 x N. A.1.2 phase-contrast water immersion objective through Z-stacking mode to scan through the Fusarium hyphae with intracellular infection (CLSM with 514nm excitation - argon and LP585 emission filters).
Hyphae-hyphae interactions and contact structures in the contact zone were examined for seven days. On day three, Sphaerodes mycoparasitica was found to produce hook-shaped contact structures on F. equiseti and F. culmorum (Figure 39). On day five, more hook-shaped contact structures and intracellular penetration of F. equiseti were observed (Figures 39A, 39A-39D). The combination of lactofuchsin dye and fluorescent or confocal laser scanning microscopy revealed that the parasitized or penetrated Fusarium cells became empty (loss of cytoplasm = no fluorescence) or fluoresced with low intensity (very pale) (Figures 39A-39D) as compared to healthy Fusarium cells. During the seven days of observation, no S. mycoparasitica hyphae were observed within F. culmorum cells. S. mycoparasitica produced hook-shaped contact structures (Figure 38 A, a) more frequently than clamp-like contact structures (Figure 38B, b) on both F. equiseti and F. culmorum. Diameters of F. equiseti, but not F. culmorum, hyphae parasitized by S. mycoparasitica were observed to be significantly reduced compared to non-parasitized Fusarium hyphae (with T-test, P = 0.001 and P > 0.05, respectively) (Figure 41).
None of the Fusarium taxa tested appeared to be suitable hosts for mycoparasitic S. quadrangular is and S. retispora even after 10 days of co-inoculation on slide cultures. No contact biotrophic parasitic structures or intracellular parasitism by S. quadrangular is and S. retispora on the tested Fusarium strains were observed at the interaction or contact zone. Also, F. arthrosporioides, F. flocciferum, F. poae, and F. torulosum did not appear to be suitable hosts for S. mycoparasitica. Around five days after inoculation on slide culture assays, mycelia of F. arthrosporioides were inhibited by S. mycoparasitica. F. arthrosporioides started to form rosette-like mycelia at the contact zone with S. mycoparasitica (Figure 39B).
On the fifth and seventh days after inoculation, anamorphic structures were produced by S. mycoparasitica more abundantly in the zone of contact with F. culmorum (Figures 4OC and 40D). Anamorphic structures or asexual organs in close proximity to F. culmorum mycelia were red-colored (Figure 40D), whereas the organs at a distance were not (Figure 40C).

Claims

1. A biologically pure culture of Sphaerodes mycoparasitia strain IDAC 301008-01.
2. A biologically pure culture of Sphaerodes mycoparasitia strain SMCD2220-01.
3. An isolated nucleic acid molecule from a biologically pure culture of Sphaerodes mycoparasitia, comprising a nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:3.
4. A nucleotide construct comprising a nucleic acid molecule according to claim 3, wherein the nucleic acid molecule is operably linked to a promoter that drives expression in a cell.
5. A microbial cell having stably incorporated into its genome at least one nucleotide construct comprising a nucleic acid operably linked to a promoter that drives expression of said nucleic acid in said microbial cell, wherein said nucleic acid comprises the nucleotide sequence set forth in one of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO:3.
6. Use of a culture of Sphaerodes mycoparasitia strain IDAC 301008-01 or strain SMCD2220-01 for controlling disease symptoms caused by Fusarium spp. in plants.
7. Use of a culture of the microbial cell of claim 5 for controlling disease symptoms caused by Fusarium spp. in plants.
8. Use of a culture according to claim 6 or 7, for modulating synthesis of one of a Fusarium trichothecene mycotoxin deoxynivalenol (DON), mycotoxin 3-ADON, mycotoxin 15-ADON, mycotoxin zerelanone, and mycotoxin aurofusarin.
9. A composition for controlling disease symptoms caused by Fusarium spp. in plants, the composition comprising a culture of Sphaerodes mycoparasitia strain IDAC 301008-01 and/or strain SMCD2220-01 and a carrier therefor.
10. A composition for controlling disease symptoms caused by Fusarium spp. in plants, the composition comprising a microbial culture of a microbial cell according to claim 5 and a carrier therefor.
11. A composition according to claim 9 or 10, for modulating synthesis of one of a Fusarium trichothecene mycotoxin deoxynivalenol (DON), myco toxin 3 -ADON, mycotoxin 15-ADON, mycotoxin zerelanone, and mycotoxin aurofusarin.
12. A method for controlling disease symptoms caused by Fusarium spp. in plants, the method comprising treating a batch of seeds with the composition of claim 9 or 10, and then culturing the treated seeds into plants.
13. A method for controlling disease symptoms caused by Fusarium spp. in plants, the method comprising treating a batch of seeds with the culture of claim 6 or 7, and then culturing the treated seeds into plants.
14. A method for controlling disease symptoms caused by Fusarium spp. in plants, the method comprising treating the plants with the composition of claim 9 or 10.
15. A method for controlling disease symptoms caused by Fusarium spp. in plants, the method comprising treating the plants with the culture of claim 6 or 7.
16. A method according to any of claims 12 to 15, wherein synthesis of one of a Fusarium mycotoxin 3-ADON, mycotoxin 15-ADON, mycotoxin zerelanone, and mycotoxin aurofusarin, is modulated.
17. An exocellular protein recoverable from a culture of Sphaerodes mycoparasitia strain IDAC 301008-01, said exocellular protein having a molecular weight of 13 kDa.
18. An exocellular protein recoverable from a culture of Sphaerodes mycoparasitia strain IDAC 301008-01, said exocellular protein having a molecular weight of 50 kDa.
19. Use of the exocellular protein of claim 17 or 18 for controlling disease symptoms caused by Fusarium spp. in plants.
20. A composition for controlling disease symptoms caused by Fusarium spp. in plants, the composition comprising the exocellular protein of claim 17 or 18, and a carrier therefor.
21. A method for testing a sample of plant seeds for the presence therein of aurofusarin, the method comprising:
processing a portion of the sample of plant seeds to produce a DNA sample therefrom; and processing the DNA sample with a PCR primer set comprising a set of gene sequences set forth in SEQ ID NO: 32 and SEQ ID NO: 33 to detect the presence and/or expression therein of a gene or gene sequence coding for aurofusarin.
22. An isolated nucleic acid molecule comprising a nucleotide sequence set forth in SEQ ID NO: 32 or SEQ ID NO: 33.
23. A nucleotide construct comprising a nucleic acid molecule according to claim 22.
PCT/CA2010/001253 2009-08-28 2010-08-30 Fusarium and fusarium mycotoxin biocontrol WO2011022809A1 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
AU2010286276A AU2010286276B2 (en) 2009-08-28 2010-08-30 Fusarium and Fusarium mycotoxin biocontrol
JP2012525827A JP2013502902A (en) 2009-08-28 2010-08-30 Biological regulators for fusarium and fusarium mycotoxins
UAA201203725A UA104050C2 (en) 2009-08-28 2010-08-30 Isolated culture of sphaerodes mycoparasitica for control of fusarium spp
CA2772106A CA2772106C (en) 2009-08-28 2010-08-30 Fusarium and fusarium mycotoxin biocontrol
EP10811051.1A EP2470659A4 (en) 2009-08-28 2010-08-30 Fusarium and fusarium mycotoxin biocontrol
EA201270327A EA201270327A1 (en) 2009-08-28 2010-08-30 BIOLOGICAL REGULATION OF FUSARIUM AND MYCOTOXIN FUSARIUM
BRBR112012004160-6A BR112012004160A2 (en) 2009-08-28 2010-08-30 Fusarium biocontrol and fusarium mycotoxins
US13/405,771 US20120156173A1 (en) 2009-08-28 2012-02-27 Fusarium and other pathogenic fungi and mycotoxin biocontrol
IN2475DEN2012 IN2012DN02475A (en) 2009-08-28 2012-03-21
US14/556,624 US20150150921A1 (en) 2009-08-28 2014-12-01 Fusarium and other pathogenic fungi and mycotoxin biocontrol

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US23790609P 2009-08-28 2009-08-28
US61/237,906 2009-08-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/405,771 Continuation-In-Part US20120156173A1 (en) 2009-08-28 2012-02-27 Fusarium and other pathogenic fungi and mycotoxin biocontrol

Publications (1)

Publication Number Publication Date
WO2011022809A1 true WO2011022809A1 (en) 2011-03-03

Family

ID=43627106

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2010/001253 WO2011022809A1 (en) 2009-08-28 2010-08-30 Fusarium and fusarium mycotoxin biocontrol

Country Status (9)

Country Link
EP (1) EP2470659A4 (en)
JP (1) JP2013502902A (en)
AU (1) AU2010286276B2 (en)
BR (1) BR112012004160A2 (en)
CA (1) CA2772106C (en)
EA (1) EA201270327A1 (en)
IN (1) IN2012DN02475A (en)
UA (1) UA104050C2 (en)
WO (1) WO2011022809A1 (en)

Cited By (58)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014053404A1 (en) 2012-10-01 2014-04-10 Basf Se Pesticidally active mixtures comprising anthranilamide compounds
WO2014053395A1 (en) 2012-10-01 2014-04-10 Basf Se Use of n-thio-anthranilamide compounds on cultivated plants
WO2014053405A1 (en) 2012-10-01 2014-04-10 Basf Se Pesticidally active mixtures comprising anthranilamide compounds
WO2014053406A1 (en) 2012-10-01 2014-04-10 Basf Se Method of controlling ryanodine-modulator insecticide resistant insects
WO2014053407A1 (en) 2012-10-01 2014-04-10 Basf Se N-thio-anthranilamide compounds and their use as pesticides
WO2014053403A1 (en) 2012-10-01 2014-04-10 Basf Se Method of controlling insecticide resistant insects
WO2014053401A2 (en) 2012-10-01 2014-04-10 Basf Se Method of improving plant health
WO2014056780A1 (en) 2012-10-12 2014-04-17 Basf Se A method for combating phytopathogenic harmful microbes on cultivated plants or plant propagation material
WO2014079820A1 (en) 2012-11-22 2014-05-30 Basf Se Use of anthranilamide compounds for reducing insect-vectored viral infections
WO2014082871A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides
WO2014082879A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted [1,2,4]triazole compounds
WO2014082881A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides
WO2014082880A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted [1,2,4] triazole compounds
WO2014086850A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a fungicidal inhibitor of respiratory complex ii
WO2014086856A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a biopesticide
WO2014086854A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a plant growth regulator
EP2746256A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP2746258A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746255A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746278A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746277A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP2746262A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds for combating phytopathogenic fungi
EP2746259A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746257A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746279A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP2746260A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746263A1 (en) 2012-12-19 2014-06-25 Basf Se Alpha-substituted triazoles and imidazoles
EP2746267A2 (en) 2012-12-19 2014-06-25 Basf Se New substituted triazoles and imidazoles and their use as fungicides
EP2746264A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2014095555A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095534A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095672A1 (en) 2012-12-19 2014-06-26 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
WO2014095547A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095381A1 (en) 2012-12-19 2014-06-26 Basf Se Fungicidal imidazolyl and triazolyl compounds
WO2014095548A1 (en) 2012-12-19 2014-06-26 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
WO2014124850A1 (en) 2013-02-14 2014-08-21 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2014147528A1 (en) 2013-03-20 2014-09-25 Basf Corporation Synergistic compositions comprising a bacillus subtilis strain and a biopesticide
EP2815649A1 (en) 2013-06-18 2014-12-24 Basf Se Fungicidal mixtures II comprising strobilurin-type fungicides
WO2015011615A1 (en) 2013-07-22 2015-01-29 Basf Corporation Mixtures comprising a trichoderma strain and a pesticide
WO2015036058A1 (en) 2013-09-16 2015-03-19 Basf Se Fungicidal pyrimidine compounds
WO2015036059A1 (en) 2013-09-16 2015-03-19 Basf Se Fungicidal pyrimidine compounds
WO2015055757A1 (en) 2013-10-18 2015-04-23 Basf Se Use of pesticidal active carboxamide derivative in soil and seed application and treatment methods
WO2015086462A1 (en) 2013-12-12 2015-06-18 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2015091645A1 (en) 2013-12-18 2015-06-25 Basf Se Azole compounds carrying an imine-derived substituent
WO2015104422A1 (en) 2014-01-13 2015-07-16 Basf Se Dihydrothiophene compounds for controlling invertebrate pests
EP2924027A1 (en) 2014-03-28 2015-09-30 Basf Se Substituted [1,2,4]triazole and imidazole fungicidal compounds
EP2949649A1 (en) 2014-05-30 2015-12-02 Basf Se Fungicide substituted [1,2,4]triazole and imidazole compounds
EP2949216A1 (en) 2014-05-30 2015-12-02 Basf Se Fungicidal substituted alkynyl [1,2,4]triazole and imidazole compounds
EP2952506A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2952512A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole compounds
EP2952507A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole compounds
EP2962568A1 (en) 2014-07-01 2016-01-06 Basf Se Mixtures comprising a bacillus amyliquefaciens ssp. plantarum strain and a pesticide
EP3111763A1 (en) 2015-07-02 2017-01-04 BASF Agro B.V. Pesticidal compositions comprising a triazole compound
CN107916266A (en) * 2017-12-05 2018-04-17 华中农业大学 Fusarium toxin detoxification path related gene ADH, AKR6D1, AKR13B2 and its application
CN110724643A (en) * 2019-11-18 2020-01-24 河南省农业科学院植物保护研究所 Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof
EP3628158A1 (en) 2018-09-28 2020-04-01 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
US10899932B2 (en) 2014-10-24 2021-01-26 Basf Se Non-amphoteric, quaternisable and water-soluble polymers for modifying the surface charge of solid particles
CN113832038A (en) * 2021-09-27 2021-12-24 中国农业科学院植物保护研究所 Fusarium equiseti (Fusarium equiseti) K2017-696 and application thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110286190B (en) * 2019-06-26 2024-03-22 山东农业大学 Method for simultaneously measuring DON and multiple DON bioconversion products

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120156173A1 (en) * 2009-08-28 2012-06-21 Vladimir Vujanovic Fusarium and other pathogenic fungi and mycotoxin biocontrol

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
GOH, Y.K. ET AL.: "Biotrophic mycoparasitic interactions between Sphaerodes mycoparasitica and phytopathogenic Fusarium species.", BIOCONTROL SCIENCE AND TECHNOLOGY., vol. 20, no. 9, 30 April 2010 (2010-04-30), pages 891 - 902, XP008151207 *
HAVERSON, R.M. ET AL.: "Novel use of a Pyrenomycetous Mycoparasite for Management of Fusarium Wilt of Watermelon.", PLANT DISEASE., vol. 86, no. 9, September 2002 (2002-09-01), pages 1025 - 1030, XP008151214 *
See also references of EP2470659A4 *
VUJANOVIC, V. ET AL.: "Sphaerodes mycoparasitica sp. nov., a new biotrophic mycoparasite on Fusarium avenaceum, F. graminearum and F. oxysporum.", MYCOLOGICAL RESEARCH., vol. 113, 1 September 2009 (2009-09-01), pages 1172 - 1180, XP026709811 *

Cited By (65)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014053404A1 (en) 2012-10-01 2014-04-10 Basf Se Pesticidally active mixtures comprising anthranilamide compounds
WO2014053395A1 (en) 2012-10-01 2014-04-10 Basf Se Use of n-thio-anthranilamide compounds on cultivated plants
WO2014053405A1 (en) 2012-10-01 2014-04-10 Basf Se Pesticidally active mixtures comprising anthranilamide compounds
WO2014053406A1 (en) 2012-10-01 2014-04-10 Basf Se Method of controlling ryanodine-modulator insecticide resistant insects
WO2014053407A1 (en) 2012-10-01 2014-04-10 Basf Se N-thio-anthranilamide compounds and their use as pesticides
WO2014053403A1 (en) 2012-10-01 2014-04-10 Basf Se Method of controlling insecticide resistant insects
WO2014053401A2 (en) 2012-10-01 2014-04-10 Basf Se Method of improving plant health
WO2014056780A1 (en) 2012-10-12 2014-04-17 Basf Se A method for combating phytopathogenic harmful microbes on cultivated plants or plant propagation material
WO2014079820A1 (en) 2012-11-22 2014-05-30 Basf Se Use of anthranilamide compounds for reducing insect-vectored viral infections
WO2014082871A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides
WO2014082879A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted [1,2,4]triazole compounds
WO2014082881A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted 2-[phenoxy-phenyl]-1-[1,2,4]triazol-1-yl-ethanol compounds and their use as fungicides
WO2014082880A1 (en) 2012-11-27 2014-06-05 Basf Se Substituted [1,2,4] triazole compounds
WO2014086850A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a fungicidal inhibitor of respiratory complex ii
WO2014086856A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a biopesticide
WO2014086854A1 (en) 2012-12-04 2014-06-12 Basf Agro B.V., Arnhem (Nl) Compositions comprising a quillay extract and a plant growth regulator
EP2746256A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP3181558A1 (en) 2012-12-19 2017-06-21 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
EP2746278A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746277A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP2746262A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds for combating phytopathogenic fungi
EP2746279A1 (en) 2012-12-19 2014-06-25 Basf Se Fungicidal imidazolyl and triazolyl compounds
EP2746263A1 (en) 2012-12-19 2014-06-25 Basf Se Alpha-substituted triazoles and imidazoles
EP2746267A2 (en) 2012-12-19 2014-06-25 Basf Se New substituted triazoles and imidazoles and their use as fungicides
EP2746264A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746255A1 (en) 2012-12-19 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2014095555A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095534A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095672A1 (en) 2012-12-19 2014-06-26 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
WO2014095547A1 (en) 2012-12-19 2014-06-26 Basf Se New substituted triazoles and imidazoles and their use as fungicides
WO2014095381A1 (en) 2012-12-19 2014-06-26 Basf Se Fungicidal imidazolyl and triazolyl compounds
WO2014095548A1 (en) 2012-12-19 2014-06-26 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
EP3173406A1 (en) 2012-12-19 2017-05-31 Basf Se Substituted [1,2,4]triazole compounds and their use as fungicides
EP2746259A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746257A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746258A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2746260A1 (en) 2012-12-21 2014-06-25 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2014124850A1 (en) 2013-02-14 2014-08-21 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2014147528A1 (en) 2013-03-20 2014-09-25 Basf Corporation Synergistic compositions comprising a bacillus subtilis strain and a biopesticide
EP2815649A1 (en) 2013-06-18 2014-12-24 Basf Se Fungicidal mixtures II comprising strobilurin-type fungicides
EP2815650A1 (en) 2013-06-18 2014-12-24 Basf Se Fungicidal mixtures II comprising strobilurin-type fungicides
WO2015011615A1 (en) 2013-07-22 2015-01-29 Basf Corporation Mixtures comprising a trichoderma strain and a pesticide
WO2015036059A1 (en) 2013-09-16 2015-03-19 Basf Se Fungicidal pyrimidine compounds
WO2015036058A1 (en) 2013-09-16 2015-03-19 Basf Se Fungicidal pyrimidine compounds
EP3456201A1 (en) 2013-10-18 2019-03-20 BASF Agrochemical Products B.V. Use of pesticidal active carboxamide derivative in soil and seed application and treatment meth-ods
WO2015055757A1 (en) 2013-10-18 2015-04-23 Basf Se Use of pesticidal active carboxamide derivative in soil and seed application and treatment methods
WO2015086462A1 (en) 2013-12-12 2015-06-18 Basf Se Substituted [1,2,4]triazole and imidazole compounds
WO2015091645A1 (en) 2013-12-18 2015-06-25 Basf Se Azole compounds carrying an imine-derived substituent
WO2015104422A1 (en) 2014-01-13 2015-07-16 Basf Se Dihydrothiophene compounds for controlling invertebrate pests
EP2924027A1 (en) 2014-03-28 2015-09-30 Basf Se Substituted [1,2,4]triazole and imidazole fungicidal compounds
EP2949649A1 (en) 2014-05-30 2015-12-02 Basf Se Fungicide substituted [1,2,4]triazole and imidazole compounds
EP2949216A1 (en) 2014-05-30 2015-12-02 Basf Se Fungicidal substituted alkynyl [1,2,4]triazole and imidazole compounds
EP2952506A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole and imidazole compounds
EP2952507A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole compounds
EP2952512A1 (en) 2014-06-06 2015-12-09 Basf Se Substituted [1,2,4]triazole compounds
EP2962568A1 (en) 2014-07-01 2016-01-06 Basf Se Mixtures comprising a bacillus amyliquefaciens ssp. plantarum strain and a pesticide
US10899932B2 (en) 2014-10-24 2021-01-26 Basf Se Non-amphoteric, quaternisable and water-soluble polymers for modifying the surface charge of solid particles
EP3111763A1 (en) 2015-07-02 2017-01-04 BASF Agro B.V. Pesticidal compositions comprising a triazole compound
CN107916266B (en) * 2017-12-05 2020-08-11 华中农业大学 Fusarium toxin detoxification pathway related genes ADH, AKR6D1 and AKR13B2 and application thereof
CN107916266A (en) * 2017-12-05 2018-04-17 华中农业大学 Fusarium toxin detoxification path related gene ADH, AKR6D1, AKR13B2 and its application
EP3628158A1 (en) 2018-09-28 2020-04-01 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
WO2020064480A1 (en) 2018-09-28 2020-04-02 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
CN110724643A (en) * 2019-11-18 2020-01-24 河南省农业科学院植物保护研究所 Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof
CN110724643B (en) * 2019-11-18 2022-07-15 河南省农业科学院植物保护研究所 Penicillium citrinum with disease prevention and growth promotion functions, microbial inoculum and application thereof
CN113832038A (en) * 2021-09-27 2021-12-24 中国农业科学院植物保护研究所 Fusarium equiseti (Fusarium equiseti) K2017-696 and application thereof

Also Published As

Publication number Publication date
EP2470659A4 (en) 2013-07-10
EP2470659A1 (en) 2012-07-04
UA104050C2 (en) 2013-12-25
CA2772106C (en) 2017-11-07
AU2010286276A1 (en) 2012-03-08
CA2772106A1 (en) 2011-03-03
BR112012004160A2 (en) 2015-09-01
IN2012DN02475A (en) 2015-08-21
AU2010286276B2 (en) 2013-12-12
JP2013502902A (en) 2013-01-31
EA201270327A1 (en) 2013-03-29

Similar Documents

Publication Publication Date Title
AU2010286276B2 (en) Fusarium and Fusarium mycotoxin biocontrol
You et al. Multiple criteria-based screening of Trichoderma isolates for biological control of Botrytis cinerea on tomato
RU2634386C2 (en) Microbacterium strain, compositions and methods to combat fusariosis
Shanmugam et al. Biocontrol of vascular wilt and corm rot of gladiolus caused by Fusarium oxysporum f. sp. gladioli using plant growth promoting rhizobacterial mixture
Sreedevi et al. Isolation and screening of effective Trichoderma spp. against the root rot pathogen Macrophomina phaseolina.
Jaihan et al. Selection of entomopathogenic fungus for biological control of chili anthracnose disease caused by Colletotrichum spp.
Phong et al. Antifungal Activities of Chaetomium spp. against Fusarium Wilt of Tea.
US20220017856A1 (en) Anti-phytopathogenic compositions
Martínez-Arias et al. Enhancement of Populus alba tolerance to Venturia tremulae upon inoculation with endophytes showing in vitro biocontrol potential
WO2019035067A1 (en) Organic fungicide derived through microbial fermentation
US20150150921A1 (en) Fusarium and other pathogenic fungi and mycotoxin biocontrol
Kumar et al. Trichoderma spp.: Identification and characterization for pathogenic control and its potential application
Leplat et al. Colonization dynamic of various crop residues by Fusarium graminearum monitored through real‐time PCR measurements
Vilavong et al. Application of a new bio-formulation of Chaetomium cupreum for biocontrol of Colletotrichum gloeosporioides causing coffee anthracnose on Arabica variety in Laos.
WO2010115802A1 (en) New actinomycetes strain compositions and their use for the prevention and/or the control of micro organism inducing plant diseases
Mahmoud et al. Genetic diversity and biological control of Rhizoctonia solani associated with root rot of soybean in assiut governorate, Egypt
ES2696982B2 (en) Endophytic fungi HTF58 Alternaria alternata and HRO8 Fusarium acuminatum from Artemisa thuscula and Artemisa austriaca as antifungals for agricultural use
Ibrahim et al. Fungi as potential biocontrol agents against Convolvulus arvensis and Portulaca oleracea infesting the agroecosystems of Egypt
KR101876939B1 (en) Composition for controlling plant disease comprising Aspergillus persii strain producing penicillic acid as effective component and uses thereof
Elshahawy et al. Antagonistic activity of Trichoderma asperellum against Fusarium species, chemical profile and their efficacy for management of Fusarium‐root rot disease in dry bean
KR100459066B1 (en) Method for the biological control of plant diseases using chaetomium globosum f0142 and chaetoviridins a and b produced by same
CN112955538A (en) Method for biologically controlling fusarium ear blight of grain
WO2015111081A2 (en) An herbicidal composition for controlling parthenium weed and strain thereof
WO2021130735A1 (en) Organic fungicide derived through microbial fermentation and efficient formulation
Bastos Isolate of Trichoderma brevicompactum for the control of cocoa witches' broom disease: preliminary results

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10811051

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2010286276

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2772106

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2012525827

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2010286276

Country of ref document: AU

Date of ref document: 20100830

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2475/DELNP/2012

Country of ref document: IN

REEP Request for entry into the european phase

Ref document number: 2010811051

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2010811051

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: A201203725

Country of ref document: UA

Ref document number: 201270327

Country of ref document: EA

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112012004160

Country of ref document: BR

ENP Entry into the national phase

Ref document number: 112012004160

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20120224