WO2006066594A2 - Alpha-amylase variants - Google Patents
Alpha-amylase variants Download PDFInfo
- Publication number
- WO2006066594A2 WO2006066594A2 PCT/DK2005/000817 DK2005000817W WO2006066594A2 WO 2006066594 A2 WO2006066594 A2 WO 2006066594A2 DK 2005000817 W DK2005000817 W DK 2005000817W WO 2006066594 A2 WO2006066594 A2 WO 2006066594A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alpha
- amylase
- variant
- seq
- bacillus
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
- C12N9/2411—Amylases
- C12N9/2414—Alpha-amylase (3.2.1.1.)
- C12N9/2417—Alpha-amylase (3.2.1.1.) from microbiological source
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02E—REDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
- Y02E50/00—Technologies for the production of fuel of non-fossil origin
- Y02E50/10—Biofuels, e.g. bio-diesel
Definitions
- the present invention relates, inter alia, to novel variants of parent Termamyl-like alpha- amylases, notably variants exhibiting altered properties, in particular altered starch affinity (relative to the parent) which are advantageous with respect to applications of the variants in, in particular, industrial starch processing (e.g., starch liquefaction or saccharification).
- industrial starch processing e.g., starch liquefaction or saccharification
- Alpha-Amylases (alpha-1,4-glucan-4-glucanohydrolases, EC 3.2.1.1) constitute a group of enzymes which catalyze hydrolysis of starch and other linear and branched 1 ,4-glucosidic oligo- and polysaccharides.
- alpha-amylase such as Termamyl-like alpha- amylases variants are known from, e.g., WO 90/11352, WO 95/10603, WO 95/26397, WO 96/23873, WO 96/23874 and WO 97/41213.
- WO 96/23874 provides three-dimensional, X-ray crystal structural data for a Termamyl-like alpha-amylase, referred to as BA2, which consists of the 300 N-terminal amino acid residues of the S. amyloliquefaciens alpha-amylase comprising the amino acid sequence shown in SEQ ID NO: 6 herein and amino acids 301-483 of the C-terminal end of the B.
- licheniformis alpha-amylase comprising the amino acid sequence shown in SEQ ID NO: 4 herein (the latter being available commercially under the tradename TermamylTM), and which is thus closely related to the industrially important Bacillus alpha-amylases (which in the present context are embraced within the meaning of the term "Termamyl-like alpha-amylases", and which include, inter alia, the B. licheniformis, B. amyloliquefaciens and B. stearothermophilus alpha-amylases).
- WO 96/23874 further describes methodology for designing, on the basis of an analysis of the structure of a parent Termamyl- like alpha-amylase, variants of the parent Termamyl-like alpha-amylase which exhibit altered properties relative to the parent.
- the present invention relates to novel alpha-amylolytic variants (mutants) of a Termamyl- like alpha-amylase, in particular variants exhibiting altered starch affinity (relative to the parent), which hadvantageous in connection with the industrial processing of starch (starch liquefaction, saccharification and the like).
- the inventors have found that the variants with altered properties, in particular altered starch affinity, improves the conversion of starch as compared to the parent Termamyl-like alpha-amylase.
- the invention further relates to DNA constructs encoding variants of the invention, to composition comprising variants of the invention, to methods for preparing variants of the invention, and to the use of variants and compositions of the invention, alone or in combination with other alpha-amylolytic enzymes, in various industrial processes, e.g., starch liquefaction, and in detergent compositions, such as laundry, dish washing and hard surface cleaning compositions; ethanol production, such as fuel, drinking and industrial ethanol production; desizing of textiles, fabrics or garments etc.
- various industrial processes e.g., starch liquefaction, and in detergent compositions, such as laundry, dish washing and hard surface cleaning compositions
- ethanol production such as fuel, drinking and industrial ethanol production
- alpha-amylase variants of the invention are described by use of the following nomenclature: Original amino acid(s): position(s): substituted amino acid(s) According to this nomenclature, for instance the substitution of alanine for asparagine in position 30 is shown as:
- Ala30* or A30* and insertion of an additional amino acid residue, such as lysine, is shown as: Ala30Alal_ysor A30AK
- a deletion of a consecutive stretch of amino acid residues, such as amino acid residues 30-33, is indicated as (30-33)* or ⁇ (A30-N33).
- Ala30Asn + Glu34Ser or A30N+E34S representing mutations in positions 30 and 34 substituting alanine and glutamic acid for asparagine and serine, respectively.
- any amino acid residue may be substituted for the amino acid residue present in the position.
- the alanine may be deleted or substituted for any other amino acid, i.e., any one of: R,N,D,A,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V.
- A30X means any one of the following substitutions: A30R, A30N, A30D, A30C, A30Q, A30E, A30G, A30H, A30I, A30L, A30K, A30M, A30F, A30P, A30S, A30T, A30W, A30Y, or A30 V; or in short: ASOR 1 N 1 D 1 C 1 Q 1 E 1 G 1 H 1 I 1 L 1 K 1 M 1 F 1 P 1 S 1 T 1 W 1 Y 1 V.
- Negatively charged amino acids (with the most negative residue first): Asp, GIu
- Neutral amino acids GIy, Ala, VaI, Leu, lie, Phe, Tyr, Trp, Met, Cys, Asn, GIn, Ser, Thr, Pro
- Hydrophobic amino acid residues (with the most hydrophobic residue listed last): GIy, Ala, VaI, Pro, Met, Leu, lie, Tyr, Phe, Trp,
- Hvdrophilic amino acids (with the most hvdrophilic residue listed last): Thr, Ser, Cys, GIn, Asn
- alpha-amylases produced by Bacillus spp. are highly homologous on the amino acid level.
- the B. licheniformis alpha-amylase comprising the amino acid sequence shown in SEQ ID NO: 4 (commercially available as TermamylTM) has been found to be about 89% homologous with the S. amyloliquefaciens alpha- amylase comprising the amino acid sequence shown in SEQ ID NO: 6 and about 79% homologous with the S. stearothermophilus alpha-amylase comprising the amino acid sequence shown in SEQ ID NO: 8.
- alpha-amylases include an alpha- amylase derived from a strain of the Bacillus sp. NCIB 12289, NCIB 12512, NCIB 12513 or DSM 9375, all of which are described in detail in WO 95/26397, and the #707 alpha-amylase described by Tsukamoto et al., Biochemical and Biophysical Research Communications, 151 (1988), pp. 25-31.
- alpha-amylases include the alpha-amylase produced by the B. licheniformis strain described in EP 0252666 (ATCC 27811), and the alpha-amylases identified in WO 91/00353 and WO 94/18314.
- Termamyl-like alpha-amylases are comprised in the products sold under the following tradenames: OptithermTM and TakathermTM (available from Solvay); MaxamylTM (available from Gist-brocades/Genencor), Spezym AATM and Spezyme Delta AATM (available from Genencor), and KeistaseTM (available from Daiwa), PurastarTM ST 5000E, PURASTRATM HPAM L (from Genencor Int.).
- alpha-amylases Because of the substantial homology found between these alpha-amylases, they are considered to belong to the same class of alpha-amylases, namely the class of "Termamyl-like alpha-amylases".
- Termamyl-like alpha-amylase is intended to indicate an alpha-amylase, which at the amino acid level exhibits a substantial homology to TermamylTM, i.e., the ⁇ . licheniformis alpha-amylase having the amino acid sequence shown in SEQ ID NO: 4 herein.
- a Termamyl-like alpha-amylase is an alpha-amylase, which has the amino acid sequence shown in SEQ ID NO: 2, 4, or 6 herein, and the amino acid sequence shown in SEQ ID NO: 1 or 2 of WO 95/26397 or in Tsukamoto et al., 1988, or i) which displays at least 60%, preferred at least 70%, more preferred at least 75%, even more preferred at least 80%, especially at least 85%, especially preferred at least 90%, even especially more preferred at least 95% homology, more preferred at least 97%, more preferred at least 99% with at least one of said amino acid sequences and/or ii) displays immunological cross-reactivity with an antibody raised against at least one of said alpha-amylases, and/or iii) is encoded by a DNA sequence which hybridises to the DNA sequences encoding the above-specified alpha- amylases which are apparent from SEQ ID NOS: 1 , 3, and 5 of the present application and SEQ ID NO
- the homology may be determined as the degree of identity between the two sequences indicating a derivation of the first sequence from the second.
- the homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (described above).
- GAP provided in the GCG program package (described above).
- GAP creation penalty of 5.0 and GAP extension penalty of 0.3, respectively for nucleic acidic sequence comparison
- GAP creation penalty of 3.0 and GAP extension penalty of 0.1 respectively, for protein sequence comparison.
- GAP uses the method of Needleman and Wunsch, (1970), J. MoI. Biol. 48, p.443- 453, to make alignments and to calculate the identity.
- a structural alignment between Termamyl and a Termamyl-like alpha-amylase may be used to identify equivalent/corresponding positions in other Termamyl-like alpha-amylases.
- One method of obtaining said structural alignment is to use the Pile Up programme from the GCG package using default values of gap penalties, i.e., a gap creation penalty of 3.0 and gap exten- sion penalty of 0.1.
- Other structural alignment methods include the hydrophobic cluster analysis (Gaboriaud et al., (1987), FEBS LETTERS 224, pp. 149-155) and reverse threading (Huber, T ; Torda, AE, PROTEIN SCIENCE Vol. 7, No. 1 pp. 142-149 (1998).
- the immunological cross reactivity may be assayed using an antibody raised against, or reactive with, at least one epitope of the relevant Termamyl-like alpha-amylase.
- the antibody which may either be monoclonal or polyclonal, may be produced by methods known in the art, e.g., as described by Hudson et al., Practical Immunology, Third edition (1989), Black- well Scientific Publications.
- the immunological cross-reactivity may be determined using assays known in the art, examples of which are Western Blotting or radial immunodiffusion assay, e.g., as described by Hudson et al., 1989. In this respect, immunological cross-reactivity between the alpha-amylases having the amino acid sequences SEQ ID NOS: 2, 4, 6, or 8, respectively, have been found.
- the oligonucleotide probe used in the characterization of the Termamyl-like alpha-amylase in accordance with property iii) above may suitably be prepared on the basis of the full or partial nucleotide or amino acid sequence of the alpha-amylase in question.
- Suitable conditions for testing hybridization involve presoaking in 5xSSC and prehybri- dizing for 1 hour at ⁇ 40°C in a solution of 20% formamide, 5xDenhardt's solution, 5OmM sodium phosphate, pH 6.8, and 50mg of denatured sonicated calf thymus DNA, followed by hybridiza- tion in the same solution supplemented with 10OmM ATP for 18 hours at -4O 0 C, followed by three times washing of the filter in 2xSSC, 0.2% SDS at 40 0 C for 30 minutes (low stringency), preferred at 50 0 C (medium stringency), more preferably at 65 0 C (high stringency), even more preferably at ⁇ 75°C (very high stringency). More details about the hybridization method can be found in Sambrook et al., Molecular_Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, 1989.
- derived from is intended not only to indicate an alpha-amylase produced or producible by a strain of the organism in question, but also an alpha-amylase encoded by a DNA sequence isolated from such strain and produced in a host organism trans- formed with said DNA sequence.
- the term is intended to indicate an alpha-amylase, which is encoded by a DNA sequence of synthetic and/or cDNA origin and which has the identifying characteristics of the alpha-amylase in question.
- the parent alpha-amylase may be a variant of a naturally occurring alpha-amylase, i.e. a variant, which is the result of a modification (insertion, substitution, deletion) of one or more amino acid residues of the naturally occurring alpha-amylase.
- the parent alpha-amylase may be a hybrid alpha-amylase, i.e., an alpha-amylase, which comprises a combination of partial amino acid sequences derived from at least two alpha-amylases.
- the parent hybrid alpha-amylase may be one, which on the basis of amino acid homology and/or immunological cross-reactivity and/or DNA hybridization (as defined above) can be determined to belong to the Termamyl-like alpha-amylase family.
- the hybrid alpha- amylase is typically composed of at least one part of a Termamyl-like alpha-amylase and part(s) of one or more other alpha-amylases selected from Termamyl-like alpha-amylases or non- Termamyl-like alpha-amylases of microbial (bacterial or fungal) and/or mammalian origin.
- the parent hybrid alpha-amylase may comprise a combination of partial amino acid sequences deriving from at least two Termamyl-like alpha-amylases, or from at least one Termamyl-like and at least one non-Termamyl-like bacterial alpha-amylase, or from at least one Termamyl-like and at least one fungal alpha-amylase.
- the Termamyl-like alpha-amylase from which a partial amino acid sequence derives may, e.g., be any of those specific Termamyl-like alpha-amylases referred to herein.
- the parent alpha-amylase may comprise a C-terminal part of an alpha- amylase derived from a strain of B. licheniformis, and a N-terminal part of an alpha-amylase derived from a strain of B. amyloliquefaciens or from a strain of B. stearothermophilus.
- the parent alpha-amylase may comprise at least 430 amino acid residues of the C- terminal part of the ⁇ . licheniformis alpha-amylase, and may, e.g., comprise a) an amino acid segment corresponding to the 37 N-terminal amino acid residues of the B.
- amyloliquefaciens alpha-amylase having the amino acid sequence shown in SEQ ID NO: 6 and an amino acid segment corresponding to the 445 C-terminal amino acid residues of the S. licheniformis alpha- amylase having the amino acid sequence shown in SEQ ID NO: 4, or b) an amino acid segment corresponding to the 68 N-terminal amino acid residues of the S. stearothermophilus alpha-amylase having the amino acid sequence shown in SEQ ID NO: 8 and an amino acid segment corresponding to the 415 C-terminal amino acid residues of the B. licheniformis alpha- amylase having the amino acid sequence shown in SEQ ID NO: 4.
- the parent Termamyl-like alpha-amylase is a hybrid Termamyl- like alpha-amylase identical to the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4, except that the N-terminal 35 amino acid residues (of the mature protein) is replaced with the N- terminal 33 amino acid residues of the mature protein of the Bacillus amyloliquefaciens alpha- amylase (BAN) shown in SEQ ID NO: 6.
- Said hybrid may further have the following mutations: H156Y+A181T+N190F+A209V+Q264S (using the numbering in SEQ ID NO: 4) referred to as LE174.
- Another preferred parent hybrid alpha-amylase is LE429 shown in SEQ ID NO: 2.
- the non-Termamyl-like alpha-amylase may, e.g., be a fungal alpha-amylase, a mammalian or a plant alpha-amylase or a bacterial alpha-amylase (different from a Termamyl- like alpha-amylase).
- alpha-amylases include the Aspergillus oryzae TAKA alpha-amylase, the A. niger acid alpha-amylase, the Bacillus subtilis alpha-amylase, the porcine pancreatic alpha-amylase and a barley alpha-amylase. All of these alpha-amylases have elucidated structures, which are markedly different from the structure of a typical Termamyl-like alpha-amylase as referred to herein.
- the fungal alpha-amylases mentioned above i.e., derived from A. niger and A. oryzae, are highly homologous on the amino acid level and generally considered to belong to the same family of alpha-amylases.
- the fungal alpha-amylase derived from Aspergillus oryzae is commercially available under the tradename FungamylTM.
- variant of a Termamyl-like alpha-amylase variant of the invention
- modification e.g., deletion or substitution
- variants of another Termamyl-like alpha-amylase modified in the equivalent position(s) are encompassed thereby.
- a preferred embodiment of a variant of the invention is one derived from a B.
- licheniformis alpha-amylase (as parent Termamyl-like alpha-amylase), e.g., one of those referred to above, such as the B. licheniformis alpha-amylase having the amino acid sequence shown in SEQ ID NO: 4.
- the construction of the variant of interest may be accomplished by cultivating a microorganism comprising a DNA sequence encoding the variant under conditions which are conducive for producing the variant. The variant may then subsequently be recovered from the resulting culture broth. This is described in detail further below.
- the invention relates to a variant of a parent Termamyl-like alpha- amylase having alpha-amylase activity and comprising the substitution R437W, wherein the position corresponds to a position of the amino acid sequence of the parent Termamyl-like alpha-amylase having the amino acid sequence of SEQ ID NO: 4.
- the present inventors have found that by introducing a tryptophane residue in the C- terminal domain of an alpha-amylase having only one of two tryptophanes and thereby creating a pair of tryptophanes a putative starch binding site is formed which is found to have a major role in the adsorption to starch and thus is critical for the high starch conversion rate.
- Alpha-amylases produced by the S. licheniformis strain described in EP 0252666 (ATCC
- alpha-amylases identified in WO 91/00353 and WO 94/18314.
- Other commercial Termamyl-like B. licheniformis alpha-amylases are OptithermTM and TakathermTM
- Termamyl-like alpha-amylases which do not have two tryptophane residues in the C-terminal may suitably be used as backbone for preparing variants of the invention.
- the parent Termamyl-like alpha-amylase is an alpha-amylase of SEQ ID NO:4 or SEQ ID NO:6 or a variant thereof.
- the variant comprises one or more of the following additional mutations: R176 * , G177*, N190F, E469N, more particular R176*+G177*+N190F, even more particular R176*+G177*+N190F+E469N (using the numbering in SEQ ID NO: 6).
- the parent Termamyl-like alpha-amylase is a hybrid alpha-amylase of SEQ ID NO: 4 and SEQ ID NO: 6.
- the parent hybrid Termamyl-like alpha-amylase may be a hybrid alpha-amylase comprising the 445 C-terminal amino acid residues of the B. licheniformis alpha-amylase shown in SEQ ID NO: 4 and the 37
- LE174 This hybrid is referred to as LE174.
- the LE174 hybrid may be combined with a further mutation 1201 F to form a parent hybrid Termamyl-like alpha-amylase having the following mutations
- the mutations/alterations, in particular substitutions, deletions and insertions may according to the invention be made in one or more of the following positions: R176*, G 177*, E469N (using the numbering in SEQ ID NO: 6).
- the variant comprises the additional mutation: E469N (using the numbering in SEQ ID NO: 6).
- the variant comprises the additional mutation: R176 * +G177*+E469N (using the numbering in SEQ ID NO: 6).
- a variant of the invention comprises one or more modifications in addition to those outlined above.
- the DNA sequence encoding a parent alpha-amylase may be isolated from any cell or microorganism producing the alpha-amylase in question, using various methods well known in the art.
- a genomic DNA and/or cDNA library should be constructed using chromosomal DNA or messenger RNA from the organism that produces the alpha-amylase to be studied.
- homologous, labelled oligonucleotide probes may be synthesized and used to identify alpha-amylase-encoding clones from a genomic library prepared from the organism in question.
- a labelled oligonucleotide probe containing sequences homologous to a known alpha-amylase gene could be used as a probe to identify alpha-amylase-encoding clones, using hybridization and washing conditions of lower stringency.
- Yet another method for identifying alpha-amylase-encoding clones would involve inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming alpha- amylase-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar containing a substrate for alpha-amylase, thereby allowing clones expressing the alpha-amylase to be identified.
- an expression vector such as a plasmid
- transforming alpha- amylase-negative bacteria with the resulting genomic DNA library
- the DNA sequence encoding the enzyme may be prepared synthetically by established standard methods, e.g., the phosphoroamidite method described by S. L. Beaucage and M.H. Caruthers (1981) or the method described by Matthes et al. (1984).
- the phos- phoroamidite method oligonucleotides are synthesized, e.g., in an automatic DNA synthesizer, purified, annealed, ligated and cloned in appropriate vectors.
- the DNA sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate, the fragments corresponding to various parts of the entire DNA sequence), in accordance with standard techniques.
- the DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in US 4,683,202 or R.K. Saiki et al. (1988).
- mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites; mutant nucleotides are inserted during oligonucleotide synthesis.
- a single- stranded gap of DNA, bridging the alpha-amylase-encoding sequence is created in a vector carrying the alpha-amylase gene.
- the synthetic nucleotide, bearing the desired mutation is annealed to a homologous portion of the single-stranded DNA.
- PCR-generated fragment containing the desired mutation introduced by using a chemically synthesized DNA strand as one of the primers in the PCR reactions.
- a DNA fragment carrying the mutation may be isolated by cleavage with restriction endonucleases and reinserted into an expression plasmid.
- Random mutagenesis is suitably performed either as localised or region-specific random mutagenesis in at least three parts of the gene translating to the amino acid sequence shown in question, or within the whole gene.
- the random mutagenesis of a DNA sequence encoding a parent alpha-amylase may be conveniently performed by use of any method known in the art.
- a further aspect of the present invention relates to a method for generating a variant of a parent alpha-amylase, e.g., wherein the variant exhibits an altered starch affinity relative to the parent, the method comprising:
- step (a) subjecting a DNA sequence encoding the parent alpha-amylase to random mutagenesis, (b) expressing the mutated DNA sequence obtained in step (a) in a host cell, and
- Step (a) of the above method of the invention is preferably performed using doped primers.
- the random mutagenesis may be performed by use of a suitable physical or chemical mutagenizing agent, by use of a suitable oligonucleotide, or by subjecting the DNA sequence to PCR generated mutagenesis.
- the random mutagenesis may be performed by use of any combination of these mutagenizing agents.
- the mutagenizing agent may, e.g., be one, which induces transitions, transversions, inversions, scrambling, deletions, and/or insertions.
- Examples of a physical or chemical mutagenizing agent suitable for the present purpose include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O- methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide analogues.
- UV ultraviolet
- MNNG N-methyl-N'-nitro-N-nitrosoguanidine
- EMS ethyl methane sulphonate
- sodium bisulphite formic acid
- nucleotide analogues examples include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), O- methyl hydroxylamine, nitrous acid, ethyl methane sulphonate (EMS), sodium bisulphite, formic acid, and nucleotide
- the oligonucleotide may be doped or spiked with the three non-parent nucleotides during the synthesis of the oligonucleotide at the positions, which are to be changed.
- the doping or spiking may be done so that codons for unwanted amino acids are avoided.
- the doped or spiked oligonucleotide can be incorporated into the DNA encoding the alpha-amylase enzyme by any published technique, using e.g., PCR, LCR or any DNA polymerase and ligase as deemed appropriate.
- the doping is carried out using "constant random doping", in which the percentage of wild type and mutation in each position is predefined.
- the doping may be directed toward a preference for the introduction of certain nucleotides, and thereby a preference for the introduction of one or more specific amino acid residues.
- the doping may be made, e.g., so as to allow for the introduction of 90% wild type and 10% mutations in each position.
- An additional consideration in the choice of a doping scheme is based on genetic as well as protein-structural constraints.
- the doping scheme may be made by using the DOPE program, which, inter alia, ensures that introduction of stop codons is avoided.
- PCR-generated mutagenesis When PCR-generated mutagenesis is used, either a chemically treated or non-treated gene encoding a parent alpha-amylase is subjected to PCR under conditions that increase the mis-incorporation of nucleotides (Deshler 1992; Leung et al., Technique, Vol.1 , 1989, pp. 11-15).
- a mutator strain of E. coli (Fowler et al., Molec. Gen.
- S. cereviseae or any other microbial organism may be used for the random mutagenesis of the DNA encoding the alpha-amylase by, e.g., transforming a plasmid containing the parent glycosylase into the mutator strain, growing the mutator strain with the plasmid and isolating the mutated plasmid from the mutator strain.
- the mutated plasmid may be subsequently transformed into the expression organism.
- the DNA sequence to be mutagenized may be conveniently present in a genomic or cDNA library prepared from an organism expressing the parent alpha-amylase.
- the DNA sequence may be present on a suitable vector such as a plasmid or a bacteriophage, which as such may be incubated with or otherwise exposed to the mutagenising agent.
- the DNA to be mutagenized may also be present in a host cell either by being integrated in the genome of said cell or by being present on a vector harboured in the cell.
- the DNA to be mutagenized may be in isolated form. It will be understood that the DNA sequence to be subjected to random mutagenesis is preferably a cDNA or a genomic DNA sequence. In some cases it may be convenient to amplify the mutated DNA sequence prior to performing the expression step b) or the screening step c).
- Such amplification may be performed in accordance with methods known in the art, the presently preferred method being PCR-generated amplification using oligonucleotide primers prepared on the basis of the DNA or amino acid sequence of the parent enzyme.
- the mutated DNA is expressed by culturing a suitable host cell carrying the DNA sequence under conditions allowing expression to take place.
- the host cell used for this purpose may be one which has been transformed with the mutated DNA sequence, optionally present on a vector, or one which was carried the DNA sequence encoding the parent enzyme during the mutagenesis treatment.
- suitable host cells are the following: gram positive bacteria such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus hrevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thuringiensis, Streptomyces lividans or Streptomyces murinus; and gram-negative bacteria such as E. coli.
- the mutated DNA sequence may further comprise a DNA sequence encoding functions permitting expression of the mutated DNA sequence.
- the random mutagenesis may be advantageously localised to a part of the parent alpha- amylase in question. This may, e.g., be advantageous when certain regions of the enzyme have been identified to be of particular importance for a given property of the enzyme, and when modified are expected to result in a variant having improved properties. Such regions may normally be identified when the tertiary structure of the parent enzyme has been elucidated and related to the function of the enzyme.
- the localised, or region-specific, random mutagenesis is conveniently performed by use of PCR generated mutagenesis techniques as described above or any other suitable technique known in the art.
- the DNA sequence encoding the part of the DNA sequence to be modified may be isolated, e.g., by insertion into a suitable vector, and said part may be subsequently subjected to mutagenesis by use of any of the mutagenesis methods discussed above.
- a DNA sequence encoding the variant produced by methods described above, or by any alternative methods known in the art can be expressed, in enzyme form, using an expression vector which typically includes control sequences encoding a promoter, operator, ribosome binding site, translation initiation signal, and, optionally, a repressor gene or various activator genes.
- the recombinant expression vector carrying the DNA sequence encoding an alpha-amylase variant of the invention may be any vector, which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced.
- the vector may be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, a bacteriophage or an extrachromosomal element, minichromosome or an artificial chromosome.
- the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
- the DNA sequence should be operably connected to a suitable promoter sequence.
- the promoter may be any DNA sequence, which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
- Suitable promoters for directing the transcription of the DNA sequence encoding an alpha-amylase variant of the invention, especially in a bacterial host are the promoter of the lac operon of E.coli, the Streptomyces coelicolor agarase gene cfagA promoters, the promoters of the Bacillus licheniformis alpha-amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens alpha-amylase (amyQ), the promoters of the Bacillus subtilis xylA and xylB genes etc.
- useful promoters are those derived from the gene encoding A. oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, A. niger neutral alpha-amylase, A. niger acid stable alpha-amylase, A. niger glu- coamylase, Rhizomucor miehei lipase, A. oryzae alkaline protease, A. oryzae triose phosphate isomerase or A. nidulans acetamidase.
- the expression vector of the invention may also comprise a suitable transcription terminator and, in eukaryotes, polyadenylation sequences operably connected to the DNA sequence encoding the alpha-amylase variant of the invention. Termination and polyadenylation sequences may suitably be derived from the same sources as the promoter.
- the vector may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
- a DNA sequence enabling the vector to replicate in the host cell in question. Examples of such sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1 and plJ702.
- the vector may also comprise a selectable marker, e.g., a gene the product of which complements a defect in the host cell, such as the dal genes from ⁇ . subtilis or S. licheniformis, or one which confers antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
- the vector may comprise Aspergillus selection markers such as amdS, argB, niaD and sC, a marker giving rise to hygromycin resistance, or the selection may be accomplished by co-transformation, e.g., as described in WO 91/17243.
- Aspergillus selection markers such as amdS, argB, niaD and sC, a marker giving rise to hygromycin resistance, or the selection may be accomplished by co-transformation, e.g., as described in WO 91/17243.
- Bacillus alpha-amylases mentioned herein comprise a pre-region permitting secretion of the expressed protease into the culture medium. If desirable, this pre-region may be replaced by a different preregion or signal sequence, conveniently accomplished by substitution of the DNA sequences encoding the respective preregions.
- the cell of the invention is advantageously used as a host cell in the recombinant production of an alpha-amylase variant of the invention.
- the cell may be transformed with the DNA con- struct of the invention encoding the variant, conveniently by integrating the DNA construct (in one or more copies) in the host chromosome. This integration is generally considered to be an advantage as the DNA sequence is more likely to be stably maintained in the cell. Integration of the DNA constructs into the host chromosome may be performed according to conventional methods, e.g., by homologous or heterologous recombination. Alternatively, the cell may be transformed with an expression vector as described above in connection with the different types of host cells.
- the cell of the invention may be a cell of a higher organism such as a mammal or an insect, but is preferably a microbial cell, e.g., a bacterial or a fungal (including yeast) cell.
- suitable bacteria are gram-positive bacteria such as Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus steamthermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus circulans, Bacillus lautus, Bacillus megaterium, Bacillus thuringiensis, or Streptomyces lividans or Streptomyces murinus, or gram- negative bacteria such as E.coli.
- the transformation of the bacteria may, for instance, be effected by protoplast transformation or by using competent cells in a manner known perse.
- the yeast organism may favourably be selected from a species of Saccharomyces or Schizosaccharomyces, e.g., Saccharomyces cerevisiae.
- the filamentous fungus may advantageously belong to a species of Aspergillus, e.g., Aspergillus oryzae or Aspergillus niger.
- Fungal cells may be transformed by a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known per se. A suitable procedure for transformation of Aspergillus host cells is described in EP 238 023.
- the present invention relates to a method of producing an alpha- amylase variant of the invention, which method comprises cultivating a host cell as described above under conditions conducive to the production of the variant and recovering the variant from the cells and/or culture medium.
- the medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in question and obtaining expression of the alpha-amylase variant of the invention. Suitable media are available from commercial suppliers or may be prepared accor- ding to published recipes (e.g., as described in catalogues of the American Type Culture Collection).
- the alpha-amylase variant secreted from the host cells may conveniently be recovered from the culture medium by well-known procedures, including separating the cells from the medium by centrifugation or filtration, and precipitating proteinaceous components of the medium by means of a salt such as ammonium sulphate, followed by the use of chromatographic procedures such as ion exchange chromatography, affinity chromatography, or the like.
- alpha-amylase variants of this invention possess valuable properties allowing for a variety of industrial applications.
- enzyme variants of the invention are applicable as a component in washing, dishwashing, and hard surface cleaning detergent compositions.
- Variant of the invention with altered properties may be used for starch processes, in particular starch conversion, especially liquefaction of starch (see, e.g., US 3,912,590, EP patent application nos. 252 730 and 63 909, WO 99/19467, and WO 96/28567 all references hereby incorporated by reference).
- compositions for starch conversion purposes which may beside the variant of the invention also comprise a glucoamylase, pullulanase, and other alpha-amylases.
- variants of the invention are also particularly useful in the production of sweeteners and ethanol (see, e.g., US patent no.
- Starch Conversion Conventional starch-conversion processes, such as liquefaction and saccharification processes are described, e.g., in US Patent No. 3,912,590 and EP patent publications Nos. 252,730 and 63,909, hereby incorporated by reference.
- the starch conversion process degrading starch to lower molecular weight carbohydrate components such as sugars or fat replacers includes a debranching step.
- a such depolymerization process consists of a Pre-treatment step and two or three consecutive process steps, viz. a liquefaction process, a saccharification process and dependent on the desired end product optionally an isomerization process.
- Native starch consists of microscopic granules, which are insoluble in water at room temperature. When an aqueous starch slurry is heated, the granules swell and eventually burst, dispersing the starch molecules into the solution. During this "gelatinization” process there is a dramatic increase in viscosity. As the solids level is 30-40% in a typically industrial process, the starch has to be thinned or "liquefied” so that it can be handled. This reduction in viscosity is today mostly obtained by enzymatic degradation.
- the long chained starch is degraded into branched and linear shorter units (maltodextrins) by an alpha-amylase.
- the liquefaction process is carried out at 105-110 0 C for 5 to 10 minutes followed by 1-2 hours at 95°C.
- the pH lies between 5.5 and 6.2.
- 1 mM of calcium is added (40 ppm free calcium ions).
- the liquefied starch will have a "dex- trose equivalent" (DE) of 10-15.
- the maltodextrins are converted into dextrose by addi- tion of a glucoamylase (e.g., AMG) and a debranching enzyme, such as an isoamylase (US patent no. 4,335,208) or a pullulanase (e.g., PromozymeTM) (US patent no. 4,560,651).
- a glucoamylase e.g., AMG
- a debranching enzyme such as an isoamylase (US patent no. 4,335,208) or a pullulanase (e.g., PromozymeTM) (US patent no. 4,560,651).
- the pH is reduced to a value below 4.5, maintaining the high temperature (above 95 0 C) to inactivate the liquefying alpha-amylase to reduce the formation of short oligosaccharide called "panose precursors" which cannot be hydrolyzed properly by the debranching enzyme.
- the temperature is lowered to 60 0 C, and glucoamylase and debranching enzyme are added.
- the saccharification process proceeds for 24-72 hours.
- the dextrose syrup may be converted into fructose.
- the pH is increased to a value in the range of 6-8, preferably pH 7.5, and the calcium is removed by ion exchange.
- the dextrose syrup is then converted into high fructose syrup using, e.g., an immmobilized glucoseisomerase (such as SweetzymeTM IT).
- Milling The grain is milled in order to open up the structure and allowing for further processing. Two processes are used wet or dry milling. In dry milling the whole kernel is milled and used in the remaining part of the process. Wet milling gives a very good separation of germ and meal (starch granules and protein) and is with a few exceptions applied at locations where there is a parallel production of syrups.
- the starch granules are solubilized by hydrolysis to mal- todextrins mostly of a DP higher than 4.
- the hydrolysis may be carried out by acid treatment or enzymatically by alpha-amylase. Acid hydrolysis is used on a limited basis.
- the raw mate- rial can be milled whole grain or a side stream from starch processing.
- Enzymatic liquefaction is typically carried out as a three-step hot slurry process.
- the slurry is heated to between 60-95 0 C, preferably 80-85°C, and the enzyme(s) is (are) added.
- the slurry is jet-cooked at between 95-140°C, preferably 105-125 0 C, cooled to 60-95°C and more enzyme(s) is (are) added to obtain the final hydrolysis.
- the liquefaction process is carried out at pH 4.5-6.5, typically at a pH between 5 and 6. Milled and liquefied grain is also known as mash.
- the malto- dextrin from the liquefaction must be further hydrolyzed.
- the hydrolysis is typically done enzymatically by glucoamylases, alternatively alpha-glucosidases or acid alpha-amylases can be used.
- a full saccharification step may last up to 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes and then complete saccharification during fermentation (SSF). Saccharification is typically carried out at temperatures from 30-65 0 C, typically around 60 0 C, and at pH 4.5.
- Yeast typically from Saccharomyces spp. is added to the mash and the fermentation is ongoing for 24-96 hours, such as typically 35-60 hours.
- the temperature is between 26- 34 0 C, typically at about 32 0 C, and the pH is from pH 3-6, preferably around pH 4-5.
- SSF simultaneous saccharification and fermentation
- the ethanol obtained according to the process of the invention may be used as, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol.
- the grain which is typically used for animal feed either in liquid form or dried.
- the alkaline alpha-amylase of the invention may also be used in the production of lignocellulosic materials, such as pulp, paper and cardboard, from starch reinforced waste paper and cardboard, especially where re-pulping occurs at pH above 7 and where amylases facilitate the disintegration of the waste material through degradation of the reinforcing starch.
- the alpha-amylase of the invention is especially useful in a process for producing a papermaking pulp from starch-coated printed-paper.
- the process may be performed as de- scribed in WO 95/14807, comprising the following steps: a) disintegrating the paper to produce a pulp, b) treating with a starch-degrading enzyme before, during or after step a), and c) separating ink particles from the pulp after steps a) and b).
- the alpha-amylases of the invention may also be very useful in modifying starch where enzymatically modified starch is used in papermaking together with alkaline fillers such as calcium carbonate, kaolin and clays. With the alkaline alpha-amylases of the invention it becomes possible to modify the starch in the presence of the filler thus allowing for a simpler integrated process.
- alpha-amylase of the invention may also be very useful in textile, fabric or garment desizing.
- alpha-amylases are traditionally used as auxiliaries in the desizing process to facilitate the removal of starch-containing size, which has served as a protective coating on weft yarns during weaving. Complete removal of the size coating after weaving is important to ensure optimum results in the subsequent processes, in which the fabric is scoured, bleached and dyed. Enzymatic starch breakdown is preferred because it does not involve any harmful effect on the fiber material.
- the desizing processing is sometimes combined with the scouring and bleaching steps.
- non-enzymatic auxiliaries such as alkali or oxidation agents are typically used to break down the starch, because traditional al- pha-amylases are not very compatible with high pH levels and bleaching agents.
- the non- enzymatic breakdown of the starch size does lead to some fiber damage because of the rather aggressive chemicals used. Accordingly, it would be desirable to use the alpha- amylases of the invention as they have an improved performance in alkaline solutions.
- the alpha-amylases may be used alone or in combination with a cellulase when desizing cellulose-containing fabric or textile.
- Desizing and bleaching processes are well known in the art. For instance, such processes are described in WO 95/21247, US patent 4,643,736, EP 119,920 hereby in corporate by reference.
- the alpha-amylases of the invention may also be very useful in a beer-making process; the alpha-amylases will typically be added during the mashing process.
- the alpha-amylase of the invention may be added to and thus become a component of a detergent composition.
- the detergent composition of the invention may for example be formulated as a hand or machine laundry detergent composition including a laundry additive composition suitable for pre-treatment of stained fabrics and a rinse added fabric softener composition, or be formulated as a detergent composition for use in general household hard surface cleaning operations, or be formulated for hand or machine dishwashing operations.
- the invention provides a detergent additive comprising the enzyme of the invention.
- the detergent additive as well as the detergent composition may comprise one or more other enzymes such as a protease, a lipase, a peroxidase, another amylolytic enzyme, e.g., another alpha-amylase, glucoamylase, maltogenic amylase, CGTase and/or a cellulase, mannanase (such as MANNAWAYTM from Novozymes, Denmark), pectinase, pectine lyase, cutinase, and/or laccase.
- a protease e.g., a lipase, a peroxidase
- another amylolytic enzyme e.g., another alpha-amylase, glucoamylase, maltogenic amylase, CGTase and/or a cellulase, mannanase (such as MANNA
- the properties of the chosen enzyme(s) should be compatible with the selected detergent, (i.e., pH-optimum, compatibility with other enzymatic and non-enzymatic ingredients, etc.), and the enzyme(s) should be present in effective amounts.
- proteases include those of animal, vegetable or microbial origin. Microbial origin is preferred. Chemically modified or protein engineered mutants are included.
- the protease may be a serine protease or a metallo protease, preferably an alkaline micro- bial protease or a trypsin-like protease.
- alkaline proteases are subtilisins, especially those derived from Bacillus, e.g., subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (described in WO 89/06279).
- trypsin-like proteases are trypsin (e.g., of porcine or bovine origin) and the Fusarium protease described in WO 89/06270 and WO 94/25583.
- proteases examples include the variants described in WO 92/19729, WO 98/20115, WO 98/20116, and WO 98/34946, especially the variants with substitutions in one or more of the following positions: 27, 36, 57, 76, 87, 97, 101 , 104, 120, 123, 167, 170, 194, 206, 218, 222, 224, 235 and 274.
- Preferred commercially available protease enzymes include ALCALASE®, SAVI-
- NASE®, PRIMASE®, DURALASE®, ESPERASE®, and KANNASE® from Novozymes A/S
- MAXATASE® MAXACAL
- MAXAPEM® PROPERASE®
- PURAFECT® PURAFECT OXP®
- FN2® FN3®
- FN4® Genecor International Inc.
- Suitable lipases include those of bacterial or fungal origin. Chemically modi- tied or protein engineered mutants are included. Examples of useful lipases include lipases from Humicola (synonym Thermomyces), e.g., from H. lanuginosa (T. lanuginosus) as described in EP 258 068 and EP 305 216 or from H. insolens as described in WO 96/13580, a Pseudomonas lipase, e.g., from P. alcaligenes or P. pseudoalcaligenes (EP 218 272), P. cepacia (EP 331 376), P. stutzeri (GB 1,372,034), P.
- lipase variants such as those described in WO 92/05249, WO 94/01541, EP 407 225, EP 260 105, WO 95/35381 , WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 and WO 97/07202.
- Preferred commercially available lipase enzymes include LIPOLASETM and LIPO- LASE ULTRATM (Novozymes A/S).
- Amylases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Amylases include, for example, alpha-amylases obtained from Bacillus, e.g., a special strain of B. licheniformis, described in more detail in GB 1 ,296,839.
- alpha-amylases examples are the variants described in WO 94/02597, WO 94/18314, WO 96/23873, and WO 97/43424, especially the variants with substitutions in one or more of the following positions: 15, 23, 105, 106, 124, 128, 133, 154, 156, 181 , 188, 190, 197, 202, 208, 209, 243, 264, 304, 305, 391, 408, and 444.
- alpha-amylases are DURAMYLTM, LIQUEZYMETM TERMA- MYLTM, NATALASETM, SUPRAMYLTM, STAINZYMETM, FUNGAMYLTM and BANTM (Novozymes A/S), RAPIDASETM , PURASTARTM and PURASTAR OXAMTM (from Genencor In- ternational Inc.).
- Suitable cellulases include those of bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Suitable cellulases include cellulases from the genera Bacillus, Pseudomonas, Humicola, Fusarium, Thielavia, Acremonium, e.g., the fungal cellulases produced from Humicola insolens, Myceliophthora thermophila and Fusarium oxysporum disclosed in US 4,435,307, US 5,648,263, US 5,691 ,178, US 5,776,757 and WO 89/09259.
- cellulases are the alkaline or neutral cellulases having colour care benefits.
- Examples of such cellu-lases are cellulases described in EP 0 495 257, EP 0 531 372, WO 96/11262, WO 96/29397, WO 98/08940.
- Other examples are cellulase variants such as those described in WO 94/07998, EP 0 531 315, US 5,457,046, US 5,686,593, US
- cellulases include CELLUZYME®, and CAREZYME® (No- vozymes A/S), CLAZINASE®, and PURADAX HA® (Genencor International Inc.), and KAC- 500(B)® (Kao Corporation).
- Peroxidases/Oxidases include those of plant, bacterial or fungal origin. Chemically modified or protein engineered mutants are included. Examples of useful peroxidases include peroxidases from Coprinus, e.g., from C. cinereus, and variants thereof as those described in WO 93/24618, WO 95/10602, and WO 98/15257. Commercially available peroxidases include GUARDZYME® (Novozymes A/S).
- the detergent enzyme(s) may be included in a detergent composition by adding separate additives containing one or more enzymes, or by adding a combined additive comprising all of these enzymes.
- a detergent additive of the invention i.e., a separate additive or a combined additive, can be formulated, e.g., granulate, a liquid, a slurry, etc.
- Preferred de- tergent additive formulations are granulates, in particular non-dusting granulates, liquids, in particular stabilized liquids, or slurries.
- Non-dusting granulates may be produced, e.g., as disclosed in US 4,106,991 and 4,661 ,452 and may optionally be coated by methods known in the art.
- waxy coating materials are poly(ethylene oxide) products (polyethyleneglycol, PEG) with mean molar weights of 1000 to 20000; ethoxylated nonyl-phenols having from 16 to 50 ethylene oxide units; ethoxylated fatty alcohols in which the alcohol contains from 12 to 20 carbon atoms and in which there are 15 to 80 ethylene oxide units; fatty alcohols; fatty acids; and mono- and di- and triglycerides of fatty acids.
- Liquid enzyme pre- parations may, for instance, be stabilized by adding a polyol such as propylene glycol, a sugar or sugar alcohol, lactic acid or boric acid according to established methods.
- Protected enzymes may be prepared according to the method disclosed in EP 238,216.
- the detergent composition of the invention may be in any convenient form, e.g., a bar, a tablet, a powder, a granule, a paste or a liquid.
- a liquid detergent may be aqueous, typically containing up to 70 % water and 0-30 % organic solvent, or non-aqueous.
- the detergent composition comprises one or more surfactants, which may be non- ionic including semi-polar and/or anionic and/or cationic and/or zwitterionic.
- the surfactants are typically present at a level of from 0.1 % to 60% by weight.
- the detergent When included therein the detergent will usually contain from about 1% to about 40% of an anionic surfactant such as linear alkylbenzenesulfonate, alpha-olefinsulfonate, al- kyl sulfate (fatty alcohol sulfate), alcohol ethoxysulfate, secondary alkanesulfonate, alpha- sulfo fatty acid methyl ester, alkyl- or alkenylsuccinic acid or soap. When included therein the detergent will usually contain from about 0.2% to about
- a non-ionic surfactant such as alcohol ethoxylate, nonyl-phenol ethoxylate, alkylpoly- glycoside, alkyldimethylamine-oxide, ethoxylated fatty acid monoethanol-amide, fatty acid monoethanolamide, polyhydroxy alkyl fatty acid amide, or N-acyl N-alkyl derivatives of glucosamine ("glucamides")-
- the detergent may contain 0-65 % of a detergent builder or complexing agent such as zeolite, diphosphate, tripho-sphate, phosphonate, carbonate, citrate, nitrilotriacetic acid, ethylenediaminetetraacetic acid, diethylenetri-aminepen-taacetic acid, alkyl- or alkenylsuccinic acid, soluble silicates or layered silicates (e.g. SKS-6 from Hoechst).
- a detergent builder or complexing agent such as zeolite, diphosphate,
- the detergent may comprise one or more polymers.
- examples are carboxymethyl- cellulose, poly(vinyl-pyrrolidone), poly (ethylene glycol), polyvinyl alcohol), poly(vinylpyridine-N-oxide), poly(vinylimidazole), polycarboxylates such as polyacrylates, maleic/acrylic acid copolymers and lauryl methacrylate/acrylic acid co-polymers.
- the detergent may contain a bleaching system, which may comprise a H 2 O 2 source such as perborate or percarbonate which may be combined with a peracid-forming bleach activator such as tetraacetylethylenediamine or nonanoyloxyben-zenesul-fonate.
- a bleaching system may comprise peroxyacids of, e.g., the amide, imide, or sulfone type.
- the enzyme(s) of the detergent composition of the inven-tion may be stabilized using conventional stabilizing agents, e.g., a polyol such as propylene glycol or glycerol, a sugar or sugar alcohol, lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid, and the corn-position may be formulated as described in, e.g., WO 92/19709 and WO 92/19708.
- stabilizing agents e.g., a polyol such as propylene glycol or glycerol
- a sugar or sugar alcohol lactic acid, boric acid, or a boric acid derivative, e.g., an aromatic borate ester, or a phenyl boronic acid derivative such as 4-formylphenyl boronic acid
- the corn-position may be formulated as described in, e.
- the detergent may also contain other conventional detergent ingredients such as e.g. fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil re-deposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
- fabric conditioners including clays, foam boosters, suds suppressors, anti-corrosion agents, soil-suspending agents, anti-soil re-deposition agents, dyes, bactericides, optical brighteners, hydrotropes, tarnish inhibitors, or perfumes.
- any enzyme in particular the enzyme of the invention, may be added in an amount corresponding to 0.001-100 mg of enzyme protein per liter of wash liquor, preferably 0.005-5 mg of enzyme protein per liter of wash liquor, more preferably 0.01-1 mg of enzyme protein per liter of wash liquor and in particular 0.1-1 mg of enzyme protein per liter of wash liquor.
- the enzyme of the invention may additionally be incorporated in the detergent formulations disclosed in WO 97/07202, which is hereby incorporated as reference.
- the enzyme of the invention may also be used in dish wash detergent compositions, including the following:
- Nonionic surfactant 0.5 - 2.0%
- Liquid nonionic surfactant e.g. alcohol ethoxylates
- Liquid carrier selected from higher glycols, polyglycols, polyoxides, glycolethers 25.0 - 45.0%
- Stabilizer e.g. a partial ester of phosphoric acid and a C 16 -Ci 8 alkanol
- Foam suppressor e.g. silicone 0 1.5%
- Liquid nonionic surfactant e.g. alcohol ethoxylates
- Stabilizing system e.g. mixtures of finely divided silicone and low molecular weight dialkyl polyglycol ethers
- Clay gel thickener e.g. bentonite 0.0 - 10.0%
- Liquid carrier selected from higher lycols, polyglycols, polyoxides and glycol ethers Balance 9) THIXOTROPIC LIQUID AUTOMATIC DISHWASHING COMPOSITION
- the manganese catalyst may, e.g., be one of the compounds described in "Efficient manganese catalysts for low-temperature bleaching". Nature 369, 1994, pp. 637-639.
- LE174 is a hybrid Termamyl-like alpha-amylase being identical to the Termamyl sequence, i.e., the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4, except that the N- terminal 35 amino acid residues (of the mature protein) has been replaced by the N-terminal
- BAN mature protein
- Bacillus amyloliquefaciens alpha-amylase shown in SEQ ID NO: 6, which further have following mutations:
- LE429 is a hybrid Termamyl-like alpha-amylase being identical to the Termamyl sequence, i.e., the Bacillus licheniformis alpha-amylase shown in SEQ ID NO: 4, except that the N- terminal 35 amino acid residues (of the mature protein) has been replaced by the N-terminal 33 residues of BAN (mature protein), i.e., the Bacillus amyloliquefaciens alpha-amylase shown in SEQ ID NO: 6, which further have following mutations:
- Glucoamylase derived from Aspergillus niger having the amino acid sequence shown in WO00/04136 as SEQ ID No: 2 or one of the disclosed variants.
- Acid fungal alpha-amylase derived from Aspergillus niger Acid fungal alpha-amylase derived from Aspergillus niger.
- Wheat starch (S-5127) was obtained from Sigma-Aldrich.
- a B. subtilis strain harbouring the relevant expression plasmid is streaked on an
- the colonies are transferred to 100 ml BPX media supplemented with 10 micro g/ml kanamycin in a 500 ml shaking flask.
- composition of BPX medium Composition of BPX medium:
- the culture is shaken at 37°C at 270 rpm for 5 days.
- the amylolytic activity may be determined using potato starch as substrate. This method is based on the break-down of modified potato starch by the enzyme, and the reac- tion is followed by mixing samples of the starch/enzyme solution with an iodine solution. Initially, a blackish-blue colour is formed, but during the break-down of the starch the blue colour gets weaker and gradually turns into a reddish-brown, which is compared to a coloured glass standard.
- KNU Kilo Novo alpha amylase Unit
- the Novo Glucoamylase Unit is defined as the amount of enzyme, which hy- drolyzes 1 micromole maltose per minute at 37 0 C and pH 4.3.
- the activity is determined as AGU/ml by a method modified after (AEL-SM-0131 , available on request from Novozymes) using the Glucose GOD-Perid kit from Boehringer Mannheim, 124036. Standard: AMG-standard, batch 7-1195, 195 AGU/ml. 375 microL substrate (1% maltose in 50 mM Sodium acetate, pH 4.3) is incubated 5 minutes at 37 0 C. 25 mi- croL enzyme diluted in sodium acetate is added. The reaction is stopped after 10 minutes by adding 100 microL 0.25 M NaOH. 20 microL is transferred to a 96 well microtitre plate and 200 microL GOD-Perid solution (124036, Boehringer Mannheim) is added.
- AEL-SM-0131 available on request from Novozymes
- AFAU Acid alpha-amylase activity
- Acid alpha-amylase activity may be measured in AFAU (Acid Fungal Alpha-amylase Units), which are determined relative to an enzyme standard.
- AFAU Acid Fungal Alpha-amylase Units
- AMG 300 L from Novozymes A/S, glucoamylase wildtype As- pergillus niger G1 , also disclosed in Boel et al. (1984), EMBO J. 3 (5), p. 1097-1102 and in WO92/00381).
- the neutral alpha-amylase in this AMG falls after storage at room temperature for 3 weeks from approx. 1 FAU/mL to below 0.05 FAU/mL.
- AFAU is defined as the amount of enzyme, which degrades 5.26 mg starch dry solids per hour under standard conditions.
- Iodine forms a blue complex with starch but not with its degradation products.
- the intensity of colour is therefore directly proportional to the concentration of starch.
- Amylase activity is determined using reverse colorimetry as a reduction in the concentration of starch under specified analytic conditions.
- Iodine (I2) 0.03 g/L
- the sugar composition of the starch hydrolysates was determined by HPLC and glucose yield was subsequently calculated as DX. 0 BRIX, solubilised (soluble) dry solids of the starch hydrolysate were determined by refractive index measurement.
- Phadebas® tablets Phadebas tablets (Phadebas® Amylase Test, supplied by Pharmacia Diagnostic) contain a cross-linked insoluble blue-coloured starch polymer, which has been mixed with bovine serum albumin and a buffer substance and tabletted. For every single measurement one tablet is suspended in a tube containing 5 ml 50 mM
- Britton-Robinson buffer 50 mM acetic acid, 50 mM phosphoric acid, 50 mM boric acid, 0.1 mM CaCI 2 , pH adjusted to the value of interest with NaOH.
- the test is performed in a water bath at the temperature of interest.
- the alpha-amylase to be tested is diluted in x ml of 50 mM Britton- Robinson buffer. 1 ml of this alpha-amylase solution is added to the 5 ml 50 mM Britton- Robinson buffer.
- the starch is hydrolysed by the alpha-amylase giving soluble blue fragments.
- the absorbance of the resulting blue solution measured spectrophotometrically at 620 nm, is a function of the alpha-amylase activity. It is important that the measured 620 nm absorbance after 10 or 15 minutes of incubation
- test time is in the range of 0.2 to 2.0 absorbance units at 620 nm. In this absorbance range there is linearity between activity and absorbance (Lambert-Beer law). The dilution of the enzyme must therefore be adjusted to fit this criterion.
- a specified set of conditions temp., pH, reaction time, buffer conditions
- 1 mg of a given alpha-amylase will hydrolyse a certain amount of substrate and a blue colour will be produced.
- the colour intensity is measured at 620 nm.
- the measured absorbance is directly proportional to the specific activity (activity/mg of pure alpha-amylase protein) of the alpha-amylase in question under the given set of conditions.
- the specific activity is determined using the Phadebas assay (Pharmacia) as activity/mg enzyme.
- the variant is stored in 20 mM TRIS ph 7.5, 0.1 mM, CaCI 2 and tested at 30 0 C, 50 mM Britton-Robinson, 0.1 mM CaCI 2 .
- the pH activity is measured at pH 4.0, 4.5, 5.0, 5.5, 6.0, 7.0, 8.0, 9.5, 9.5, 10, and 10.5, using the Phadebas assay described above.
- Termamyl (S. licheniformis alpha-amylase SEQ ID NO: 4) is expressed in S. subtilis from a plasmid denoted pDN1528.
- This plasmid contains the complete gene encoding Termamyl, amyL, the expression of which is directed by its own promoter. Further, the plasmid contains the origin of replication, ori, from plasmid pUB110 and the cat gene from plasmid pC194 conferring resistance towards chloramphenicol.
- pDN1528 is shown in Fig. 9 of WO 96/23874. A specific mutagenesis vector containing a major part of the coding region of SEQ ID NO: 3 was prepared.
- pJeENI The important features of this vector, denoted pJeENI , include an origin of replication derived from the pUC plasmids, the cat gene conferring resistance towards chloramphenicol, and a frameshift-containing version of the bla gene, the wild type of which normally confers resistance towards ampicillin (amp R phenotype). This mutated version results in an amp s pheno- type.
- the plasmid pJeENI is shown in Fig. 10 of WO 96/23874, and the E. coli origin of replica- tion, on, bla, cat, the 5'-truncated version of the Termamyl amylase gene, and selected restriction sites are indicated on the plasmid.
- Mutations are introduced in amyL by the method described by Deng and Nickoloff (1992, Anal. Biochem. 200, pp. 81-88) except that plasmids with the "selection primer" (primer #6616; see below) incorporated are selected based on the amp R phenotype of transformed E. coli cells harboring a plasmid with a repaired bla gene, instead of employing the selection by restriction enzyme digestion outlined by Deng and Nickoloff. Chemicals and enzymes used for the mutagenesis were obtained from the Chameleon ⁇ mutagenesis kit from Stratagene (catalogue number 200509).
- the truncated gene containing the desired alteration, is subcloned into pDN1528 as a Psfl-EcoRI fragment and transformed into the protease- and amylase-depleted Bacillus subtilis strain SHA273 (described in WO92/11357 and WO95/10603) in order to express the variant enzyme.
- the Termamyl variant V54W was constructed by the use of the following mutagenesis primer (written 5 1 to 3', left to right):
- the Termamyl variant A52W + V54W was constructed by the use of the following mutagenesis primer (written 5 1 to 3', left to right):
- the Termamyl variant V54E was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variant V54M was constructed by the use of the following mutagenesis primer (written 5'-3', left to right): PGG TCG TAG GCA CCG TAG CCC ATA TCC GCT TG (SEQ ID NO: 13)
- the Termamyl variant V54I was constructed by the use of the following mutagenesis primer (written 5'-3', left to right): PGG TCG TAG GCA CCG TAG CCA ATA TCC GCT TG (SEQ ID NO: 14)
- Termamyl variants Y290E and Y290K were constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- Y represents an equal mixture of C and T.
- the presence of a codon encoding either Gluta- mate or Lysine in position 290 was verified by DNA sequencing.
- the Termamyl variant N190F was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- PCA TAG TTG CCG AAT TCA TTG GAA ACT TCC C (SEQ ID NO: 16)
- the Termamyl variant N188P+N190F was constructed by the use of the following mutagenesis primer (written 5'-3', left to right): PCA TAG TTG CCG AAT TCA GGG GAA ACT TCC CAA TC (SEQ ID NO: 17)
- the Termamyl variant H140K+H142D was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variant H156Y was constructed by the use of the following mutagenesis primer (written 5'-3 ⁇ left to right):
- PCA AAA TGG TAC CAA TAC CAC TTA AAA TCG CTG (SEQ ID NO: 19)
- the Termamyl variant A181T was constructed by the use of the following mutagenesis primer (written 5 ! -3', left to right): PCT TCC CAA TCC CAA GTC TTC CCT TGA AAC (SEQ ID NO: 20)
- the Termamyl variant A209V was constructed by the use of the following mutagenesis primer (written 5'-3', left to right): PCTT AAT TTC TGC TAC GAC GTC AGG ATG GTC ATA ATC (SEQ ID NO: 21 )
- the Termamyl variant Q264S was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variant S187D was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variant DELTA(K370-G371-D372) (i.e., deleted of amino acid residues nos. 370, 371 and 372) was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variant DELTA(D372-S373-Q374) was constructed by the use of the following mutagenesis primer (written 5'-3', left to right):
- the Termamyl variants A181T and A209V were combined to A181T+A209V by digesting the A181T containing pDN1528-like plasmid (i.e., pDN1528 containing within amyL the mutation resulting in the A181T alteration) and the A209V-containing pDN1528-like plasmid (i.e., pDN1528 containing within amyL the mutation resulting in the A209V alteration) with restriction enzyme C/al which cuts the pDN1528-like plasmids twice resulting in a frag- ment of 1116 bp and the vector-part (i.e.
- the fragment containing the A209V mutation and the vector part containing the A181T mutation were purified by QIAquick gel extraction kit (purchased from QIAGEN) after separation on an agarose gel. The fragment and the vector were ligated and transformed into the protease and amylase depleted Bacillus subtilis strain referred to above. Plasmid from amy+ (clearing zones on starch containing agar-plates) and chloramphenicol resistant transfor- mants were analysed for the presence of both mutations on the plasmid.
- H156Y and A209V were combined utilizing re- striction endonucleases Acc65l and EcoRI, giving H156Y+A209V.
- H156Y +A209V and A181T+A209V were combined into H156Y+ A181T+A209V by the use of restriction endonucleases Acc65l and Hindlll.
- Primer 19363 CGG ATA TCG GTA TTA CTG CCG TCT GGA TTC (SEQ ID NO: 28)
- Primer 1C CTC GTC CCA ATC GGT TCC GTC (SEQ ID NO: 29)
- PCR1 An approximately 130 bp fragment was amplified in a first PCR denoted PCR1 with primers 19364 and 19362 on a DNA fragment containing the gene encoding the R amyloliquefaciens alpha-amylase.
- PCR2 An approximately 400 bp fragment was amplified in another PCR denoted PCR2 with primers 19363 and 1C on template pDN1528.
- PCR1 and PCR2 were purified from an agarose gel and used as templates in PCR3 with primers 19364 and 1C, which resulted in a fragment of approximately 520 bp. This fragment thus contains one part of DNA encoding the N-terminus from BAN fused to a part of DNA encoding Termamyl from the 35th amino acid.
- the 520 bp fragment was subcloned into a pDN1528-like plasmid (containing the gene encoding Termamyl variant H156Y+ A181T+A209V) by digestion with restriction endonucleases Pst ⁇ and Sacll, ligation and transformation of the S. subtilis strain as previously described.
- the DNA sequence between restriction sites Pst ⁇ and Sacll was verified by DNA sequencing in extracted plasmids from amy+ and chloramphenicol resistant transformants.
- BAN(1-35)+ H156Y+ A181T+A209V The final construct containing the correct N-terminus from BAN and H156Y+ A181T+A209V was denoted BAN(1-35)+ H156Y+ A181T+A209V.
- N190F was combined with BAN(1-35)+ H156Y+ A181T+A209V giving BAN(1-35)+ H156Y+ A181T+N190F+A209V by carrying out mutagenesis as described above except that the sequence of amyL in pJeENI was substituted by the DNA sequence encoding Termamyl variant BAN(1-35)+ H156Y+ A181T+A209V
- Q264S was combined with BAN(I -35)+ H156Y+ A181T+A209V giving BAN(I -35)+
- BAN(I -35)+ H156Y+ A181T+A209V+Q264S and BAN(I -35)+ H156Y+ A181T+N190F+A209V were combined into BAN(1-35)+ H156Y+
- Primer AM100 5'GATGTATGCCGACTTCGATTATGACC 3' (SEQ ID NO: 30)
- the vector primer CAAX37 binding downstream of the amylase gene and mutagenic primer CAAX447 are used to amplify by PCR an approximately 450 bp DNA fragment from a pDN1528-like plasmid (harbouring the BAN(I-
- the 450 bp fragment is purified from an agarose gel and used as a Mega-primer together with primer 1 B in a second PCR carried out on the same template.
- SHA273 (amylase and protease low) cells are transformed with the ligation and Chloramp- enicol resistant transformants are checked by DNA sequencing to verify the presence of the correct mutations on the plasmid.
- BAN/Termamyl hybrid + H156Y+A181T+N190F+A209V+Q264S + [R437W+E469N] is carried our in a similar way, except that both mutagenic primers CAAX447 and CAAX448 are used.
- BAN ( ⁇ . amyloliquefacience alpha-amylase SEQ ID NO: 6) is expressed in S. subtilis from a plasmid similar to the pDN1528 discribed in example 1.
- This BAN plasmid, denoted pCA330-BAN contains the gene encoding the mature part of BAN, defined as amino acid 1 to 483 in SEQ ID NO: 6 in substitute for the gene encoding the mature part of ⁇ . licheniformis alpha-amylase, defined as amino acid 1 to 483 in SEQ ID NO: 4.
- B.amyloliquefacience alpha-amylase This variant is in the following referred to as BAN- var003.
- site directed mutagenesis is carried out using the Mega-primer method as described by Sarkar and Sommer, 1990 (BioTechniques 8: 404-407):
- BE1001 BAN-var003 + R437W:
- the vector primer CAAX37 binding downstream of the amylase gene and mutagenic primer CABX437 are used to amplify by PCR an approximately 450 bp DNA fragment from a pCA330-BAN plasmid (harbouring the BAN-var003 mutations in the gene encoding the amylase from SEQ ID NO: 6).
- the 450 bp fragment is purified from an agarose gel and used as a Mega-primer to- gether with primer 1B in a second PCR carried out on the same template.
- the resulting approximately 1800 bp fragment is digested with restriction enzymes Pst I and Avr Il and the resulting approximately 1600 bp DNA fragment is purified and ligated with the pCA330-like plasmid digested with the same enzymes.
- Competent Bacillus subtilis SHA273 (amylase and protease low) cells are transformed with the ligation and Chloramp- enicol resistant transformants are checked by DNA sequencing to verify the presence of the correct mutations on the plasmid.
- BAN-var003 amylase + [R437W+E469N] is carried our in a similar way, except that both mutagenic primers CABX437 and CABX438 are used.
- CABX438 ⁇ 'GGAAGGCTGGGGAAACTTTCACGTAAACGS' (SEQ ID NO: 36)
- Termamyl LC vs. LE1153 and LE1154 This example illustrates the conversion of granular wheat starch into glucose using a bacterial alpha-amylase according to the present invention (LE1153 and LE1154) compared to Termamyl LC.
- a slurry with 33% dry solids (DS) granular starch was prepared by adding 247.5 g of wheat starch under stirring to 502.5 ml of water. The pH was adjusted with HCI to 4.5. The granular starch slurry was distributed to 100 ml Erlenmeyer flasks with 75 g in each flask. The flasks were incubated with magnetic stirring in a 6O 0 C water bath. At zero hours the enzyme activities given in table 1 were dosed to the flasks. Samples were withdrawn after 24, 48 and 73 and 94 hours. Table 1. The enzyme activity levels used.
- Total dry solids starch was determined using the following method. The starch was completely hydrolyzed by adding an excess amount of alpha-amylase (300 KNU/kg dry solids) and placing the sample in an oil bath at 95 0 C for 45 minutes. Subsequently the samples were cooled to 60 0 C and an excess amount of glucoamylase (600 AGU/kg DS) was added followed by incubation for 2 hours at 6O 0 C.
- Soluble dry solids in the starch hydrolysate were determined by refractive index measurement on samples after filtering through a 0.22 microM filter.
- the sugar profiles were determined by HPLC.
- the amount of glucose was calculated as DX. The results are shown in table 2 and 3.
- This example illustrates the conversion of granular wheat starch into glucose using a bacterial alpha-amylase according to the present invention BAN R437W variant compared to BAN WT.
- a slurry with 33% dry solids (DS) granular starch was prepared by adding 247.5 g of wheat starch under stirring to 502.5 ml of water. The pH was adjusted with HCI to 4.5. The granular starch slurry was distributed to 100 ml Erlenmeyer flasks with 75 g in each flask. The flasks were incubated with magnetic stirring in a 60 0 C water bath. At zero hours the enzyme activities given in table 1 were dosed to the flasks. Samples were withdrawn after 24, 48 and 73 and 94 hours.
- Total dry solids starch was determined using the following method. The starch was completely hydrolyzed by adding an excess amount of alpha-amylase (300 KNU/kg dry solids) and placing the sample in an oil bath at 95 0 C for 45 minutes. Subsequently the samples were cooled to 60 0 C and an excess amount of glucoamylase (600 AGU/kg DS) was added followed by incubation for 2 hours at 60°C.
- alpha-amylase 300 KNU/kg dry solids
- Soluble dry solids in the starch hydrolysate were determined by refractive index measurement on samples after filtering through a 0.22 microM filter.
- the sugar profiles were determined by HPLC.
- the amount of glucose was calculated as DX. The results are shown in table 4 and 5.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Detergent Compositions (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (7)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2005800486042A CN101128579B (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants |
MX2007007494A MX2007007494A (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants. |
EP05823004A EP1831360A2 (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants |
JP2007547183A JP5166880B2 (en) | 2004-12-23 | 2005-12-22 | α-Amylase variant |
CA002593920A CA2593920A1 (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants |
US11/722,192 US20090275078A1 (en) | 2004-12-23 | 2005-12-22 | Alpha-Amylase Variants |
AU2005318696A AU2005318696B2 (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DKPA200402000 | 2004-12-23 | ||
DKPA200402000 | 2004-12-23 |
Publications (2)
Publication Number | Publication Date |
---|---|
WO2006066594A2 true WO2006066594A2 (en) | 2006-06-29 |
WO2006066594A3 WO2006066594A3 (en) | 2006-08-31 |
Family
ID=34956405
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/DK2005/000817 WO2006066594A2 (en) | 2004-12-23 | 2005-12-22 | Alpha-amylase variants |
Country Status (8)
Country | Link |
---|---|
US (1) | US20090275078A1 (en) |
EP (1) | EP1831360A2 (en) |
JP (1) | JP5166880B2 (en) |
CN (1) | CN101128579B (en) |
AU (1) | AU2005318696B2 (en) |
CA (1) | CA2593920A1 (en) |
MX (1) | MX2007007494A (en) |
WO (1) | WO2006066594A2 (en) |
Cited By (320)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009140504A1 (en) * | 2008-05-16 | 2009-11-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2011080352A1 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylases |
WO2013110766A1 (en) | 2012-01-26 | 2013-08-01 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
WO2013167581A1 (en) | 2012-05-07 | 2013-11-14 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2013171241A1 (en) | 2012-05-16 | 2013-11-21 | Novozymes A/S | Compositions comprising lipase and methods of use thereof |
WO2013189972A2 (en) | 2012-06-20 | 2013-12-27 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
WO2014029819A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloprotease from exiguobacterium |
WO2014029821A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloproteases from alicyclobacillus sp. |
WO2014087011A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014096259A1 (en) | 2012-12-21 | 2014-06-26 | Novozymes A/S | Polypeptides having protease activiy and polynucleotides encoding same |
WO2014183921A1 (en) | 2013-05-17 | 2014-11-20 | Novozymes A/S | Polypeptides having alpha amylase activity |
WO2014184164A1 (en) | 2013-05-14 | 2014-11-20 | Novozymes A/S | Detergent compositions |
WO2014194117A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194034A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194032A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194054A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014207224A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2014207227A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2015001017A2 (en) | 2013-07-04 | 2015-01-08 | Novozymes A/S | Polypeptides having anti-redeposition effect and polynucleotides encoding same |
WO2015049370A1 (en) | 2013-10-03 | 2015-04-09 | Novozymes A/S | Detergent composition and use of detergent composition |
WO2015089447A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of the bacillus gibsonii-clade |
WO2015089441A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2015095358A1 (en) | 2013-12-18 | 2015-06-25 | E. I. Du Pont De Nemours And Company | Cationic poly alpha-1,3-glucan ethers |
WO2015123323A1 (en) | 2014-02-14 | 2015-08-20 | E. I. Du Pont De Nemours And Company | Poly-alpha-1,3-1,6-glucans for viscosity modification |
WO2015134737A1 (en) | 2014-03-05 | 2015-09-11 | Novozymes A/S | Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase |
WO2015134729A1 (en) | 2014-03-05 | 2015-09-11 | Novozymes A/S | Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase |
WO2015138283A1 (en) | 2014-03-11 | 2015-09-17 | E. I. Du Pont De Nemours And Company | Oxidized poly alpha-1,3-glucan as detergent builder |
WO2015150457A1 (en) | 2014-04-01 | 2015-10-08 | Novozymes A/S | Polypeptides having alpha amylase activity |
WO2015181119A2 (en) | 2014-05-27 | 2015-12-03 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2015189371A1 (en) | 2014-06-12 | 2015-12-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2015195777A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
WO2015195960A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
WO2016001319A1 (en) | 2014-07-03 | 2016-01-07 | Novozymes A/S | Improved stabilization of non-protease enzyme |
WO2016061438A1 (en) | 2014-10-17 | 2016-04-21 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2016069569A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016069548A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016069557A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2016069544A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016069552A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016079305A1 (en) | 2014-11-20 | 2016-05-26 | Novozymes A/S | Alicyclobacillus variants and polynucleotides encoding same |
WO2016079110A2 (en) | 2014-11-19 | 2016-05-26 | Novozymes A/S | Use of enzyme for cleaning |
WO2016087401A1 (en) | 2014-12-05 | 2016-06-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3034592A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
EP3034589A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034588A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034591A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
EP3034596A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034597A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034590A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
WO2016096996A1 (en) | 2014-12-16 | 2016-06-23 | Novozymes A/S | Polypeptides having n-acetyl glucosamine oxidase activity |
WO2016106011A1 (en) | 2014-12-23 | 2016-06-30 | E. I. Du Pont De Nemours And Company | Enzymatically produced cellulose |
WO2016135351A1 (en) | 2015-06-30 | 2016-09-01 | Novozymes A/S | Laundry detergent composition, method for washing and use of composition |
WO2016162556A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Laundry method, use of dnase and detergent composition |
WO2016162558A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Detergent composition |
WO2016184944A1 (en) | 2015-05-19 | 2016-11-24 | Novozymes A/S | Odor reduction |
EP3101109A1 (en) | 2015-06-04 | 2016-12-07 | The Procter and Gamble Company | Hand dishwashing liquid detergent composition |
EP3101108A1 (en) | 2015-06-04 | 2016-12-07 | The Procter and Gamble Company | Hand dishwashing liquid detergent composition |
WO2016201069A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Low-density enzyme-containing particles |
WO2016201044A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Osmotic burst encapsulates |
WO2016201040A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc. | Water-triggered enzyme suspension |
EP3106508A1 (en) | 2015-06-18 | 2016-12-21 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
WO2016202785A1 (en) | 2015-06-17 | 2016-12-22 | Novozymes A/S | Container |
WO2016202739A1 (en) | 2015-06-16 | 2016-12-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
WO2017046260A1 (en) | 2015-09-17 | 2017-03-23 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2017046232A1 (en) | 2015-09-17 | 2017-03-23 | Henkel Ag & Co. Kgaa | Detergent compositions comprising polypeptides having xanthan degrading activity |
WO2017060505A1 (en) | 2015-10-07 | 2017-04-13 | Novozymes A/S | Polypeptides |
WO2017064253A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017066510A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Cleaning of water filtration membranes |
WO2017064269A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptide variants |
WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
WO2017083228A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017083226A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017083229A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017089366A1 (en) | 2015-11-24 | 2017-06-01 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017093318A1 (en) | 2015-12-01 | 2017-06-08 | Novozymes A/S | Methods for producing lipases |
WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
WO2017117089A1 (en) | 2015-12-28 | 2017-07-06 | Novozymes Bioag A/S | Heat priming of bacterial spores |
WO2017129754A1 (en) | 2016-01-29 | 2017-08-03 | Novozymes A/S | Beta-glucanase variants and polynucleotides encoding same |
WO2017174769A2 (en) | 2016-04-08 | 2017-10-12 | Novozymes A/S | Detergent compositions and uses of the same |
WO2017186943A1 (en) | 2016-04-29 | 2017-11-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
WO2017207762A1 (en) | 2016-06-03 | 2017-12-07 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2017210188A1 (en) | 2016-05-31 | 2017-12-07 | Novozymes A/S | Stabilized liquid peroxide compositions |
WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
EP3257931A1 (en) | 2016-06-17 | 2017-12-20 | The Procter and Gamble Company | Detergent composition |
WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
WO2017220422A1 (en) | 2016-06-23 | 2017-12-28 | Novozymes A/S | Use of enzymes, composition and method for removing soil |
WO2018002261A1 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Detergent compositions |
WO2018001959A1 (en) | 2016-06-30 | 2018-01-04 | Novozymes A/S | Lipase variants and compositions comprising surfactant and lipase variant |
WO2018007573A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Detergent compositions with galactanase |
WO2018011276A1 (en) | 2016-07-13 | 2018-01-18 | The Procter & Gamble Company | Bacillus cibi dnase variants and uses thereof |
WO2018015295A1 (en) | 2016-07-18 | 2018-01-25 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
EP3284805A1 (en) | 2016-08-17 | 2018-02-21 | The Procter & Gamble Company | Cleaning composition comprising enzymes |
WO2018037061A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2018037062A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2018037065A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent composition comprising gh9 endoglucanase variants i |
WO2018037064A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent compositions comprising xanthan lyase variants i |
WO2018060216A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Use of enzyme for washing, method for washing and warewashing composition |
WO2018060475A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Spore containing granule |
EP3309249A1 (en) | 2013-07-29 | 2018-04-18 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2018077938A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Detergent compositions |
WO2018083093A1 (en) | 2016-11-01 | 2018-05-11 | Novozymes A/S | Multi-core granules |
WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
EP3321360A2 (en) | 2013-01-03 | 2018-05-16 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2018099762A1 (en) | 2016-12-01 | 2018-06-07 | Basf Se | Stabilization of enzymes in compositions |
WO2018108865A1 (en) | 2016-12-12 | 2018-06-21 | Novozymes A/S | Use of polypeptides |
WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
WO2018177938A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018177936A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018183662A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Delayed release enzyme formulations for bleach-containing detergents |
WO2018178061A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having rnase activity |
EP3385361A1 (en) | 2017-04-05 | 2018-10-10 | Henkel AG & Co. KGaA | Detergent compositions comprising bacterial mannanases |
EP3385362A1 (en) | 2017-04-05 | 2018-10-10 | Henkel AG & Co. KGaA | Detergent compositions comprising fungal mannanases |
WO2018185269A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018184817A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018184818A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185280A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018184873A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Detergent compositions and uses thereof |
WO2018184816A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185181A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Glycosyl hydrolases |
WO2018185150A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptides |
WO2018185152A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptide compositions and uses thereof |
WO2018185285A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185267A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185048A1 (en) | 2017-04-03 | 2018-10-11 | Novozymes A/S | Recovery process |
WO2018202846A1 (en) | 2017-05-05 | 2018-11-08 | Novozymes A/S | Compositions comprising lipase and sulfite |
EP3401385A1 (en) | 2017-05-08 | 2018-11-14 | Henkel AG & Co. KGaA | Detergent composition comprising polypeptide comprising carbohydrate-binding domain |
WO2018206535A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Carbohydrate-binding domain and polynucleotides encoding the same |
WO2018224544A1 (en) | 2017-06-08 | 2018-12-13 | Novozymes A/S | Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions |
WO2019002356A1 (en) | 2017-06-30 | 2019-01-03 | Novozymes A/S | Enzyme slurry composition |
WO2019006077A1 (en) | 2017-06-30 | 2019-01-03 | Danisco Us Inc | Low-agglomeration, enzyme-containing particles |
WO2019038059A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent compositions comprising gh9 endoglucanase variants ii |
WO2019038057A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2019038060A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase variants ii |
WO2019038058A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
EP3453757A1 (en) | 2013-12-20 | 2019-03-13 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2019057758A1 (en) | 2017-09-20 | 2019-03-28 | Novozymes A/S | Use of enzymes for improving water absorption and/or whiteness |
WO2019057902A1 (en) | 2017-09-22 | 2019-03-28 | Novozymes A/S | Novel polypeptides |
EP3461881A1 (en) | 2013-05-03 | 2019-04-03 | Novozymes A/S | Microencapsulation of detergent enzymes |
WO2019067390A1 (en) | 2017-09-27 | 2019-04-04 | The Procter & Gamble Company | Detergent compositions comprising lipases |
WO2019063499A1 (en) | 2017-09-27 | 2019-04-04 | Novozymes A/S | Lipase variants and microcapsule compositions comprising such lipase variants |
WO2019068713A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019068715A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019076800A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2019076833A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Low dusting granules |
WO2019076834A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Low dusting granules |
DE102017125559A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE II |
WO2019081721A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
WO2019081515A1 (en) | 2017-10-24 | 2019-05-02 | Novozymes A/S | Compositions comprising polypeptides having mannanase activity |
DE102017125560A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE III |
WO2019084349A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
DE102017125558A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANING COMPOSITIONS CONTAINING DISPERSINE I |
WO2019086528A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Polypeptides and compositions comprising such polypeptides |
WO2019086532A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Methods for cleaning medical devices |
WO2019086530A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Polypeptides and compositions comprising such polypeptides |
WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
WO2019110462A1 (en) | 2017-12-04 | 2019-06-13 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2019125683A1 (en) | 2017-12-21 | 2019-06-27 | Danisco Us Inc | Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant |
WO2019156670A1 (en) | 2018-02-08 | 2019-08-15 | Danisco Us Inc. | Thermally-resistant wax matrix particles for enzyme encapsulation |
WO2019154951A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipases, lipase variants and compositions thereof |
WO2019154955A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019162000A1 (en) | 2018-02-23 | 2019-08-29 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase and endoglucanase variants |
WO2019175240A1 (en) | 2018-03-13 | 2019-09-19 | Novozymes A/S | Microencapsulation using amino sugar oligomers |
WO2019180111A1 (en) | 2018-03-23 | 2019-09-26 | Novozymes A/S | Subtilase variants and compositions comprising same |
WO2019201793A1 (en) | 2018-04-17 | 2019-10-24 | Novozymes A/S | Polypeptides comprising carbohydrate binding activity in detergent compositions and their use in reducing wrinkles in textile or fabric. |
WO2019201785A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019201783A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019206994A1 (en) | 2018-04-26 | 2019-10-31 | Basf Se | Lipase enzymes |
WO2019211143A1 (en) | 2018-05-03 | 2019-11-07 | Basf Se | Amylase enzymes |
EP3569611A1 (en) | 2013-04-23 | 2019-11-20 | Novozymes A/S | Liquid automatic dish washing detergent compositions with stabilised subtilisin |
WO2019238761A1 (en) | 2018-06-15 | 2019-12-19 | Basf Se | Water soluble multilayer films containing wash active chemicals and enzymes |
WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
EP3587569A1 (en) | 2014-03-21 | 2020-01-01 | Danisco US Inc. | Serine proteases of bacillus species |
WO2020002255A1 (en) | 2018-06-29 | 2020-01-02 | Novozymes A/S | Subtilase variants and compositions comprising same |
WO2020002604A1 (en) | 2018-06-28 | 2020-01-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020002608A1 (en) | 2018-06-29 | 2020-01-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020007875A1 (en) | 2018-07-03 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020008043A1 (en) | 2018-07-06 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020008024A1 (en) | 2018-07-06 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020007863A1 (en) | 2018-07-02 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
EP3608403A2 (en) | 2014-12-15 | 2020-02-12 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
EP3611260A1 (en) | 2013-07-29 | 2020-02-19 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2020047215A1 (en) | 2018-08-30 | 2020-03-05 | Danisco Us Inc | Enzyme-containing granules |
WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
WO2020070249A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Cleaning compositions |
WO2020069914A1 (en) | 2018-10-05 | 2020-04-09 | Basf Se | Compounds stabilizing amylases in liquids |
WO2020070009A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Endonuclease 1 ribonucleases for cleaning |
WO2020070209A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition |
WO2020070011A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition |
WO2020070014A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition comprising anionic surfactant and a polypeptide having rnase activity |
WO2020070199A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same |
WO2020070063A2 (en) | 2018-10-01 | 2020-04-09 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020074545A1 (en) | 2018-10-11 | 2020-04-16 | Novozymes A/S | Cleaning compositions and uses thereof |
EP3647398A1 (en) | 2018-10-31 | 2020-05-06 | Henkel AG & Co. KGaA | Cleaning compositions containing dispersins v |
EP3647397A1 (en) | 2018-10-31 | 2020-05-06 | Henkel AG & Co. KGaA | Cleaning compositions containing dispersins iv |
WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
WO2020114965A1 (en) | 2018-12-03 | 2020-06-11 | Novozymes A/S | LOW pH POWDER DETERGENT COMPOSITION |
WO2020114968A1 (en) | 2018-12-03 | 2020-06-11 | Novozymes A/S | Powder detergent compositions |
WO2020127775A1 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Detergent pouch comprising metalloproteases |
WO2020127796A2 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same |
EP3677676A1 (en) | 2019-01-03 | 2020-07-08 | Basf Se | Compounds stabilizing amylases in liquids |
EP3690037A1 (en) | 2014-12-04 | 2020-08-05 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2020169564A1 (en) | 2019-02-20 | 2020-08-27 | Basf Se | Industrial fermentation process for bacillus using defined medium and trace element feed |
WO2020169563A1 (en) | 2019-02-20 | 2020-08-27 | Basf Se | Industrial fermentation process for bacillus using defined medium and magnesium feed |
EP3702452A1 (en) | 2019-03-01 | 2020-09-02 | Novozymes A/S | Detergent compositions comprising two proteases |
WO2020188095A1 (en) | 2019-03-21 | 2020-09-24 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3715442A1 (en) | 2016-03-23 | 2020-09-30 | Novozymes A/S | Use of polypeptide having dnase activity for treating fabrics |
WO2020193535A2 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Amylase enzymes |
WO2020193532A1 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Cleaning composition having amylase enzymes |
WO2020193534A2 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Amylase enzymes |
WO2020201403A1 (en) | 2019-04-03 | 2020-10-08 | Novozymes A/S | Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions |
EP3722406A1 (en) | 2014-04-11 | 2020-10-14 | Novozymes A/S | Detergent composition |
WO2020207944A1 (en) | 2019-04-10 | 2020-10-15 | Novozymes A/S | Polypeptide variants |
WO2020208056A1 (en) | 2019-04-12 | 2020-10-15 | Novozymes A/S | Stabilized glycoside hydrolase variants |
EP3739029A1 (en) | 2014-07-04 | 2020-11-18 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2020229480A1 (en) | 2019-05-14 | 2020-11-19 | Basf Se | Compounds stabilizing hydrolases in liquids |
EP3741849A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3741848A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
WO2020249546A1 (en) | 2019-06-13 | 2020-12-17 | Basf Se | Method of recovering a protein from fermentation broth using a divalent cation |
WO2021001400A1 (en) | 2019-07-02 | 2021-01-07 | Novozymes A/S | Lipase variants and compositions thereof |
WO2021004830A1 (en) | 2019-07-05 | 2021-01-14 | Basf Se | Industrial fermentation process for microbial cells using a fed-batch pre-culture |
WO2021009067A1 (en) | 2019-07-12 | 2021-01-21 | Novozymes A/S | Enzymatic emulsions for detergents |
WO2021032881A1 (en) | 2019-08-22 | 2021-02-25 | Basf Se | Amylase variants |
EP3786269A1 (en) | 2013-06-06 | 2021-03-03 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2021037895A1 (en) | 2019-08-27 | 2021-03-04 | Novozymes A/S | Detergent composition |
WO2021037878A1 (en) | 2019-08-27 | 2021-03-04 | Novozymes A/S | Composition comprising a lipase |
WO2021053127A1 (en) | 2019-09-19 | 2021-03-25 | Novozymes A/S | Detergent composition |
WO2021064068A1 (en) | 2019-10-03 | 2021-04-08 | Novozymes A/S | Polypeptides comprising at least two carbohydrate binding domains |
WO2021074430A1 (en) | 2019-10-18 | 2021-04-22 | Basf Se | Storage-stable hydrolase containing liquids |
WO2021105336A1 (en) | 2019-11-29 | 2021-06-03 | Basf Se | Compositions comprising polymer and enzyme |
WO2021115912A1 (en) | 2019-12-09 | 2021-06-17 | Basf Se | Formulations comprising a hydrophobically modified polyethyleneimine and one or more enzymes |
WO2021122118A1 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning compositions comprising dispersins vi |
WO2021122120A2 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning compositions comprising dispersins viii |
WO2021122117A1 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning composition coprising a dispersin and a carbohydrase |
WO2021121394A1 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Stabilized liquid boron-free enzyme compositions |
WO2021123307A2 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Polypeptides having proteolytic activity and use thereof |
WO2021151536A1 (en) | 2020-01-29 | 2021-08-05 | Unilever Ip Holdings B.V. | Laundry detergent product |
WO2021152120A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021152123A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
EP3872175A1 (en) | 2015-06-18 | 2021-09-01 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP3872174A1 (en) | 2015-05-13 | 2021-09-01 | Danisco US Inc. | Aprl-clade protease variants and uses thereof |
EP3878957A1 (en) | 2014-05-27 | 2021-09-15 | Novozymes A/S | Methods for producing lipases |
EP3878960A1 (en) | 2014-07-04 | 2021-09-15 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP3892708A1 (en) | 2020-04-06 | 2021-10-13 | Henkel AG & Co. KGaA | Cleaning compositions comprising dispersin variants |
WO2021204838A1 (en) | 2020-04-08 | 2021-10-14 | Novozymes A/S | Carbohydrate binding module variants |
WO2021214059A1 (en) | 2020-04-21 | 2021-10-28 | Novozymes A/S | Cleaning compositions comprising polypeptides having fructan degrading activity |
EP3907271A1 (en) | 2020-05-07 | 2021-11-10 | Novozymes A/S | Cleaning composition, use and method of cleaning |
WO2021239818A1 (en) | 2020-05-26 | 2021-12-02 | Novozymes A/S | Subtilase variants and compositions comprising same |
EP3929285A2 (en) | 2015-07-01 | 2021-12-29 | Novozymes A/S | Methods of reducing odor |
WO2021259099A1 (en) | 2020-06-24 | 2021-12-30 | Novozymes A/S | Use of cellulases for removing dust mite from textile |
EP3936593A1 (en) | 2020-07-08 | 2022-01-12 | Henkel AG & Co. KGaA | Cleaning compositions and uses thereof |
WO2022008732A1 (en) | 2020-07-10 | 2022-01-13 | Basf Se | Enhancing the activity of antimicrobial preservatives |
WO2022023250A1 (en) | 2020-07-27 | 2022-02-03 | Unilever Ip Holdings B.V. | Use of an enzyme and surfactant for inhibiting microorganisms |
EP3950939A2 (en) | 2015-07-06 | 2022-02-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3957711A2 (en) | 2015-10-28 | 2022-02-23 | Novozymes A/S | Detergent composition comprising amylase and protease variants |
WO2022043547A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Protease variants with improved solubility |
WO2022043321A2 (en) | 2020-08-25 | 2022-03-03 | Novozymes A/S | Variants of a family 44 xyloglucanase |
WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
WO2022058322A1 (en) | 2020-09-15 | 2022-03-24 | Novozymes A/S | Animal feed comprising insects or insect meal |
WO2022063699A1 (en) | 2020-09-22 | 2022-03-31 | Basf Se | Improved combination of protease and protease inhibitor with secondary enzyme |
WO2022063698A1 (en) | 2020-09-22 | 2022-03-31 | Basf Se | Liquid composition comprising peptide aldehyde |
WO2022074037A2 (en) | 2020-10-07 | 2022-04-14 | Novozymes A/S | Alpha-amylase variants |
WO2022084303A2 (en) | 2020-10-20 | 2022-04-28 | Novozymes A/S | Use of polypeptides having dnase activity |
WO2022090361A2 (en) | 2020-10-29 | 2022-05-05 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2022090320A1 (en) | 2020-10-28 | 2022-05-05 | Novozymes A/S | Use of lipoxygenase |
WO2022103725A1 (en) | 2020-11-13 | 2022-05-19 | Novozymes A/S | Detergent composition comprising a lipase |
WO2022106400A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of immunochemically different proteases |
WO2022106404A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of proteases |
EP4015629A1 (en) | 2020-12-18 | 2022-06-22 | Basf Se | Polymer mixtures for increasing stability and performance of hydrolase-containing detergents |
EP4032966A1 (en) | 2021-01-22 | 2022-07-27 | Novozymes A/S | Liquid enzyme composition with sulfite scavenger |
WO2022162043A1 (en) | 2021-01-28 | 2022-08-04 | Novozymes A/S | Lipase with low malodor generation |
WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
EP4039806A1 (en) | 2021-02-04 | 2022-08-10 | Henkel AG & Co. KGaA | Detergent composition comprising xanthan lyase and endoglucanase variants with im-proved stability |
WO2022171872A1 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Stabilized biological detergents |
WO2022171780A2 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Alpha-amylase variants |
EP4047088A1 (en) | 2021-02-22 | 2022-08-24 | Basf Se | Amylase variants |
WO2022175435A1 (en) | 2021-02-22 | 2022-08-25 | Basf Se | Amylase variants |
US11441140B2 (en) | 2015-12-07 | 2022-09-13 | Henkel Ag & Co. Kgaa | Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof |
WO2022189521A1 (en) | 2021-03-12 | 2022-09-15 | Novozymes A/S | Polypeptide variants |
EP4060036A1 (en) | 2021-03-15 | 2022-09-21 | Novozymes A/S | Polypeptide variants |
WO2022194673A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Dnase variants |
WO2022268885A1 (en) | 2021-06-23 | 2022-12-29 | Novozymes A/S | Alpha-amylase polypeptides |
WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
WO2023039270A2 (en) | 2021-09-13 | 2023-03-16 | Danisco Us Inc. | Bioactive-containing granules |
EP4163305A1 (en) | 2013-12-16 | 2023-04-12 | Nutrition & Biosciences USA 4, Inc. | Use of poly alpha-1,3-glucan ethers as viscosity modifiers |
WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023118015A1 (en) | 2021-12-21 | 2023-06-29 | Basf Se | Environmental attributes for care composition ingredients |
WO2023116569A1 (en) | 2021-12-21 | 2023-06-29 | Novozymes A/S | Composition comprising a lipase and a booster |
EP4206309A1 (en) | 2021-12-30 | 2023-07-05 | Novozymes A/S | Protein particles with improved whiteness |
EP4234664A1 (en) | 2022-02-24 | 2023-08-30 | Evonik Operations GmbH | Composition comprising glucolipids and enzymes |
WO2023165507A1 (en) | 2022-03-02 | 2023-09-07 | Novozymes A/S | Use of xyloglucanase for improvement of sustainability of detergents |
WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
WO2023165950A1 (en) | 2022-03-04 | 2023-09-07 | Novozymes A/S | Dnase variants and compositions |
WO2023194204A1 (en) | 2022-04-08 | 2023-10-12 | Novozymes A/S | Hexosaminidase variants and compositions |
WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
WO2023233028A1 (en) | 2022-06-03 | 2023-12-07 | Unilever Ip Holdings B.V. | Laundry detergent product |
WO2023247348A1 (en) | 2022-06-21 | 2023-12-28 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2023247664A2 (en) | 2022-06-24 | 2023-12-28 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
WO2024012894A1 (en) | 2022-07-15 | 2024-01-18 | Basf Se | Alkanolamine formates for enzyme stabilization in liquid formulations |
WO2024033135A2 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Amylase variants |
WO2024033136A1 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Amylase variants |
WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
WO2024094735A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024094732A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024094733A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP5492879B2 (en) * | 2008-06-06 | 2014-05-14 | ダニスコ・ユーエス・インク | Geobacillus stearothermophilus alpha amylase (AmyS) variant with improved properties |
CN102341495A (en) * | 2009-03-10 | 2012-02-01 | 丹尼斯科美国公司 | ALPHA-AMYLASES ASSOCIATED with BACILLUS MEGATERIUM DSM90, and method for using same |
EP3101102B2 (en) | 2015-06-05 | 2023-12-13 | The Procter & Gamble Company | Compacted liquid laundry detergent composition |
EP3101100B1 (en) | 2015-06-05 | 2018-02-07 | The Procter and Gamble Company | Compacted liquid laundry detergent composition |
EP3101107B1 (en) | 2015-06-05 | 2019-04-24 | The Procter and Gamble Company | Compacted liquid laundry detergent composition |
CN106047844B (en) * | 2016-08-01 | 2020-05-22 | 安徽工程大学 | Fungus α -amylase variant with high maltose generation rate and preparation method thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996023874A1 (en) * | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | A method of designing alpha-amylase mutants with predetermined properties |
US6187576B1 (en) * | 1997-10-13 | 2001-02-13 | Novo Nordisk A/S | α-amylase mutants |
US20040096952A1 (en) * | 2001-05-15 | 2004-05-20 | Allan Svendsen | Alpha-amylase variant with altered properties |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6197565B1 (en) * | 1998-11-16 | 2001-03-06 | Novo-Nordisk A/S | α-Amylase variants |
BR0009392B1 (en) * | 1999-03-31 | 2012-06-12 | mutant of a polypeptide with alpha-amylase activity, and use of the polypeptide or variant. |
-
2005
- 2005-12-22 CA CA002593920A patent/CA2593920A1/en not_active Abandoned
- 2005-12-22 JP JP2007547183A patent/JP5166880B2/en not_active Expired - Fee Related
- 2005-12-22 WO PCT/DK2005/000817 patent/WO2006066594A2/en active Application Filing
- 2005-12-22 CN CN2005800486042A patent/CN101128579B/en not_active Expired - Fee Related
- 2005-12-22 MX MX2007007494A patent/MX2007007494A/en active IP Right Grant
- 2005-12-22 AU AU2005318696A patent/AU2005318696B2/en not_active Ceased
- 2005-12-22 EP EP05823004A patent/EP1831360A2/en not_active Withdrawn
- 2005-12-22 US US11/722,192 patent/US20090275078A1/en not_active Abandoned
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO1996023874A1 (en) * | 1995-02-03 | 1996-08-08 | Novo Nordisk A/S | A method of designing alpha-amylase mutants with predetermined properties |
US6187576B1 (en) * | 1997-10-13 | 2001-02-13 | Novo Nordisk A/S | α-amylase mutants |
US20040096952A1 (en) * | 2001-05-15 | 2004-05-20 | Allan Svendsen | Alpha-amylase variant with altered properties |
Non-Patent Citations (2)
Title |
---|
HASHIDA M AND BISGAARD-FRANTZEN H: "Protein engineering of new industrial amylases" TRENDS IN GLYCOSICIENCE AND GLYCOTECHNOLOGY, vol. 12, no. 68, November 2000 (2000-11), pages 389-401, XP002388328 * |
MACHIUS M ET AL: "CRYSTAL STRUCTURE OF CALCIUM-DEPLETED BACILLUS LICHENIFORMIS ALPHA-AMYLASE AT 2.2 A RESOLUTION" JOURNAL OF MOLECULAR BIOLOGY, LONDON, GB, vol. 246, 1995, pages 545-559, XP000944781 ISSN: 0022-2836 * |
Cited By (390)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2009140504A1 (en) * | 2008-05-16 | 2009-11-19 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
US8530216B2 (en) | 2008-05-16 | 2013-09-10 | Novozymes A/S | Polypeptides having alpha-amylase activity and polynucleotides encoding same |
WO2011080352A1 (en) | 2010-01-04 | 2011-07-07 | Novozymes A/S | Alpha-amylases |
WO2013110766A1 (en) | 2012-01-26 | 2013-08-01 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
WO2013167581A1 (en) | 2012-05-07 | 2013-11-14 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2013171241A1 (en) | 2012-05-16 | 2013-11-21 | Novozymes A/S | Compositions comprising lipase and methods of use thereof |
WO2013189972A2 (en) | 2012-06-20 | 2013-12-27 | Novozymes A/S | Use of polypeptides having protease activity in animal feed and detergents |
WO2014029819A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloprotease from exiguobacterium |
WO2014029821A1 (en) | 2012-08-22 | 2014-02-27 | Novozymes A/S | Metalloproteases from alicyclobacillus sp. |
WO2014087011A1 (en) | 2012-12-07 | 2014-06-12 | Novozymes A/S | Preventing adhesion of bacteria |
EP3556836A1 (en) | 2012-12-07 | 2019-10-23 | Novozymes A/S | Preventing adhesion of bacteria |
WO2014096259A1 (en) | 2012-12-21 | 2014-06-26 | Novozymes A/S | Polypeptides having protease activiy and polynucleotides encoding same |
EP3321360A2 (en) | 2013-01-03 | 2018-05-16 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
EP3569611A1 (en) | 2013-04-23 | 2019-11-20 | Novozymes A/S | Liquid automatic dish washing detergent compositions with stabilised subtilisin |
EP3461881A1 (en) | 2013-05-03 | 2019-04-03 | Novozymes A/S | Microencapsulation of detergent enzymes |
WO2014184164A1 (en) | 2013-05-14 | 2014-11-20 | Novozymes A/S | Detergent compositions |
WO2014183921A1 (en) | 2013-05-17 | 2014-11-20 | Novozymes A/S | Polypeptides having alpha amylase activity |
EP3260538A1 (en) | 2013-05-29 | 2017-12-27 | Danisco US Inc. | Novel metalloproteases |
WO2014194034A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194117A2 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194054A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
WO2014194032A1 (en) | 2013-05-29 | 2014-12-04 | Danisco Us Inc. | Novel metalloproteases |
EP3882346A1 (en) | 2013-05-29 | 2021-09-22 | Danisco US Inc. | Novel metalloproteases |
EP4159854A1 (en) | 2013-05-29 | 2023-04-05 | Danisco US Inc | Novel metalloproteases |
EP3636662A1 (en) | 2013-05-29 | 2020-04-15 | Danisco US Inc. | Novel metalloproteases |
EP3786269A1 (en) | 2013-06-06 | 2021-03-03 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2014207227A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2014207224A1 (en) | 2013-06-27 | 2014-12-31 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2015001017A2 (en) | 2013-07-04 | 2015-01-08 | Novozymes A/S | Polypeptides having anti-redeposition effect and polynucleotides encoding same |
EP3613853A1 (en) | 2013-07-29 | 2020-02-26 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3611260A1 (en) | 2013-07-29 | 2020-02-19 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3309249A1 (en) | 2013-07-29 | 2018-04-18 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2015049370A1 (en) | 2013-10-03 | 2015-04-09 | Novozymes A/S | Detergent composition and use of detergent composition |
EP3553173A1 (en) | 2013-12-13 | 2019-10-16 | Danisco US Inc. | Serine proteases of the bacillus gibsonii-clade |
EP3910057A1 (en) | 2013-12-13 | 2021-11-17 | Danisco US Inc. | Serine proteases of the bacillus gibsonii-clade |
WO2015089441A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2015089447A1 (en) | 2013-12-13 | 2015-06-18 | Danisco Us Inc. | Serine proteases of the bacillus gibsonii-clade |
EP3514230A1 (en) | 2013-12-13 | 2019-07-24 | Danisco US Inc. | Serine proteases of bacillus species |
EP4163305A1 (en) | 2013-12-16 | 2023-04-12 | Nutrition & Biosciences USA 4, Inc. | Use of poly alpha-1,3-glucan ethers as viscosity modifiers |
WO2015095358A1 (en) | 2013-12-18 | 2015-06-25 | E. I. Du Pont De Nemours And Company | Cationic poly alpha-1,3-glucan ethers |
EP3789407A1 (en) | 2013-12-18 | 2021-03-10 | Nutrition & Biosciences USA 4, Inc. | Cationic poly alpha-1,3-glucan ethers |
EP3453757A1 (en) | 2013-12-20 | 2019-03-13 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2015123323A1 (en) | 2014-02-14 | 2015-08-20 | E. I. Du Pont De Nemours And Company | Poly-alpha-1,3-1,6-glucans for viscosity modification |
WO2015134729A1 (en) | 2014-03-05 | 2015-09-11 | Novozymes A/S | Compositions and methods for improving properties of non-cellulosic textile materials with xyloglucan endotransglycosylase |
WO2015134737A1 (en) | 2014-03-05 | 2015-09-11 | Novozymes A/S | Compositions and methods for improving properties of cellulosic textile materials with xyloglucan endotransglycosylase |
WO2015138283A1 (en) | 2014-03-11 | 2015-09-17 | E. I. Du Pont De Nemours And Company | Oxidized poly alpha-1,3-glucan as detergent builder |
EP3587569A1 (en) | 2014-03-21 | 2020-01-01 | Danisco US Inc. | Serine proteases of bacillus species |
EP4155398A1 (en) | 2014-03-21 | 2023-03-29 | Danisco US Inc. | Serine proteases of bacillus species |
WO2015150457A1 (en) | 2014-04-01 | 2015-10-08 | Novozymes A/S | Polypeptides having alpha amylase activity |
EP3722406A1 (en) | 2014-04-11 | 2020-10-14 | Novozymes A/S | Detergent composition |
WO2015181119A2 (en) | 2014-05-27 | 2015-12-03 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3760713A2 (en) | 2014-05-27 | 2021-01-06 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3878957A1 (en) | 2014-05-27 | 2021-09-15 | Novozymes A/S | Methods for producing lipases |
WO2015189371A1 (en) | 2014-06-12 | 2015-12-17 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2015195777A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
WO2015195960A1 (en) | 2014-06-19 | 2015-12-23 | E. I. Du Pont De Nemours And Company | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
EP3919599A1 (en) | 2014-06-19 | 2021-12-08 | Nutrition & Biosciences USA 4, Inc. | Compositions containing one or more poly alpha-1,3-glucan ether compounds |
WO2016001319A1 (en) | 2014-07-03 | 2016-01-07 | Novozymes A/S | Improved stabilization of non-protease enzyme |
EP3878960A1 (en) | 2014-07-04 | 2021-09-15 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP3739029A1 (en) | 2014-07-04 | 2020-11-18 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2016061438A1 (en) | 2014-10-17 | 2016-04-21 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2016069569A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
EP3550017A1 (en) | 2014-10-27 | 2019-10-09 | Danisco US Inc. | Serine proteases |
WO2016069548A2 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016069557A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases of bacillus species |
WO2016069544A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016069552A1 (en) | 2014-10-27 | 2016-05-06 | Danisco Us Inc. | Serine proteases |
WO2016079110A2 (en) | 2014-11-19 | 2016-05-26 | Novozymes A/S | Use of enzyme for cleaning |
WO2016079305A1 (en) | 2014-11-20 | 2016-05-26 | Novozymes A/S | Alicyclobacillus variants and polynucleotides encoding same |
EP3690037A1 (en) | 2014-12-04 | 2020-08-05 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP4067485A2 (en) | 2014-12-05 | 2022-10-05 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2016087401A1 (en) | 2014-12-05 | 2016-06-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
EP3608403A2 (en) | 2014-12-15 | 2020-02-12 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
US10760036B2 (en) | 2014-12-15 | 2020-09-01 | Henkel Ag & Co. Kgaa | Detergent composition comprising subtilase variants |
WO2016096996A1 (en) | 2014-12-16 | 2016-06-23 | Novozymes A/S | Polypeptides having n-acetyl glucosamine oxidase activity |
WO2016099858A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Detergent composition |
WO2016100323A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Detergent composition |
WO2016099861A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Method of automatic dishwashing |
WO2016100324A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Method of automatic dishwashing |
EP3034597A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034589A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034588A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034592A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
EP3034596A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Detergent composition |
EP3034591A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
EP3034590A1 (en) | 2014-12-17 | 2016-06-22 | The Procter and Gamble Company | Method of automatic dishwashing |
WO2016099859A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Detergent composition |
WO2016100320A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Detergent composition |
WO2016099860A1 (en) | 2014-12-17 | 2016-06-23 | The Procter & Gamble Company | Method of automatic dishwashing |
EP3741848A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
EP3741849A2 (en) | 2014-12-19 | 2020-11-25 | Novozymes A/S | Protease variants and polynucleotides encoding same |
WO2016106011A1 (en) | 2014-12-23 | 2016-06-30 | E. I. Du Pont De Nemours And Company | Enzymatically produced cellulose |
WO2016162556A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Laundry method, use of dnase and detergent composition |
WO2016162558A1 (en) | 2015-04-10 | 2016-10-13 | Novozymes A/S | Detergent composition |
EP3872174A1 (en) | 2015-05-13 | 2021-09-01 | Danisco US Inc. | Aprl-clade protease variants and uses thereof |
EP4219704A2 (en) | 2015-05-13 | 2023-08-02 | Danisco US Inc | Aprl-clade protease variants and uses thereof |
WO2016184944A1 (en) | 2015-05-19 | 2016-11-24 | Novozymes A/S | Odor reduction |
WO2016196874A1 (en) | 2015-06-04 | 2016-12-08 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
EP3101108A1 (en) | 2015-06-04 | 2016-12-07 | The Procter and Gamble Company | Hand dishwashing liquid detergent composition |
EP3101109A1 (en) | 2015-06-04 | 2016-12-07 | The Procter and Gamble Company | Hand dishwashing liquid detergent composition |
US10377973B2 (en) | 2015-06-04 | 2019-08-13 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
WO2016196872A1 (en) | 2015-06-04 | 2016-12-08 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
EP3284811A1 (en) | 2015-06-04 | 2018-02-21 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
US10377974B2 (en) | 2015-06-04 | 2019-08-13 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
EP3287513A1 (en) | 2015-06-04 | 2018-02-28 | The Procter & Gamble Company | Hand dishwashing liquid detergent composition |
WO2016201069A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Low-density enzyme-containing particles |
WO2016201044A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc | Osmotic burst encapsulates |
WO2016201040A1 (en) | 2015-06-09 | 2016-12-15 | Danisco Us Inc. | Water-triggered enzyme suspension |
WO2016202739A1 (en) | 2015-06-16 | 2016-12-22 | Novozymes A/S | Polypeptides with lipase activity and polynucleotides encoding same |
WO2016202785A1 (en) | 2015-06-17 | 2016-12-22 | Novozymes A/S | Container |
WO2016205755A1 (en) | 2015-06-17 | 2016-12-22 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
EP4234693A2 (en) | 2015-06-17 | 2023-08-30 | Danisco US Inc | Bacillus gibsonii-clade serine proteases |
EP4071244A1 (en) | 2015-06-18 | 2022-10-12 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
EP3106508A1 (en) | 2015-06-18 | 2016-12-21 | Henkel AG & Co. KGaA | Detergent composition comprising subtilase variants |
EP3872175A1 (en) | 2015-06-18 | 2021-09-01 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2016135351A1 (en) | 2015-06-30 | 2016-09-01 | Novozymes A/S | Laundry detergent composition, method for washing and use of composition |
EP3929285A2 (en) | 2015-07-01 | 2021-12-29 | Novozymes A/S | Methods of reducing odor |
EP3950939A2 (en) | 2015-07-06 | 2022-02-09 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2017046260A1 (en) | 2015-09-17 | 2017-03-23 | Novozymes A/S | Polypeptides having xanthan degrading activity and polynucleotides encoding same |
WO2017046232A1 (en) | 2015-09-17 | 2017-03-23 | Henkel Ag & Co. Kgaa | Detergent compositions comprising polypeptides having xanthan degrading activity |
EP3708660A2 (en) | 2015-10-07 | 2020-09-16 | Novozymes A/S | Polypeptides |
WO2017060505A1 (en) | 2015-10-07 | 2017-04-13 | Novozymes A/S | Polypeptides |
WO2017064269A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptide variants |
WO2017066510A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Cleaning of water filtration membranes |
EP4324919A2 (en) | 2015-10-14 | 2024-02-21 | Novozymes A/S | Polypeptide variants |
WO2017064253A1 (en) | 2015-10-14 | 2017-04-20 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
EP3957711A2 (en) | 2015-10-28 | 2022-02-23 | Novozymes A/S | Detergent composition comprising amylase and protease variants |
WO2017079756A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus and bacillus spp. mannanases |
EP4141113A1 (en) | 2015-11-05 | 2023-03-01 | Danisco US Inc | Paenibacillus sp. mannanases |
WO2017079751A1 (en) | 2015-11-05 | 2017-05-11 | Danisco Us Inc | Paenibacillus sp. mannanases |
US10844324B2 (en) | 2015-11-13 | 2020-11-24 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
US10822574B2 (en) | 2015-11-13 | 2020-11-03 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
US10876074B2 (en) | 2015-11-13 | 2020-12-29 | Dupont Industrial Biosciences Usa, Llc | Glucan fiber compositions for use in laundry care and fabric care |
WO2017083229A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017083226A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017083228A1 (en) | 2015-11-13 | 2017-05-18 | E. I. Du Pont De Nemours And Company | Glucan fiber compositions for use in laundry care and fabric care |
WO2017089366A1 (en) | 2015-11-24 | 2017-06-01 | Novozymes A/S | Polypeptides having protease activity and polynucleotides encoding same |
WO2017093318A1 (en) | 2015-12-01 | 2017-06-08 | Novozymes A/S | Methods for producing lipases |
US11441140B2 (en) | 2015-12-07 | 2022-09-13 | Henkel Ag & Co. Kgaa | Dishwashing compositions comprising polypeptides having beta-glucanase activity and uses thereof |
WO2017106676A1 (en) | 2015-12-18 | 2017-06-22 | Danisco Us Inc | Polypeptides with endoglucanase activity and uses thereof |
WO2017117089A1 (en) | 2015-12-28 | 2017-07-06 | Novozymes Bioag A/S | Heat priming of bacterial spores |
WO2017129754A1 (en) | 2016-01-29 | 2017-08-03 | Novozymes A/S | Beta-glucanase variants and polynucleotides encoding same |
EP3715442A1 (en) | 2016-03-23 | 2020-09-30 | Novozymes A/S | Use of polypeptide having dnase activity for treating fabrics |
WO2017174769A2 (en) | 2016-04-08 | 2017-10-12 | Novozymes A/S | Detergent compositions and uses of the same |
EP3693449A1 (en) | 2016-04-29 | 2020-08-12 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017186943A1 (en) | 2016-04-29 | 2017-11-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2017192692A1 (en) | 2016-05-03 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
WO2017192300A1 (en) | 2016-05-05 | 2017-11-09 | Danisco Us Inc | Protease variants and uses thereof |
EP3845642A1 (en) | 2016-05-05 | 2021-07-07 | Danisco US Inc. | Protease variants and uses thereof |
WO2017210295A1 (en) | 2016-05-31 | 2017-12-07 | Danisco Us Inc. | Protease variants and uses thereof |
WO2017210188A1 (en) | 2016-05-31 | 2017-12-07 | Novozymes A/S | Stabilized liquid peroxide compositions |
WO2017207762A1 (en) | 2016-06-03 | 2017-12-07 | Novozymes A/S | Subtilase variants and polynucleotides encoding same |
WO2017218861A1 (en) | 2016-06-17 | 2017-12-21 | The Procter & Gamble Company | Detergent composition |
EP4151726A1 (en) | 2016-06-17 | 2023-03-22 | Danisco US Inc | Protease variants and uses thereof |
EP3257931A1 (en) | 2016-06-17 | 2017-12-20 | The Procter and Gamble Company | Detergent composition |
WO2017219011A1 (en) | 2016-06-17 | 2017-12-21 | Danisco Us Inc | Protease variants and uses thereof |
WO2017220422A1 (en) | 2016-06-23 | 2017-12-28 | Novozymes A/S | Use of enzymes, composition and method for removing soil |
WO2018001959A1 (en) | 2016-06-30 | 2018-01-04 | Novozymes A/S | Lipase variants and compositions comprising surfactant and lipase variant |
WO2018002261A1 (en) | 2016-07-01 | 2018-01-04 | Novozymes A/S | Detergent compositions |
WO2018007573A1 (en) | 2016-07-08 | 2018-01-11 | Novozymes A/S | Detergent compositions with galactanase |
EP3950941A2 (en) | 2016-07-13 | 2022-02-09 | Novozymes A/S | Dnase polypeptide variants |
WO2018011276A1 (en) | 2016-07-13 | 2018-01-18 | The Procter & Gamble Company | Bacillus cibi dnase variants and uses thereof |
WO2018011277A1 (en) | 2016-07-13 | 2018-01-18 | Novozymes A/S | Bacillus cibi dnase variants |
WO2018015295A1 (en) | 2016-07-18 | 2018-01-25 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
EP4357453A2 (en) | 2016-07-18 | 2024-04-24 | Novozymes A/S | Lipase variants, polynucleotides encoding same and the use thereof |
WO2018034842A1 (en) | 2016-08-17 | 2018-02-22 | The Procter & Gamble Company | Cleaning composition comprising enzymes |
EP3284805A1 (en) | 2016-08-17 | 2018-02-21 | The Procter & Gamble Company | Cleaning composition comprising enzymes |
WO2018037064A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent compositions comprising xanthan lyase variants i |
WO2018037065A1 (en) | 2016-08-24 | 2018-03-01 | Henkel Ag & Co. Kgaa | Detergent composition comprising gh9 endoglucanase variants i |
WO2018037062A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2018037061A1 (en) | 2016-08-24 | 2018-03-01 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2018060475A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Spore containing granule |
WO2018060216A1 (en) | 2016-09-29 | 2018-04-05 | Novozymes A/S | Use of enzyme for washing, method for washing and warewashing composition |
WO2018077938A1 (en) | 2016-10-25 | 2018-05-03 | Novozymes A/S | Detergent compositions |
WO2018083093A1 (en) | 2016-11-01 | 2018-05-11 | Novozymes A/S | Multi-core granules |
WO2018085524A2 (en) | 2016-11-07 | 2018-05-11 | Danisco Us Inc | Laundry detergent composition |
WO2018099762A1 (en) | 2016-12-01 | 2018-06-07 | Basf Se | Stabilization of enzymes in compositions |
WO2018108865A1 (en) | 2016-12-12 | 2018-06-21 | Novozymes A/S | Use of polypeptides |
WO2018112123A1 (en) | 2016-12-15 | 2018-06-21 | Danisco Us Inc. | Polypeptides with endoglucanase activity and uses thereof |
WO2018118917A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Protease variants and uses thereof |
WO2018118950A1 (en) | 2016-12-21 | 2018-06-28 | Danisco Us Inc. | Bacillus gibsonii-clade serine proteases |
EP4212622A2 (en) | 2016-12-21 | 2023-07-19 | Danisco US Inc. | Bacillus gibsonii-clade serine proteases |
WO2018169750A1 (en) | 2017-03-15 | 2018-09-20 | Danisco Us Inc | Trypsin-like serine proteases and uses thereof |
WO2018177938A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018177936A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having dnase activity |
WO2018183662A1 (en) | 2017-03-31 | 2018-10-04 | Danisco Us Inc | Delayed release enzyme formulations for bleach-containing detergents |
WO2018178061A1 (en) | 2017-03-31 | 2018-10-04 | Novozymes A/S | Polypeptides having rnase activity |
WO2018185048A1 (en) | 2017-04-03 | 2018-10-11 | Novozymes A/S | Recovery process |
WO2018185150A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptides |
WO2018185181A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Glycosyl hydrolases |
WO2018185152A1 (en) | 2017-04-04 | 2018-10-11 | Novozymes A/S | Polypeptide compositions and uses thereof |
EP3385362A1 (en) | 2017-04-05 | 2018-10-10 | Henkel AG & Co. KGaA | Detergent compositions comprising fungal mannanases |
WO2018184767A1 (en) | 2017-04-05 | 2018-10-11 | Henkel Ag & Co. Kgaa | Detergent compositions comprising bacterial mannanases |
EP3385361A1 (en) | 2017-04-05 | 2018-10-10 | Henkel AG & Co. KGaA | Detergent compositions comprising bacterial mannanases |
WO2018184818A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185280A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
EP3626809A1 (en) | 2017-04-06 | 2020-03-25 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185269A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018184873A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Detergent compositions and uses thereof |
WO2018184816A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
EP3967756A1 (en) | 2017-04-06 | 2022-03-16 | Novozymes A/S | Detergent compositions and uses thereof |
WO2018184817A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185285A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018185267A1 (en) | 2017-04-06 | 2018-10-11 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2018202846A1 (en) | 2017-05-05 | 2018-11-08 | Novozymes A/S | Compositions comprising lipase and sulfite |
EP3401385A1 (en) | 2017-05-08 | 2018-11-14 | Henkel AG & Co. KGaA | Detergent composition comprising polypeptide comprising carbohydrate-binding domain |
WO2018206535A1 (en) | 2017-05-08 | 2018-11-15 | Novozymes A/S | Carbohydrate-binding domain and polynucleotides encoding the same |
WO2018206178A1 (en) | 2017-05-08 | 2018-11-15 | Henkel Ag & Co. Kgaa | Detergent composition comprising polypeptide comprising carbohydrate-binding domain |
WO2018224544A1 (en) | 2017-06-08 | 2018-12-13 | Novozymes A/S | Compositions comprising polypeptides having cellulase activity and amylase activity, and uses thereof in cleaning and detergent compositions |
WO2019006077A1 (en) | 2017-06-30 | 2019-01-03 | Danisco Us Inc | Low-agglomeration, enzyme-containing particles |
WO2019002356A1 (en) | 2017-06-30 | 2019-01-03 | Novozymes A/S | Enzyme slurry composition |
WO2019038059A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent compositions comprising gh9 endoglucanase variants ii |
WO2019038057A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Xanthan lyase variants and polynucleotides encoding same |
WO2019038060A1 (en) | 2017-08-24 | 2019-02-28 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase variants ii |
WO2019038058A1 (en) | 2017-08-24 | 2019-02-28 | Novozymes A/S | Gh9 endoglucanase variants and polynucleotides encoding same |
WO2019057758A1 (en) | 2017-09-20 | 2019-03-28 | Novozymes A/S | Use of enzymes for improving water absorption and/or whiteness |
WO2019057902A1 (en) | 2017-09-22 | 2019-03-28 | Novozymes A/S | Novel polypeptides |
WO2019067390A1 (en) | 2017-09-27 | 2019-04-04 | The Procter & Gamble Company | Detergent compositions comprising lipases |
WO2019063499A1 (en) | 2017-09-27 | 2019-04-04 | Novozymes A/S | Lipase variants and microcapsule compositions comprising such lipase variants |
WO2019068715A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019068713A1 (en) | 2017-10-02 | 2019-04-11 | Novozymes A/S | Polypeptides having mannanase activity and polynucleotides encoding same |
WO2019076834A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Low dusting granules |
WO2019076833A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Low dusting granules |
WO2019076800A1 (en) | 2017-10-16 | 2019-04-25 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2019081515A1 (en) | 2017-10-24 | 2019-05-02 | Novozymes A/S | Compositions comprising polypeptides having mannanase activity |
WO2019081724A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
WO2019084349A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
WO2019084350A1 (en) | 2017-10-27 | 2019-05-02 | The Procter & Gamble Company | Detergent compositions comprising polypeptide variants |
WO2019081721A1 (en) | 2017-10-27 | 2019-05-02 | Novozymes A/S | Dnase variants |
WO2019086530A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Polypeptides and compositions comprising such polypeptides |
WO2019086526A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins iii |
DE102017125560A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE III |
WO2019086520A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins i |
WO2019086532A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Methods for cleaning medical devices |
WO2019086521A1 (en) | 2017-11-01 | 2019-05-09 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins ii |
WO2019086528A1 (en) | 2017-11-01 | 2019-05-09 | Novozymes A/S | Polypeptides and compositions comprising such polypeptides |
DE102017125559A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANSING COMPOSITIONS CONTAINING DISPERSINE II |
DE102017125558A1 (en) | 2017-11-01 | 2019-05-02 | Henkel Ag & Co. Kgaa | CLEANING COMPOSITIONS CONTAINING DISPERSINE I |
WO2019108599A1 (en) | 2017-11-29 | 2019-06-06 | Danisco Us Inc | Subtilisin variants having improved stability |
WO2019110462A1 (en) | 2017-12-04 | 2019-06-13 | Novozymes A/S | Lipase variants and polynucleotides encoding same |
WO2019125683A1 (en) | 2017-12-21 | 2019-06-27 | Danisco Us Inc | Enzyme-containing, hot-melt granules comprising a thermotolerant desiccant |
WO2019154952A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019156670A1 (en) | 2018-02-08 | 2019-08-15 | Danisco Us Inc. | Thermally-resistant wax matrix particles for enzyme encapsulation |
WO2019154951A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipases, lipase variants and compositions thereof |
WO2019154955A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019154954A1 (en) | 2018-02-08 | 2019-08-15 | Novozymes A/S | Lipase variants and compositions thereof |
WO2019162000A1 (en) | 2018-02-23 | 2019-08-29 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase and endoglucanase variants |
WO2019175240A1 (en) | 2018-03-13 | 2019-09-19 | Novozymes A/S | Microencapsulation using amino sugar oligomers |
WO2019180111A1 (en) | 2018-03-23 | 2019-09-26 | Novozymes A/S | Subtilase variants and compositions comprising same |
WO2019201793A1 (en) | 2018-04-17 | 2019-10-24 | Novozymes A/S | Polypeptides comprising carbohydrate binding activity in detergent compositions and their use in reducing wrinkles in textile or fabric. |
WO2019201785A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019201783A1 (en) | 2018-04-19 | 2019-10-24 | Novozymes A/S | Stabilized cellulase variants |
WO2019206994A1 (en) | 2018-04-26 | 2019-10-31 | Basf Se | Lipase enzymes |
WO2019211143A1 (en) | 2018-05-03 | 2019-11-07 | Basf Se | Amylase enzymes |
WO2019238761A1 (en) | 2018-06-15 | 2019-12-19 | Basf Se | Water soluble multilayer films containing wash active chemicals and enzymes |
WO2019245704A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
WO2019245705A1 (en) | 2018-06-19 | 2019-12-26 | Danisco Us Inc | Subtilisin variants |
WO2020002604A1 (en) | 2018-06-28 | 2020-01-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020002608A1 (en) | 2018-06-29 | 2020-01-02 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020002255A1 (en) | 2018-06-29 | 2020-01-02 | Novozymes A/S | Subtilase variants and compositions comprising same |
WO2020007863A1 (en) | 2018-07-02 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020007875A1 (en) | 2018-07-03 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020008043A1 (en) | 2018-07-06 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020008024A1 (en) | 2018-07-06 | 2020-01-09 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020047215A1 (en) | 2018-08-30 | 2020-03-05 | Danisco Us Inc | Enzyme-containing granules |
WO2020068486A1 (en) | 2018-09-27 | 2020-04-02 | Danisco Us Inc | Compositions for medical instrument cleaning |
WO2020070063A2 (en) | 2018-10-01 | 2020-04-09 | Novozymes A/S | Detergent compositions and uses thereof |
WO2020070014A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition comprising anionic surfactant and a polypeptide having rnase activity |
WO2020070209A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition |
WO2020070011A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Cleaning composition |
WO2020070009A1 (en) | 2018-10-02 | 2020-04-09 | Novozymes A/S | Endonuclease 1 ribonucleases for cleaning |
WO2020070249A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Cleaning compositions |
WO2020070199A1 (en) | 2018-10-03 | 2020-04-09 | Novozymes A/S | Polypeptides having alpha-mannan degrading activity and polynucleotides encoding same |
WO2020069914A1 (en) | 2018-10-05 | 2020-04-09 | Basf Se | Compounds stabilizing amylases in liquids |
WO2020074545A1 (en) | 2018-10-11 | 2020-04-16 | Novozymes A/S | Cleaning compositions and uses thereof |
WO2020088958A1 (en) | 2018-10-31 | 2020-05-07 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins v |
WO2020088957A1 (en) | 2018-10-31 | 2020-05-07 | Henkel Ag & Co. Kgaa | Cleaning compositions containing dispersins iv |
EP3647397A1 (en) | 2018-10-31 | 2020-05-06 | Henkel AG & Co. KGaA | Cleaning compositions containing dispersins iv |
EP3647398A1 (en) | 2018-10-31 | 2020-05-06 | Henkel AG & Co. KGaA | Cleaning compositions containing dispersins v |
WO2020112599A1 (en) | 2018-11-28 | 2020-06-04 | Danisco Us Inc | Subtilisin variants having improved stability |
WO2020114965A1 (en) | 2018-12-03 | 2020-06-11 | Novozymes A/S | LOW pH POWDER DETERGENT COMPOSITION |
WO2020114968A1 (en) | 2018-12-03 | 2020-06-11 | Novozymes A/S | Powder detergent compositions |
WO2020127796A2 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Polypeptides having peptidoglycan degrading activity and polynucleotides encoding same |
WO2020127775A1 (en) | 2018-12-21 | 2020-06-25 | Novozymes A/S | Detergent pouch comprising metalloproteases |
EP3677676A1 (en) | 2019-01-03 | 2020-07-08 | Basf Se | Compounds stabilizing amylases in liquids |
WO2020169564A1 (en) | 2019-02-20 | 2020-08-27 | Basf Se | Industrial fermentation process for bacillus using defined medium and trace element feed |
WO2020169563A1 (en) | 2019-02-20 | 2020-08-27 | Basf Se | Industrial fermentation process for bacillus using defined medium and magnesium feed |
EP3702452A1 (en) | 2019-03-01 | 2020-09-02 | Novozymes A/S | Detergent compositions comprising two proteases |
WO2020178102A1 (en) | 2019-03-01 | 2020-09-10 | Novozymes A/S | Detergent compositions comprising two proteases |
WO2020188095A1 (en) | 2019-03-21 | 2020-09-24 | Novozymes A/S | Alpha-amylase variants and polynucleotides encoding same |
WO2020193535A2 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Amylase enzymes |
WO2020193532A1 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Cleaning composition having amylase enzymes |
WO2020193534A2 (en) | 2019-03-25 | 2020-10-01 | Basf Se | Amylase enzymes |
WO2020201403A1 (en) | 2019-04-03 | 2020-10-08 | Novozymes A/S | Polypeptides having beta-glucanase activity, polynucleotides encoding same and uses thereof in cleaning and detergent compositions |
WO2020207944A1 (en) | 2019-04-10 | 2020-10-15 | Novozymes A/S | Polypeptide variants |
WO2020208056A1 (en) | 2019-04-12 | 2020-10-15 | Novozymes A/S | Stabilized glycoside hydrolase variants |
WO2020229480A1 (en) | 2019-05-14 | 2020-11-19 | Basf Se | Compounds stabilizing hydrolases in liquids |
WO2020242858A1 (en) | 2019-05-24 | 2020-12-03 | Danisco Us Inc | Subtilisin variants and methods of use |
WO2020247582A1 (en) | 2019-06-06 | 2020-12-10 | Danisco Us Inc | Methods and compositions for cleaning |
WO2020249546A1 (en) | 2019-06-13 | 2020-12-17 | Basf Se | Method of recovering a protein from fermentation broth using a divalent cation |
WO2021001400A1 (en) | 2019-07-02 | 2021-01-07 | Novozymes A/S | Lipase variants and compositions thereof |
WO2021004830A1 (en) | 2019-07-05 | 2021-01-14 | Basf Se | Industrial fermentation process for microbial cells using a fed-batch pre-culture |
WO2021009067A1 (en) | 2019-07-12 | 2021-01-21 | Novozymes A/S | Enzymatic emulsions for detergents |
WO2021032881A1 (en) | 2019-08-22 | 2021-02-25 | Basf Se | Amylase variants |
WO2021037895A1 (en) | 2019-08-27 | 2021-03-04 | Novozymes A/S | Detergent composition |
WO2021037878A1 (en) | 2019-08-27 | 2021-03-04 | Novozymes A/S | Composition comprising a lipase |
WO2021053127A1 (en) | 2019-09-19 | 2021-03-25 | Novozymes A/S | Detergent composition |
WO2021064068A1 (en) | 2019-10-03 | 2021-04-08 | Novozymes A/S | Polypeptides comprising at least two carbohydrate binding domains |
WO2021074430A1 (en) | 2019-10-18 | 2021-04-22 | Basf Se | Storage-stable hydrolase containing liquids |
WO2021105336A1 (en) | 2019-11-29 | 2021-06-03 | Basf Se | Compositions comprising polymer and enzyme |
WO2021115912A1 (en) | 2019-12-09 | 2021-06-17 | Basf Se | Formulations comprising a hydrophobically modified polyethyleneimine and one or more enzymes |
WO2021122120A2 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning compositions comprising dispersins viii |
WO2021122118A1 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning compositions comprising dispersins vi |
WO2021122117A1 (en) | 2019-12-20 | 2021-06-24 | Henkel Ag & Co. Kgaa | Cleaning composition coprising a dispersin and a carbohydrase |
WO2021121394A1 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Stabilized liquid boron-free enzyme compositions |
WO2021123307A2 (en) | 2019-12-20 | 2021-06-24 | Novozymes A/S | Polypeptides having proteolytic activity and use thereof |
WO2021151536A1 (en) | 2020-01-29 | 2021-08-05 | Unilever Ip Holdings B.V. | Laundry detergent product |
WO2021152120A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2021152123A1 (en) | 2020-01-31 | 2021-08-05 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
EP3892708A1 (en) | 2020-04-06 | 2021-10-13 | Henkel AG & Co. KGaA | Cleaning compositions comprising dispersin variants |
WO2021204838A1 (en) | 2020-04-08 | 2021-10-14 | Novozymes A/S | Carbohydrate binding module variants |
WO2021214059A1 (en) | 2020-04-21 | 2021-10-28 | Novozymes A/S | Cleaning compositions comprising polypeptides having fructan degrading activity |
EP3907271A1 (en) | 2020-05-07 | 2021-11-10 | Novozymes A/S | Cleaning composition, use and method of cleaning |
WO2021224389A1 (en) | 2020-05-07 | 2021-11-11 | Novozymes A/S | Medical cleaning composition, use and method of cleaning |
WO2021239818A1 (en) | 2020-05-26 | 2021-12-02 | Novozymes A/S | Subtilase variants and compositions comprising same |
WO2021259099A1 (en) | 2020-06-24 | 2021-12-30 | Novozymes A/S | Use of cellulases for removing dust mite from textile |
EP3936593A1 (en) | 2020-07-08 | 2022-01-12 | Henkel AG & Co. KGaA | Cleaning compositions and uses thereof |
WO2022008387A1 (en) | 2020-07-08 | 2022-01-13 | Henkel Ag & Co. Kgaa | Cleaning compositions and uses thereof |
WO2022008732A1 (en) | 2020-07-10 | 2022-01-13 | Basf Se | Enhancing the activity of antimicrobial preservatives |
WO2022023250A1 (en) | 2020-07-27 | 2022-02-03 | Unilever Ip Holdings B.V. | Use of an enzyme and surfactant for inhibiting microorganisms |
WO2022043321A2 (en) | 2020-08-25 | 2022-03-03 | Novozymes A/S | Variants of a family 44 xyloglucanase |
WO2022047149A1 (en) | 2020-08-27 | 2022-03-03 | Danisco Us Inc | Enzymes and enzyme compositions for cleaning |
WO2022043547A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Protease variants with improved solubility |
WO2022043563A1 (en) | 2020-08-28 | 2022-03-03 | Novozymes A/S | Polyester degrading protease variants |
WO2022058322A1 (en) | 2020-09-15 | 2022-03-24 | Novozymes A/S | Animal feed comprising insects or insect meal |
WO2022063699A1 (en) | 2020-09-22 | 2022-03-31 | Basf Se | Improved combination of protease and protease inhibitor with secondary enzyme |
WO2022063698A1 (en) | 2020-09-22 | 2022-03-31 | Basf Se | Liquid composition comprising peptide aldehyde |
WO2022074037A2 (en) | 2020-10-07 | 2022-04-14 | Novozymes A/S | Alpha-amylase variants |
WO2022084303A2 (en) | 2020-10-20 | 2022-04-28 | Novozymes A/S | Use of polypeptides having dnase activity |
WO2022090320A1 (en) | 2020-10-28 | 2022-05-05 | Novozymes A/S | Use of lipoxygenase |
WO2022090361A2 (en) | 2020-10-29 | 2022-05-05 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2022103725A1 (en) | 2020-11-13 | 2022-05-19 | Novozymes A/S | Detergent composition comprising a lipase |
WO2022106400A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of immunochemically different proteases |
WO2022106404A1 (en) | 2020-11-18 | 2022-05-27 | Novozymes A/S | Combination of proteases |
EP4015629A1 (en) | 2020-12-18 | 2022-06-22 | Basf Se | Polymer mixtures for increasing stability and performance of hydrolase-containing detergents |
WO2022157311A1 (en) | 2021-01-22 | 2022-07-28 | Novozymes A/S | Liquid enzyme composition with sulfite scavenger |
EP4032966A1 (en) | 2021-01-22 | 2022-07-27 | Novozymes A/S | Liquid enzyme composition with sulfite scavenger |
WO2022162043A1 (en) | 2021-01-28 | 2022-08-04 | Novozymes A/S | Lipase with low malodor generation |
WO2022165107A1 (en) | 2021-01-29 | 2022-08-04 | Danisco Us Inc | Compositions for cleaning and methods related thereto |
EP4039806A1 (en) | 2021-02-04 | 2022-08-10 | Henkel AG & Co. KGaA | Detergent composition comprising xanthan lyase and endoglucanase variants with im-proved stability |
WO2022167251A1 (en) | 2021-02-04 | 2022-08-11 | Henkel Ag & Co. Kgaa | Detergent composition comprising xanthan lyase and endoglucanase variants with improved stability |
WO2022171872A1 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Stabilized biological detergents |
WO2022171780A2 (en) | 2021-02-12 | 2022-08-18 | Novozymes A/S | Alpha-amylase variants |
WO2022175435A1 (en) | 2021-02-22 | 2022-08-25 | Basf Se | Amylase variants |
EP4047088A1 (en) | 2021-02-22 | 2022-08-24 | Basf Se | Amylase variants |
WO2022189521A1 (en) | 2021-03-12 | 2022-09-15 | Novozymes A/S | Polypeptide variants |
WO2022194673A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Dnase variants |
WO2022194668A1 (en) | 2021-03-15 | 2022-09-22 | Novozymes A/S | Polypeptide variants |
EP4060036A1 (en) | 2021-03-15 | 2022-09-21 | Novozymes A/S | Polypeptide variants |
WO2022268885A1 (en) | 2021-06-23 | 2022-12-29 | Novozymes A/S | Alpha-amylase polypeptides |
WO2023278297A1 (en) | 2021-06-30 | 2023-01-05 | Danisco Us Inc | Variant lipases and uses thereof |
WO2023034486A2 (en) | 2021-09-03 | 2023-03-09 | Danisco Us Inc. | Laundry compositions for cleaning |
WO2023039270A2 (en) | 2021-09-13 | 2023-03-16 | Danisco Us Inc. | Bioactive-containing granules |
WO2023114932A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023114936A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023114939A2 (en) | 2021-12-16 | 2023-06-22 | Danisco Us Inc. | Subtilisin variants and methods of use |
WO2023116569A1 (en) | 2021-12-21 | 2023-06-29 | Novozymes A/S | Composition comprising a lipase and a booster |
WO2023118015A1 (en) | 2021-12-21 | 2023-06-29 | Basf Se | Environmental attributes for care composition ingredients |
WO2023126254A1 (en) | 2021-12-30 | 2023-07-06 | Novozymes A/S | Protein particles with improved whiteness |
EP4206309A1 (en) | 2021-12-30 | 2023-07-05 | Novozymes A/S | Protein particles with improved whiteness |
EP4234664A1 (en) | 2022-02-24 | 2023-08-30 | Evonik Operations GmbH | Composition comprising glucolipids and enzymes |
WO2023168234A1 (en) | 2022-03-01 | 2023-09-07 | Danisco Us Inc. | Enzymes and enzyme compositions for cleaning |
WO2023165507A1 (en) | 2022-03-02 | 2023-09-07 | Novozymes A/S | Use of xyloglucanase for improvement of sustainability of detergents |
WO2023165950A1 (en) | 2022-03-04 | 2023-09-07 | Novozymes A/S | Dnase variants and compositions |
WO2023194204A1 (en) | 2022-04-08 | 2023-10-12 | Novozymes A/S | Hexosaminidase variants and compositions |
WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
WO2023233028A1 (en) | 2022-06-03 | 2023-12-07 | Unilever Ip Holdings B.V. | Laundry detergent product |
WO2023247348A1 (en) | 2022-06-21 | 2023-12-28 | Novozymes A/S | Mannanase variants and polynucleotides encoding same |
WO2023250301A1 (en) | 2022-06-21 | 2023-12-28 | Danisco Us Inc. | Methods and compositions for cleaning comprising a polypeptide having thermolysin activity |
WO2023247664A2 (en) | 2022-06-24 | 2023-12-28 | Novozymes A/S | Lipase variants and compositions comprising such lipase variants |
WO2024012894A1 (en) | 2022-07-15 | 2024-01-18 | Basf Se | Alkanolamine formates for enzyme stabilization in liquid formulations |
WO2024033136A1 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Amylase variants |
WO2024033135A2 (en) | 2022-08-11 | 2024-02-15 | Basf Se | Amylase variants |
WO2024050339A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Mannanase variants and methods of use |
WO2024050346A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Detergent compositions and methods related thereto |
WO2024050343A1 (en) | 2022-09-02 | 2024-03-07 | Danisco Us Inc. | Subtilisin variants and methods related thereto |
WO2024094735A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024094732A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024094733A1 (en) | 2022-11-04 | 2024-05-10 | Basf Se | Polypeptides having protease activity for use in detergent compositions |
WO2024102698A1 (en) | 2022-11-09 | 2024-05-16 | Danisco Us Inc. | Subtilisin variants and methods of use |
Also Published As
Publication number | Publication date |
---|---|
US20090275078A1 (en) | 2009-11-05 |
AU2005318696A1 (en) | 2006-06-29 |
AU2005318696B2 (en) | 2010-12-16 |
JP2008524995A (en) | 2008-07-17 |
EP1831360A2 (en) | 2007-09-12 |
MX2007007494A (en) | 2007-08-15 |
CA2593920A1 (en) | 2006-06-29 |
WO2006066594A3 (en) | 2006-08-31 |
JP5166880B2 (en) | 2013-03-21 |
CN101128579A (en) | 2008-02-20 |
CN101128579B (en) | 2013-10-02 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US10563186B2 (en) | Alpha-amylase variants with altered properties | |
AU2005318696B2 (en) | Alpha-amylase variants | |
US9695405B2 (en) | Stabilization of alpha-amylases towards calcium depletion and acidic pH | |
US9670471B2 (en) | Alpha-amylase variant with altered properties | |
US20080153733A1 (en) | Alpha-Amylase Variant With Altered Properties | |
US20040091994A1 (en) | Alpha-amylase variant with altered properties | |
MXPA06015025A (en) | Alpha-amylase variants with altered properties |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005318696 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2007/007494 Country of ref document: MX Ref document number: 11722192 Country of ref document: US |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2007547183 Country of ref document: JP Ref document number: 2593920 Country of ref document: CA |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2756/CHENP/2007 Country of ref document: IN |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2005823004 Country of ref document: EP |
|
ENP | Entry into the national phase |
Ref document number: 2005318696 Country of ref document: AU Date of ref document: 20051222 Kind code of ref document: A |
|
WWP | Wipo information: published in national office |
Ref document number: 2005318696 Country of ref document: AU |
|
WWE | Wipo information: entry into national phase |
Ref document number: 200580048604.2 Country of ref document: CN |
|
WWP | Wipo information: published in national office |
Ref document number: 2005823004 Country of ref document: EP |