WO2006046861A2 - Tomato plants having higher levels of resistance to botrytis - Google Patents

Tomato plants having higher levels of resistance to botrytis Download PDF

Info

Publication number
WO2006046861A2
WO2006046861A2 PCT/NL2005/000762 NL2005000762W WO2006046861A2 WO 2006046861 A2 WO2006046861 A2 WO 2006046861A2 NL 2005000762 W NL2005000762 W NL 2005000762W WO 2006046861 A2 WO2006046861 A2 WO 2006046861A2
Authority
WO
WIPO (PCT)
Prior art keywords
plant
botrytis
lycopersicon
qtl
resistance
Prior art date
Application number
PCT/NL2005/000762
Other languages
French (fr)
Other versions
WO2006046861A3 (en
Inventor
Johannes Arnoldus Laurentius Van Kan
Arjen Ten Have
Willem Hendrik Lindhout
Hendrikus Johannes Finkers
Remco Van Berloo
Adriaan Willem Van Heusden
Original Assignee
De Ruiter Seeds R & D B.V.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=34928600&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2006046861(A2) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Priority to CA2584780A priority Critical patent/CA2584780C/en
Priority to KR1020137010619A priority patent/KR101365296B1/en
Priority to CN200580044768.8A priority patent/CN101087884B/en
Priority to KR1020077011767A priority patent/KR101329485B1/en
Priority to MX2007004779A priority patent/MX2007004779A/en
Priority to JP2007538841A priority patent/JP5464804B2/en
Priority to BRPI0516970-4A priority patent/BRPI0516970A/en
Application filed by De Ruiter Seeds R & D B.V. filed Critical De Ruiter Seeds R & D B.V.
Priority to MX2013010797A priority patent/MX349007B/en
Priority to ES05797992T priority patent/ES2436094T3/en
Priority to EP05797992.4A priority patent/EP1812575B1/en
Priority to AU2005300181A priority patent/AU2005300181B8/en
Publication of WO2006046861A2 publication Critical patent/WO2006046861A2/en
Publication of WO2006046861A3 publication Critical patent/WO2006046861A3/en
Priority to US11/738,279 priority patent/US7968773B2/en
Priority to IL182722A priority patent/IL182722A/en
Priority to US13/166,958 priority patent/US8575451B2/en
Priority to IL217617A priority patent/IL217617A/en

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/82Solanaceae, e.g. pepper, tobacco, potato, tomato or eggplant
    • A01H6/825Solanum lycopersicum [tomato]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • A01H1/045Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/08Fruits
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/138Amplified fragment length polymorphism [AFLP]

Definitions

  • the present invention relates to plant breeding and molecular biology. More specifically, the present invention relates to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis cinerea in tomato, to a method of producing a Botrytis-resistant tomato plant therewith and to Botrytis-resistant tomato plants thus obtained and parts thereof.
  • QTL quantitative trait locus
  • Botrytis dnere ⁇ is a necrotrophic pathogenic fungus with an exceptionally wide host range comprising at least 235 possible hosts. Because of its wide host range and because it affects economically important parts of the plant B. cinere ⁇ is a major problem in many commercially grown crops. Amongst growers, the fungus is commonly referred to as Botrytis. The cultivated tomato (predominantly Lycopersicon esculentum) is also susceptible to infection by Botrytis and the fungus generally affects stem, leaves and fruit of the tomato plant. In heated greenhouses the occurrence of infections by Botrytis on stems is particularly common.
  • Botrytis actively kills infected cells, causing soft rot, blights, leaf spot, damping-off and stem cancers. Affected leaves become covered with conidiophores and conidia, and subsequently collapse and wither. The fungus will grow from diseased leaves into the stem and produce dry, light brown lesions a few millimetres to several centimetres in length. Lesions may also form at pruning scars on the stem. The stem lesions may also be covered with a gray mold. In severe cases, the infection girdles the stem and kills the plant. Older, senescent tissue of a tomato plant is usually more susceptible to attack by Botrytis than younger tissue.
  • L. hirsutum comprises a genetic region on chromosome 10 of the genome that is involved in partial resistance to Botrytis.
  • the introgression of this genetic material into cultivated tomato varieties is believed to be capable of providing for cultivated tomato plants that are partially resistant to Botrytis.
  • Botrytis It is a further aim of the present invention to provide for additional and/or improved resistance to Botrytis in commercial tomato varieties. It is yet another aim of the present invention to provide for a method for finding additional wild Lycopersicon accessions as sources of resistance to Botrytis and for finding additional genetic material in the genome of such plants that is involved in resistance of tomato to Botrytis. Such additional sources and additional genetic material may be used to broaden the basis for the production of Botryti s-resistant varieties of cultivated tomato. SUMMARY OF THE INVENTION
  • a particular quantitative bioassay which comprises the measurement of initial and/or progressive parameters of infection with Botrytis in tomato plants in combination with a molecular marker detection technique provides for a very advantageous method of detecting sources of resistance to Botrytis amongst wild Lycopersicon accessions and for detecting genetic material in the genome of such plants that is involved in improved resistance of tomato to Botrytis.
  • the present inventors have successfully identified partial resistance to Botrytis in two lines of wild relatives of tomato, i.e. Lycopersicon hirsutum LYC 4/78 and Lycopersicon par ⁇ iflorum Gl.1601.
  • the inventors were subsequently able to produce Botrytis-resistant tomato plants by crossing plants from these i3o£ryi£is-resistant wild (donor) tomato lines with non-resistant recipient tomato plants. These plants exhibited a higher level of resistance than plants comprising a genomic region on chromosome 10 of L. hirsutum associated with Botrytis resistance as disclosed in WO 02/085105.
  • the present inventors By assessing the resistance level to Botrytis in segregating populations (F2 populations) of these newly produced crosses in relation to the presence of molecular markers of the donor plant, the present inventors were able to identify multiple quantitative trait loci (QTLs) linked to j3o£ry£js-resistance in the resistant wild tomato lines and thereby establish the location of multiple resistance-conferring DNA sequences in the genome.
  • QTLs quantitative trait loci linked to j3o£ry£js-resistance in the resistant wild tomato lines and thereby establish the location of multiple resistance-conferring DNA sequences in the genome.
  • the present inventors have now found that Botrytis resistance in tomato is inherited polygenically, which may partly explain the poor breeding results. This finding now provides for the improvement of methods of producing Botrytis-xesistaxit tomato plants.
  • a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato will be addressed in short as a QTL for Botrytis-resistance or a QTL associated with Botry tis-resistance.
  • QTL quantitative trait locus
  • a total of six new QTLs for Botryt is-resistance were found in the two wild tomato lines.
  • Four of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to reduce the initial establishment of an infection, hereinafter referred to as the parameter for disease incidence.
  • Two of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to slow the progression of infection, hereinafter referred to as the parameter for lesion growth rate.
  • chromosome 1 of L. hirsutum LYC 4/78 harbors a QTL that is linked to a reduced rate of growth of lesions induced by Botrytis infection and that both chromosomes 2 and 4 of that same accession harbor a QTL that is linked to a reduced disease incidence.
  • L. par ⁇ iflorum Gl.1601 a QTL for reduced rate of lesion growth was found to be located on chromosome 9, while two separate QTLs for reduced disease incidence were found to be located on chromosomes 3 and 4.
  • a QTL on chromosome 10 could not be detected by this method.
  • the present invention relates in a first aspect to a .Bo ⁇ ry ⁇ s-resistant tomato plant, wherein said plant has a susceptibility to Botrytis dnerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay wherein the average length of a stem lesion resulting from Botrytis dnerea infection in adult plants is measured during a three week period under standard practice conditions.
  • the stem lesion length over a period of three weeks as used herein as a measure for the level of resistance is to be determined by standard practice conditions as described herein.
  • said Botrytis-resistant tomato plant is characterized in that said plant comprises within its genome at least one QTL or a .Boiryf ⁇ s-resistance-conferring part thereof selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicori hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said .Botfryiis-resistance-conferring part thereof is not in its natural genetic background.
  • the present invention relates in another aspect to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato.
  • the method comprises the steps of crossing a Botrytis-resistant donor tomato plant with a non-resistant or partially resistant (Botry tis-susceptible) recipient tomato plant; contacting one or more offspring plants with an infective amount of Botrytis; quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants; establishing a genetic linkage map that links the observed disease incidence and/or the lesion growth rate to the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants; and assigning to a quantitative trait locus the contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced lesion growth rate.
  • QTL quantitative trait locus
  • the present invention relates to QTLs obtainable by a method for detecting a QTL for Botrytis-resistance according to the invention as outlined above.
  • QTLs are different from the prior art QTLs.
  • prior art QTLs could not be found.
  • the QTLs of the present invention are more informative than those of the prior art as they are indicative of either a characteristic relating to the plant's ability to oppose the onset of the disease, or a characteristic relating to the plant's ability to slow the progress of the disease.
  • Such information is highly valuable in breeding programs, since combinations thereof may suitably provide for improved resistance, and proper inheritance of the resistance trait from one generation to another may be better controlled.
  • the present invention further relates to a QTL for Botiytis-resist&nce in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parviflorum G 1.1601 associated with Botrytis resistance.
  • QTLs are located on positions of the genome not previously associated with resistance to Botrytis. Details of these QTLs are described in more detail herein below.
  • a QTL of the present invention may be in the form of an isolated, preferably double stranded nucleic acid sequence comprising said QTL or a resistance-conferring part thereof.
  • the size of the nucleic acid sequence which may for instance be isolated from the chromosome of a suitable donor plant, may represent a genetic distance of 1-100 cM, preferably 10-50 cM on said chromosome.
  • Said nucleic acid may comprise at least 50, more preferably at least 500, even more preferably at least 1000, still more preferably at least 5000 base pairs.
  • One or more nucleic acid sequences comprising a QTL or a resistance-conferring part thereof according to the invention may in turn be comprised in a nucleic acid construct, said construct may further comprise regions that flank said one or more nucleic acid sequences and which regions are capable of being integrated into a suitable vector for transfer of said one or more nucleic acid sequences into a suitable Bo£r;y£fs-susceptible recipient tomato plant.
  • the vector may further comprise suitable promoter regions or other regulatory sequences.
  • the QTLs may also be in a form present within the genome of a tomato plant.
  • the QTLs of the present invention preferably comprise at least one marker, preferably two, more preferably three, still more preferably four, still more preferably more than four markers associated with jBo£ryiis-resistance selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to said QTL.
  • the present invention relates in another aspect to a method for detecting a QTL for Botrytis-resistance, comprising detecting at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for J3o£ry£js-resistance in a suspected Botrytis- resistant tomato plant.
  • the present invention further relates to a method of producing a Botrytis- resistant tomato plant.
  • the method comprises the steps of detecting a QTL for Botjytis-resistance in a Botryt is-resistant donor tomato plant by performing any one of the methods for detecting a quantitative trait locus (QTL) for Botrytis ⁇ resistwn.ce according to the invention, and transferring nucleic acid comprising at least one QTL thus detected, or a Sofryiis-resistance-conferring part thereof, from said donor plant to a jBo£ry£ ⁇ s-susceptible recipient tomato plant.
  • QTL quantitative trait locus
  • the transfer of nucleic acid comprising at least one QTL or a Botrytis- resistance-conferring part thereof may very suitably be performed by crossing said Botrytis-resistant donor tomato plant with a .Boiryiis-susceptible recipient tomato plant to produce offspring plants; and selecting from among the offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL for Botrytis- resistance according to the invention, or a Bo£ry£is-resistance-conferring part thereof.
  • the presence in said introgressed nucleic acid of at least one QTL for Botrytis- resistance according to the invention, or a .Bo£r.y£is-resistance-conferring part thereof, may suitably be detected by a method according to the present invention wherein at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for Botrytis- resistance is detected.
  • a preferred selection method therefore comprises marker-assisted selection (MAS) (see e.g. Tanksley et al. 1998) of said introgressed DNA wherein one or more markers associated with said QTL are detected in offspring plants.
  • MAS may for instance be performed by isolating genetic material from said offspring plants and determining the presence therein, by molecular techniques, of one or more donor plant markers.
  • molecular marker detection methods may be used without prior isolation of genetic material.
  • a phenotypic test on Botrytis resistance may be performed in order to select suitable plants.
  • a very suitable test therefore is the quantitative bioassay as described herein, whereby such parameters as disease incidence and/or rate of lesion growth are determined.
  • the confirmation of the presence of at least one marker from a QTL for .Bo£r;y£ ⁇ s-resistance in combination with the establishment of the presence of a resistant phenotype provides evidence for the successful transfer of nucleic acid comprising at least one QTL, or a .Bofryt ⁇ -resistanee-conferring part thereof, from the donor plant to the recipient plant.
  • the indicated transfer of nucleic acid may very suitably be performed by transgenic methods (e.g. by transformation), by protoplast fusion, by a doubled haploid technique or by embryo rescue.
  • the donor plants are Lycopersicon hirsutum LYC 4/78 and/or Ly coper sicon par ⁇ iflorum Gl.1601 and the nucleic acid transferred from these donor plants into recipient plants preferably comprises at least one QTL for Botrytis- resistance selected from the group consisting of the QTLs on chromosomes 1 (QTL- Ih), 2 (QTL-2h) and 4 (QTL-4K) of Lycopersicon, hirsutum LYC 4/78 and the QTLs on chromosomes 3 (QTL-3p), 4 (QTL-4p) and 9 (QTL-9p) in Lycopersicon parviflorum Gl.1601 associated with Botrytis resistance, or a So ⁇ -j ⁇ s-resistance-conferring part thereof.
  • the method comprises the crossing of said Bot?ytis-vesistant donor tomato plant with a Bo ⁇ ss-susceptible recipient tomato plant to produce first generation offspring plants; selecting from among the first generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Uoiryiis-resistance according to the invention, or a Bofryiis-resistance-conferring part thereof; crossing said selected offspring plant with a suitable commercial tomato line to produce second generation offspring plants; selecting from among the second generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said first generation offspring tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Botryt
  • the present invention relates to a .Bo ⁇ ryiis-resistant tomato plant, or part thereof, obtainable by a method of the present invention.
  • the present invention relates to a .Boiryi ⁇ s-resistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a £o£ry£is-resistance-conferring part thereof, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said Boirytis- resistance-conferring part thereof is not in its natural genetic background.
  • the present invention relates to a method of producing a
  • the method comprises the steps of producing a JBofryiis-resistant tomato plant according to a method of the invention, selfing said plant, growing seed obtained from said selfed plant into new plants; identifying plants that exhibit Botrytis resistance and possess commercially desirable characteristics from amongst said new plants, and repeating the steps of selfing and selection until an inbred tomato plant is produced which exhibits Botrytis resistance and possesses commercially desirable characteristics.
  • a method of producing a Botrytis-resistax ⁇ , inbred tomato plant may further comprise the additional step of selecting homozygote inbred tomato plants that exhibit Botrytis resistance and possess commercially desirable characteristics.
  • the present invention relates to a Botrytis-ves ⁇ st&nt inbred tomato plant, or parts thereof, obtainable by a method of the invention.
  • the present invention relates to a hybrid tomato plant, or parts thereof, that exhibits resistance to Botrytis, wherein said hybrid tomato plant is obtainable by crossing a jBo.ryiis-resistant inbred tomato plant obtainable by a method of the invention with an inbred tomato plant that exhibits commercially desirable characteristics.
  • the invention further relates to a tissue culture of regenerable cells of the tomato plants of the present invention.
  • a tissue culture the cells or protoplasts of said cells having been isolated from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruits, and stems and seeds.
  • the invention further relates to the use of a marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6, for the detection of QTLs for Bot ryt is-resistance according to the invention, and/or for the detection of .Boiry ⁇ s-resistant tomato plants.
  • the Botryt is-resistant donor tomato plant used in methods of the present invention is preferably selected from the group consisting of Lycopersicon cer ⁇ siforme, Lycopersicon cheesm ⁇ nii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon p ⁇ r ⁇ iflorum, Lycopersicon pennellii, Lycopersicon peru ⁇ i ⁇ num, Lycopersicon pimpinellifolium and Sol ⁇ num lycopersicoides, more preferably, a wild Lycopersicon accession is used as the donor plant.
  • Lycopersicon hirsutum and Lycopersicon p ⁇ r ⁇ iflorum are Lycopersicon hirsutum and Lycopersicon p ⁇ r ⁇ iflorum, in particular Lycopersicon hirsutum LYC 4/78 and Lycopersicon p ⁇ r ⁇ iflorum Gl.1601.
  • the recipient tomato plant used in methods of the present invention is preferably a plant of the species Lycopersicon esculentum, more preferably an L. esculentum cultivar that possess commercially desirable characteristics, or another commercial tomato line.
  • Figure 1 shows the position of quantitative trait loci (QTLs) for resistance to B. cinerea originating from L. hirsutum LYC 4/78 with the linkage maps representing chromosome 1 and 2. Map positions are given in cM. The QTL detected on chromosome 1 is for lesion growth and the QTL detected on chromosome 2 is for disease incidence. Bars indicate the QTL intervals. The box shows the LOD 1 interval and the line shows the LOD 2 interval. The codes for AFLP markers are more extensively described in Table 1. All markers indicated as associated to the QTLs may be used as markers in aspects of the present invention.
  • Figure 2 shows a schematic overview of the development of the L. esculentum x
  • BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain BC5 lines to aid in the development of QTL-NIL lines for the two main effects, which were identified in the F2 population.
  • BC3 and BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain a backcross inbred line (BIL) population (See Example 3).
  • Figure 3 shows the segregation in the two BC2S1 populations (population size 60 resp. 47) segregating for lesion growth (figure 3B and 3D and disease incidence (figure 3A and 3C).
  • Lesion growth is on the x-axis in mm (figure 3B and 3D) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on ) and disease incidence (figure 3A and 3C) is in classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on).
  • On the y-axis is the number of plants in each class. The average parental values are indicated by the arrows for MM resp. Lye 4/78.
  • Figure 4 shows the results of the L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 cross.
  • Disease incidence is on the x-axis as percentage (figure 4A) and classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on.
  • Lesion growth is on the x-axis in mm (figure 4B) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on).
  • Figure 5 shows a linkage map of the L. parviflorum QTLs as described herein.
  • QTL-3p is located in the region indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60-65.
  • Figure 6 shows a linkage map and QTL plots of the L. hirsutum QTLs as described herein. The map is an update to that of Figure 1, showing the genomic regions more clearly.
  • markers indicated as associated to the QTLs may be used as markers in aspects of the present invention.
  • This updated version provides basis for preferred embodiments in aspects of the present invention.
  • Botrytis means Botrytis cinerea, also known as gray mold or gray spot, a disease commonly found on the stem, leaves and fruit of tomatoes. It is generally considered that the plant pathogenic fungus Sclerotinia sclerotiorum has an infection mechanism similar to that of B. cinerea (Prins et al., 2000). Although S. sclerotiorum-in ⁇ ection in tomato is economically far less important than B.
  • Botrytis-vesistance such resistance should be understood as including resistance to any fungus of the family of Sclerotini ⁇ ce ⁇ e, preferably resistance to S. sclerotiorum and B. cinerea, more preferably resistance to B. cinerea.
  • allele(s) means any of one or more alternative forms of a gene, all of which alleles relate to at least one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. Since the present invention relates to QTLs, Le. genomic regions that may comprise one or more genes, but also regulatory sequences, it is in some instances more accurate to refer to "haplotype" (i.e. an allele of a chromosomal segment) in stead of "allele", however, in those instances, the term “allele” should be understood to comprise the term “haplotype”.
  • haplotype i.e. an allele of a chromosomal segment
  • a “gene” is defined herein as a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristics or trait in an organism.
  • locus is defined herein as the position that a given gene occupies on a chromosome of a given species.
  • heterozygous means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
  • homozygous means a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
  • hybrid means any offspring of a cross between two genetically unlike individuals, including but not limited to the cross between two inbred lines.
  • inbred means a substantially homozygous individual or line
  • a "recombination event” is understood to mean a meiotic crossing-over.
  • the terms “introgression”, “introgressed” and “introgressing” refer to both a natural and artificial process whereby genes of one species, variety or cultivar are moved into the genome of another species, variety or cultivar, by crossing those species. The process may optionally be completed by backcrossing to the recurrent parent.
  • “Genetic engineering”, “transformation” and “genetic modification” are all used herein as synonyms for the transfer of isolated and cloned genes into the DNA, usually the chromosomal DNA or genome, of another organism.
  • the term "molecular marker” refers to an indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences.
  • indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), microsatellite markers (e.g. SSRs), sequence-characterized amplified region (SCAR) markers, cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
  • RFLP restriction fragment length polymorphism
  • AFLP amplified fragment length polymorphism
  • SNPs single nucleotide polymorphisms
  • SCAR sequence-characterized amplified region
  • CAS cleaved amplified polymorphic sequence
  • resistant and resistance encompass both partial and full resistance to infection.
  • a Botryt is-susceptible tomato plant may either be non- resistant or have low levels of resistance to infection by Botrytis.
  • plant part indicates a part of the tomato plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which tomato plants can be regenerated.
  • plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
  • population means a genetically heterogeneous collection of plants sharing a common genetic derivation.
  • tomato means any plant, line or population of Lycopersicon including but not limited to Lycopersicon cerasiforme, Lycopersicon cheesmanii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum (or Solanum lycopersicum), Lycopersicon hirsutum, Lycopersicon par ⁇ iflorum, Lycopersicon pennellii, Lycopersicon peruvianum, Lycopersicon pimpinelli folium, or Solanum lycopersicoides.
  • L. cerasiforme, and L. pimpinellifolium Over the past few years, there has been debate among tomato researchers and botanists whether to reclassify the names of these species. The newly proposed scientific name for the modern tomato is Solanum Iy coper sicum. Similarly, the names of the wild species may be altered. L. pennellii may become Solanum pennellii, L. hirsutum may become S. habrochaites, L. peruvianum may be split into S. 'N peru ⁇ ianum' and S. 'Callejon de Huayles', S. peruvianum, and S. corneliomuelleri, L. par ⁇ iflorum may become S.neorickii, L.
  • L. chilense may become S. chilense
  • L. cheesmaniae may become S. cheesinaniae or S. galapagense
  • L. pimpinellifolium may become S. pimpinellifolium (Solanacea Genome Network (2005) Spooner and Knapp; http://www.sgn.cornell.edii/help/about/solanum nomenclature.html)
  • variable means a group of similar plants that by structural or genetic features and/or performance can be distinguished from other varieties within the same species.
  • QTL is used herein in its art-recognised meaning.
  • QTL associated with resistance to B. cinerea in tomato as well as the shorter term “QTL for Bohytis-xesistance” refer to a region located on a particular chromosome of tomato that is associated with at least one gene that encodes for Boiryiis-resistance or at least a regulatory region, i.e. a region of a chromosome that controls the expression of one or more genes involved in Botrytis-xesistaxice. The phenotypic expression of that gene may for instance be observed as a reduced rate of lesion growth and/or as a reduced disease incidence.
  • a QTL may for instance comprise one or more genes of which the products confer the genetic resistance.
  • a QTL may for instance comprise regulatory genes or sequences of which the products influence the expression of genes on other loci in the genome of the plant thereby conferring the Botrytis-resist ⁇ nce.
  • the QTLs of the present invention may be defined by indicating their genetic location in the genome of the respective wild Lycopersicon accession using one or more molecular genomic markers. One or more markers, in turn, indicate a specific locus. Distances between loci are usually measured by frequency of crossing- over between loci on the same chromosome. The farther apart two loci are, the more likely that a crossover will occur between them.
  • Botrytis-susceptible recipient tomato plant is used herein to indicate a tomato plant that is to receive DNA obtained from a donor tomato plant that comprises a QTL for Botiytis-resistsuice. Said " Botry tis-susceptible recipient tomato plant” may or may not already comprise one or more QTLs for Botrytis- resistance, in which case the term indicates a plant that is to receive an additional QTL.
  • Naturally genetic background is used herein to indicate the original genetic background of a QTL.
  • a background may for instance be the genome of a Botiytis-resistance wild accession of tomato.
  • the QTLs of the present invention were found at specific locations on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and chromosomes 3, 4 and 9 of Lycopersicon parviflorum Gl.1601.
  • the Lycopersicon hirsutum LYC 4/78 represents the natural genetic background of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78.
  • Lycopersicon hirsutum LYC 4/78 represent the natural genetic background of said QTLs.
  • a method that involves the transfer of DNA comprising the QTL, or a resistance-conferring part thereof, from chromosomes 1 of Lycopersicon hirsutum LYC 4/78 to the same position on chromosome 1 of another tomato species will result in that QTL, or said resistance-conferring part thereof, not being in its natural genetic background.
  • the term "disease incidence” is defined herein as the parameter that reflects the capability of the plant to reduce the establishment of an infection and may for instance be established by determining the success of achieving infection of the plant upon contact with the infectious agent.
  • rate of lesion growth or “lesion growth rate” is defined herein as the parameter that reflects the capability of the plant to slow or reduce the progression of infection, and may for instance be established by determining the rate of growth of expanding lesions.
  • Quantitatively determining is defined herein as establishing or assessing in a manner involving measurement, in particular the measurement of aspects measurable in terms of amounts and number. Determinations in degrees of severity and indications of greater, more, less, or equal or of increasing or decreasing magnitude, are not comprised in the present term “quantitatively determining”, which term ultimately implies the presence of objective counting mechanism for determining absolute values.
  • “quantitatively determining disease incidence and/or rate of lesion growth” preferably comprises determining the percentage of all potentially infectious contacts between plant and infectious agent that result in measurable lesions (in order to asses the disease incidence), and/or determining the increase in diameter, circumference, surface area or volume of one or more of said lesions over time under favourable conditions for fungal growth (in order to asses the rate of lesion growth).
  • standard practice conditions refer to the conditions of light, humidity, temperature, etc. where under plants are grown or incubated, for instance for the purpose of phenotypic characterization of disease resistance, as being standard. For greenhouses for instance, this refers to 16-h day, 15°C-25°C.
  • the terms refer to standard and reference growth conditions with a photoperiod of 8 to 24 h (photosynthetic photon flux (PPF) 50 to 1000 ⁇ mol nr 2 s" 1 ), preferably a light regime of 16 hours light and 8 hours dark, an air temperature of about 19 0 C during the day and 15°C at night, a water vapour pressure deficit of about 4.4 g m "3 corresponding to a relative humidity (RH) of about 60%-85%, at 600-700 ppm CO 2 and atmospheric O2 concentration and at atmospheric air pressure (generany 1008 hPa). Water and nutrients may be given drop wise near the stem, or in the form of spray or mist.
  • Standard bioassay experimentation conditions such as stem lesion length assay, disease incidence and lesion growth rate measurements, are further specified in the Examples below. In more detail, the average stem lesion length assay is to be performed as described in Examples 3.10 and 3.11.
  • Urbasch Urbason, 1986
  • QTLs quantitative trait loci
  • Botrytis cinerea infection in Lycopersicon esculentum under laboratory conditions is relatively well studied (e.g. Benito et al., 1998).
  • Droplet inoculation of leaves and subsequent incubation at moderate temperatures (15-20 0 C) results in a rapid (16-24 h post-infection (hpi)) development of necrotic spots at the site of the inoculum. Infection is temporarily restricted at this point for approximately 48 h. From that moment onwards a proportion of the lesions (usually 5-10%) starts to expand.
  • Outgrowth of these so called “expanding lesions” is accompanied by an increase in fungal biomass and results in colonisation of the complete leaflet in the following 48 h.
  • the present inventors found that specific QTLs associated with Botrytis- resistance in tomato can be identified when a bioassay for measuring resistance is used wherein the rate of the progression of infection and or the success of achieving infection upon contact with the infectious agent are measured quantitatively on parts of the tomato plant, preferably on detached parts, more preferably on stem segments. It was surprisingly found that multiple QTLs for Boiryiis-resistance were present in the genomes of Botrytis-resistant tomato plants, whereas the prior art methods resulted in the tentative identification of only a single QTL for Bofrytis-xesist&nce. Moreover, the QTLs that were found by using these methods were located on chromosomes not previously associated with J3o£r;y£is-resistance of tomato plants and the QTLs were associated with various phenotypic manifestations of resistance.
  • the methods of the present invention have provided the new insight that the genetic basis of Bot ry iis-resistance in tomato is polygenic.
  • the method of the present invention is capable of uncovering major QTLs for Botrytis resistance that confer a level of resistance to the plant that is higher than previously attained.
  • one advantage of the method of the present invention is that it results in the discovery of QTLs that are associated with higher levels of resistance to Botrytis.
  • This level of resistance may be determined by any method available, such as by using the methods of the present invention or by using conventional methods of the prior art. A detailed description of experimental setup and conditions is provided in the Examples below.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato requires the availability of a (partially) Botrytis-resistant tomato plant.
  • a plant may be provided by any means known in the art, and by using any method for the determination of the presence of said (partial) resistance in said plant.
  • Botrytis-xesistant tomato plant (which will further serve as a donor plant in a method of the present invention) enables the establishment or provision of chromosomal markers, preferably AFLP, CAPS and/or SCAR markers, most preferably CAPS and/or SCAR markers, for at least one, but preferably for all chromosome of said plant.
  • chromosomal markers preferably AFLP, CAPS and/or SCAR markers, most preferably CAPS and/or SCAR markers, for at least one, but preferably for all chromosome of said plant.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato comprises as a first step the crossing of said (partially) Botrytis-xesistant donor tomato plant with a non- resistant, or Botrytis susceptible, recipient tomato plant in order to produce offspring plants. Subsequently one or more offspring plants are contacted with an infective amount of Botrytis. Such an amount may vary between plants and between fungal species tested. Usually an amount of about 1 to 10 to an amount of about 500-5000 conidia of said fungus will be sufficient.
  • a subsequent step comprises quantitatively determining the disease incidence and/or the rate of lesion growth in one or more offspring plants produced from said cross.
  • the offspring plants are preferably plants of the F2 population derived from a cross between a i?o£r;y£is-resistant donor tomato plant and a non-resistant or Botrytis- susceptible recipient tomato plant.
  • a segregating F2 population is used, more preferably, an F2 population derived from a cross between L. esculentum cv. Moneymaker and L. hirsutum LYC 4/78.
  • Fi seed derived from said cross may be grown into Fi plants where after one single Fi plant is then selfed to produce F2 seed of which the subsequently derived F2 plants are used for the determination of the disease incidence and/or the rate of lesion growth in a method of the invention.
  • F3 lines may be used for resistance assays.
  • the step of contacting one or more offspring plants with an infective amount of Botrytis and quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants is preferably performed as part of a resistance bioassay on stem segments or leaves as described herein, preferably a resistance bioassay on stem segments.
  • a resistance bioassay on stem segments preferably a resistance bioassay on stem segments.
  • a resistance bioassay on stem segments may essentially be performed as follows: First, seeds for the offspring plants are planted and grown to seedlings/plants of suitably approximately 50 cm in height. The top 5-10 cm and bottom 5-10 cm of the stem of the plants may be removed and the remaining 30 cm may be cut into equal segments of 5-6 cm.
  • the stem segments are preferably placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments are suitably sprayed with water in order to ensure an equal spread of the inoculum over the wound surface. Each stem segment may then be inoculated by a conidial suspension of B. cinerea.
  • a suitable amount of inoculum for instance one drop of about 5 ⁇ l, comprising approximately 10 ⁇ conidia • ml "1 , may thereto be applied on the top of each stem segment.
  • the stem segments are then incubated at a temperature of suitably about 16 0 C, preferably in the dark, and preferably at high humidity (e.g. 100% RH).
  • Infection progress may be determined quantitatively by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper.
  • the stems may then be inspected for lesion formation (disease incidence) and lesion growth, in a quantitative manner.
  • Very suitable parameters comprise the measurement of the size of the lesion, for instance by using a caliper.
  • the quantitative measurements of the bioassays may be related to the comparable measurements in susceptible control or reference lines.
  • the disease incidence may suitably be determined by dividing the total number of expanding lesions by the total number of inoculation droplets.
  • the proportion of expanding lesions on a particular genotype may then be divided by the proportion of expanding lesions observed in a control or reference genotype and expressed as a percentage.
  • lesion growth rates may be determined by calculating the increase in lesion size (e.g. in mm) over a suitable period, for instance over a 24 h period.
  • Data for the non-expanding lesions may be deleted from the quantitative analysis.
  • the lesion growth rate obtained may then optionally be divided by the lesion growth rate observed in a control or reference genotype and expressed as a percentage or as an absolute figure, for instance in millimetres.
  • plants can be screened by using a leaf infection bioassay as follows: First, tomato seeds are planted and grown to seedlings/plants. For each individual plant one or two compound leaves may be cut from the main stem and transferred to pre-wetted florist foam. The florist foam is then placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. A suitable inoculum comprising B. dnerea conidia may be prepared by methods known in the art, for instance as described by Benito et al., 1998. The compound leaves are then inoculated with the conidial suspension of B.
  • dnerea by placing a number of droplets, suitably for instance 6 to 10 droplets of 2 ⁇ l each, onto the upper surface of the leaves.
  • the container is then closed and the leaves are incubated at a temperature of suitably between 15°C-20°C, preferably in the dark, and preferably at high humidity.
  • the leaves may then be inspected for disease incidence and lesion growth, in a quantitative manner as described above for the stem bioassay.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato further comprises the steps of establishing a genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants and assigning contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced rate of lesion growth to a quantitative trait locus.
  • a genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of the donor tomato plant in said one or more offspring plants may be established by any method known in the art.
  • the skilled person is aware of methods for identifying molecular markers linked to resistance quantitative trait loci (QTLs) and the mapping of these markers on a genetic linkage map (see e.g. Bai et al., 2003; Foolad et al., 2002; van Heusden et al., 1999).
  • the association between the J3o£?;y£is-resistant phenotype and marker genotype may suitably be performed by using such software packages as JoinMap ® and MapQTL ® (see Examples) or any standard statistical package which can perform analysis of variance analysis.
  • the molecular markers can be used to construct genetic linkage maps and to identify quantitative trait loci (QTLs) for Botrytis resistance.
  • a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention may further be improved by reducing experimental variation in the bioassay and/or by the construction of a complete backcross inbred population (BIL).
  • BIL backcross inbred population
  • Molecular markers are used for the visualisation of differences in nucleic acid sequences. This visualisation is possible due to DNA-DNA hybridisation techniques (RFLP) and/or due to techniques using the polymerase chain reaction (e.g. STS, microsatellites, AFLP). All differences between two parental genotypes will segregate in a mapping population (e.g., BCi, F2; see Figure 2) based on the cross of these parental genotypes. The segregation of the different markers may be compared and recombination frequencies can be calculated. The recombination frequencies of molecular markers on different chromosomes is generally 50%. Between molecular markers located on the same chromosome the recombination frequency depends on the distance between the markers.
  • RFLP DNA-DNA hybridisation techniques
  • STS polymerase chain reaction
  • a low recombination frequency corresponds to a low distance between markers on a chromosome. Comparing all recombination frequencies will result in the most logical order of the molecular markers on the chromosomes. This most logical order can be depicted in a linkage map (Paterson, 1996). A group of adjacent or contiguous markers on the linkage map that is associated to a reduced disease incidence and/or a reduced lesion growth rate pinpoints the position of a QTL. Upon the identification of the QTL, the QTL effect (the resistance) may for instance be confirmed by assessing .Boiryiis-resistance in BC2S1 progenies segregating for the QTLs under investigation. The assessment of the Botrytis resistance may suitably be performed by using a stem or leaf bioassay as described herein.
  • the QTLs for resistance against Botrytis in tomato are an aspect of the present invention.
  • a characteristic of such QTLs is that, when present in plants, they are indicative of the presence of a reduced disease incidence and/or a reduced lesion growth rate upon contacting said plant with infective amount of Botrytis material, which material may be provided in any form, such as in the form of conidia or mycelium.
  • the present invention also relates to a QTL for resistance against Botrytis in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon par ⁇ iflorum Gl.1601 associated with Botrytis resistance.
  • QTLs may be more clearly defined or indicated by the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6.
  • Table 1 and Figures 1 and 6 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L.hirsutum LYC 4/78.
  • Table 2 and Figure 5 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L. par ⁇ iflorum Gl.1601. In both tables, the genomic region where the QTLs are located is indicated by the AFLP-markers listed.
  • the QTLs of the present invention comprise genetic information in the form of DNA responsible for conferring (partial) Botrytis disease incidence or a reduced rate of Botrytis lesion growth in a tomato plant.
  • the genetic information may for instance comprise a gene or a regulatory element.
  • P-GT M-GAT - 412h wherein P and M are the common Pstl and Msel primer sequences or universal primers (Vos et al., 1995; Bai et al. 2003) followed by 2 or 3 extra selective bases as indicated by a two digit extension code.
  • 412 is the approximated size in basepairs of the resulting polymorphic fragment (given size ⁇ 2 basepairs). The size is normally rounded off but may also be given in decimals. This fragment is amplified in either L. esculentum cv Moneymaker (e) or L. hirsutum LYC 4/78 (h). Primer and adapter sequences are described in detail by Bai et al. 2003.
  • CT128 is a marker located on chromosome 2 position 44 cM on the Tanksley map (Tanksley et al. 1992).
  • TG609 (see Table 20) is an RFLP Marker located on chromosome 4 position 38 cM on the Tomato-EXPEN 1992 composite map based on a S. lycopersicum cv. VF36 x S. pennellii LA716 F2 population (Tanksley et al. 1992).
  • any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as well as any marker known to be located in that region based on publicly available information, such as from consensus maps Tomato-EXPEN 1992 (Tanksley et al, 1992), Tomato-EXHTR 1997 (Bernacchi and Tanksley, 1997), Tomato-EXPEN 2000 (Fulton et al, 2002) or Tomato-EXPIMP 2001 (Grandillo and Tanksley, 1996; Tanksley et al. 1996, Doganlar et al. 2002).
  • the genomic region where QTL-4h is located is positioned between markers TG609 (Table 20) and C2Atlg74970 (Table 24) as shown in Figure 6. Therefore, any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as' well as any marker known to be located in that region based on publicly available information.
  • Table 2 QTLs found in offspring of a cross of L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 and related quantitative resistance information.
  • the genomic region where QTL-3p is located is indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60- 65.
  • a QTL of the present invention comprises at least one marker of Table 1 or 2 or as indicated in Figures 1, 5 or 6 associated with said QTL. Because the nucleic acid sequence of the QTL that is responsible for conferring the Botrytis resistance may only be a fraction of the entire QTL herein identified, the markers merely indicate linked inheritance of genetic regions or the absence of observed recombination within such genetic regions.
  • the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6 indicate the chromosomal region where a QTL of the invention is located in the genome of the specified Lycopersicon lines and that those markers do not necessarily define the boundaries or the structure of that QTL.
  • the part of the QTL that comprises the essential resistance-conferring nucleic acid sequence(s) may be considerably smaller than that indicated by the contiguous markers listed for a particular QTL.
  • Such a part is herein referred to as a "resistance-conferring part" of a QTL.
  • a resistance-conferring part of a QTL need not necessarily comprise any of said listed markers.
  • markers may be used to indicate the various QTLs, provided that such markers are genetically linked to the QTLs and the skilled person may find or use a QTL that is analogous to those of the present invention, but wherein one or more markers listed in table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL are absent.
  • a jBofryf ⁇ s-resistance-conferring part of a QTL for resistance against Botrytis in tomato may be identified by using a molecular marker technique, for instance with one or more of the markers for a QTL shown in Table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL, preferably in combination with a resistance bioassay.
  • Tomato plants that do not comprise a Boiryiis-resistance-conferring part of a QTL of the present invention are relatively susceptible to infection by Botrytis.
  • the markers provided by the present invention may very suitably be used for detecting the presence of one or more QTLs of the invention in a suspected Botrytis- resistant tomato plant, and may therefore be used in methods involving marker- assisted breeding and selection of Botrytis resistant tomato plants.
  • detecting the presence of a QTL of the invention is performed with at least one of the markers for a QTL shown in Table 1 or 2 or as indicated in Figures 1, 5 or 6 as being linked to said QTL.
  • the present invention therefore relates in another aspect to a method for detecting the presence of a QTL for Botiytis-Yesistance, comprising detecting the presence of a nucleic acid sequence of said QTL in a suspected Botrytis- resistant tomato plant, which presence may be detected by the use of the said markers.
  • the nucleic acid sequence of a QTL of the present invention may be determined by methods known to the skilled person. For instance, a nucleic acid sequence comprising said QTL or a resistance-conferring part thereof may be isolated from a Botrytis-resistant donor plant by fragmenting the genome of said plant and selecting those fragments harboring one or more markers indicative of said QTL.
  • the marker sequences (or parts thereof) indicative of said QTL may be used as (PCR) amplification primers, in order to amplify a nucleic acid sequence comprising said QTL from a genomic nucleic acid sample or a genome fragment obtained from said plant.
  • the amplified sequence may then be purified in order to obtain the isolated QTL.
  • the nucleotide sequence of the QTL, and/or of any additional markers comprised therein, may then be obtained by standard sequencing methods.
  • the present invention therefore also relates to an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a Boiryiis-resistance-conferring part thereof.
  • an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a Boiryiis-resistance-conferring part thereof.
  • the markers that pinpoint the various QTLs described herein may be used for the identification, isolation and purification of one or more genes from tomato that encode for Botrytis resistance.
  • the nucleotide sequence of a QTL of the present invention may for instance also be resolved by determining the nucleotide sequence of one or more markers associated with said QTL and designing internal primers for said marker sequences that may then be used to further determine the sequence the QTL outside of said marker sequences.
  • the nucleotide sequence of the AFLP markers from Tables 1 and 2 may be obtained by isolating said markers from the electrophoresis gel used in the determination of the presence of said markers in the genome of a subject plant, and determining the nucleotide sequence of said markers by for instance dideoxy chain terminating methods, well known in the art.
  • the method may also comprise the steps of providing a oligonucleotide or polynucleotide capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence of a marker linked to said QTL, preferably selected from the markers of Tables 1 and 2 and as indicated in Figures 1, 5 or 6 as being linked to said QTL, contacting said oligonucleotide or polynucleotide with a genomic nucleic acid of a suspected Botryt is-resistant tomato plant, and determining the presence of specific hybridization of said oligonucleotide or polynucleotide to said genomic nucleic acid.
  • said method is performed on a nucleic acid sample obtained from said suspected Botrytis-resistant tomato plant, although in situ hybridization methods may also be employed.
  • the skilled person may, once the nucleotide sequence of the QTL has been determined, design specific hybridization probes or oligonucleotides capable of hybridizing under stringent hybridization conditions to the nucleic acid sequence of said QTL and may use such hybridization probes in methods for detecting the presence of a QTL of the invention in a suspected .Boirytis-resistant tomato plant.
  • stringent hybridization conditions refers to conditions under which a probe or polynucleotide will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Thijssen, 1993). Generally, stringent conditions are selected to be about 5-10 0 C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH.
  • Tm thermal melting point
  • the Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium).
  • Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 0 C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O 0 C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions are often: 50% formamide, ⁇ xSSC, and 1% SDS, incubating at 42°C, or, 5xSSC, 1% SDS, incubating at 65 0 C, with wash in 0.2xSSC, and 0.1% SDS at 65 0 C.
  • a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures may vary between about 32°C and 48 0 C depending on primer length. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g. Current Protocols in Molecular Biology, eds. Ausubel, et al. 1995).
  • Nucleic acid or “oligonucleotide” or “polynucleotide” or grammatical equivalents used herein means at least two nucleotides covalently linked together. Oligonucleotides are typically from about 7, 8, 9, 10, 12, 15, 1820 25, 30, 40, 50 or up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10.000, etc.
  • a nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, 1991), and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring nucleic acids and analogs can be used. Particularly preferred analogs for oligonucleotides are peptide nucleic acids (PNA).
  • PNA peptide nucleic acids
  • a nucleic acid (preferably DNA) sequence comprising at least one QTL of the present invention or a Botrytis- resistance-co ⁇ ferring part thereof, may be used for the production of a Botrytis- resistant tomato plant.
  • the invention provides for the use of a QTL of to the present invention or Botryt is-resistanee-conferring parts thereof, for producing a Botrytis-vesist&nt tomato plant, which use involves the introduction of a nucleic acid sequence comprising said QTL in a Boiryiis-susceptible recipient tomato plant.
  • said nucleic acid sequence may be derived from a suitable Botrytis-resist&nt donor tomato plant.
  • Two suitable J3o£ry£is-resistant donor tomato plants capable of providing a nucleic acid sequence comprising at least one of the hereinbefore described QTLs, or Bofryiis-resistance-conferring parts thereof, are L. hirsutum LYC 4/78 and L. parviflorum Gl.1601.
  • Other related tomato plants that exhibit resistance to Botrytis and comprise one or more genes that encode for Botrytis resistance may also be utilized as JSoiryiis-resistance donor plants as the present invention describes how this material may be identified.
  • the nucleic acid sequence that comprises a QTL for Botrytis-resistance according to the present invention, or a ⁇ o£r,y£is-resistance-coriferring part thereof may be transferred to a suitable recipient plant by any method available.
  • the said nucleic acid sequence may be transferred by crossing a .Bofryiis-resistance donor tomato plant with a susceptible recipient tomato plant (i.e. by introgression), by transformation, by protoplast fusion, by a doubled haploid technique or by embryo rescue or by any other nucleic acid transfer system, optionally followed by selection of offspring plants comprising the QTL and exhibiting jBo£ry£ ⁇ s-resistance.
  • a nucleic acid sequence comprising a QTL for jBoiryfis-resistance according to the present invention, or a jBoiry&s-resistance-conferring part thereof, may be isolated from said donor plant by using methods known in the art and the thus isolated nucleic acid sequence may be transferred to the recipient plant by transgenic methods, for instance by means of a vector, in a gamete, or in any other suitable transfer element, such as a ballistic particle coated with said nucleic acid sequence.
  • Plant transformation generally involves the construction of an expression vector that will function in plant cells.
  • a vector comprises a nucleic acid sequence that comprises a QTL for Botrytis-resistance of the present invention, or a .Bofryiis-resistance-conferring part thereof, which vector may comprise a .Bofryiis-resistance-conferring gene that is under control of or operatively linked to a regulatory element, such as a promoter.
  • the expression vector may contain one or more such operably linked gene/regulatory element combinations, provided that at least one of the genes contained in the combinations encodes for Botrytis- resistance.
  • the vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, to provide transgenic plants that are resistant to Botrytis, using transformation methods known in the art, such as the Agrobacterium transformation system.
  • Expression vectors can include at least one marker gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the marker gene).
  • selectable marker genes for plant transformation include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor.
  • positive selection methods are known in the art, such as mannose selection.
  • marker-less transformation can be used to obtain plants without mentioned marker genes, the techniques for which are known in the art.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria that genetically transform plant cells.
  • the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant (see e.g. Kado, 1991).
  • Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant cells with Agrobacterium tumefaciens (Horsch et al., 1985).
  • Another method for introducing an expression vector into a plant is based on microprojectile-mediated transformation wherein DNA is carried on the surface of microprojectiles.
  • the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes (See, Sanford et al., 1987, 1993; Sanford, 1988, 1990; Klein et al.,1988, 1992).
  • Another method for introducing DNA to plants is via the sonication of target cells (see Zhang et al., 1991).
  • liposome or spheroplast fusion has been used to introduce expression vectors into plants (see e.g.
  • protoplast fusion can be used for the transfer of nucleic acids from a donor plant to a recipient plant.
  • Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells of which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell.
  • the fused cell that may even be obtained with plant species that cannot be interbreeded in nature, is tissue cultured into a hybrid plant exhibiting the desirable combination of traits.
  • a first protoplast can be obtained from a tomato plant or other plant line that exhibits resistance to infection by Botrytis. For example, a protoplast from L.
  • a second protoplast can be obtained from a second tomato or other plant variety, preferably a tomato line that comprises commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art.
  • embryo rescue may be employed in the transfer of a nucleic acid comprising one or more QTLs of the present invention from a donor plant to a recipient plant.
  • Embryo rescue can be used as a procedure to isolate embryo's from crosses wherein plants fail to produce viable seed. In this process, the fertilized ovary or immature seed of a plant is tissue cultured to create new plants (Pierik, 1999).
  • the present invention also relates to a method of producing a J3o£ry£is-resistant tomato plant comprising the steps of performing a method for detecting the presence of a quantitative trait locus (QTL) associated with resistance to B. cinerea in a donor tomato plant according to invention as described above, and transferring a nucleic acid sequence comprising at least one QTL thus detected, or a Bot ryt is-resistance- conferring part thereof, from said donor plant to a .Boiry ⁇ s-susceptible recipient tomato plant.
  • QTL quantitative trait locus
  • a preferred embodiment of such a method comprises the transfer by introgression of said nucleic acid sequence from a Botrytis-resistant donor tomato plant into a .Boiryiis-susceptible recipient tomato plant by crossing said plants. This transfer may thus suitably be accomplished by using traditional breeding techniques.
  • QTLs are preferably introgressed into commercial tomato varieties by using marker- assisted breeding (MAS).
  • Marker- assisted breeding or marker-assisted selection involves the use of one or more of the molecular markers for the identification and selection of those offspring plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on selection of QTLs of the present invention or markers associated therewith.
  • MAS can also be used to develop near-isogenic lines (NIL) harboring the QTL of interest, allowing a more detailed study of each QTL effect and is also an effective method for development of backcross inbred line (BIL) populations (see e.g. Nesbitt et ⁇ l., 2001; van Berloo et ⁇ l., 2001).
  • NIL near-isogenic lines
  • BIL backcross inbred line
  • At least two, preferably three QTLs or .Bofryi ⁇ s-resistance-conferring parts thereof, are inserted by a suitable transfer method into a single recipient plant, i.e. that multiple QTLs are stacked in the recipient plant's genome. It is believed that stacking of two or more QTLs of the invention may lead to increased resistance to Botrytis. As the skilled person will readily understand, stacking may be achieved by any method, for instance by transforming a plant with a nucleic acid construct comprising multiple QTLs of the invention.
  • At least one QTL may be present in each parent plant of a cross, so that at least two QTLs are comprised in the resulting hybrid.
  • highly resistant plants may be obtained.
  • Such plants are highly preferred embodiments of the present invention.
  • traditional breeding techniques can be used to introgress a nucleic acid sequence encoding for Botrytis resistance into a Botrytis- susceptible recipient tomato plant.
  • a donor tomato plant that exhibits resistance to Botrytis and comprising a nucleic acid sequence encoding for Botrytis resistance is crossed with a Botrytis- susceptible recipient tomato plant that preferably exhibits commercially desirable characteristics, such as, but not limited to, disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the resulting plant population (representing the Fi hybrids) is then self-pollinated and set seeds (F2 seeds).
  • the Fs plants grown from the F2 seeds are then screened for resistance to Botrytis.
  • the population can be screened in a number of different ways.
  • the population can be screened using a traditional disease screen.
  • a quantitative stem or leaf infection bioassay is used, preferably the stem bioassay used in methods of the present invention as outlined in more detail hereinabove and the Examples is used.
  • marker-assisted selection can be performed using one or more of the hereinbefore- described molecular markers to identify those progeny that comprise a nucleic acid sequence encoding for Botrytis-vesistance. Other methods, referred to hereinabove by methods for detecting the presence of a QTL may be used.
  • marker-assisted selection can be used to confirm the results obtained from the quantitative bioassays, and therefore, several methods may also be used in combination.
  • a Botrytis-resistaxit tomato plant of the present invention is characterized by having a high level of resistance. This is defined as being a resistance level that is higher than that observed for susceptible control plants. In fact, the plants of the invention have a level of resistance that is higher than that of any commercial tomato variety, i.e. a variety having commercially desirable characteristics, known to date.
  • a plant of the invention has a susceptibility to Botrytis cinerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay.
  • a plant of the invention has a level of resistance that results in an average stem lesion length of Botrytis cinerea lesions in adult plants of less than 3.2 cm three weeks after inoculation using standard practice conditions in a resistance bioassay designed to determine resistance based on such characteristics. More typically, a plant of the invention shows an average stem lesion length of less than 2.9 cm. Some plants of the invention even show an average stem lesion length of 2.0 cm.
  • the plants of the invention show net stem lesions in the above referred resistance bioassay that are generally less than about 30% (0.9/2.85 xlOO%) of the net length of susceptible control plants, and generally less than about 40% (0.9/2.3 x 100%) of the net length of partially resistant L. hirsutum LA 1777.
  • a plant of the present invention has a susceptibility to Botrytis cinerea when measured by a bioassay which is 3 times lower than, or which is less than 1/3 the level of, a susceptible control plant.
  • a plant of the invention is more than 3 times more resistant than a susceptible control plant, as defined herein and determined with the bioassay as described.
  • QTLs or combinations of QTLs e.g. QTL-Ih and the combinations of QTL-3p+QTL-4p or QTL-9p+QTL-4p
  • full resistance is observed (See Table 10).
  • a susceptible control plant is defined as a plant showing normal susceptibility, or no resistance, to Botrytis cinerea infection.
  • Examples of susceptible control plants are the hybrid Lycopersicon esculentum cv. "Tradiro”, and Lycopersicon esculentum cv. “Moneyberg” (De Ruiter Seeds CV, Bergschenhoek, The Netherlands).
  • a Bot ryiis-resistant tomato plant, or a part thereof, obtainable by a method of the invention is also an aspect of the present invention.
  • Another aspect of the present invention relates to a Botrytis-vesistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a Botrytis- resistance-conferring part thereof, selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon p ⁇ r ⁇ iflorum Gl.1601 associated with Botrytis resistance, wherein said QTL or said Boiryiis-resistance-conferring part thereof is not in its natural genetic background.
  • the Botrytis-resistant tomato plants of the present invention can be of any genetic type such as inbred, hybrid, haploid, dihaploid, parthenocarp or transgenic. Further, the plants of the present invention may be heterozygous or homozygous for the resistance trait, preferably homozygous.
  • the QTLs of the present invention, as well as those QTLs obtainable by a method of the invention, as well as jBo£ry£ts-resistance-conferring parts thereof may be transferred to any plant in order to provide for a .Boiryi ⁇ s-resistant plant
  • the methods and plants of the invention are preferably related to plants of the Sol ⁇ n ⁇ ce ⁇ e family, more preferably tomato.
  • Botrytis-resistant tomato plant lines can be developed using the techniques of recurrent selection and backcrossing, selling and/or dihaploids or any other technique used to make parental lines.
  • Botrytis-xesistance can be introgressed into a target recipient plant (which is called the recurrent parent) by crossing the recurrent parent with a first donor plant (which is different from the recurrent parent and referred to herein as the "non-recurrent parent").
  • the recurrent parent is a plant that is non-resistant or has a low level of resistance to Botrytis and possesses commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc.
  • the non-recurrent parent exhibits Botrytis resistance and comprises a nucleic acid sequence that encodes for Botrytis resistance.
  • the non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent.
  • the progeny resulting from a cross between the recurrent parent and non-recurrent parent are backcrossed to the recurrent parent.
  • the resulting plant population is then screened.
  • the population can be screened in a number of different ways. For instance, the population can be screened using a stem quantitative bioassays as described previously herein.
  • Fi hybrid plants that exhibit a .Bo£ry£is-resistant phenotype comprise the requisite nucleic acid sequence encoding for Botrytis resistance, and possess commercially desirable characteristics, are then selected and selfed and selected for a number of generations in order to allow for the tomato plant to become increasingly inbred. This process of continued selfing and selection can be performed for two to five or more generations.
  • the result of such breeding and selection is the production of lines that are genetically homogenous for the genes associated with Botrytis resistance as well as other genes associated with traits of commercial interest.
  • MAS can be performed using one or more of the hereinbefore described molecular markers, hybridization probes or polynucleotides to identify those progeny that comprise a nucleic acid sequence encoding for .Bo ⁇ ry ⁇ s-resistance.
  • MAS can be used to confirm the results obtained from the quantitative bioassays. Once the appropriate selections are made, the process is repeated. The process of backcrossing to the recurrent parent and selecting for jBo£ry£ ⁇ s-resistance is repeated for approximately five or more generations.
  • progeny resulting from this process are heterozygous for one or more genes that encode for J3o£ry£is-resistance.
  • the last backcross generation is then selfed in order to provide for homozygous pure breeding progeny for -Bo£ry£ ⁇ s-resistance.
  • Bot ryiis-resistant inbred tomato lines described herein can be used in additional crossings to create Botrytis-resistant hybrid plants.
  • a first Botryt is-resistant inbred tomato plant of the invention can be crossed with a second inbred tomato plant possessing commercially desirable traits such as, but not limited to, disease resistance, insect resistance, desirable fruit characteristics, etc.
  • This second inbred tomato line may or may not be JBo.r ⁇ tis-resistant.
  • Another aspect of the present invention relates to a method of producing seeds that can be grown into Botrytis-xesi&tant tomato plants.
  • the method comprises the steps of providing a Botrytis-resistant tomato plant of the invention, crossing said Botrytis-resistant plant with a Lycopersicon esculentum plant, and collecting seeds resulting from said cross, which when planted, produce Botrytis- resistant tomato plants.
  • the method comprises the steps of providing a Botiytis-vesistant tomato plant of the invention, crossing said .BoJryiis-resistant plant with a Lycopersicon esculentum plant, collecting seeds resulting from said cross, regenerating said seeds into plants, selecting jBoiryiis-resistant plants by any of the methods described herein, self-crossing the selected plants for a sufficient number of generations to obtain plants that are fixed for an allele that confers Botrytis- resistance in the plants, backcrossing the plants thus produced with L. esculentum plants having desirable phenotypic traits for a sufficient number of generations to obtain L. esculentum plants that are Botrytis-resistant and have desirable phenotypic traits, and collecting the seeds produced from the plants resulting from the last backcross, which when planted, produce tomato plants which are Soir ⁇ iis-resistant.
  • Example 1 Method of identifying plants resistant to Botrytis cinere ⁇ . 1.1. Introduction.
  • This Example presents the development of a quantitative bioassay for evaluating the resistance to Botrytis cinere ⁇ of a collection of wild tomato genotypes.
  • Partial resistance against Botrytis cinere ⁇ has been reported in wild Lycopersicon species, but these reports have largely been descriptive and qualitative.
  • the identification of partially resistant genotypes would provide perspectives to introgress resistance into commercial breeding lines to obtain lines with manageable resistance levels.
  • the availability of a reproducible, objective and quantitative assay, as well as the identification of genotypes with a genetically determined (partial) grey mould resistance opens the way for resistance breeding in cultured tomato varieties.
  • the present Example describes a quantitative disease assay.
  • the assay is applied on leaves (leaf inoculation assay) and stem segments (stem inoculation assay).
  • Two parameters for disease susceptibility were examined.
  • the first parameter was the disease incidence (DI), i.e. the proportion of inoculation droplets that resulted in an expanding lesion. If the (partial) failure of a primary S. cinere ⁇ lesion to expand on a particular host genotype is a genetic trait of the plant, such a trait is important as it directly limits the number of disease foci in the crop.
  • DI disease incidence
  • the second parameter tested was the lesion growth rate over a period of 24 h (lesion growth, LG).
  • the present assays enable the quantification of both the occurrence (disease incidence) and development (lesion growth) of B. cinerea infection, resulting in two sets of quantitative trait data.
  • the assay was used to screen a collection of Lycopersicon species (hereinafter also termed "accessions") for the presence of resistance therein.
  • Table 3 List of Lycopersicon genotypes tested.
  • DRS De Ruiter Seeds, Bergschenhoek, The Netherlands
  • WU PPW Plantgrass Proefcentrum Wageningen, Wageningen University, Wageningen, The Netherlands
  • LoPB Laboratory of Plant Breeding, Wageningen University, Wageningen, The Netherlands
  • MPIZK Max Planck Institut fur Z ⁇ chtungsutze, K ⁇ ln, Germany
  • TGRC Tomato Genetics Resource Center, University of California at Davis, Davis CA, USA
  • IPK Institut fur Degenetik undbooesseforschung, Gatersleben, Germany.
  • An inoculum from B. cinerea strain B05.10 was prepared according to Benito (1998). For each individual plant one or two compound leaves that were fully stretched were detached from the main stem with a sharp razor blade and transferred to pre-wetted florist foam. The florist foam was placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. The compound leaves were then inoculated with a conidial suspension of B. cinerea by carefully pipetting a total of 6 to 10 droplets of inoculum (2 ⁇ l) onto the upper surface of the leaves.
  • the containers were closed with a spray-wetted lid and incubated at 15°C in the dark at 100% RH, essentially as described by Benito et al., 1998.
  • the data in Table 4 were derived from a test wherein one composite leaf was divided into four leaflets, and wherein every leaflet was inoculated with 10 drops of 2 ⁇ l each, containing 2000 conidia. Both the proportion of aggressive expanding lesions (disease incidence) and the lesion growth rate were monitored over several days.
  • the disease incidence of a particular genotype in each experiment was related to the disease incidence of Moneymaker tested in that same experiment.
  • Lesion sizes were measured at 96, 120 and 144 hpi using a caliper. The disease incidence was determined by dividing the total number of expanding lesions by the total number of inoculation droplets. Lesion growth rates were determined by calculating the increase in lesion size (in mm) over a 24 h period. Data for the non- expanding lesions were deleted from the quantitative analysis. The results of the leaf assay are presented in Table 4.
  • Table 4 Disease incidence (DI, in %) and lesion growth rates (LG, in mm/day ⁇ standard deviation) in leaves of Lycopersicon accessions inoculated with B. cinerea. Experiments were conducted in 1999 and 2000 in different weeks as indicated.
  • the stem assay was performed as follows: The top 5-10 cm and bottom 5-10 cm of the stem of approximately 50 cm high plants were removed and the remaining 30 cm was cut into equal segments of 5-6 cm. Each stem segment was placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments were sprayed with tap water in order to ensure an equal spread of the inoculum over the wound surface. Inoculum was prepared as described for the leaf assay. One drop of a 5 ⁇ l inoculum, containing approximately 10 6 conidia • ml" 1 , was applied on the top of each stem segment. Incubations were performed at 15 ⁇ 2 0 C in the dark with 100% relative humidity. Infection progress was determined by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper.
  • the percentage of infected stem pieces was calculated.
  • the disease incidence was determined by dividing the total number of stem segments with expanding lesions by the total number of inoculated segments.
  • Lesion growth rates were determined by calculating the increase in lesion size over a 24 h period, whereby the data for the non-expanding lesions were omitted from the analysis.
  • the results of the stem assay are presented in Table 5.
  • the disease incidence and lesion growth in detached leaf infection experiments were determined over several days for each genotype, usually from 2-4 days post ⁇ infection.
  • Table 4 shows the results of 14 genotypes for which detached compound leaves originating from at least 5 individual plants were inoculated, with 40 inoculation spots per leaf (10 per leaflet).
  • the disease incidence in these 14 genotypes should be compared to that in the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Except for genotypes 82/2577 and 83/2896 (both of the species L.
  • Genotypes Gl.1556, Gl.1560 and Gl.1601 showed a low disease incidence in three independent experiments, ranging from 0 to 21%.
  • the disease incidence in 17 genotypes should be compared to the disease incidence of the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Most genotypes showed a disease incidence in a similar range as the control line Moneymaker. Genotypes Gl.1556 (29% and 41%) and Gl.1560 (28% and 7%) showed a reduced disease incidence. Only Gl.1560 differed statistically significant (p ⁇ 0.05) from the control.
  • the lesion growth rates in the stem assay (Table 5) for the control genotype L. esculentum cv. Moneymaker ranged from 5.4 to 9.2 mm/day. The lesion growth rates of many genotypes were in a similar range as the control.
  • the glasshouse compartment was kept at high humidity by spraying the floor twice a day with tap water and leaving doors and windows closed. At regular intervals pruning wounds were made on all plants and the occurrence of grey mould was monitored over time. A number of wild Lycopersicon accessions were identified that displayed a severe reduction of both parameters, thus providing potential sources for introgressing two, potentially independent mechanisms of partial resistance into L. esculentum.
  • a set of Lycopersicon accessions from diverse origins was screened for resistance to the fungal pathogen Botrytis cinerea as described in Example 1.
  • the accession Lycopersicon par ⁇ iflorum Gl.1601 showed in a leaf assay a lower disease incidence and also a slower lesion growth (see Tables 4 and 5 above).
  • Amplified Fragment Length Polymorphism markers were used to construct a linkage map and to perform Quantitative Trait Locus-analysis. QTLs were detected for both disease incidence and lesion growth.
  • Lycopersicon par ⁇ iflorum Gl.1601 a segregating population with this accession as founding parent (Huang, 2001), was used for further analysis.
  • the segregating population consisted of 130 Fa- derived F3 populations.
  • Example 2 2.3. Disease evaluations From each of the 130 F3 populations 5 seedlings were grown and subjected to the stem assay described in Example 1 (see 1.4). For practical reasons the complete set of measurements was divided (at random) into 13 portions of equal size. Every week one portion consisting of 50 plants was measured. A large set of susceptible Moneymaker control plants was used to correct for environmental differences between weeks. For practical reasons L. par ⁇ iflorum Gl.1601 was not included in the experiment. Measurements were performed as described in Example 1.
  • aa is homozygous L. esculentum for the complete chromosomal region
  • b- is heterozygous or homozygous L. par ⁇ iflorum for the QTL-region.
  • This Example shows that genetic sources like L. par ⁇ iflorum Gl.1601 can be used to increase the resistance to B. cinerea in tomato.
  • Several QTLs both for disease incidence as for lesion growth could be identified (table 6). These QTLs may be confirmed in more advanced breeding material such as backcross lines.
  • Table 7 shows the experimental results of disease resistance tests of various F3 lines resulting from a cross between L. esculentum cv Moneymaker and L. par ⁇ iflorum G.1601. It is clearly shown that the BChirs ⁇ reference line used in this experiment exhibits a higher level of resistance than that of the L. par ⁇ iflorum (L parv) lines listed. However, the presence of QTL effects can also be established for the par ⁇ iflorum QTLs.
  • Table 7 Average stem lesion length o£ Botrytis cinerea lesions in adult plants of L. parviflorum accession G.1601 three weeks after inoculation.
  • Tradiro is a hybrid, suscpetible to Botrytis according to growers
  • Durintha is a hybrid with partial resistance according to growers
  • Moneyberg and Moneymaker are similar types of susceptible lines
  • GT is Moneyberg with TMV resistance
  • BChirs ⁇ is a backcross line resulting from L. hirsutum LYC 4/78 introgression and comprises the hirsutum QTL-Ih for lesion growth. (+): heterozygous or homozygous presence; (— ): not present; n.d.: not determined.
  • Example 3 Mapping partial resistance to Botrytis cinerea in an interspecific tomato population (L. esculentum cv Moneymaker x L. hirsutum accession LYC 4/78)
  • LYC 4/78 Seeds of Lycopersicon hirsutum LYC 4/78 (hereafter referred as LYC 4/78) were obtained from the gene bank located at the Institute for Plant Genetics and Crop Plant Research, Gatersleben, Germany. Seeds of Lycopersicon esculentum cv. Moneymaker (hereafter referred as Moneymaker) were obtained from the seed bank of De Ruiter Seeds cv, Bergschenhoek, The Netherlands.
  • Genomic DNA was isolated from two young (rolled up) leaves using a cetyltrimethylammonium bromide (CTAB) based protocol according to Steward and Via (1993), adjusted for high throughput DNA isolation using one ml micronic tubes (Micronic BV, Lelystad, The Netherlands) and grounded using a Retsch 300 mm shaker at maximum speed (Retsch BV, Ochten, The Netherlands).
  • CTAB cetyltrimethylammonium bromide
  • the AFLP analysis (Vos et al, 1995) of F2, BC2, BC3, BC4 and BC2S1 populations was done and the AFLP fragments were resolved on a LI-COR 4200 DNA sequencer, essentially following the method published by Myburg (Myburg et al. 2001).
  • the selective Pst primer was labeled with an IRD 700 or IRD 800 fluorescent label.
  • AFLP gel images were scored using the AFLP-Quantar Pro software package (Keygene BV, Wageningen, The Netherlands). The following ten primer combinations and adapter sequences were used for genotyping: P14M48, P14M49, P14M50, P14M60, P14M61, P15M48, P18M50, P18M51, P22M50 and P22M51, as described by Bai et al. (2003). 3.4. Phenotypic analysis of the F2 population
  • Average disease incidence of each individual experiment ranged from 31% to 73%, while the average lesion growth ranged from 6.2 to 7.9 mm/day (Table 8). Lesion growth can only be calculated if there is at least infection in one of the six stem pieces. Consequently an increase in the number of informative genotypes for lesion growth could be observed with higher disease incidences. For instance, with the low average disease incidence (31%) only 52% of the genotypes were informative for lesion growth.
  • Table 8 Average disease incidence and average lesion growth of seven experiments according to Example 3.4. The average values of the weeks are ordered according to disease incidence percentage.
  • AFLP amplified fragment length polymorphism
  • IM interval mapping
  • Interval mapping for disease incidence in the F2 population was done for those individual disease tests with an average disease incidence lower than 50% and for average data obtained from all disease tests (table 8).
  • the average data of all tests gave in the interval mapping procedure a single significant QTL for disease incidence (likelihood of odds (LOD) score must be higher than 3.4 for a genome-wide confidence level o ⁇ P ⁇ 0.05).
  • This QTL had a LOD score of 4.5 and explained 13 % of the total phenotypic variation (Table 9).
  • the allele contributing to resistance originated from the resistant parent LYC 4/78.
  • QTL mapping on each individual experiment gave in all four cases the same QTL region. In each independent experiment occasionally other "minor QTLs" were observed.
  • Lesion growth can best be measured in those disease tests with a high disease incidence.
  • QTL mapping the average of all 7 disease tests was used and one QTL for lesion growth of B. dnerea was identified above the threshold (LOD 3.4 for a genome-wide confidence level of P ⁇ 0.05).
  • This QTL had a LOD score of 4.2 and explained 12 % of the total phenotypic variation (Table 9).
  • the positive effect originated from the resistant parent LYC 4/78. The necessity of performing multiple disease tests is illustrated because in only one single repetition a LOD profile above the threshold was found.
  • Table 9 Estimation of the calculated effects for plants homozygous Moneymaker (A), heterozygous (H) or homozygous LYC 4/78 (B). Scores for the F2 population were calculated with the interval mapping procedure, while scores for the BC2S1 population were calculated with a Kruskal- Walk ' s analysis.
  • the Fi plant of the cross Moneymaker x LYC 4/78 was twice backcrossed with Moneymaker and the 59 progeny plants were screened for the presence of the two identified QTL-regions (one for disease incidence and one for lesion growth) using AFLP markers. Plants, heterozygous for one of the two identified QTLs, were selected and selfed to obtain two BC2S1 populations. A total of four disease bioassays were performed with each BC2S1 genotype. The data of both BC2S1 subpopulations, analyzed with SPSS, showed normal distributions for lesion growth, but not for disease incidence as some subclasses were observed (Figure 2).
  • BC2S1 plants were AFLP genotyped with the same 10 primer combinations as described for the F2 population in section 3.3 above.
  • the average lesion growth in the population segregating for the lesion growth locus was 5.3 mm/day while in the other population an average lesion growth of 6.3 mm/day was observed.
  • Not a single plant had a lesion growth as low as the resistant parent LYC 4/78.
  • plants with a lower disease incidence then the resistant parent LYC 4/78 were observed.
  • the average disease incidence for both BC2S1 populations was equal (57-59%).
  • QTL- 2h a major QTL for disease incidence was identified.
  • QTL-4h a restricted 'multiple QTL mapping 1 (MQM) procedure on the F2 dataset.
  • MQM restricted 'multiple QTL mapping 1
  • QTL-4h A QTL is denoted as "minor” when its score is below the significance threshold of LOD 3.4. The effects however are believed to be real QTL effects.
  • QTL-4h is located on chromosome 4 and reduces disease incidence (see table 1).
  • the QTL has a LOD score of 2.9 and is coupled to the following AFLP markers: P18M51-169.5e, P18M51-305.4h, Pl4M60-262.9e, and P14M61-292.7h.
  • the positive effect of this locus is derived from the resistant parent L. hirsutum.
  • the positive effect was identified both in the F2 and in the BC2S1 population.
  • This QTL was initially identified in the BC2S1 population lacking segregation of QTL-2h and is also coupled to the AFLP markers P14M48-345e, P14M48-177e, and Pl8M50-147e.
  • NIL near isogenic lines
  • BIL backcross inbred line
  • the bioassay for measuring resistance to B. cinerea has proven to be a valuable tool. However, a still large and unknown variation appears to influence the development of the infection process. This large non-genetic variation can be minimized by using standardized procedures and by performing many independent replications. The variation can be caused by the greenhouse conditions changing from week to week (day length, hours of sunlight and temperature) causing differences in physiological conditions of the stem. Also, small variations in the preparation of the fungal inoculum may play a role in the variation of the infection process. Another observation is that the development of the disease can also be affected by the microclimate in the trays in which the stem pieces were placed. Ten different experimental trays were used for the BC2S1 bioassays. Statistical analysis was used to compensate for variation between and within experiments.
  • Table 10 Average stem lesion length oiBotrytis cinerea lesions in adult plants of L. hirsutum accession LYC 4/78 and L. hirsutum LA 1777, three weeks after inoculation.
  • a, b, c and d are repeats whereby each repeat represents 5 plants; e and f are repeats whereby each repeat represents 3 plants; GT is Moneyberg with TMV resistance; Durintha is a hybrid with partial resistance according to growers; Tradiro is a hybrid, susceptible to Botrytis according to growers; BChirs indicates backcross lines resulting from L. hirsutum LYC 4/78 introgressions; LA 1777 is wild species accession L. hirsutum LA 1777; BC chrs 10 indicates backcross lines with introgression at chromosome 10 from L. hirsutum LA 1777; parv indicates lines resulting from L. par ⁇ iflorum introgressions.
  • the level of resistance to Botrytis conferred by L. hirsutum LYC 4/78 QTLs is higher than the level of resistance conferred by L. peruvianum LA 1777 QTLs at chromosome 10.
  • the level of resistance in plants containing the L. hirsutum LYC 4/78 QTLs described herein was compared to that of L. hirsutum LA1777, the source of WO02/085105 that contains a QTL for partial Biotrytis resistance on chromosome 10, and to introgression lines derived therefrom with introgressions at chromosome 10. Lines were placed in the greenhouse in soil and grown under standard practice conditions in the Netherlands.
  • results are listed in Table 10. It was observed that lines containing the QTLs from L. hirsutum LYC 4/78 showed a higher level of resistance to Botrytis than the LA 1777 source and IL-lines. Additionally, L. parviflorum lines containing the combination of either the QTL for disease incidence on chromosome 4 and that of lesion growth on chromosome 9 (line 68), or the combination of both QTLs for disease incidence on chromosome 3 and chromosome 4 (line 78) were compared to the LA 1777 source and IL-lines. Former lines showed less lesion growth on the stem and therefore exhibit a higher level of resistance to Botrytis then the lines derived from LA 1777 (See Table 10). Where a lesion length of 2.0 cm is recorded, only the original wound could be measured and no fungal growth was observed, which indicates a high level of resistance. Thus, a stem lesion length of 2 cm indicates absence of net growth.
  • Tables provide detailed information on the various RFLP and COS-II markers as indicated in the various linkage maps and as indicated for association with the QTLs of the present invention.
  • the information was directly copied in from the SOL Genomic Network (SGN) database hosted at Cornell University, version of 7 October 2005.
  • SGN SOL Genomic Network
  • TGTCTACTTTC CTTTTTAA ⁇ AGAAAGAACTTAAGGAGAGGACATACTTATTATTTTTGCA
  • LA716 380+220
  • LA925 340+220
  • LA716 1300 LA925: 1200
  • TGATAAATGCTGGGAAGATTGACTC Reverse primer ATCAACCTGGCTCCATCTTCTATTTG
  • LA716 200 LA925: 220
  • GAAATTTACGAAGGAATATTATAGACTGA ATTCCTTGGTGACAAGTATCAAGACATCTTGACCAAGTTTAAAGTTTTGTAGTGGCAGTTC
  • Reverse primer (5'-3'): ACGCTTGCGAGCCTTCTTGAGAC Temperature: 55°C Mg +2 concentration: 1.5 mM
  • LA716 1000 LA925: 1000 Digested band sizes (using AIuI)
  • LA716 550 LA925: 850
  • Lycopersicon parviflorum Gl.1601 co-localize with two qualitative powdery mildew resistance genes. MoI. plant microbe interactions 16:169-176.
  • Brassica napus using Agrobacterium vectors Plant Cell Reports 8:238-242. Myburg AA, Remington DL, O' Malley DM, Sederoff RR, Whetten RW (2001)
  • Nesbitt TC, Tanksley SD (2001) fw2.2 directly affects the size of developing tomato fruit, with secondary effects on fruit number and photosynthate distribution. Plant Physiol. 127: 575-583.
  • Nicot PC Moretti A, Romiti C, Bardin M, Caranta C, Ferriere H (2002)
  • Paterson AH ed. (1996) Genome Mapping in Plants, Academic Press Inc San Diego, CA, USA.
  • GGT Software for the display of graphical genotypes. J.
  • Van Heusden AW Van Heusden AW, Koornneef M, Voorrips RE, Bruggemann W, Pet G,

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Botany (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Chemical & Material Sciences (AREA)
  • Physiology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Analytical Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Cultivation Of Plants (AREA)

Abstract

The present invention relates to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis cinerea in tomato, comprising the steps of crossing a Botrytis-resistant donor tomato plant with a non-resistant, or Botrytis-susceptible, recipient tomato plant, contacting one or more offspring plants with an infective amount of Botrytis, quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants, establishing a genetic linkage map that links the observed disease incidence and/or rate of lesion growth to the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants, and assigning to a QTL the contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced lesion growth rate.

Description

Title: Tomato plants having higher levels of resistance to Botrytis.
TECHNICAL FIELD
The present invention relates to plant breeding and molecular biology. More specifically, the present invention relates to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis cinerea in tomato, to a method of producing a Botrytis-resistant tomato plant therewith and to Botrytis-resistant tomato plants thus obtained and parts thereof.
BACKGROUND OF THE INVENTION
Botrytis dnereα is a necrotrophic pathogenic fungus with an exceptionally wide host range comprising at least 235 possible hosts. Because of its wide host range and because it affects economically important parts of the plant B. cinereα is a major problem in many commercially grown crops. Amongst growers, the fungus is commonly referred to as Botrytis. The cultivated tomato (predominantly Lycopersicon esculentum) is also susceptible to infection by Botrytis and the fungus generally affects stem, leaves and fruit of the tomato plant. In heated greenhouses the occurrence of infections by Botrytis on stems is particularly common.
Botrytis actively kills infected cells, causing soft rot, blights, leaf spot, damping-off and stem cancers. Affected leaves become covered with conidiophores and conidia, and subsequently collapse and wither. The fungus will grow from diseased leaves into the stem and produce dry, light brown lesions a few millimetres to several centimetres in length. Lesions may also form at pruning scars on the stem. The stem lesions may also be covered with a gray mold. In severe cases, the infection girdles the stem and kills the plant. Older, senescent tissue of a tomato plant is usually more susceptible to attack by Botrytis than younger tissue. In order to prevent the development of Botrytis in greenhouse grown tomatoes, the temperature and relative humidity must be closely regulated. It is further important to provide water without wetting the leaves. For field grown plants, good drainage and weed control should be employed. Moreover, the nutrient levels of the plants must be kept high. However, these preventive measures cannot fully avert the occurrence of considerable yield loss in case of infection. Fungicides are available for controlling Botrytis in both greenhouse and field grown tomatoes. Examples of some fungicides include Dowicide A® and chlorothalonil, which may also be applied to the tomato fruits after harvest. However, Botrytis is known to have developed resistance against several commonly used fungicides. In addition, the use of fungicides is undesired both from an economic and from an environmental perspective. Presently, there is a need for commercial tomato varieties that exhibit resistance to Botrytis.
Partial resistance to Botrytis has been found in several wild species of Lycopersicon (Bgashira et al. 2000; Nicot et al. 2002; Urbasch 1986). These plants however do not produce commercial crop tomatoes.
It is known from WO 02/085105 that L. hirsutum comprises a genetic region on chromosome 10 of the genome that is involved in partial resistance to Botrytis. The introgression of this genetic material into cultivated tomato varieties is believed to be capable of providing for cultivated tomato plants that are partially resistant to Botrytis.
Thus far, however, breeding programs aimed at providing resistance to Botrytis in tomato have had limited success. The reason for these poor results is at present not clear. For one part, this may be due to insufficient knowledge on the genetic basis and inheritance of J3o£ry£is-resistance. For another part, this may be due to the lack of proper bioassays for assessing .Bo£ry£is-resistance levels in tomato plants obtained in breeding programs. The lack of knowledge and methods also complicates the selection of plants among both wild accessions and offspring plants that comprise genes involved in resistance to Botrytis.
It is an aim of the present invention to improve the success of breeding programs aimed at providing commercial tomato varieties that are resistant to
Botrytis. It is a further aim of the present invention to provide for additional and/or improved resistance to Botrytis in commercial tomato varieties. It is yet another aim of the present invention to provide for a method for finding additional wild Lycopersicon accessions as sources of resistance to Botrytis and for finding additional genetic material in the genome of such plants that is involved in resistance of tomato to Botrytis. Such additional sources and additional genetic material may be used to broaden the basis for the production of Botryti s-resistant varieties of cultivated tomato. SUMMARY OF THE INVENTION
The present inventors have now found that a particular quantitative bioassay which comprises the measurement of initial and/or progressive parameters of infection with Botrytis in tomato plants in combination with a molecular marker detection technique provides for a very advantageous method of detecting sources of resistance to Botrytis amongst wild Lycopersicon accessions and for detecting genetic material in the genome of such plants that is involved in improved resistance of tomato to Botrytis. By using this combination of techniques, the present inventors have successfully identified partial resistance to Botrytis in two lines of wild relatives of tomato, i.e. Lycopersicon hirsutum LYC 4/78 and Lycopersicon parυiflorum Gl.1601.
The inventors were subsequently able to produce Botrytis-resistant tomato plants by crossing plants from these i3o£ryi£is-resistant wild (donor) tomato lines with non-resistant recipient tomato plants. These plants exhibited a higher level of resistance than plants comprising a genomic region on chromosome 10 of L. hirsutum associated with Botrytis resistance as disclosed in WO 02/085105.
By assessing the resistance level to Botrytis in segregating populations (F2 populations) of these newly produced crosses in relation to the presence of molecular markers of the donor plant, the present inventors were able to identify multiple quantitative trait loci (QTLs) linked to j3o£ry£js-resistance in the resistant wild tomato lines and thereby establish the location of multiple resistance-conferring DNA sequences in the genome. As a result, the present inventors have now found that Botrytis resistance in tomato is inherited polygenically, which may partly explain the poor breeding results. This finding now provides for the improvement of methods of producing Botrytis-xesistaxit tomato plants. In the description below, a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato will be addressed in short as a QTL for Botrytis-resistance or a QTL associated with Botry tis-resistance. A total of six new QTLs for Botryt is-resistance were found in the two wild tomato lines. Four of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to reduce the initial establishment of an infection, hereinafter referred to as the parameter for disease incidence. Two of these six QTLs could be linked to a quantitative parameter that reflected the capability of the plant to slow the progression of infection, hereinafter referred to as the parameter for lesion growth rate.
By producing genetic linkage maps, it was found that chromosome 1 of L. hirsutum LYC 4/78 harbors a QTL that is linked to a reduced rate of growth of lesions induced by Botrytis infection and that both chromosomes 2 and 4 of that same accession harbor a QTL that is linked to a reduced disease incidence. In L. parυiflorum Gl.1601, a QTL for reduced rate of lesion growth was found to be located on chromosome 9, while two separate QTLs for reduced disease incidence were found to be located on chromosomes 3 and 4. A QTL on chromosome 10, as reported in the prior art, could not be detected by this method. By using the above-mentioned quantitative bioassay all QTLs in L. hirsutum LYC 4/78 tested thus far could be confirmed by assessing disease resistance in BC2S1 (backcross 2, selfed) progenies segregating for the QTLs under investigation.
The present invention relates in a first aspect to a .Boϊry^s-resistant tomato plant, wherein said plant has a susceptibility to Botrytis dnerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay wherein the average length of a stem lesion resulting from Botrytis dnerea infection in adult plants is measured during a three week period under standard practice conditions. The stem lesion length over a period of three weeks as used herein as a measure for the level of resistance is to be determined by standard practice conditions as described herein. In a preferred embodiment, said Botrytis-resistant tomato plant is characterized in that said plant comprises within its genome at least one QTL or a .Boiryføs-resistance-conferring part thereof selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicori hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon pαrυiflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said .Botfryiis-resistance-conferring part thereof is not in its natural genetic background.
The present invention relates in another aspect to a method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato. The method comprises the steps of crossing a Botrytis-resistant donor tomato plant with a non-resistant or partially resistant (Botry tis-susceptible) recipient tomato plant; contacting one or more offspring plants with an infective amount of Botrytis; quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants; establishing a genetic linkage map that links the observed disease incidence and/or the lesion growth rate to the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants; and assigning to a quantitative trait locus the contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced lesion growth rate.
In another aspect, the present invention relates to QTLs obtainable by a method for detecting a QTL for Botrytis-resistance according to the invention as outlined above. These QTLs are different from the prior art QTLs. For one, prior art QTLs could not be found. Furthermore, the QTLs of the present invention are more informative than those of the prior art as they are indicative of either a characteristic relating to the plant's ability to oppose the onset of the disease, or a characteristic relating to the plant's ability to slow the progress of the disease. Such information is highly valuable in breeding programs, since combinations thereof may suitably provide for improved resistance, and proper inheritance of the resistance trait from one generation to another may be better controlled.
The present invention further relates to a QTL for Botiytis-resist&nce in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parviflorum G 1.1601 associated with Botrytis resistance. These QTLs are located on positions of the genome not previously associated with resistance to Botrytis. Details of these QTLs are described in more detail herein below.
The alleles present on the positions of the genome indicated by these QTLs are an aspect of the present invention. A QTL of the present invention may be in the form of an isolated, preferably double stranded nucleic acid sequence comprising said QTL or a resistance-conferring part thereof. Very suitably, the size of the nucleic acid sequence, which may for instance be isolated from the chromosome of a suitable donor plant, may represent a genetic distance of 1-100 cM, preferably 10-50 cM on said chromosome. Said nucleic acid may comprise at least 50, more preferably at least 500, even more preferably at least 1000, still more preferably at least 5000 base pairs. One or more nucleic acid sequences comprising a QTL or a resistance-conferring part thereof according to the invention may in turn be comprised in a nucleic acid construct, said construct may further comprise regions that flank said one or more nucleic acid sequences and which regions are capable of being integrated into a suitable vector for transfer of said one or more nucleic acid sequences into a suitable Bo£r;y£fs-susceptible recipient tomato plant. The vector may further comprise suitable promoter regions or other regulatory sequences. The QTLs may also be in a form present within the genome of a tomato plant. The QTLs of the present invention preferably comprise at least one marker, preferably two, more preferably three, still more preferably four, still more preferably more than four markers associated with jBo£ryiis-resistance selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to said QTL.
The present invention relates in another aspect to a method for detecting a QTL for Botrytis-resistance, comprising detecting at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for J3o£ry£js-resistance in a suspected Botrytis- resistant tomato plant.
The present invention further relates to a method of producing a Botrytis- resistant tomato plant. The method comprises the steps of detecting a QTL for Botjytis-resistance in a Botryt is-resistant donor tomato plant by performing any one of the methods for detecting a quantitative trait locus (QTL) for Botrytis~resistwn.ce according to the invention, and transferring nucleic acid comprising at least one QTL thus detected, or a Sofryiis-resistance-conferring part thereof, from said donor plant to a jBo£ry£ϊs-susceptible recipient tomato plant.
The transfer of nucleic acid comprising at least one QTL or a Botrytis- resistance-conferring part thereof may very suitably be performed by crossing said Botrytis-resistant donor tomato plant with a .Boiryiis-susceptible recipient tomato plant to produce offspring plants; and selecting from among the offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL for Botrytis- resistance according to the invention, or a Bo£ry£is-resistance-conferring part thereof. The presence in said introgressed nucleic acid of at least one QTL for Botrytis- resistance according to the invention, or a .Bo£r.y£is-resistance-conferring part thereof, may suitably be detected by a method according to the present invention wherein at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6 linked to a QTL for Botrytis- resistance is detected.
A preferred selection method therefore comprises marker-assisted selection (MAS) (see e.g. Tanksley et al. 1998) of said introgressed DNA wherein one or more markers associated with said QTL are detected in offspring plants. MAS may for instance be performed by isolating genetic material from said offspring plants and determining the presence therein, by molecular techniques, of one or more donor plant markers. Alternatively, molecular marker detection methods may be used without prior isolation of genetic material. Optionally, in addition to the marker detection, a phenotypic test on Botrytis resistance may be performed in order to select suitable plants. A very suitable test therefore is the quantitative bioassay as described herein, whereby such parameters as disease incidence and/or rate of lesion growth are determined. The confirmation of the presence of at least one marker from a QTL for .Bo£r;y£ϊs-resistance in combination with the establishment of the presence of a resistant phenotype provides evidence for the successful transfer of nucleic acid comprising at least one QTL, or a .Bofrytø-resistanee-conferring part thereof, from the donor plant to the recipient plant.
In an alternative embodiment of a method of producing a .Boir.yiis-resistant tomato plant, the indicated transfer of nucleic acid may very suitably be performed by transgenic methods (e.g. by transformation), by protoplast fusion, by a doubled haploid technique or by embryo rescue.
In a preferred embodiment of a method of producing a J3o£ry£is-resistant tomato plant, the donor plants are Lycopersicon hirsutum LYC 4/78 and/or Ly coper sicon parυiflorum Gl.1601 and the nucleic acid transferred from these donor plants into recipient plants preferably comprises at least one QTL for Botrytis- resistance selected from the group consisting of the QTLs on chromosomes 1 (QTL- Ih), 2 (QTL-2h) and 4 (QTL-4K) of Lycopersicon, hirsutum LYC 4/78 and the QTLs on chromosomes 3 (QTL-3p), 4 (QTL-4p) and 9 (QTL-9p) in Lycopersicon parviflorum Gl.1601 associated with Botrytis resistance, or a So^-j^s-resistance-conferring part thereof.
In another preferred embodiment of a method of producing a jBoiryiis-resistant tomato plant, the method comprises the crossing of said Bot?ytis-vesistant donor tomato plant with a Bo^ss-susceptible recipient tomato plant to produce first generation offspring plants; selecting from among the first generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said donor tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Uoiryiis-resistance according to the invention, or a Bofryiis-resistance-conferring part thereof; crossing said selected offspring plant with a suitable commercial tomato line to produce second generation offspring plants; selecting from among the second generation offspring plants a plant that comprises in its genome nucleic acid introgressed from said first generation offspring tomato plant, wherein said introgressed nucleic acid comprises at least one QTL, preferably two, more preferably more than two QTLs for Botrytis-resistance according to the invention, or a Bofr^fis-resistance-conferring part thereof, and optionally producing further generations of offspring plants. The mentioned preferably two, more preferably more than two QTLs for Botryt is-resistance that are introgressed in offspring plants may be QTLs for disease incidence, QTLs for lesion growth rate or a combination of these types.
In another aspect, the present invention relates to a .Boϊryiis-resistant tomato plant, or part thereof, obtainable by a method of the present invention.
In a still further aspect, the present invention relates to a .Boiryiϊs-resistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a £o£ry£is-resistance-conferring part thereof, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon pαrυiflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said Boirytis- resistance-conferring part thereof is not in its natural genetic background. In yet another aspect, the present invention relates to a method of producing a
Bo£r;y£is-resistant inbred tomato plant. The method comprises the steps of producing a JBofryiis-resistant tomato plant according to a method of the invention, selfing said plant, growing seed obtained from said selfed plant into new plants; identifying plants that exhibit Botrytis resistance and possess commercially desirable characteristics from amongst said new plants, and repeating the steps of selfing and selection until an inbred tomato plant is produced which exhibits Botrytis resistance and possesses commercially desirable characteristics. A method of producing a Botrytis-resistaxύ, inbred tomato plant may further comprise the additional step of selecting homozygote inbred tomato plants that exhibit Botrytis resistance and possess commercially desirable characteristics.
In a further aspect, the present invention relates to a Botrytis-vesϊst&nt inbred tomato plant, or parts thereof, obtainable by a method of the invention.
In a further aspect, the present invention relates to a hybrid tomato plant, or parts thereof, that exhibits resistance to Botrytis, wherein said hybrid tomato plant is obtainable by crossing a jBo.ryiis-resistant inbred tomato plant obtainable by a method of the invention with an inbred tomato plant that exhibits commercially desirable characteristics.
The invention further relates to a tissue culture of regenerable cells of the tomato plants of the present invention. In a preferred embodiment of such a tissue culture, the cells or protoplasts of said cells having been isolated from a tissue selected from the group consisting of leaves, pollen, embryos, roots, root tips, anthers, flowers, fruits, and stems and seeds.
The invention further relates to the use of a marker selected from the group consisting of the markers of Tables 1 and 2 and the markers as indicated in Figures 1, 5 and 6, for the detection of QTLs for Bot ryt is-resistance according to the invention, and/or for the detection of .Boiryϋs-resistant tomato plants. The Botryt is-resistant donor tomato plant used in methods of the present invention is preferably selected from the group consisting of Lycopersicon cerαsiforme, Lycopersicon cheesmαnii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon pαrυiflorum, Lycopersicon pennellii, Lycopersicon peruυiαnum, Lycopersicon pimpinellifolium and Solαnum lycopersicoides, more preferably, a wild Lycopersicon accession is used as the donor plant. Highly preferred donor plants are Lycopersicon hirsutum and Lycopersicon pαrυiflorum, in particular Lycopersicon hirsutum LYC 4/78 and Lycopersicon pαrυiflorum Gl.1601.
The
Figure imgf000010_0001
recipient tomato plant used in methods of the present invention is preferably a plant of the species Lycopersicon esculentum, more preferably an L. esculentum cultivar that possess commercially desirable characteristics, or another commercial tomato line. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the position of quantitative trait loci (QTLs) for resistance to B. cinerea originating from L. hirsutum LYC 4/78 with the linkage maps representing chromosome 1 and 2. Map positions are given in cM. The QTL detected on chromosome 1 is for lesion growth and the QTL detected on chromosome 2 is for disease incidence. Bars indicate the QTL intervals. The box shows the LOD 1 interval and the line shows the LOD 2 interval. The codes for AFLP markers are more extensively described in Table 1. All markers indicated as associated to the QTLs may be used as markers in aspects of the present invention. Figure 2 shows a schematic overview of the development of the L. esculentum x
L. hirsutum LYC 4/78 populations. BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain BC5 lines to aid in the development of QTL-NIL lines for the two main effects, which were identified in the F2 population. BC3 and BC4 lines are backcrossed to L. esculentum cv. Moneymaker to obtain a backcross inbred line (BIL) population (See Example 3).
Figure 3 shows the segregation in the two BC2S1 populations (population size 60 resp. 47) segregating for lesion growth (figure 3B and 3D and disease incidence (figure 3A and 3C). Lesion growth is on the x-axis in mm (figure 3B and 3D) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on ) and disease incidence (figure 3A and 3C) is in classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on). On the y-axis is the number of plants in each class. The average parental values are indicated by the arrows for MM resp. Lye 4/78.
Figure 4 shows the results of the L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 cross. The segregation in the F2 population (based on average of F3 lines) for disease incidence (figure 4A) and lesion growth (figure 4B). Disease incidence is on the x-axis as percentage (figure 4A) and classes of 5% (12.5 - 17.5%; 17.5-22.5% and so on. Lesion growth is on the x-axis in mm (figure 4B) and classes are 0.5 mm (2.75-3.25; 3.25-3.75 and so on). On the y-axis the number of plants in each class is presented. Figure 5 shows a linkage map of the L. parviflorum QTLs as described herein.
QTL-3p is located in the region indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60-65. QTL-4p is located in the region indicated by markers P14M48-158 and P14M48-34xCD (= P14M48-349 in Table 2). QTL- 9p is located in the region indicated by markers TGlO, P22M50-56, P14M48-56, P14M50-82, P14M50-204, P15M48-138 (= P15M48-137 in Table 2), P14M50-174 (=P14M50-176 in Table 2), P22M51-201, P15M48-54, TM2a, P22M51-165, P14M48- 120, TG551, P15M48-15xCD (= P15M48-155 in Table 2). Figure 6 shows a linkage map and QTL plots of the L. hirsutum QTLs as described herein. The map is an update to that of Figure 1, showing the genomic regions more clearly. All markers indicated as associated to the QTLs (those running from TG301 through to and including TG460 on Cl; those running from TG145 through to and including At5g64670 on C2; and those running from TG339 through to and including T1405 on C4) may be used as markers in aspects of the present invention. This updated version provides basis for preferred embodiments in aspects of the present invention.
DETAILED DESCRIPTION OF THE INVENTION Definitions
The headings provided herein are not limitations of the various aspects or embodiments of the invention that can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole. As used herein, the term "Botrytis" means Botrytis cinerea, also known as gray mold or gray spot, a disease commonly found on the stem, leaves and fruit of tomatoes. It is generally considered that the plant pathogenic fungus Sclerotinia sclerotiorum has an infection mechanism similar to that of B. cinerea (Prins et al., 2000). Although S. sclerotiorum-inϊection in tomato is economically far less important than B. eireereα-infection, both fungi secrete a spectrum of proteases, plant cell wall- degrading enzymes, toxins as well as oxalic acid. Some of these factors are known to play a role in the infection strategy of both fungi. As a result, the mechanisms and genes that confer resistance to Botrytis are believed to be equally effective in providing resistance to infection by S. sclerotiorum. Therefore, when reference is made herein to "Botrytis-vesistance", such resistance should be understood as including resistance to any fungus of the family of Sclerotiniαceαe, preferably resistance to S. sclerotiorum and B. cinerea, more preferably resistance to B. cinerea. As used herein, the term "allele(s)" means any of one or more alternative forms of a gene, all of which alleles relate to at least one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes. Since the present invention relates to QTLs, Le. genomic regions that may comprise one or more genes, but also regulatory sequences, it is in some instances more accurate to refer to "haplotype" (i.e. an allele of a chromosomal segment) in stead of "allele", however, in those instances, the term "allele" should be understood to comprise the term "haplotype".
A "gene" is defined herein as a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristics or trait in an organism.
A "locus" is defined herein as the position that a given gene occupies on a chromosome of a given species.
As used herein, the term "heterozygous" means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.
As used herein, the term "homozygous" means a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
As used herein, the term "hybrid" means any offspring of a cross between two genetically unlike individuals, including but not limited to the cross between two inbred lines.
As used herein, the term "inbred" means a substantially homozygous individual or line
In this application a "recombination event" is understood to mean a meiotic crossing-over. As used herein, the terms "introgression", "introgressed" and "introgressing" refer to both a natural and artificial process whereby genes of one species, variety or cultivar are moved into the genome of another species, variety or cultivar, by crossing those species. The process may optionally be completed by backcrossing to the recurrent parent. "Genetic engineering", "transformation" and "genetic modification" are all used herein as synonyms for the transfer of isolated and cloned genes into the DNA, usually the chromosomal DNA or genome, of another organism. As used herein, the term "molecular marker" refers to an indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences. Examples of such indicators are restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), microsatellite markers (e.g. SSRs), sequence-characterized amplified region (SCAR) markers, cleaved amplified polymorphic sequence (CAPS) markers or isozyme markers or combinations of the markers described herein which defines a specific genetic and chromosomal location.
The terms "resistant" and "resistance" encompass both partial and full resistance to infection. A Botryt is-susceptible tomato plant may either be non- resistant or have low levels of resistance to infection by Botrytis.
As used herein, the term "plant part" indicates a part of the tomato plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which tomato plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
As used herein, the term "population" means a genetically heterogeneous collection of plants sharing a common genetic derivation.
As used herein, the term "tomato" means any plant, line or population of Lycopersicon including but not limited to Lycopersicon cerasiforme, Lycopersicon cheesmanii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum (or Solanum lycopersicum), Lycopersicon hirsutum, Lycopersicon parυiflorum, Lycopersicon pennellii, Lycopersicon peruvianum, Lycopersicon pimpinelli folium, or Solanum lycopersicoides. Although Linnaeus first categorized the modern tomato as a Solanum, its scientific name for many years has been Lycopersicon esculentum. Similarly, the wild relatives of the modern tomato have been classified within the Lycopersicon genus, like L. pennellii, L. hirsutum, L. peruvianum, L. chilense, L. parυiflorum, L. chmielewskii, L. cheesmanii,
L. cerasiforme, and L. pimpinellifolium. Over the past few years, there has been debate among tomato researchers and botanists whether to reclassify the names of these species. The newly proposed scientific name for the modern tomato is Solanum Iy coper sicum. Similarly, the names of the wild species may be altered. L. pennellii may become Solanum pennellii, L. hirsutum may become S. habrochaites, L. peruvianum may be split into S. 'N peruυianum' and S. 'Callejon de Huayles', S. peruvianum, and S. corneliomuelleri, L. parυiflorum may become S.neorickii, L. chmielewskii may become S. chmielewskii, L. chilense may become S. chilense, L. cheesmaniae may become S. cheesinaniae or S. galapagense, and L. pimpinellifolium may become S. pimpinellifolium (Solanacea Genome Network (2005) Spooner and Knapp; http://www.sgn.cornell.edii/help/about/solanum nomenclature.html)
As used herein, the term "variety" or "cultivar" means a group of similar plants that by structural or genetic features and/or performance can be distinguished from other varieties within the same species.
The term "QTL" is used herein in its art-recognised meaning. The term "QTL associated with resistance to B. cinerea in tomato" as well as the shorter term "QTL for Bohytis-xesistance" refer to a region located on a particular chromosome of tomato that is associated with at least one gene that encodes for Boiryiis-resistance or at least a regulatory region, i.e. a region of a chromosome that controls the expression of one or more genes involved in Botrytis-xesistaxice. The phenotypic expression of that gene may for instance be observed as a reduced rate of lesion growth and/or as a reduced disease incidence. A QTL may for instance comprise one or more genes of which the products confer the genetic resistance. Alternatively, a QTL may for instance comprise regulatory genes or sequences of which the products influence the expression of genes on other loci in the genome of the plant thereby conferring the Botrytis-resistαnce. The QTLs of the present invention may be defined by indicating their genetic location in the genome of the respective wild Lycopersicon accession using one or more molecular genomic markers. One or more markers, in turn, indicate a specific locus. Distances between loci are usually measured by frequency of crossing- over between loci on the same chromosome. The farther apart two loci are, the more likely that a crossover will occur between them. Conversely, if two loci are close together, a crossover is less likely to occur between them. As a rule, one centimorgan (cM) is equal to 1% recombination between loci (markers). When a QTL can be indicated by multiple markers the genetic distance between the end-point markers is indicative of the size of the QTL. The term "Botrytis-susceptible recipient tomato plant" is used herein to indicate a tomato plant that is to receive DNA obtained from a donor tomato plant that comprises a QTL for Botiytis-resistsuice. Said " Botry tis-susceptible recipient tomato plant" may or may not already comprise one or more QTLs for Botrytis- resistance, in which case the term indicates a plant that is to receive an additional QTL.
The term "natural genetic background" is used herein to indicate the original genetic background of a QTL. Such a background may for instance be the genome of a Botiytis-resistance wild accession of tomato. For instance, the QTLs of the present invention were found at specific locations on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and chromosomes 3, 4 and 9 of Lycopersicon parviflorum Gl.1601. As an example, the Lycopersicon hirsutum LYC 4/78 represents the natural genetic background of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78. Also the Lycopersicon hirsutum LYC 4/78 represent the natural genetic background of said QTLs. Conversely, a method that involves the transfer of DNA comprising the QTL, or a resistance-conferring part thereof, from chromosomes 1 of Lycopersicon hirsutum LYC 4/78 to the same position on chromosome 1 of another tomato species, will result in that QTL, or said resistance-conferring part thereof, not being in its natural genetic background. The term "disease incidence" is defined herein as the parameter that reflects the capability of the plant to reduce the establishment of an infection and may for instance be established by determining the success of achieving infection of the plant upon contact with the infectious agent.
The term "rate of lesion growth" or "lesion growth rate" is defined herein as the parameter that reflects the capability of the plant to slow or reduce the progression of infection, and may for instance be established by determining the rate of growth of expanding lesions.
The term "quantitatively determining" is defined herein as establishing or assessing in a manner involving measurement, in particular the measurement of aspects measurable in terms of amounts and number. Determinations in degrees of severity and indications of greater, more, less, or equal or of increasing or decreasing magnitude, are not comprised in the present term "quantitatively determining", which term ultimately implies the presence of objective counting mechanism for determining absolute values. Therefore "quantitatively determining disease incidence and/or rate of lesion growth" preferably comprises determining the percentage of all potentially infectious contacts between plant and infectious agent that result in measurable lesions (in order to asses the disease incidence), and/or determining the increase in diameter, circumference, surface area or volume of one or more of said lesions over time under favourable conditions for fungal growth (in order to asses the rate of lesion growth).
The term "standard practice conditions", "standard greenhouse conditions" and "standard conditions" refer to the conditions of light, humidity, temperature, etc. where under plants are grown or incubated, for instance for the purpose of phenotypic characterization of disease resistance, as being standard. For greenhouses for instance, this refers to 16-h day, 15°C-25°C. More in general, the terms refer to standard and reference growth conditions with a photoperiod of 8 to 24 h (photosynthetic photon flux (PPF) 50 to 1000 μmol nr2 s"1), preferably a light regime of 16 hours light and 8 hours dark, an air temperature of about 190C during the day and 15°C at night, a water vapour pressure deficit of about 4.4 g m"3 corresponding to a relative humidity (RH) of about 60%-85%, at 600-700 ppm CO2 and atmospheric O2 concentration and at atmospheric air pressure (generany 1008 hPa). Water and nutrients may be given drop wise near the stem, or in the form of spray or mist. Standard bioassay experimentation conditions, such as stem lesion length assay, disease incidence and lesion growth rate measurements, are further specified in the Examples below. In more detail, the average stem lesion length assay is to be performed as described in Examples 3.10 and 3.11.
Identification of QTLs associated with resistance to Botrytis in tomato
It is known that wild Lycopersicon species provide suitable sources for disease and pest resistance traits and the presence of partial resistance to B. cinerea in leaves of wild Lycopersicon species has been documented (Urbasch, 1986). Two factors have hampered breeding for B. cinerea resistance in tomato in the past. Firstly, crossing partial resistance into commercial breeding lines has met with limited success.
Secondly, reliable and reproducible disease assays were lacking that would enable the identification and localization of genetic material responsible for conferring resistance. Urbasch (Urbason, 1986), for instance, infected leaves with mycelium using agar plugs providing the fungus with an excess of nutrients, which strongly affected the infection process. Other researchers have used subjective plant disease indices, which are unsuitable for quantitative analysis required for the identification of quantitative trait loci (QTLs).
Botrytis cinerea infection in Lycopersicon esculentum under laboratory conditions is relatively well studied (e.g. Benito et al., 1998). Droplet inoculation of leaves and subsequent incubation at moderate temperatures (15-200C) results in a rapid (16-24 h post-infection (hpi)) development of necrotic spots at the site of the inoculum. Infection is temporarily restricted at this point for approximately 48 h. From that moment onwards a proportion of the lesions (usually 5-10%) starts to expand. Outgrowth of these so called "expanding lesions" is accompanied by an increase in fungal biomass and results in colonisation of the complete leaflet in the following 48 h. The present inventors found that specific QTLs associated with Botrytis- resistance in tomato can be identified when a bioassay for measuring resistance is used wherein the rate of the progression of infection and or the success of achieving infection upon contact with the infectious agent are measured quantitatively on parts of the tomato plant, preferably on detached parts, more preferably on stem segments. It was surprisingly found that multiple QTLs for Boiryiis-resistance were present in the genomes of Botrytis-resistant tomato plants, whereas the prior art methods resulted in the tentative identification of only a single QTL for Bofrytis-xesist&nce. Moreover, the QTLs that were found by using these methods were located on chromosomes not previously associated with J3o£r;y£is-resistance of tomato plants and the QTLs were associated with various phenotypic manifestations of resistance.
Therefore, the methods of the present invention have provided the new insight that the genetic basis of Bot ry iis-resistance in tomato is polygenic.
For instance, it was found that genetic regions present on chromosome 2 and 4 of L. hirsutum LYC 4/78 were responsible for a reduced disease incidence, while a genetic region present on chromosome 1 was at least partially responsible for a reduced the rate of lesion growth. Similar genetic regions linked to these phenotypes were found to exist in L. parυiflorum Gl.1601, although these were not necessarily located on the same chromosomes. It was furthermore discovered that the new QTL regions were associated with higher levels of resistance than that associated with the QTL on chromosome 10 of the prior art. Thus, the method of the present invention is capable of uncovering major QTLs for Botrytis resistance that confer a level of resistance to the plant that is higher than previously attained. Thus, one advantage of the method of the present invention is that it results in the discovery of QTLs that are associated with higher levels of resistance to Botrytis. This level of resistance may be determined by any method available, such as by using the methods of the present invention or by using conventional methods of the prior art. A detailed description of experimental setup and conditions is provided in the Examples below.
A method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention, otherwise addressable as method for identifying or locating a quantitative trait locus (QTL), requires the availability of a (partially) Botrytis-resistant tomato plant. Such a plant may be provided by any means known in the art, and by using any method for the determination of the presence of said (partial) resistance in said plant. The provision of a (partially) Botrytis-xesistant tomato plant (which will further serve as a donor plant in a method of the present invention) enables the establishment or provision of chromosomal markers, preferably AFLP, CAPS and/or SCAR markers, most preferably CAPS and/or SCAR markers, for at least one, but preferably for all chromosome of said plant. By establishing a collection of chromosomal markers over the whole length of said chromosomes, the various locations of said chromosomes may effectively be marked. Such methods are well known in the art and exemplary methods will be described in more detail herein below. A method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention comprises as a first step the crossing of said (partially) Botrytis-xesistant donor tomato plant with a non- resistant, or Botrytis susceptible, recipient tomato plant in order to produce offspring plants. Subsequently one or more offspring plants are contacted with an infective amount of Botrytis. Such an amount may vary between plants and between fungal species tested. Usually an amount of about 1 to 10 to an amount of about 500-5000 conidia of said fungus will be sufficient. A subsequent step comprises quantitatively determining the disease incidence and/or the rate of lesion growth in one or more offspring plants produced from said cross. Said quantitative determination is preferably performed in multiple offspring plants. The offspring plants are preferably plants of the F2 population derived from a cross between a i?o£r;y£is-resistant donor tomato plant and a non-resistant or Botrytis- susceptible recipient tomato plant. Preferably, as the offspring, a segregating F2 population is used, more preferably, an F2 population derived from a cross between L. esculentum cv. Moneymaker and L. hirsutum LYC 4/78. In practice, Fi seed derived from said cross may be grown into Fi plants where after one single Fi plant is then selfed to produce F2 seed of which the subsequently derived F2 plants are used for the determination of the disease incidence and/or the rate of lesion growth in a method of the invention. Alternatively, F3 lines may be used for resistance assays.
The step of contacting one or more offspring plants with an infective amount of Botrytis and quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants is preferably performed as part of a resistance bioassay on stem segments or leaves as described herein, preferably a resistance bioassay on stem segments. The skilled person will understand that variations to these assays as described herein below are possible.
A resistance bioassay on stem segments may essentially be performed as follows: First, seeds for the offspring plants are planted and grown to seedlings/plants of suitably approximately 50 cm in height. The top 5-10 cm and bottom 5-10 cm of the stem of the plants may be removed and the remaining 30 cm may be cut into equal segments of 5-6 cm. The stem segments are preferably placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments are suitably sprayed with water in order to ensure an equal spread of the inoculum over the wound surface. Each stem segment may then be inoculated by a conidial suspension of B. cinerea. A suitable amount of inoculum, for instance one drop of about 5 μl, comprising approximately 10β conidia ml"1, may thereto be applied on the top of each stem segment. The stem segments are then incubated at a temperature of suitably about 160C, preferably in the dark, and preferably at high humidity (e.g. 100% RH). Infection progress may be determined quantitatively by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper. At a number of suitable time intervals, for instance at 96, 120 and 144 hours post-infection (hpi), the stems may then be inspected for lesion formation (disease incidence) and lesion growth, in a quantitative manner. Very suitable parameters comprise the measurement of the size of the lesion, for instance by using a caliper. In order to correct for variation caused by the season or cultivation of the plants, the quantitative measurements of the bioassays may be related to the comparable measurements in susceptible control or reference lines. The disease incidence may suitably be determined by dividing the total number of expanding lesions by the total number of inoculation droplets. The proportion of expanding lesions on a particular genotype may then be divided by the proportion of expanding lesions observed in a control or reference genotype and expressed as a percentage. Alternatively, or additionally, lesion growth rates may be determined by calculating the increase in lesion size (e.g. in mm) over a suitable period, for instance over a 24 h period. Data for the non-expanding lesions may be deleted from the quantitative analysis. The lesion growth rate obtained may then optionally be divided by the lesion growth rate observed in a control or reference genotype and expressed as a percentage or as an absolute figure, for instance in millimetres.
Alternatively, plants can be screened by using a leaf infection bioassay as follows: First, tomato seeds are planted and grown to seedlings/plants. For each individual plant one or two compound leaves may be cut from the main stem and transferred to pre-wetted florist foam. The florist foam is then placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. A suitable inoculum comprising B. dnerea conidia may be prepared by methods known in the art, for instance as described by Benito et al., 1998. The compound leaves are then inoculated with the conidial suspension of B. dnerea by placing a number of droplets, suitably for instance 6 to 10 droplets of 2 μl each, onto the upper surface of the leaves. The container is then closed and the leaves are incubated at a temperature of suitably between 15°C-20°C, preferably in the dark, and preferably at high humidity. At a number of suitable time intervals, for instance at 96, 120 and 144 hpi, the leaves may then be inspected for disease incidence and lesion growth, in a quantitative manner as described above for the stem bioassay.
A method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention further comprises the steps of establishing a genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants and assigning contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced rate of lesion growth to a quantitative trait locus. A genetic linkage map that links the observed disease incidence and/or the rate of lesion growth with the presence of chromosomal markers of the donor tomato plant in said one or more offspring plants may be established by any method known in the art. The skilled person is aware of methods for identifying molecular markers linked to resistance quantitative trait loci (QTLs) and the mapping of these markers on a genetic linkage map (see e.g. Bai et al., 2003; Foolad et al., 2002; van Heusden et al., 1999). The association between the J3o£?;y£is-resistant phenotype and marker genotype may suitably be performed by using such software packages as JoinMap® and MapQTL® (see Examples) or any standard statistical package which can perform analysis of variance analysis. The molecular markers can be used to construct genetic linkage maps and to identify quantitative trait loci (QTLs) for Botrytis resistance.
Suitable types of molecular markers and methods for obtaining those are described in more detail herein below.
A method for detecting a quantitative trait locus (QTL) associated with resistance to Botrytis in tomato according to the present invention may further be improved by reducing experimental variation in the bioassay and/or by the construction of a complete backcross inbred population (BIL). By using such a BIL line in combination with the methods of the present invention, the quantitative resistance to B. cinerea may be assessed even more precisely and additional QTLs may be identified.
Molecular Markers and QTLs
Molecular markers are used for the visualisation of differences in nucleic acid sequences. This visualisation is possible due to DNA-DNA hybridisation techniques (RFLP) and/or due to techniques using the polymerase chain reaction (e.g. STS, microsatellites, AFLP). All differences between two parental genotypes will segregate in a mapping population (e.g., BCi, F2; see Figure 2) based on the cross of these parental genotypes. The segregation of the different markers may be compared and recombination frequencies can be calculated. The recombination frequencies of molecular markers on different chromosomes is generally 50%. Between molecular markers located on the same chromosome the recombination frequency depends on the distance between the markers. A low recombination frequency corresponds to a low distance between markers on a chromosome. Comparing all recombination frequencies will result in the most logical order of the molecular markers on the chromosomes. This most logical order can be depicted in a linkage map (Paterson, 1996). A group of adjacent or contiguous markers on the linkage map that is associated to a reduced disease incidence and/or a reduced lesion growth rate pinpoints the position of a QTL. Upon the identification of the QTL, the QTL effect (the resistance) may for instance be confirmed by assessing .Boiryiis-resistance in BC2S1 progenies segregating for the QTLs under investigation. The assessment of the Botrytis resistance may suitably be performed by using a stem or leaf bioassay as described herein.
The QTLs for resistance against Botrytis in tomato obtainable by using a method of the invention are an aspect of the present invention. A characteristic of such QTLs is that, when present in plants, they are indicative of the presence of a reduced disease incidence and/or a reduced lesion growth rate upon contacting said plant with infective amount of Botrytis material, which material may be provided in any form, such as in the form of conidia or mycelium. The present invention also relates to a QTL for resistance against Botrytis in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parυiflorum Gl.1601 associated with Botrytis resistance. These QTLs may be more clearly defined or indicated by the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6. Table 1 and Figures 1 and 6 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L.hirsutum LYC 4/78. Table 2 and Figure 5 indicate the QTLs found in the F2 population derived from the cross of L. esculentum cv. Moneymaker x L. parυiflorum Gl.1601. In both tables, the genomic region where the QTLs are located is indicated by the AFLP-markers listed. The QTLs of the present invention comprise genetic information in the form of DNA responsible for conferring (partial) Botrytis disease incidence or a reduced rate of Botrytis lesion growth in a tomato plant. The genetic information may for instance comprise a gene or a regulatory element.
Table 1. QTLs found in offspring of a cross of L. esculentum cv. Moneymaker x L. hirsutum LYC 4/78 and related quantitative resistance information.
Figure imgf000025_0001
1 marker nomenclature: e.g. P-GT M-GAT - 412h, wherein P and M are the common Pstl and Msel primer sequences or universal primers (Vos et al., 1995; Bai et al. 2003) followed by 2 or 3 extra selective bases as indicated by a two digit extension code. 412 is the approximated size in basepairs of the resulting polymorphic fragment (given size ± 2 basepairs). The size is normally rounded off but may also be given in decimals. This fragment is amplified in either L. esculentum cv Moneymaker (e) or L. hirsutum LYC 4/78 (h). Primer and adapter sequences are described in detail by Bai et al. 2003.
2 Codes by which the AFLP primer combination is commonly indicated. For P, M see marker nomenclature. Two digit extension codes are as follows: 14: AT; 15: CA; 18- CT; 22: GT; 48: CAC; 49: CAG; 50: CAT; 51: CCA; 60: CTC; 61: CTG. 3 aa, marker homozygous L. esculentum; ab, marker heterozygous; bb, marker homozygous wild relative L. hirsutum LYC 4/78.
4 Disease incidence and lesion growth are determined using methods as explained in detail in the Examples. 5 CT128 (see Table 25) is a marker located on chromosome 2 position 44 cM on the Tanksley map (Tanksley et al. 1992).
6 TG609 (see Table 20) is an RFLP Marker located on chromosome 4 position 38 cM on the Tomato-EXPEN 1992 composite map based on a S. lycopersicum cv. VF36 x S. pennellii LA716 F2 population (Tanksley et al. 1992).
Most reliably, the genomic region where QTL-Ih is located is positioned between markers TG301 (Table 11) and TG460.61 (Table 12) as shown in Figure 6. Therefore, any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as well as any marker known to be located in that region based on publicly available information, such as from consensus maps Tomato-EXPEN 1992 (Tanksley et al, 1992), Tomato-EXHTR 1997 (Bernacchi and Tanksley, 1997), Tomato-EXPEN 2000 (Fulton et al, 2002) or Tomato-EXPIMP 2001 (Grandillo and Tanksley, 1996; Tanksley et al. 1996, Doganlar et al. 2002). Most preferred regions are indicated by a bar in Figure 6. Most reliably, the genomic region where QTL-2h is located is positioned between markers TG145 (Table 15) and At5g64670 (Table 19) as shown in Figure 6. Therefore, any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as well as any marker known to be located in that region based on publicly available information. Most preferred regions are indicated by a bar in Figure 6.
Most reliably, the genomic region where QTL-4h is located is positioned between markers TG609 (Table 20) and C2Atlg74970 (Table 24) as shown in Figure 6. Therefore, any marker located within that region may be used to assess the presence of the QTL in the genome of a plant, as' well as any marker known to be located in that region based on publicly available information. Table 2. QTLs found in offspring of a cross of L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 and related quantitative resistance information.
Figure imgf000027_0001
1 marker nomenclature: e.g. P-CA M-CAC - 234p, wherein P, M and E are the common Pstl, EcόRI and Mseϊ primer sequences or universal primers (Vbs et al., 1995; Bai et al. 2003) followed by 2 or 3 extra selective bases as indicated. 234 is the approximated size in base pairs of the resulting polymorphic fragment (given size ± 2 base pairs). This fragment is amplified in either L. esculentum cv Moneymaker (e) or L. parviflorum Gl.1601 (p). Primer and adapter sequences are described in detail by Bai et al. 2003.
2 Codes by which the AFLP primer combination is commonly indicated. For P, M see marker nomenclature. 3 aa, marker homozygous L. esculentum; b-, one allele wild relative (here L. parviflorum) and the other allele can be either L. esculentum or wild relative.
Most reliably, the genomic region where QTL-3p is located is indicated by markers P15M48-234, P18M50-167, TG599, P18M51-486, P22M50-151 and P14M60- 65.
Most reliably, the genomic region where QTL-4p is located is indicated by markers P14M48-158 and P14M48-34xCD (= P14M48-349 in Table 2).
Most reliably, the genomic region where QTL-9p is located is indicated by markers TGlO, P22M50-56, P14M48-56, P14M50-82, P14M50-204, P15M48-138 (= P15M48-137 in Table 2), P14M50-174 (=P14M50-176 in Table 2), P22M51-201,
P15M48-54, TM2a, P22M51-165, P14M48-120, TG551, P15M48-15xCD (= P15M48- 155 in Table 2).
All markers for the QTLs found in offspring of a cross of L. esculentum cv. Moneymaker x L. parviflorum Gl.1601 as described herein, as well as any marker known to be located in that region based on publicly available information may be used in aspects of the present invention. Preferably, a QTL of the present invention comprises at least one marker of Table 1 or 2 or as indicated in Figures 1, 5 or 6 associated with said QTL. Because the nucleic acid sequence of the QTL that is responsible for conferring the Botrytis resistance may only be a fraction of the entire QTL herein identified, the markers merely indicate linked inheritance of genetic regions or the absence of observed recombination within such genetic regions. Therefore, it is noted that the markers listed in Tables 1 and 2 and as indicated in Figures 1, 5 and 6 indicate the chromosomal region where a QTL of the invention is located in the genome of the specified Lycopersicon lines and that those markers do not necessarily define the boundaries or the structure of that QTL. Thus, the part of the QTL that comprises the essential resistance-conferring nucleic acid sequence(s) may be considerably smaller than that indicated by the contiguous markers listed for a particular QTL. Such a part is herein referred to as a "resistance-conferring part" of a QTL. As a result a resistance-conferring part of a QTL need not necessarily comprise any of said listed markers. Also other markers may be used to indicate the various QTLs, provided that such markers are genetically linked to the QTLs and the skilled person may find or use a QTL that is analogous to those of the present invention, but wherein one or more markers listed in table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL are absent.
A jBofryfϊs-resistance-conferring part of a QTL for resistance against Botrytis in tomato may be identified by using a molecular marker technique, for instance with one or more of the markers for a QTL shown in Table 1 or 2 or indicated in Figures 1, 5 or 6 as being linked to said QTL, preferably in combination with a resistance bioassay. Tomato plants that do not comprise a Boiryiis-resistance-conferring part of a QTL of the present invention are relatively susceptible to infection by Botrytis.
The markers provided by the present invention may very suitably be used for detecting the presence of one or more QTLs of the invention in a suspected Botrytis- resistant tomato plant, and may therefore be used in methods involving marker- assisted breeding and selection of Botrytis resistant tomato plants. Preferably, detecting the presence of a QTL of the invention is performed with at least one of the markers for a QTL shown in Table 1 or 2 or as indicated in Figures 1, 5 or 6 as being linked to said QTL. The present invention therefore relates in another aspect to a method for detecting the presence of a QTL for Botiytis-Yesistance, comprising detecting the presence of a nucleic acid sequence of said QTL in a suspected Botrytis- resistant tomato plant, which presence may be detected by the use of the said markers. The nucleic acid sequence of a QTL of the present invention may be determined by methods known to the skilled person. For instance, a nucleic acid sequence comprising said QTL or a resistance-conferring part thereof may be isolated from a Botrytis-resistant donor plant by fragmenting the genome of said plant and selecting those fragments harboring one or more markers indicative of said QTL. Subsequently, or alternatively, the marker sequences (or parts thereof) indicative of said QTL may be used as (PCR) amplification primers, in order to amplify a nucleic acid sequence comprising said QTL from a genomic nucleic acid sample or a genome fragment obtained from said plant. The amplified sequence may then be purified in order to obtain the isolated QTL. The nucleotide sequence of the QTL, and/or of any additional markers comprised therein, may then be obtained by standard sequencing methods.
The present invention therefore also relates to an isolated nucleic acid (preferably DNA) sequence that comprises a QTL of the present invention, or a Boiryiis-resistance-conferring part thereof. Thus, the markers that pinpoint the various QTLs described herein may be used for the identification, isolation and purification of one or more genes from tomato that encode for Botrytis resistance.
The nucleotide sequence of a QTL of the present invention may for instance also be resolved by determining the nucleotide sequence of one or more markers associated with said QTL and designing internal primers for said marker sequences that may then be used to further determine the sequence the QTL outside of said marker sequences. For instance the nucleotide sequence of the AFLP markers from Tables 1 and 2 may be obtained by isolating said markers from the electrophoresis gel used in the determination of the presence of said markers in the genome of a subject plant, and determining the nucleotide sequence of said markers by for instance dideoxy chain terminating methods, well known in the art.
In embodiments of such methods for detecting the presence of a QTL in a suspected Botrytis-resistant tomato plant, the method may also comprise the steps of providing a oligonucleotide or polynucleotide capable of hybridizing under stringent hybridization conditions to a nucleic acid sequence of a marker linked to said QTL, preferably selected from the markers of Tables 1 and 2 and as indicated in Figures 1, 5 or 6 as being linked to said QTL, contacting said oligonucleotide or polynucleotide with a genomic nucleic acid of a suspected Botryt is-resistant tomato plant, and determining the presence of specific hybridization of said oligonucleotide or polynucleotide to said genomic nucleic acid. Preferably said method is performed on a nucleic acid sample obtained from said suspected Botrytis-resistant tomato plant, although in situ hybridization methods may also be employed. Alternatively, and in a more preferred embodiment, the skilled person may, once the nucleotide sequence of the QTL has been determined, design specific hybridization probes or oligonucleotides capable of hybridizing under stringent hybridization conditions to the nucleic acid sequence of said QTL and may use such hybridization probes in methods for detecting the presence of a QTL of the invention in a suspected .Boirytis-resistant tomato plant. The phrase "stringent hybridization conditions" refers to conditions under which a probe or polynucleotide will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to essentially no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Thijssen, 1993). Generally, stringent conditions are selected to be about 5-100C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 300C for short probes (e.g., 10 to 50 nucleotides) and at least about 6O0C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions are often: 50% formamide, δxSSC, and 1% SDS, incubating at 42°C, or, 5xSSC, 1% SDS, incubating at 650C, with wash in 0.2xSSC, and 0.1% SDS at 650C. For PCR, a temperature of about 36°C is typical for low stringency amplification, although annealing temperatures may vary between about 32°C and 480C depending on primer length. Additional guidelines for determining hybridization parameters are provided in numerous references, e.g. Current Protocols in Molecular Biology, eds. Ausubel, et al. 1995).
"Nucleic acid" or "oligonucleotide" or "polynucleotide" or grammatical equivalents used herein means at least two nucleotides covalently linked together. Oligonucleotides are typically from about 7, 8, 9, 10, 12, 15, 1820 25, 30, 40, 50 or up to about 100 nucleotides in length. Nucleic acids and polynucleotides are a polymers of any length, including longer lengths, e.g., 200, 300, 500, 1000, 2000, 3000, 5000, 7000, 10.000, etc. A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some cases, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphophoroamidite linkages (see Eckstein, 1991), and peptide nucleic acid backbones and linkages. Mixtures of naturally occurring nucleic acids and analogs can be used. Particularly preferred analogs for oligonucleotides are peptide nucleic acids (PNA).
Production of jfo£ryfe-resistant tomato plants by transgenic methods
According to another aspect of the present invention, a nucleic acid (preferably DNA) sequence comprising at least one QTL of the present invention or a Botrytis- resistance-coήferring part thereof, may be used for the production of a Botrytis- resistant tomato plant. In this aspect, the invention provides for the use of a QTL of to the present invention or Botryt is-resistanee-conferring parts thereof, for producing a Botrytis-vesist&nt tomato plant, which use involves the introduction of a nucleic acid sequence comprising said QTL in a Boiryiis-susceptible recipient tomato plant. As stated, said nucleic acid sequence may be derived from a suitable Botrytis-resist&nt donor tomato plant. Two suitable J3o£ry£is-resistant donor tomato plants capable of providing a nucleic acid sequence comprising at least one of the hereinbefore described QTLs, or Bofryiis-resistance-conferring parts thereof, are L. hirsutum LYC 4/78 and L. parviflorum Gl.1601. Other related tomato plants that exhibit resistance to Botrytis and comprise one or more genes that encode for Botrytis resistance may also be utilized as JSoiryiis-resistance donor plants as the present invention describes how this material may be identified. Other accessions of tomato species can be examined for .Boiryiis-resistance including, but not limited to, Lycopersicon cerasiforme, Lycopersicon cheesmanii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon parviflorum, Lycopersicon pennellii, Lycopersicon peruvianum, Lycopersicon pimpinellifolium and Solanum lycopersicoides.
Once identified in a suitable donor tomato plant, the nucleic acid sequence that comprises a QTL for Botrytis-resistance according to the present invention, or a βo£r,y£is-resistance-coriferring part thereof, may be transferred to a suitable recipient plant by any method available. For instance, the said nucleic acid sequence may be transferred by crossing a .Bofryiis-resistance donor tomato plant with a susceptible recipient tomato plant (i.e. by introgression), by transformation, by protoplast fusion, by a doubled haploid technique or by embryo rescue or by any other nucleic acid transfer system, optionally followed by selection of offspring plants comprising the QTL and exhibiting jBo£ry£ϊs-resistance. For transgenic methods of transfer a nucleic acid sequence comprising a QTL for jBoiryfis-resistance according to the present invention, or a jBoiry&s-resistance-conferring part thereof, may be isolated from said donor plant by using methods known in the art and the thus isolated nucleic acid sequence may be transferred to the recipient plant by transgenic methods, for instance by means of a vector, in a gamete, or in any other suitable transfer element, such as a ballistic particle coated with said nucleic acid sequence.
Plant transformation generally involves the construction of an expression vector that will function in plant cells. In the present invention, such a vector comprises a nucleic acid sequence that comprises a QTL for Botrytis-resistance of the present invention, or a .Bofryiis-resistance-conferring part thereof, which vector may comprise a .Bofryiis-resistance-conferring gene that is under control of or operatively linked to a regulatory element, such as a promoter. The expression vector may contain one or more such operably linked gene/regulatory element combinations, provided that at least one of the genes contained in the combinations encodes for Botrytis- resistance. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, to provide transgenic plants that are resistant to Botrytis, using transformation methods known in the art, such as the Agrobacterium transformation system.
Expression vectors can include at least one marker gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the marker gene). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection. Alternatively, marker-less transformation can be used to obtain plants without mentioned marker genes, the techniques for which are known in the art. One method for introducing an expression vector into a plant is based on the natural transformation system of Agrobacterium (see e.g. Horsch et al., 1985). A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria that genetically transform plant cells. The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant (see e.g. Kado, 1991). Methods of introducing expression vectors into plant tissue include the direct infection or co-cultivation of plant cells with Agrobacterium tumefaciens (Horsch et al., 1985). Descriptions of Agrobacterium vectors systems and methods for Agroόαctenum-mediated gene transfer provided by Gruber and Crosby, 1993 and Moloney et al., 1989. See also, U. S. Pat. No. 5,591,616. General descriptions of plant expression vectors and reporter genes and transformation protocols and descriptions of Agrobacterium, vector systems and methods for Agrobacterium-meάiated gene transfer can be found in Gruber and Crosby, 1993. General methods of culturing plant tissues are provided for example by Miki et al., 1993 and by Phillips, et al., 1988. A proper reference handbook for molecular cloning techniques and suitable expression vectors is Sambrook and Russell (2001).
Another method for introducing an expression vector into a plant is based on microprojectile-mediated transformation wherein DNA is carried on the surface of microprojectiles. The expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes (See, Sanford et al., 1987, 1993; Sanford, 1988, 1990; Klein et al.,1988, 1992). Another method for introducing DNA to plants is via the sonication of target cells (see Zhang et al., 1991). Alternatively, liposome or spheroplast fusion has been used to introduce expression vectors into plants (see e.g. Deshayes et al., 1985 and Christou et al., 1987). Direct uptake of DNA into protoplasts using CaCb precipitation, polyvinyl alcohol or poly-L- ornithine has also been reported (see e.g., Hain et al. 1985 and Draper et al., 1982). Electroporation of protoplasts and whole cells and tissues has also been described (D'Halluin et al, 1992 and Laursen et al., 1994).
Following transformation of tomato target tissues, expression of the above described selectable marker genes allows for preferential selection of transformed cells, tissues and/or plants, using regeneration and selection methods now well known in the art. The markers of Tables 1 or 2 may also be used for that purpose.
Production of Botrytis-xesistant tomato plants by non-transgenic methods
In an alternative embodiment for producing a I?θi£ry£is-resistant tomato plant, protoplast fusion can be used for the transfer of nucleic acids from a donor plant to a recipient plant. Protoplast fusion is an induced or spontaneous union, such as a somatic hybridization, between two or more protoplasts (cells of which the cell walls are removed by enzymatic treatment) to produce a single bi- or multi-nucleate cell. The fused cell, that may even be obtained with plant species that cannot be interbreeded in nature, is tissue cultured into a hybrid plant exhibiting the desirable combination of traits. More specifically, a first protoplast can be obtained from a tomato plant or other plant line that exhibits resistance to infection by Botrytis. For example, a protoplast from L. hirsutum LYC 4/78 can be used. A second protoplast can be obtained from a second tomato or other plant variety, preferably a tomato line that comprises commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc. The protoplasts are then fused using traditional protoplast fusion procedures, which are known in the art.
Alternatively, embryo rescue may be employed in the transfer of a nucleic acid comprising one or more QTLs of the present invention from a donor plant to a recipient plant. Embryo rescue can be used as a procedure to isolate embryo's from crosses wherein plants fail to produce viable seed. In this process, the fertilized ovary or immature seed of a plant is tissue cultured to create new plants (Pierik, 1999).
The present invention also relates to a method of producing a J3o£ry£is-resistant tomato plant comprising the steps of performing a method for detecting the presence of a quantitative trait locus (QTL) associated with resistance to B. cinerea in a donor tomato plant according to invention as described above, and transferring a nucleic acid sequence comprising at least one QTL thus detected, or a Bot ryt is-resistance- conferring part thereof, from said donor plant to a .Boiry^s-susceptible recipient tomato plant. The transfer of said nucleic acid sequence may be performed by any of the methods previously described herein.
A preferred embodiment of such a method comprises the transfer by introgression of said nucleic acid sequence from a Botrytis-resistant donor tomato plant into a .Boiryiis-susceptible recipient tomato plant by crossing said plants. This transfer may thus suitably be accomplished by using traditional breeding techniques. QTLs are preferably introgressed into commercial tomato varieties by using marker- assisted breeding (MAS). Marker- assisted breeding or marker-assisted selection involves the use of one or more of the molecular markers for the identification and selection of those offspring plants that contain one or more of the genes that encode for the desired trait. In the present instance, such identification and selection is based on selection of QTLs of the present invention or markers associated therewith. MAS can also be used to develop near-isogenic lines (NIL) harboring the QTL of interest, allowing a more detailed study of each QTL effect and is also an effective method for development of backcross inbred line (BIL) populations (see e.g. Nesbitt et αl., 2001; van Berloo et αl., 2001). Tomato plants developed according to this preferred embodiment can advantageously derive a majority of their traits from the recipient plant, and derive .Bo£ry£is-resistance from the donor plant.
Since it is now found that resistance to B cinereα is inherited polygenically, it is preferred that at least two, preferably three QTLs or .Bofryiϊs-resistance-conferring parts thereof, are inserted by a suitable transfer method into a single recipient plant, i.e. that multiple QTLs are stacked in the recipient plant's genome. It is believed that stacking of two or more QTLs of the invention may lead to increased resistance to Botrytis. As the skilled person will readily understand, stacking may be achieved by any method, for instance by transforming a plant with a nucleic acid construct comprising multiple QTLs of the invention. Alternatively, at least one QTL may be present in each parent plant of a cross, so that at least two QTLs are comprised in the resulting hybrid. By stacking of these resistance traits highly resistant plants may be obtained. Such plants are highly preferred embodiments of the present invention. As discussed briefly above, traditional breeding techniques can be used to introgress a nucleic acid sequence encoding for Botrytis resistance into a Botrytis- susceptible recipient tomato plant. In one method, which is referred to as pedigree breeding, a donor tomato plant that exhibits resistance to Botrytis and comprising a nucleic acid sequence encoding for Botrytis resistance is crossed with a Botrytis- susceptible recipient tomato plant that preferably exhibits commercially desirable characteristics, such as, but not limited to, disease resistance, insect resistance, valuable fruit characteristics, etc. The resulting plant population (representing the Fi hybrids) is then self-pollinated and set seeds (F2 seeds). The Fs plants grown from the F2 seeds are then screened for resistance to Botrytis. The population can be screened in a number of different ways.
First, the population can be screened using a traditional disease screen. Such disease screens are known in the art. Preferably a quantitative stem or leaf infection bioassay is used, preferably the stem bioassay used in methods of the present invention as outlined in more detail hereinabove and the Examples is used. Second, marker-assisted selection can be performed using one or more of the hereinbefore- described molecular markers to identify those progeny that comprise a nucleic acid sequence encoding for Botrytis-vesistance. Other methods, referred to hereinabove by methods for detecting the presence of a QTL may be used. Also, marker-assisted selection can be used to confirm the results obtained from the quantitative bioassays, and therefore, several methods may also be used in combination.
23o£ry^s-resistant tomato plants and seeds
A Botrytis-resistaxit tomato plant of the present invention is characterized by having a high level of resistance. This is defined as being a resistance level that is higher than that observed for susceptible control plants. In fact, the plants of the invention have a level of resistance that is higher than that of any commercial tomato variety, i.e. a variety having commercially desirable characteristics, known to date. A plant of the invention has a susceptibility to Botrytis cinerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay. For instance when measured by a bioassay wherein the average length of a stem lesion resulting from Botrytis cinerea infection in adult plants is measured during a three week period under standard practice conditions as described in more detail in the Examples 3.10 and 3.11. Typically, a plant of the invention has a level of resistance that results in an average stem lesion length of Botrytis cinerea lesions in adult plants of less than 3.2 cm three weeks after inoculation using standard practice conditions in a resistance bioassay designed to determine resistance based on such characteristics. More typically, a plant of the invention shows an average stem lesion length of less than 2.9 cm. Some plants of the invention even show an average stem lesion length of 2.0 cm. Taking into account that said numbers express the length of a lesion including the 2 cm initial inoculation wound, it can be inferred that a high level of resistance, and even full resistance in the case of some QTLs, is observed in plants of the invention. In comparison, susceptible control plants show a mean average stem lesion length under the same conditions of about 3.6 cm to about 6.0 cm, with an average of 4.85 cm (see Table 10). Also as a comparison, L. hirsutum LA 1777, the QTL-IO containing partially Botrytis resistant source of WO02/085105, shows an average stem lesion length under the same conditions of about 4.3 cm. In summary, the plants of the invention show net stem lesions in the above referred resistance bioassay that are generally less than about 30% (0.9/2.85 xlOO%) of the net length of susceptible control plants, and generally less than about 40% (0.9/2.3 x 100%) of the net length of partially resistant L. hirsutum LA 1777.
Thus, a plant of the present invention has a susceptibility to Botrytis cinerea when measured by a bioassay which is 3 times lower than, or which is less than 1/3 the level of, a susceptible control plant. Reciprocally, a plant of the invention is more than 3 times more resistant than a susceptible control plant, as defined herein and determined with the bioassay as described. With some QTLs or combinations of QTLs (e.g. QTL-Ih and the combinations of QTL-3p+QTL-4p or QTL-9p+QTL-4p) full resistance is observed (See Table 10). A susceptible control plant is defined as a plant showing normal susceptibility, or no resistance, to Botrytis cinerea infection. Examples of susceptible control plants are the hybrid Lycopersicon esculentum cv. "Tradiro", and Lycopersicon esculentum cv. "Moneyberg" (De Ruiter Seeds CV, Bergschenhoek, The Netherlands).
A Bot ryiis-resistant tomato plant, or a part thereof, obtainable by a method of the invention is also an aspect of the present invention. Another aspect of the present invention relates to a Botrytis-vesistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a Botrytis- resistance-conferring part thereof, selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon pαrυiflorum Gl.1601 associated with Botrytis resistance, wherein said QTL or said Boiryiis-resistance-conferring part thereof is not in its natural genetic background. The Botrytis-resistant tomato plants of the present invention can be of any genetic type such as inbred, hybrid, haploid, dihaploid, parthenocarp or transgenic. Further, the plants of the present invention may be heterozygous or homozygous for the resistance trait, preferably homozygous. Although the QTLs of the present invention, as well as those QTLs obtainable by a method of the invention, as well as jBo£ry£ts-resistance-conferring parts thereof may be transferred to any plant in order to provide for a .Boiryiϊs-resistant plant, the methods and plants of the invention are preferably related to plants of the Solαnαceαe family, more preferably tomato. Inbred Botrytis-resistant tomato plant lines can be developed using the techniques of recurrent selection and backcrossing, selling and/or dihaploids or any other technique used to make parental lines. In a method of selection and backcrossing, Botrytis-xesistance can be introgressed into a target recipient plant (which is called the recurrent parent) by crossing the recurrent parent with a first donor plant (which is different from the recurrent parent and referred to herein as the "non-recurrent parent"). The recurrent parent is a plant that is non-resistant or has a low level of resistance to Botrytis and possesses commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc. The non-recurrent parent exhibits Botrytis resistance and comprises a nucleic acid sequence that encodes for Botrytis resistance. The non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent. The progeny resulting from a cross between the recurrent parent and non-recurrent parent are backcrossed to the recurrent parent. The resulting plant population is then screened. The population can be screened in a number of different ways. For instance, the population can be screened using a stem quantitative bioassays as described previously herein. Fi hybrid plants that exhibit a .Bo£ry£is-resistant phenotype comprise the requisite nucleic acid sequence encoding for Botrytis resistance, and possess commercially desirable characteristics, are then selected and selfed and selected for a number of generations in order to allow for the tomato plant to become increasingly inbred. This process of continued selfing and selection can be performed for two to five or more generations. The result of such breeding and selection is the production of lines that are genetically homogenous for the genes associated with Botrytis resistance as well as other genes associated with traits of commercial interest. In stead of using phenotypic pathology screens of bioassays, MAS can be performed using one or more of the hereinbefore described molecular markers, hybridization probes or polynucleotides to identify those progeny that comprise a nucleic acid sequence encoding for .Bo^ry^s-resistance. Alternatively, MAS can be used to confirm the results obtained from the quantitative bioassays. Once the appropriate selections are made, the process is repeated. The process of backcrossing to the recurrent parent and selecting for jBo£ry£ϊs-resistance is repeated for approximately five or more generations. The progeny resulting from this process are heterozygous for one or more genes that encode for J3o£ry£is-resistance. The last backcross generation is then selfed in order to provide for homozygous pure breeding progeny for -Bo£ry£ϊs-resistance.
The Bot ryiis-resistant inbred tomato lines described herein can be used in additional crossings to create Botrytis-resistant hybrid plants. For example, a first Botryt is-resistant inbred tomato plant of the invention can be crossed with a second inbred tomato plant possessing commercially desirable traits such as, but not limited to, disease resistance, insect resistance, desirable fruit characteristics, etc. This second inbred tomato line may or may not be JBo.r^tis-resistant.
Another aspect of the present invention relates to a method of producing seeds that can be grown into Botrytis-xesi&tant tomato plants. In one embodiment, the method comprises the steps of providing a Botrytis-resistant tomato plant of the invention, crossing said Botrytis-resistant plant with a Lycopersicon esculentum plant, and collecting seeds resulting from said cross, which when planted, produce Botrytis- resistant tomato plants. In another embodiment, the method comprises the steps of providing a Botiytis-vesistant tomato plant of the invention, crossing said .BoJryiis-resistant plant with a Lycopersicon esculentum plant, collecting seeds resulting from said cross, regenerating said seeds into plants, selecting jBoiryiis-resistant plants by any of the methods described herein, self-crossing the selected plants for a sufficient number of generations to obtain plants that are fixed for an allele that confers Botrytis- resistance in the plants, backcrossing the plants thus produced with L. esculentum plants having desirable phenotypic traits for a sufficient number of generations to obtain L. esculentum plants that are Botrytis-resistant and have desirable phenotypic traits, and collecting the seeds produced from the plants resulting from the last backcross, which when planted, produce tomato plants which are Soir^iis-resistant.
By way of example, and not of limitation, Examples of the present invention will now be given.
EXAMPLES
Example 1. Method of identifying plants resistant to Botrytis cinereα. 1.1. Introduction.
This Example presents the development of a quantitative bioassay for evaluating the resistance to Botrytis cinereα of a collection of wild tomato genotypes.
Partial resistance against Botrytis cinereα has been reported in wild Lycopersicon species, but these reports have largely been descriptive and qualitative. The identification of partially resistant genotypes would provide perspectives to introgress resistance into commercial breeding lines to obtain lines with manageable resistance levels. The availability of a reproducible, objective and quantitative assay, as well as the identification of genotypes with a genetically determined (partial) grey mould resistance opens the way for resistance breeding in cultured tomato varieties.
The present Example describes a quantitative disease assay. The assay is applied on leaves (leaf inoculation assay) and stem segments (stem inoculation assay). Two parameters for disease susceptibility were examined. The first parameter was the disease incidence (DI), i.e. the proportion of inoculation droplets that resulted in an expanding lesion. If the (partial) failure of a primary S. cinereα lesion to expand on a particular host genotype is a genetic trait of the plant, such a trait is important as it directly limits the number of disease foci in the crop. The second parameter tested was the lesion growth rate over a period of 24 h (lesion growth, LG). Lesions that expanded from the primary inoculation spot appeared to spread at an even rate (in mm/day) over time until the lesion reached the edge of the leaf or the bottom end of the stem segment. The present assays enable the quantification of both the occurrence (disease incidence) and development (lesion growth) of B. cinerea infection, resulting in two sets of quantitative trait data. The assay was used to screen a collection of Lycopersicon species (hereinafter also termed "accessions") for the presence of resistance therein.
1.2. Plants
Plant genotypes tested are listed in Table 3.
Table 3: List of Lycopersicon genotypes tested.
Figure imgf000042_0001
1 DRS: De Ruiter Seeds, Bergschenhoek, The Netherlands; WU PPW: Plantkundig Proefcentrum Wageningen, Wageningen University, Wageningen, The Netherlands; LoPB: Laboratory of Plant Breeding, Wageningen University, Wageningen, The Netherlands; MPIZK: Max Planck Institut fur Zύchtungsforschung an Kulturpflanze, Kδln, Germany; TGRC: Tomato Genetics Resource Center, University of California at Davis, Davis CA, USA; IPK: Institut fur Pflanzengenetik und Kulturpflanzenforschung, Gatersleben, Germany.
2 Y indicates that the genotype was tested in the particular assay, S indicates the genotype served as a susceptible reference control.
(3> Published before as being resistant against B. cinerea.
Plants were grown in potting soil in 12 cm pots in a greenhouse with minimal temperature of 15°C. Artificial sodium lamplight was applied (16 h/day) from October through March. At 5-7 days after germination, 10 ml FeNaEDTA solution (3.5 g/1) was added, followed 3 days later by 10 ml of micronutrient solution (0.286 g/1 H3BO3; 0.1558 g/1 MnSO4-H2O; 0.008 g/1 CuO4-H2O; 0.022 g/1 ZnSO4; 0.00196 (NH4)eMθ7θ24.4H2θ). From two weeks after germination onwards, 5 ml of a Hoagland solution (5 mM Ca(NOe)* 5 mM KNO3; 2 mM MgSO4; 1 mM KH2PO4) was added on a weekly basis.
1.3. Leaf assay
An inoculum from B. cinerea strain B05.10 was prepared according to Benito (1998). For each individual plant one or two compound leaves that were fully stretched were detached from the main stem with a sharp razor blade and transferred to pre-wetted florist foam. The florist foam was placed in a Petri dish containing tap water and subsequently placed in a spray-wetted container containing wet filter paper. The compound leaves were then inoculated with a conidial suspension of B. cinerea by carefully pipetting a total of 6 to 10 droplets of inoculum (2 μl) onto the upper surface of the leaves. The containers were closed with a spray-wetted lid and incubated at 15°C in the dark at 100% RH, essentially as described by Benito et al., 1998. The data in Table 4 were derived from a test wherein one composite leaf was divided into four leaflets, and wherein every leaflet was inoculated with 10 drops of 2 μl each, containing 2000 conidia. Both the proportion of aggressive expanding lesions (disease incidence) and the lesion growth rate were monitored over several days.
To correct for variation caused by the season or cultivation of the plants, the disease incidence of a particular genotype in each experiment was related to the disease incidence of Moneymaker tested in that same experiment.
Lesion sizes were measured at 96, 120 and 144 hpi using a caliper. The disease incidence was determined by dividing the total number of expanding lesions by the total number of inoculation droplets. Lesion growth rates were determined by calculating the increase in lesion size (in mm) over a 24 h period. Data for the non- expanding lesions were deleted from the quantitative analysis. The results of the leaf assay are presented in Table 4.
Table 4: Disease incidence (DI, in %) and lesion growth rates (LG, in mm/day ± standard deviation) in leaves of Lycopersicon accessions inoculated with B. cinerea. Experiments were conducted in 1999 and 2000 in different weeks as indicated.
Figure imgf000044_0001
1.4. Stem assay (standardized procedure)
The stem assay was performed as follows: The top 5-10 cm and bottom 5-10 cm of the stem of approximately 50 cm high plants were removed and the remaining 30 cm was cut into equal segments of 5-6 cm. Each stem segment was placed upright in a lattice with the stem base on wet filter paper. Prior to inoculation, the stem segments were sprayed with tap water in order to ensure an equal spread of the inoculum over the wound surface. Inoculum was prepared as described for the leaf assay. One drop of a 5 μl inoculum, containing approximately 106 conidia ml"1, was applied on the top of each stem segment. Incubations were performed at 15 ± 20C in the dark with 100% relative humidity. Infection progress was determined by measuring the maximum advance of rot symptom at various time intervals after inoculation with a Vernier caliper.
For each genotype, the percentage of infected stem pieces was calculated. The disease incidence was determined by dividing the total number of stem segments with expanding lesions by the total number of inoculated segments. Lesion growth rates were determined by calculating the increase in lesion size over a 24 h period, whereby the data for the non-expanding lesions were omitted from the analysis. The results of the stem assay are presented in Table 5.
Table 5. Disease incidence (DI, in %) and lesion growth rates (LG, in mm/day ± strd. dev.) in stem segments of Lycopersicon accessions inoculated with B. cinerea. Experiments were conducted in 1999 and 2000 in weeks indicated.
Figure imgf000046_0001
1.5. Results
The disease incidence and lesion growth in detached leaf infection experiments were determined over several days for each genotype, usually from 2-4 days post¬ infection. The disease incidence in L. esculentum cv. Moneymaker, which served as a reference, fluctuated between 15 and 78 % in these experiments. Table 4 shows the results of 14 genotypes for which detached compound leaves originating from at least 5 individual plants were inoculated, with 40 inoculation spots per leaf (10 per leaflet). The disease incidence in these 14 genotypes should be compared to that in the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Except for genotypes 82/2577 and 83/2896 (both of the species L. esculentum), the genotypes tested showed in all experiments a lower disease incidence than Moneymaker. Genotypes Gl.1556, Gl.1560 and Gl.1601 showed a low disease incidence in three independent experiments, ranging from 0 to 21%. Statistical analysis indicated that the disease incidence in genotypes 78/1604, 91/4311, 96/4326, G1.1556, GI 1558, G1.1560, Gl.1601, LA716 and LYC 4/78 was significantly lower than in the control line L. esculentum cv. Moneymaker (p<0.05). There was, however, a great variation between weeks and some of the differences observed in detached leaf assays may actually not be very robust because of the fluctuations in disease incidence between experiments/weeks (15-78%). Within these resistant genotypes (with a disease incidence significantly lower than that in the Moneymaker reference), the lesions that expanded successfully often did so at similar rate as in Moneymaker (e.g. 96/4326, G1.1560, LA716). The converse situation was not found: none of the genotypes displayed a disease incidence similar to that of Moneymaker but a lesion growth rate slower than Moneymaker. Table 4 also presents data on the average growth rates of lesions expanding on each genotype over a 24h period (between 48 and 72 hpi). Lesion growth rate in most genotypes was in the same range as Moneymaker. Five accessions (91/4311, 160/79, Gl.1556, Gl.1601 and LYC 4/78) showed a slower lesion growth rate, which was statistically significantly different from that of L. esculentum cv.Moneymaker. The stem segment infection assay (Table 5) appeared to be more robust than the leaf assay in terms of reproducibility between experiments performed in different seasons. Even though the number of data points with stem segments (5-8 segments per plant) is a great deal smaller than with the leaf assay (40 inoculation droplets per compound leaf, one or two leaves could be tested per plant), the variability between experiments was generally lower in the stem segment assay. The disease incidence in the stem assay for the control genotype L. esculentum cv. Moneymaker ranged from 52-95%. The disease incidence in 17 genotypes (Table 5) should be compared to the disease incidence of the control line L. esculentum cv. Moneymaker determined in the same experiment/week. Most genotypes showed a disease incidence in a similar range as the control line Moneymaker. Genotypes Gl.1556 (29% and 41%) and Gl.1560 (28% and 7%) showed a reduced disease incidence. Only Gl.1560 differed statistically significant (p<0.05) from the control. The lesion growth rates in the stem assay (Table 5) for the control genotype L. esculentum cv. Moneymaker ranged from 5.4 to 9.2 mm/day. The lesion growth rates of many genotypes were in a similar range as the control. However, in accessions 89/3793, Gl.1601, LYC 4/78, T566-81, the lesion growth rate was statistically significantly different (p<0.01) from the control cv. Moneymaker. With a number of genotypes that were rated as partially resistant in the stem segment assay, qualitative assays were performed on whole plants, grown in a glasshouse on Rockwool®. The aim was to evaluate whether genotypes that appeared resistant in stem segments under laboratory conditions indeed were more resistant than control lines in a semi-commercial cropping system. Plants were grown in randomised order in rows of Rockwool®, the glasshouse compartment was filled with citrus fruit heavily infected by B. cinerea at point of sporulation. The glasshouse compartment was kept at high humidity by spraying the floor twice a day with tap water and leaving doors and windows closed. At regular intervals pruning wounds were made on all plants and the occurrence of grey mould was monitored over time. A number of wild Lycopersicon accessions were identified that displayed a severe reduction of both parameters, thus providing potential sources for introgressing two, potentially independent mechanisms of partial resistance into L. esculentum.
Example 2. QTL-mapping for resistance to Botrytis cinerea in an interspecific Lycopersicon cross (L. esculentum cv. Moneymaker x Lvconersicon parυiflorum G1.1601) 2.1. Introduction
A set of Lycopersicon accessions from diverse origins was screened for resistance to the fungal pathogen Botrytis cinerea as described in Example 1. The accession Lycopersicon parυiflorum Gl.1601 showed in a leaf assay a lower disease incidence and also a slower lesion growth (see Tables 4 and 5 above). A segregating population, consisting of 130 F2-derived F3 populations, originating from a cross between L. parυiflorum G.1601 and L. esculentum cv Moneymaker, was evaluated for resistance to B. cinerea in a stem assay.
Amplified Fragment Length Polymorphism markers were used to construct a linkage map and to perform Quantitative Trait Locus-analysis. QTLs were detected for both disease incidence and lesion growth.
2.2. Plant material
After identification of the resistant accession, Lycopersicon parυiflorum Gl.1601, a segregating population with this accession as founding parent (Huang, 2001), was used for further analysis. The segregating population consisted of 130 Fa- derived F3 populations.
2.3. Disease evaluations From each of the 130 F3 populations 5 seedlings were grown and subjected to the stem assay described in Example 1 (see 1.4). For practical reasons the complete set of measurements was divided (at random) into 13 portions of equal size. Every week one portion consisting of 50 plants was measured. A large set of susceptible Moneymaker control plants was used to correct for environmental differences between weeks. For practical reasons L. parυiflorum Gl.1601 was not included in the experiment. Measurements were performed as described in Example 1.
Progress of infection was recorded on two time points after inoculation (96 and 120 hours after infection). In this way both disease incidence, which is defined as the percentage of inoculated stem parts that showed disease symptoms at the final moment of observation, and lesion growth, which is defined as the average speed of lesion development across the tomato stem in a 24-hour period, were determined as described in Example 1. The distribution of the measurements is displayed in figure 4. The distributions suggest normal, quantitative trait characteristics, therefore suitable for a QTL mapping approach.
2.4. Molecular markers
No F2 leaf material was available; therefore leaves of twelve F3 plants derived of each of the 130 F2-derived were pooled and used for DNA-isolation. AFLP determinations were performed according to Vos et al. (1995) using a set of 10 Pst/Mse primer combinations.
2.5. Linkage analysis and QTL mapping
Due to the dominant nature of the AFLP markers, the paternal (L. parυiβorum) and maternal (L. esculentum) linkage groups were calculated separately. Marker data were analyzed and a genetic linkage map was calculated using the JoinMap® software package (version 3.0; Plant Research International,
Wageningen, The Netherlands). Linkage groups were formed at various log-likelihood (LOD) thresholds. Recombination fractions were converted to map distances using the Kosambi function (Kosambi, 1944). The output from JoinMap® was converted to a graphical format for linkage maps and QTL plots using the program MapChart (Plant Research International). Phenotypic data were analyzed and QTLs were calculated using MapQTL® (version 4.0; Kyazma B.V., Wageningen, The Netherlands) by interval mapping (IM) and multiple QTL mapping (MQM) (Jansen, 1993, 1994). The calculated phenotypic data for the F2 population came from the average values of the disease assay of all plants within an F3 line. An arcsine transformation was used to normalize disease incidence data. QTLs were calculated using the interval mapping algorithm.
For each of the 130 F3 populations the combined data of markers and the disease data were subjected to QTL analysis using MapQTL®. A first round of interval mapping was performed and peaks in the LOD profile were identified. All markers originating from the one or the other parent were directly used to calculate independent linkage maps. In total 192 AFLP markers were placed on the paternal and maternal linkage maps. The male and female linkage maps were individually used for QTL-mapping. Three QTLs were determined (see table 6). Table 6: Summary of QTL mapping results based on non-integrated map.
Figure imgf000051_0001
aa is homozygous L. esculentum for the complete chromosomal region, b- is heterozygous or homozygous L. parυiflorum for the QTL-region.
The average Botrytis resistance of the 11 plants with all three QTL-regions heterozygous or homozygous L. parυiflorum Qo-) reflected a disease incidence of 40% and a lesion growth of 5.0 mm per day. Only one plant was homozygous L. esculentum for all three QTL-regions and had a disease incidence of 72% and a lesion growth of 7.2 mm per day. Five plants were homozygous L. esculentum for two of the three
QTLs and their average disease incidence was 67% combined with a lesion growth of
5.8 mm (data not shown).
This Example shows that genetic sources like L. parυiflorum Gl.1601 can be used to increase the resistance to B. cinerea in tomato. Several QTLs both for disease incidence as for lesion growth could be identified (table 6). These QTLs may be confirmed in more advanced breeding material such as backcross lines.
Table 7 shows the experimental results of disease resistance tests of various F3 lines resulting from a cross between L. esculentum cv Moneymaker and L. parυiflorum G.1601. It is clearly shown that the BChirsδ reference line used in this experiment exhibits a higher level of resistance than that of the L. parυiflorum (L parv) lines listed. However, the presence of QTL effects can also be established for the parυiflorum QTLs. Table 7: Average stem lesion length o£ Botrytis cinerea lesions in adult plants of L. parviflorum accession G.1601 three weeks after inoculation.
Figure imgf000052_0001
*) Reference lines are indicated in bold type face: Tradiro is a hybrid, suscpetible to Botrytis according to growers; Durintha is a hybrid with partial resistance according to growers; Moneyberg and Moneymaker are similar types of susceptible lines; GT is Moneyberg with TMV resistance; BChirsδ is a backcross line resulting from L. hirsutum LYC 4/78 introgression and comprises the hirsutum QTL-Ih for lesion growth. (+): heterozygous or homozygous presence; (— ): not present; n.d.: not determined.
Example 3. Mapping partial resistance to Botrytis cinerea in an interspecific tomato population (L. esculentum cv Moneymaker x L. hirsutum accession LYC 4/78)
In this Example, two QTL loci conferring partial resistance to B. cinerea originating from L. hirsutum LYC 4/78 are presented. A confirmation of the results was obtained by assessing the resistance level to B. cinerea in two BC2S1 populations segregating for one of the two QTL loci respectively.
3.1. Plant material
Seeds of Lycopersicon hirsutum LYC 4/78 (hereafter referred as LYC 4/78) were obtained from the gene bank located at the Institute for Plant Genetics and Crop Plant Research, Gatersleben, Germany. Seeds of Lycopersicon esculentum cv. Moneymaker (hereafter referred as Moneymaker) were obtained from the seed bank of De Ruiter Seeds cv, Bergschenhoek, The Netherlands.
An interspecific cross between Moneymaker and LYC 4/78 was made to produce Fi seeds. The Fi seeds were grown into Fi plants. F2 seeds, derived from selfing one Fi plant were sown to obtain an F2 population of 174 individuals. A BC2 (backcross 2) population of 59 individuals was generated by two rounds of backcrossing with Moneymaker as the recurrent and female parent. Using MAS, BC2, BC3, and BC4 genotypes were selected containing one of the two identified QTLs and some BC2 were self pollinated to produce BC2S1 seeds (see figure 2). Two BC2S1 populations were grown: one of 60 BC2S1 individuals that segregated for the QTL for disease incidence and another one of 47 BC2S1 individuals that segregated for the QTL for lesion growth.
3.2. Stem Assay
An inoculum from B. dnerea strain B05.10 was prepared according to Benito (1998). The stem assay was performed as described in Example 1.
3.3. DNA Isolation and marker analysis Genomic DNA was isolated from two young (rolled up) leaves using a cetyltrimethylammonium bromide (CTAB) based protocol according to Steward and Via (1993), adjusted for high throughput DNA isolation using one ml micronic tubes (Micronic BV, Lelystad, The Netherlands) and grounded using a Retsch 300 mm shaker at maximum speed (Retsch BV, Ochten, The Netherlands). The AFLP analysis (Vos et al, 1995) of F2, BC2, BC3, BC4 and BC2S1 populations was done and the AFLP fragments were resolved on a LI-COR 4200 DNA sequencer, essentially following the method published by Myburg (Myburg et al. 2001). The selective Pst primer was labeled with an IRD 700 or IRD 800 fluorescent label. AFLP gel images were scored using the AFLP-Quantar Pro software package (Keygene BV, Wageningen, The Netherlands). The following ten primer combinations and adapter sequences were used for genotyping: P14M48, P14M49, P14M50, P14M60, P14M61, P15M48, P18M50, P18M51, P22M50 and P22M51, as described by Bai et al. (2003). 3.4. Phenotypic analysis of the F2 population
Variation in disease incidence between the different Botrytis assays was observed (See Example 1, supra). Therefore seven independent consecutive stem disease assays were performed on 172 of the 174 individuals of the F2 population derived from the cross between Moneymaker x LYC 4/78. This resulted in at least five independent evaluations of the disease bioassay for almost each F2 genotype. In each individual disease bioassay six stem segments contributed to the calculation of the lesion growth. The average values for disease incidence and lesion growth for the F2 population showed a normal distribution (data not shown). The average disease incidence for Moneymaker is 59 % with a lesion growth of 9.2 mm/ day. The average disease incidence in the F2 population ranged between 10% and 97% with a population average of 48%. Lesion growth ranged between 3.3 mm and 11.5 mm/day with an average of 7.8 mm/day.
Average disease incidence of each individual experiment ranged from 31% to 73%, while the average lesion growth ranged from 6.2 to 7.9 mm/day (Table 8). Lesion growth can only be calculated if there is at least infection in one of the six stem pieces. Consequently an increase in the number of informative genotypes for lesion growth could be observed with higher disease incidences. For instance, with the low average disease incidence (31%) only 52% of the genotypes were informative for lesion growth.
Table 8: Average disease incidence and average lesion growth of seven experiments according to Example 3.4. The average values of the weeks are ordered according to disease incidence percentage.
Figure imgf000055_0001
3.5. Molecular markers & Genetic linkage map
A genetic linkage map was calculated for an F2 population (n=174) derived from the cross of Moneymaker x LYC 4/78. Ten primer combinations were used to obtain 218 amplified fragment length polymorphism (AFLP) markers in the F2 population (n = 174). A total of 69 markers (31.7%) could be readily scored co- dominantly, thus allowing the calculation of an integrated F2 genetic linkage map.
Marker analysis performed on BC2, BC3 and BC2S1 genotypes allowed the addition of an additional 145 AFLP markers. A total of 102 out of these 145 additional AFLP markers were previously not scored due to complexity of the F2 gels. The overall genetic linkage map consisted of 315 AFLP markers of 14 linkage groups and has a total length of 958 cM. Since co-migrating AFLP markers within a species are generally allele specific, co-linearity with other AFLP linkage maps was used to assign linkage groups to chromosomes. Some Moneymaker specific AFLP markers were in common with the genetic linkage maps as published (Haanstra et al. 1999; Bai et al. 2003) and therefore some linkage groups could be assigned to chromosomes, including the linkage groups harboring the identified QTLs. To improve the linkage map in the QTL intervals, diagnostic CAPS markers were added in these regions based on the published L. esculentum x L. pennellii map (Tanksley et al. 1992; Haanstra et al. 1999). 5.6. Linkage analysis and QTL mapping
Marker data were analyzed and a genetic linkage map was calculated as described in Example 2. The total length of the F2 linkage map was 958 cM, which is less then other published interspecific Lycopersicon maps with genetic lengths ranging from 1200- 1400 cM (Foolad et al. 2002; Haanstra et al..1999; Tanksley et al. 1992). Additional AFLP markers were scored using AFLP marker data obtained from backcross and BC2S1 populations. Although 46% more markers were placed on the linkage map, the length of the genetic linkage map did not increase. The reason for this is that the used data were obtained from several small sub-families and thus not informative for the calculation of genetic distances, but estimation of the position is possible by visual inspection of the graphical genotypes (Van Berloo, 1999).
3.7. QTL Mapping in the F2 population
The phenotypical and marker data were used for the identification of QTLs by means of interval mapping (IM, see Example 2). IM was both applied to data obtained from individual replicates and to the average values of the replicates.
Disease incidence
Interval mapping for disease incidence in the F2 population was done for those individual disease tests with an average disease incidence lower than 50% and for average data obtained from all disease tests (table 8). The average data of all tests gave in the interval mapping procedure a single significant QTL for disease incidence (likelihood of odds (LOD) score must be higher than 3.4 for a genome-wide confidence level oϊP<0.05). This QTL had a LOD score of 4.5 and explained 13 % of the total phenotypic variation (Table 9). The allele contributing to resistance originated from the resistant parent LYC 4/78. QTL mapping on each individual experiment gave in all four cases the same QTL region. In each independent experiment occasionally other "minor QTLs" were observed.
Lesion growth Lesion growth can best be measured in those disease tests with a high disease incidence. For QTL mapping the average of all 7 disease tests was used and one QTL for lesion growth of B. dnerea was identified above the threshold (LOD 3.4 for a genome-wide confidence level of P<0.05). This QTL had a LOD score of 4.2 and explained 12 % of the total phenotypic variation (Table 9). The positive effect originated from the resistant parent LYC 4/78. The necessity of performing multiple disease tests is illustrated because in only one single repetition a LOD profile above the threshold was found.
Table 9: Estimation of the calculated effects for plants homozygous Moneymaker (A), heterozygous (H) or homozygous LYC 4/78 (B). Scores for the F2 population were calculated with the interval mapping procedure, while scores for the BC2S1 population were calculated with a Kruskal- Walk's analysis.
Figure imgf000057_0001
3.8. Confirmation of QTLs in a bioassay
The Fi plant of the cross Moneymaker x LYC 4/78 was twice backcrossed with Moneymaker and the 59 progeny plants were screened for the presence of the two identified QTL-regions (one for disease incidence and one for lesion growth) using AFLP markers. Plants, heterozygous for one of the two identified QTLs, were selected and selfed to obtain two BC2S1 populations. A total of four disease bioassays were performed with each BC2S1 genotype. The data of both BC2S1 subpopulations, analyzed with SPSS, showed normal distributions for lesion growth, but not for disease incidence as some subclasses were observed (Figure 2).
All BC2S1 plants were AFLP genotyped with the same 10 primer combinations as described for the F2 population in section 3.3 above. The average lesion growth in the population segregating for the lesion growth locus was 5.3 mm/day while in the other population an average lesion growth of 6.3 mm/day was observed. Not a single plant had a lesion growth as low as the resistant parent LYC 4/78. For disease incidence, however, plants with a lower disease incidence then the resistant parent LYC 4/78 were observed. The average disease incidence for both BC2S1 populations was equal (57-59%).
The positive effect of each QTL was confirmed in the BC2S1 populations. The QTL for disease incidence decreased the chance of infection with 17 % (46 % of the parental variation) and the QTL for lesion growth reduced fungal growth with 1.3 mm/day (33 % of the parental variation). A comparison with data obtained from the F2 population is presented in Table
8. Only a part of the variation could be explained by the effect of both QTLs. Some additional ("minor") QTL loci were identified.
During analysis of data of disease tests obtained from both F2 and BC2S1 genotypes, one major QTL for disease incidence was identified (QTL- 2h). Besides this QTL, other "putative" QTL loci for disease incidence were identified. Using this information cofactors were selected to perform a restricted 'multiple QTL mapping1 (MQM) procedure on the F2 dataset. In this analysis, one additional "minor" QTL loci for disease incidence was identified (QTL-4h). A QTL is denoted as "minor" when its score is below the significance threshold of LOD 3.4. The effects however are believed to be real QTL effects.
QTL-4h is located on chromosome 4 and reduces disease incidence (see table 1). The QTL has a LOD score of 2.9 and is coupled to the following AFLP markers: P18M51-169.5e, P18M51-305.4h, Pl4M60-262.9e, and P14M61-292.7h. The positive effect of this locus is derived from the resistant parent L. hirsutum. The positive effect was identified both in the F2 and in the BC2S1 population. This QTL was initially identified in the BC2S1 population lacking segregation of QTL-2h and is also coupled to the AFLP markers P14M48-345e, P14M48-177e, and Pl8M50-147e. Segregation of co-dominant CAPS makers for this region was assessed in both BC2S1 populations and the F2 population for loci located on both Chromosome 2 and Chromosome 4. The CAPS marker on Chromosome 2, AT4G30930, is tightly linked to the QTL on Chromosome 2 while for Chromosome 4 segregation data for a set of 10 CAPS markers equally distributed over this chromosome were analysed. ANOVA analysis, including the CAPS marker AT4G30930 and the CAPS marker TG609 on Chromosome 4 showed that CAPS marker TG609 is significantly linked to the trait disease incidence.
To verify the effect of each "minor" QTLs, near isogenic lines (NIL) for the regions containing the QTL effect may be developed. In parallel thereto, a backcross inbred line (BIL) population of L. hirsutum LYC 4/78 in a L. esculentum cv. Moneymaker genetic background may be developed.
3.9 Conclusions of Disease assay and QTL mapping
The bioassay for measuring resistance to B. cinerea has proven to be a valuable tool. However, a still large and unknown variation appears to influence the development of the infection process. This large non-genetic variation can be minimized by using standardized procedures and by performing many independent replications. The variation can be caused by the greenhouse conditions changing from week to week (day length, hours of sunlight and temperature) causing differences in physiological conditions of the stem. Also, small variations in the preparation of the fungal inoculum may play a role in the variation of the infection process. Another observation is that the development of the disease can also be affected by the microclimate in the trays in which the stem pieces were placed. Ten different experimental trays were used for the BC2S1 bioassays. Statistical analysis was used to compensate for variation between and within experiments. Experiments with the highest average disease incidence were the most informative for measuring lesion growth while experiments with a more moderate disease incidence were more informative. Disease incidence and lesion growth are independent traits, since no linear correlation between the two traits could be observed. Quantitative trait loci for resistance against B. cinerea in tomato were identified in the F2. These identified QTLs were confirmed in BC2S1 populations and explained 46% and 33% of the parental variation for disease incidence and lesion growth, respectively. These results suggest that not all QTLs conferring resistance to B. cinerea were detected in the original F2 mapping population. In both BC2S1 populations plants were found with higher resistance levels as the resistant parent LYC 4/78. This is indicative for the presence of additional resistance loci segregating in the BC2S1 population. An additional segregation of resistance was surprising because it may have been expected that already large parts of the genome of the two BC2S1 populations were homozygous Moneymaker.
3.10 Confirmation of effect of individual QTLs in greenhouse conditions Plants containing either of the QTLs described above were placed in an L. esculentum background using the method described in Figure 2. BC2S2 lines were placed in the greenhouse in soil and grown under standard practice conditions in the Netherlands. After 3 months plants were inoculated by placing an agar disc containing Botrytis in a wound in the main stem. The wound was subsequently closed using Parafilm®. Three weeks after inoculation stem lesion length was measured (in cm) (For more details see below). Results are listed in Table 10. Clearly, lines containing the QTL for lesion growth show an extreme reduction in lesion size.
Table 10: Average stem lesion length oiBotrytis cinerea lesions in adult plants of L. hirsutum accession LYC 4/78 and L. hirsutum LA 1777, three weeks after inoculation.
Figure imgf000061_0001
***) a, b, c and d are repeats whereby each repeat represents 5 plants; e and f are repeats whereby each repeat represents 3 plants; GT is Moneyberg with TMV resistance; Durintha is a hybrid with partial resistance according to growers; Tradiro is a hybrid, susceptible to Botrytis according to growers; BChirs indicates backcross lines resulting from L. hirsutum LYC 4/78 introgressions; LA 1777 is wild species accession L. hirsutum LA 1777; BC chrs 10 indicates backcross lines with introgression at chromosome 10 from L. hirsutum LA 1777; parv indicates lines resulting from L. parυiflorum introgressions.
3.11. The level of resistance to Botrytis conferred by L. hirsutum LYC 4/78 QTLs is higher than the level of resistance conferred by L. peruvianum LA 1777 QTLs at chromosome 10. The level of resistance in plants containing the L. hirsutum LYC 4/78 QTLs described herein was compared to that of L. hirsutum LA1777, the source of WO02/085105 that contains a QTL for partial Biotrytis resistance on chromosome 10, and to introgression lines derived therefrom with introgressions at chromosome 10. Lines were placed in the greenhouse in soil and grown under standard practice conditions in the Netherlands. After 3 months plants were inoculated by placing an 0.5 cm x 0.5 cm agar disc containing Botrytis in a vertical stem wound of 2 cm length in the main stem. The wound was subsequently closed using Parafilm®. Three weeks after inoculation stem lesion length (length of discolored tissue dotted with fungal growth) was measured (in cm) from top of the lesion to the bottom of the lesion.
Results are listed in Table 10. It was observed that lines containing the QTLs from L. hirsutum LYC 4/78 showed a higher level of resistance to Botrytis than the LA 1777 source and IL-lines. Additionally, L. parviflorum lines containing the combination of either the QTL for disease incidence on chromosome 4 and that of lesion growth on chromosome 9 (line 68), or the combination of both QTLs for disease incidence on chromosome 3 and chromosome 4 (line 78) were compared to the LA 1777 source and IL-lines. Former lines showed less lesion growth on the stem and therefore exhibit a higher level of resistance to Botrytis then the lines derived from LA 1777 (See Table 10). Where a lesion length of 2.0 cm is recorded, only the original wound could be measured and no fungal growth was observed, which indicates a high level of resistance. Thus, a stem lesion length of 2 cm indicates absence of net growth.
Marker sequences as used herein.
The following Tables provide detailed information on the various RFLP and COS-II markers as indicated in the various linkage maps and as indicated for association with the QTLs of the present invention. The information was directly copied in from the SOL Genomic Network (SGN) database hosted at Cornell University, version of 7 October 2005. Table 11
TG301 RFLP marker
RFLP Information
Name: TG301 Insert size: 750 Vector: pGEM4Z Cutting Site: PSTl Drug Resistance: AMP
Forward sequence
TTGTAACTTACTAAΆTTΆΆGAGCTCAGGATGAACAGAACACGAATTATTAGTTCATATTAA
GCAAGAAACTTAAAAAACTTCACCTTCTC
CAΆCATACTCTACAΆCAAACTCTTTTGTCTTGATATCTTCATCTGCCACAATCCCAGTGCC ACATTTCTCAGTCTGCACGTTATGAGTCA
ACΆΆAACTTTAGTTTTTTAGATGATTATTGCTTGGTTTTCAAΆAGAAΆCGAAAATAAGAΆG
AATACAAΆATAΆCCAΆCATTTCTTTACTT
CTTCACCAGATACACAACTGAATTAAATGCAAAΆATAGATATGAAAAATGTTACCAGCCTG
CACTTTTGATGCAGATTGTACTTGTTTGC AATTGAΆAAGTGTCGAΆTGGTCATTTTTGGTAAΆAACTGATGAATGTGGTATTTTGAGAAA
GGATTTATGACGGTCCTTTTGCTTAATTA
TCCCTCTTATAAACGTTAGTAAAGGC
Reverse sequence
TATTCTGAATCTGGAAAATTGTTCTGCCAATTTCTTTGACCAACCAGACAATACCCTTTTA ATCTAAGACCCTAATTACAAGGTTACTGA
CAATCACTTTTGACACCAΆTGTCTTTGATAAAGCACTGTTAAAATTTTCAGATGTGCTTTA
ATACTCTGCATCCTTTTTAGGAΆCTCTTT
TGTCTACTTTCΆCTTTTTAAΆAGAAAGAACTTAAGGAGAGGACATACTTATTATTTTTGCA
TTTTCTATATCAAGTAAAGTGAGAAGACT TCCATTAATTTGCATCCAGCGGATGCTAATGGCTACAACATAGCTACTTTAΆGCAΆATΆGG
TGΆTTTGATCAAGATTCTTTACGTTTTCA
AGATCACAGCAΆCAAAAAGGGTTCCTTAAAAΆCCTAGCCTTTACTAΆCGTTTATAAGAGGG
ATAΆTTAAGCAAAAGGACCGTCATAAATC
CTTTCTCΆΆΆΆTACCACATTCATCΆGTTTTTACCA Table 12
TG460 RFLPmarker
RFLP Information
Name:TG460 Insert size: 2000 Vector: pGEM4Z CuttingSite: PSTl DrugResistance:AMP
Forward sequence
CCTTAGTTTTGAAATCTTTAAGTAGCAATTAGTAATCGGTAGCTCTCCAGTATGAAAAGTT CATAATCACTTGGTGGATCTCTTATTATT
TGCATCATTTGTGTGCAATAGGCATAAGAGGTAGTCATTTCACAATGCCTCTGAAATGTGT GCATTGACATTTGAGAACACTTGAGGATG
GGATACACTCTCTGTCATCAGGAACTACTTAGGTGACAAATAGATGTGAAGATTCACGGCA TAGTGTCTTTTGATCCATATCATAACCAG
AAΆGTGΆGTATCCCCATTTCTCACATTAGCTATATGΆAGGAAGAAAGGGAAAΆCΆAΆGGAΆ AGCGCTACCCTTATTCGTCGAAAGCTAGC CTTCATGATAAACCAΆATGAAΆTTAGAAAΆΆTTTAAGAACTTTGCTATAGCTTCAAAGAAΆ TCTTTTAGATTCTTGTTTACAAAGTTTTG
CTGATCTTTCTTACAT
Reverse sequence
TTATGATGCTCAAAATTTCTTATTTTAGACAGACTCGAAATGTGACTATTCCAGAGAAAAA TAAACAAGATCCCTCGGGACACTGAACCT
GAGAACAGGTTCAAATTCCCTACTGTACCCCAACAGACAAAGGGAAGAGAGAGCTATCAGT
TTCTCTTTGGTTTGAGAAAAΆACATAATA
GTATGGAGTGTACCAGATGCTTCAGGATTTCAGACATGTTCTGACTTGTTACCTAΆTGTAT
TTGATTTCATAGTATAAATCTTAGGTGTT CTGCTTGACTΆGΆΆGTATGGAAAGTCATTCTTGTCAGTAGTCAGTCTTGAGATATAΆGATA
TAATTTGATATACATCTAAATAGATCTTG
GΆTTCATTAGATAAGTTCAACAAGCATGGGTCAATAAGCACATTGATCAΆTTACΆGGATGT
AGAATAACTTTGCTTATTGTGAAATCCTC
AAAAATGAATGATGCAGGCAΆGAAGTGCAΆATTACC Table 13
TG55 RFLPMarker
RFLPInformation
Name:TG55 Insertsize: 1800 Vector:pUC CuttingSite:PSTl DrugResistance:AMP
Forwardsequence
TGGATTCAGTGTGAAGAAAGGGGACATGGTGAGTTACCTACCATATGCAATGGGAAGAATG
AΆATTTATATGGGGCGATGATGCAGAAGA
ATATACACCGGAGAGATGGCTTGATGGGGACGGTTTCTTCAGGCAATACAATCCCTTCAAA TTTACAGCTTTCCAGGGTGTTTTGAAGCT
CATCATAAGCTTTGATTATCATTTTGTTAAAGCCTTGAACGCAΆGTCTATACTTAACTTGC
CTAGAGCTATGTACTGTCGACATATGATC
AATTAACTAAGCACATTCTTTTGTTAATAAAACAGGCAGGGCCAAGGATTTGCTTGGGAAA
GGAGTTTGCTTATAGGCAAATGAAGATAT TCTCTGCTGTTTTATTACATCACTTCGTTTTCAAGCTGAGTGATGACAACAAGGCTACCAA
CTACAGGACAATGATTACTCTTCACATTG
ATGGGGGATT
Reversesequence
GATCCAAAATATGCTTTTCTGATGACCCTTACCAGATGGATTCAGTGTGAAGAAAGGGGAC ATGGTGAGTTACCTACCATATGCAATGGG
AAGAATGAAATTTATATGGGGTGATGATGCAGAAGAΆTATAAACCGGAGAGATGGCTTGAT
GGGGACGGTTTCTTCAGGCAAGAGAATCC
CTTCAΆATTTACAGCTTTCCAGGTTGTTTTAAΆGCTCATCATAΆGCTTTGATTATCATTTT
GTTAAAGCCTTGAACGCGAGTCTATACTT AΆCTTGCCTAGTGCTATGTACTGTCGTCATATGATCAΆTTAACTAAGCΆCATTCTTTTGTT
AATAAAACAGGCAGGGCCAAGGATTTGCT
TGGGAAAGGAGTTTGCTTATAGGCAAATGAAGATATTCTCTGCTGTTTTATTACATCACTT
TGTTTTCAAGTTGAGTGATGACAACAAGG
CTACCAACTACAGGACAATGATTACTCTTCACATTGATGGGGGATTGCATGTTCGTGTCTT TAGTA Table 14
TG59 RFLPMarker
RFLPInformation
Name: TG59 Insert size: 3500 Vector: pUC CuttingSite: PSTl DrugResistance:AMP
Forward sequence
TCGACCTGCAGATATTTCATAAAAGAATGCCCCCTGAAGCAGTTGATTTGGTGTCGAGGCT
TCTCCAATATTCTCCAACTCTACGCTGCA
CTGCTGTAAGTAAAAAGTTTTCTTCTCAATTATCAAGTATTTAGGATATTCTGGTAGTTTC CCATTTTACCCATCATTCΆΆΆCATGGTGT
TCCATTTTTGTTATGTTTCAΆTATGCGAGTTCTCATTGATTGTCCTTTTAGCACTTCTGTT
TTCCGGGGATATTGAGAACATTTTGTGTT
TATTGACAGTTGGAΆGCATGTGCACACCCTTTCTTTGATTCTTTΆAGGGΆACCAΆATGCTT
GCTTGCCAAATGGGCGACCTCTGCCTCCC CTATTCAACTTTTCACCTCAAGGTGAGCTTCAGTCTAGCTTTCTCCTTTTATTTCACATGA
TTTGATACGTCAAT
Reverse sequence
AGTTGGGAATTATATCCTGTTCAGTAGACAAΆTTACCCAΆCCAGAΆTATACGTΆCCTGAAT
GTTCΆTGTGATAGATAAGTCCATACTAGT ACTTCTGTCTTGTGAΆTΆTCTGTGTGTTGCCTTGTGAGTAΆGGATATTCATTGCTCCAATG
CAAAACCATTATGTCATTGTCTTAGGGAG
CTTTCTGTTGTTTGTATGGCATGAAAAGTTAΆTCCTAAAΆGAAΆGGTAAAGTAAAGGTGCA
TCCTAGGTTΆGTATAATGTTCTGAAGGCA
AAGATGTTTTTCTTTTGATTTAΆACTTATGTTTTTTTTTCTTTGATTCCGTCTCCTTCCCT AATAGCAAAAACTGGGAAGTTGAAACTAC
GTTATAACTGGACAACCTCATAAATGAAAAAGATGGTAAΆTAΆTGCCΆTTTCTGGGGTGGG
GTAATTTTCCTTAGATGAGTGTGATACTG
TTGTACCTGTTGCTTGAACTCCTAΆGTTTCCTCATTTTCTTCCTTTTTGTTTATGCTAΆAT
GCCGTGTGTACTGTG Table 15
TG145 RFLPMarker RFLP Information
Name: TG145 Insertsize:2480 Vector:pGEM4Z CuttingSite:PSTl DrugResistance:AMP
Forward sequence
ATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTATTGGCCCGTAATGGTGTC
AAGTTCGGTGAGGCTGTGTGGTTCAAGGC
TGGATCCCAGATCTTCAGCGAGGGTGGACTTGATTACTTGGGCAACCCAAGCTTGGTCCAT
GCACAAAGCATCTTGGCCATCTGGGCTTG CCAAGTTGTGTTGATGGGAGCCGTTGAGGGATACCGCATTGCTGGTGGACCTCTTGGTGAG
GTTGTCGACCCACTCTACCCCGGTGGCAG
CTTCGACCCATTAGGCCTTGCTGAAGACCCGGAGGCATTTGCTGAGCTTAAGGTTAAGGAG
ATCAAGAACGGCAGACTTGCTATGTTCTC
TATGTTTGGGTTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTCGCT GACCACCTT
Reverse sequence
GGAGACAACCTTGCATGCCAGCAGTGGATCACCTCGAGTCCACGGTTCTTGGCAAAGGTTT
CTGGATCTGCTGAΆAGTCCAGCGGTGTCC
CACCCGTAGTCACCAGGGAATTCACCATTCAΆGTAGCTAGGGGACTCACCAGAGAATGGAC CCAAGTACTTAACACGGTCAGGGCCATAC
CATGGGCTGCTAGATGGGGCTGACTTTGCGACAGCCTTTCTCATAGTGATCCTTCCATTTC
CTGTGATTTCTGAGGCAGΆTGGTAΆGAGT
TTCACTGCTTGTCCAGCAAAΆGAAGGGGAAGAΆAGAGCCATTGTAGCAGCTGCCATGGTGT
TTATATCAAGAGAAΆTGTAΆGTGTTTGAT GGTATGAGATATTGTTGAΆGTTGGCTGTAΆTGAGATGAAGTTACAAGGAΆTTAΆTTCACCA
TATATATAGGGAGTAATTAAGAGGGAAAG
AGTCCAΆATTATCTAΆTGATATCTATATCTA Table 16
CT128 RFLP Marker
RFLP Information Name: CT128
Insertsize: 700 Vector:pBLUESC CuttingSite:EcoEl DrugResistance:AMP
Forward sequence
CTTTTTTTTTTTTTCAACACAAΆCAAAATTTCATTATATTGTCAGGTAGCACACTACATCT
TTACACTGTCATCAAΆCGACCAGAGACTT
GAGAACGTTTTAAGAGATTCATTTTCCGGGGACAAAGTTTGTGGCGAΆAGCCCAGGCATTG
TTGTTTACGGGGTCTGCAΆGGTGGTCAGC AAGGTTCTCCAATGGACCCTTTCCGGTGACAATAGCTTGAACAAAGAATCCAAACATAGAG
AACATAGCAAGTCTACCGTTCTTGATCTC
CTTTACCTTGAGCTCAGCAAATGCCTCTGGGTCTTCAGCAAGGCCTAΆTGGGTCGAΆGCTG
CCACCAGGGTAGAGTGGGTCGACAACCTC
ACCAAGAGGTCCACCΆGCAATACGGTATCCCTCAACAGCTCCCATCAACACΆΆCTTGGCAA GCCCAGATGGCCAAGATGCTTTGTGCATG
GACCAAGCTTGGGTTGCCCAAGTAGTCAA
Reverse sequence
CTGGTGATTACGGGTGGGATACCGCTGGACTTTCAGCAGACCCTGAAACTTTTGCCAAGAA
CCGTGAACTTGΆGGTGATCCACTGCAGAT GGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAATGGTGTCAA
GTTCGGTGAGGCTGTGTGGTTCAAGGCCG
GATCCCΆGATCTTCAGTGAAGGTGGACTTGACTACTTGGGCAΆCCCAAGCTTGGTCCATGC
ΆCAAAGCATCTTGGCCATCTGGGCTTGCC
AAGTTGTGTTGATGGGAGCTGTTGAGGGATACCGTATTGCTGGTGGGACCTCTTGGTGAGG TTGTCGACCCACTCTACCCTGGTGGCAGC
TTCGACCCATTAGGCCTTGCTGAAGACCCAGAGGCATTTGCTGAGCTCAAGGTΆAAGGAGA
TCAAGAACGGTAGACTTGCTATGTTCTCT
ATGTTTGGATTCTTTGTTCAAGCTΆTTGTCACCGGAAAGGGTCCA Table 17
C2_At4g30930 COS-II marker
Mapping experiments Map: Tomato-EXPEN 2000
Forward primer (5&apos;-3&apos;):
ATCATACCTTCTCTCTCCAAACCC Reverse primer (5&apos;-3&apos;): TCGCCATTGCTCACTTTAAACTG
Temperature: 55°C Mg+2 concentration: 1.5 mM
PCR Product Sizes LA716: 700
LA925: 700
Digested band sizes (using DpnII)
LA716: 380+220 LA925: 340+220
Mapped locations
Map Chromosome Offset Confidence
Tomato-EXPEN 2000 2 63.5 I
Table 18
C2_At2gl8030 COS-II marker
Mapping experiments Map: Tomato-EXPEN 2000
Forward primer (5&apos;-3&apos;):
TTGGGCGACCACGCTGAATC Reverse primer (5&apos;-3&apos;): TTACCCACATCAGGACCTTGCC
Temperature: 550C Mg+2 concentration: 1.5 mM
PCR Product Sizes LA716: 1300
LA925: 1200
Digested band sizes (using amplicon difference)
LA716: 1300 LA925: 1200
Mapped locations
Map Chromosome Offset Confidence
Tomato-EXPEN 2000 2 83.1 I
Table 19
C2_At5g64670 COS-II marker
Mapping experiments Map: Tomato-EXPEN 2000
Forward primer (5&apos;-3&apos;):
TGATAAATGCTGGGAAGATTGACTC Reverse primer (5&apos;-3&apos;): ATCAACCTGGCTCCATCTTCTATTTG
Temperature: 550C Mg+2 concentration: 1.5 mM
PCR Product Sizes LA716: 200
LA925: 220
Digested band sizes (using amplicon difference)
LA716: 200 LA925: 220
Mapped locations
Map Chromosome Offset Confidence
Tomato-EXPEN 2000 2 76 CF(LOD3)
Table 20
TG609 RFLP Marker
RFLP Information
Name: TG609 Insert size: 1900 Vector: pGEM4Z Cutting Site: PSTl
Drug Resistance: AMP
Forward sequence
GAGACAGCTTGCATGCCTGCAGAGGTGATAAATTCACCAAGGTTTCATATTTAGGAAACAA
GAAAATTAAAAGATCATTAACACAGATGA AAGGATATGACTAGGAGGCAATGACTGATCTTTGACTATCAAATACTTCTCAGGGAAACAA
TGTGAATGGGCTTTTACATGCΆGAGATAT
TGATTGTGATCATGTTGAAGAΆCTTAGGAAACATGAAATTAAATGATCATTAACACTGATG
CAAGGATATGCCAAGTAGGCAAGCAAΆTT
AAGGTTGAACATAAATGTCTGTGATCTTTGACTATCAAATATCTTCTCAGAAAAAAΆΆATG TGAATGCTCATTTACATGCAGAGATGGCT
ATTGTGATCATGTGGCTCAGCCTTGAGTCTATATTGAGGTGCAGACAΆCATAGTCCCTAAC
CACATGTGTGATCAAGCAACTTTTTTGAT
GTCCACAGGGTTATAAGTAGGCAACATTTAAGCAAGAAAAAΆCACAGGATCACTATTGAGT
CAGCTGCTGTTGCCTGT
Reverse sequence
GGAGACAAGCTTGCATGCCTGCAGAGGTGATAAATTCACCAAGGTTTCATATTTAGGAAAC
AAGAAAATTAAAAGATCATTAACACAGAT
GAAΆGGATATGACTAGTAGGCAATGACTGATCTTTGACTATCAΆΆTACTTCTCAGGGAΆAC
AATGTGAATGGGCTTTTACATGCAGAGAT ATTGATTGTGATCATGTTGAAGAACTTAGGAAACATGAAATTAAATGATCATTAACACTGA
TGCAAGGATATGCCAΆGTAGGCAAGCAAΆ
TTAΆGGTTGAACATAAATGTCTGTGATCTTTGACTΆTCAAATATCTTCTCAGAΆAAAΆAAA
TGTGAATGCTCATTTACATGCAGAGATGG
CTATTGTGATCATGTGGCTCAGCCTTGAGTCTATATTGAGGTGCAGACAΆCATAGTCCCTA ACCACATGTGTGATCAAGCAACTTTTTTG
ATGTCCACAGGTTTATAAGTAGGCAACATTTAAGCAAGAAAAAACACAGGATCACTATTGA GTCAGCTGCTGTTGCCTGTTACTGAG Table 21
TG62 RFLPMarker
RFLP Information
Name:TG62 Insert size: 1800 Vector: pUC CuttingSite: PSTl
DrugResistance:AMP
Forward sequence
CAAAATGCTTCAGCTACTGGCTAAATGAAGTATGTTCTCAACATATTCACAAGCTTCTGTC
TTCGAAGCTCAAGAAGTGTCGGTATTATC TGAATTAAATAGTAAAGCAAAGAGATGGTTTTATGTTTCTTAAGCAGCATTTCTTAGCTTA
ACGGCCCTCCAGATATATGGTGGACAΆAΆ
TAGAΆTCCATTAGATATAACAAATGGGATTAGTATAΆTGATCTTTTACTTTGTTAGATGAT
CATACTAACΆGATTGCAAGTTAATCATAT
CCAACΆTATTCTGTAGATATTTCACATTGGCTAGCATGAGGAAAGGTCATGTAGGAAATTG AATAGAGTTCAATTTTGGGAAAAGTTGCA
TTGAΆGAAGGTAACTTCAΆCAΆACGTGTGAΆAΆAATCACATTTGAGTTGCCCGCTCACCAT
CGTGATTCCAGTACGAΆCTACTCAAAAΆT
TTACTTTTGAGCCTTAAACATCATTTTAΆGCCTTGAΆΆAGCTGCTTTTGAAAΆGATCTAΆG
CAAGAT
Reverse sequence
GGAGAATATTGTCACTCTATCAGATAGTTCAAAACTATCGGAGAATGAAATGGTCAATTCT
TCTCACAAGATATTCATGCCTAGTTGCAG
TGTCCGΆATTAΆCATAACATGCTCAΆTTTTCATATCTTGCΆGCAAAATTTATCATTGAAΆC
TCTCTGAGATGGAAΆCAGAGAACAΆAGAC CATATTGGAAAGCTTCAATCAGACATGCAGAAAAAGGAAGATGAGATTCATGTTTTACGCA
AGGAAATTGACAATTACACGGAAACAGTG
GATTCACTGGAGAAGCATGTTACAGAGATTAACAATAAATTGGAGGAGAAAGATCAGCTTG
TTCAGGAΆCTTCAGGACAΆGGAGAΆGCAG
TTGGAAGCTGACAGAGAΆAAGGTTTTTACTACGGATACTTTTAGTTCTACAΆΆTTCTATTA TAACCAATACAATGTGTTCAAGTGACTAG
TGTTTTGCACCTTGTTGCAGATTCAGGCATCTTTGCTTGCTGCTGAAAGCAAGCTCACΆGA
ATCCAAAΆAGCΆGTATGATCAGATGT Table 22
TG555 RFLPMarker
RFLPInformation
Name:TG555 Insert size: 1600 Vector: pGEM4Z CuttingSite:PSTl
DrugResistance: AMP
Forward sequence
AATTCGGAGCTCACTGCTTCTAATCCTCAGTGAGACTTATTTTCTACATATTAAACAATAA
GAAATTTACGAAGGAATATTATAGACTGA ATTCCTTGGTGACAAGTATCAAGACATCTTGACCAAGTTTAAAGTTTTGTAGTGGCAGTTC
TTTTAAGCTTTACTTGTGTGAGGTAGACA
TCAAGGAΆGATAAGTAGCAGCTACTCTTCACGGAGCAGCCCATAGGACΆCTCAAATTCACT
ATTGCGΆGGGTCAATCTACCAΆTTTATGG
AACGATACCAGTAAAGTCATTTTTATGTAAACATCAGACAGCTTTTGACTAAGCAGAGACA TGAATAAGTTCTATTTGTTAGAAGTCGAA
GAGACAAATAAGTTAΆTTTCACCTATGCTATAAAAGAGGACTCTTATAGTTATAΆΆTACAG
TACATTTTATTAAGGGTTCTAΆTTGTTGA
CTATGATAGCAAGCATGCCGTACTAATT
Reverse sequence ACATTTTGAGGAAGACAGGAGTTATGTATCGCCATCTGGTGTGCTCCAAGAACATGACAGA
TATAAΆAGACCGCGGGGTGCACCAGAGAA
ΆTGTTGCATTGGAGCATATTGAACATCATAGGCTCAΆTGGAATTGTTTACTTTGCAGATGA
TGATAATATCTACTCACTTGAGTTGTTTG
AGAGCATTAGATCGATCAAGTAAGTTGAGATTCATCAGTCTTGTTTACATGACTTGTCTTT GTTTTGTCCTGCTGTGAGCATGTTCAGGA
TGΆTGTTATGTGCTTTATGTAGATGTTCΆAGTCGATAATAGTGAΆTAGTCTAGAGCTATTT
CACATATATTACAACTTCACTAACAAATT
CTTTTCCTGGTGTCCTCGGTTCATCΆCTCTTCΆTAGTTATAAGAΆTAACAGTTGTAGATTA GACCACTGGTCGTGTGATTTTTGGACTTA ATTATTATCTCAATTCTTCCTCAAAATAGCAGTCCTTAGATTAGAAGCTGAGG 62
74
Table 23
CT50 KFLPMarker
RFLPInformation
Name: CT50 Insertsize: 1600 Vector: pBLUESC CuttingSite:EcoRl
DrugResistance:AMP
Forwardsequence
CTTTTTTTTTTTTTTTATATATTGTGGTATAGATTATTATATAATAACAAGGTGAATTAAC
ATGAGAAATGAATAATTGTCACATTCTTG TTCTGTCCATTTTCCAGTAGCGGCTAGTTGGAAAATTTGTTGTAACATGTAACACAGGCTG
TCCACATTCTACTCCAGAGAGAAΆGTTGG
TAAGTAGTGGGGGCAAΆAGATAGAGACCCCAATAGCTATCAΆTTCACTTTGTTGACAATCA
AGATTTGAGAAΆAAAGATCAAΆΆCTTTAC
CAACTTAGATAGCTCCATAATCAACTGTAGGTACAATTCTTTAGTGAAATTGCGGCGTTCA TCTTCTGGGGACGAAGAGTAAGTAGACAA
TCAΆTTGTCTTGTAGAΆCTTGGGCTTTACCATTTTCCCTAGGACATAΆGCTCTTGATCGΆA
GCTTGAAGTTTΆATTTTAGTGGCACTGGT
AATG
Reverse sequence TTTTTTTTTTTTTTTAGCCAAAATGCATACAAAAACTGATTCAGAAGATACGAGCTTGGCT
CCTTCGTCGCCGGACAATAGAGGGCCGAC
GGCGTATTACGTTCAGAGTCCGTCACGTGATTCTCACGATGGCGAGAΆGACΆACGACGTCG
TTTCACTCTACTCCTGTTATCAGTCCCAT
GGGTTCTCCTCCTCACTCTCACTCATCCGTCGGCCGTCACTCCCGTGATTCCTCTTCCTCC AGATTCTCCGGCTCCCTCAAGCCTGGATC
TCAGAΆGATTTTACCCGACGCCGCCGGAGGCGTCGGCGGCCGTCACCΆCCGCAAAGGGCAG
AAGCCCTGGAAGGAATGTGATGTTATTTG
AGGAAGAAGGΆCTACTTGAAGATGATAGATCCAGTAΆATCTCTTCCACGTCGTTGCTATGT
CCTTGCTTTTTGTTGTTGGTTTCTTCGTC CTTTTCTCCTTCTTTGCTCTCATCCTTTGGGGTGCTAGTCGACCTC Table 24
C2_Atlg74970 COS-II marker
Mapping experiments
Map: Tomato-EXPEN 2000
Forward primer (5&apos;-3&apos;): TCATCATCAACTATCGTGATGCTAAG
Reverse primer (5&apos;-3&apos;): ACGCTTGCGAGCCTTCTTGAGAC Temperature: 55°C Mg+2 concentration: 1.5 mM
PCR Product Sizes
LA716: 1000 LA925: 1000 Digested band sizes (using AIuI)
LA716: 550 LA925: 850
Mapped locations
Map Chromosome Offset Confidence
Tomato-EXPEN 2000 4 109.7 I
Table25
CT128 RFLPmarker
RFLPInformation
Name: CT128 Insertsize:700 Vector:pBLUESC CuttingSite:EcoRl DrugResistance:AMP
Forwardsequence
CTTTTTTTTTTTTTCAΆCACAAΆCAAAATTTCATTATATTGTCAGGTAGCACACTACATCT
TTACACTGTCATCAΆACGACCAGAGACTT
GAGAACGTTTTAΆGAGATTCATTTTCCGGGGACAAAGTTTGTGGCGAAAGCCCAGGCΆTTG TTGTTTACGGGGTCTGCAAGGTGGTCAGC
AAGGTTCTCCAATGGACCCTTTCCGGTGACAΆTAGCTTGAACAΆAGAATCCΆΆACATAGAG
AACATAGCAAGTCTACCGTTCTTGATCTC
CTTTACCTTGAGCTCAGCAAΆTGCCTCTGGGTCTTCAGCAAGGCCTAATGGGTCGAAGCTG
CCACCAGGGTAGAGTGGGTCGACAACCTC ACCAAGΆGGTCCACCAGCAATACGGTATCCCTCAACΆGCTCCCATCAΆCACΆACTTGGCAA
GCCCAGATGGCCAAGATGCTTTGTGCATG
GACCAAGCTTGGGTTGCCCAAGTAGTCAA
Reverse sequence
CTGGTGATTACGGGTGGGATACCGCTGGACTTTCAGCAGACCCTGAAACTTTTGCCAAGAA CCGTGAACTTGAGGTGATCCACTGCAGAT
GGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCTGAGCTCTTGGCCCGTAATGGTGTCAA
GTTCGGTGAGGCTGTGTGGTTCAΆGGCCG
GATCCCAGATCTTCAGTGAΆGGTGGACTTGACTACTTGGGCAACCCAΆGCTTGGTCCATGC
ACAAΆGCATCTTGGCCATCTGGGCTTGCC AAGTTGTGTTGATGGGAGCTGTTGAGGGATACCGTATTGCTGGTGGGACCTCTTGGTGAGG
TTGTCGACCCACTCTACCCTGGTGGCAGC
TTCGACCCATTAGGCCTTGCTGAΆGΆCCCAGAGGCATTTGCTGAGCTCAAGGTAAAGGAGA
TCAAGAACGGTAGACTTGCTATGTTCTCT
ATGTTTGGATTCTTTGTTCAΆGCTATTGTCACCGGAΆAGGGTCCA Table26
TG599 RFLPmarker
RFLPInformation
Name:TG599 Insertsize:700 Vector:pGEM4Z CuttingSite:PSTl DrugResistance:AMP
Forwardsequence
TGCTTTGAGACAGATGTCTCTCATTAAGTGACTGAAGCTTTCTTCTAGTTGGCTAGCATAT
TCATTTTCAGCATATAATCTGTATCATGA
ACAΆAATTGCGACAGTATTGAATTTTTATTGTTGAATAGTCTTTTTATTATCCCCGAAGTT GAGGGTGGAACTTACATTTTCTGTTGATC
CTTGCTTGCTGTTTTTGTAAΆCAΆAΆAAGCGTCACCCATTATTTTTCTTTTΆTTCTTTCTA
GGTTGGGACTAΆGATTTTTTGAAΆTGAGA
AAGGTATTCGCTACCTTGAGGGCTGTGGTTGAAGTGATGGAGTATCTGAGCAAAGATGCAG
CTCCTGATGGTGTGGGAAGGCTTATAAAG GAGGAGGGAGTATTTCCTTTCATTTCTTTGTATTTCCGTGTGTGTATAGTCCGGAACTGGT
TCCCTACTTATGAATTCTTTCATGGTTTG
GTCAATTGAGAAGGATCAAGAAΆTCTGATGCTACTTTATCATGGGAACTT
Reversesequence
GCTTGCATGCCTGCAGAGTGGTCATACAATAAAAGGTAAAAATCAACATTCTTACCTCTGG AAAGAAACCAATAGCATTGGTCAATGATG
CTGCCTCTAGAGGAACAATATTGTATGGTGCAAGTTCCCCTGATAAΆGTAGCATCAGATTT
CTTGATCCTTCTCAACTGACCAAACCATG
AAAGAATTCATAAGTAGGGAACCAGTTCCGGACTATACACACACGGAAATACAΆAGAAATG
AAAGGAAATACTACCTCCTCCTTTATAAG CCTTCCCACACCATCAGGAGCTGCATCTTTGCTCAGATACTCCATCACTTCAACCACAGCC
CTCAAGGTAGCGAATACCTTTCTCATTTC
AAAAΆATCTTAGTCCCAΆCCTAGAAAGAATAAAAGAΆΆAATAΆTGGGTGACGCTTTTTTGT
TTACAAAAΆCAGCAΆGCAΆGGATCAACAG
AAΆATCTAAGTTCCACCCTCAACTTCGGGGATAATAAΆΆAGACTATTCAACAATAΆAAATT CAATACTGTCGCAA Table 27
TGlO RFLP marker
RFLP Information
Name: TGlO Insert size: 900 Vector: pUC
Cutting Site: EcoRl/Hindlll Drug Resistance: AMP
Forward sequence
AACTCTGCTCTGCCAATAGTAGTCAGGCAGATCAAGATGCTCAAAATTTTCTATTTGAATT
GGAAGCATCAAGATGGTTCTTAGCATTTA
TTTTAGAAΆGACTAΆCCATATTATCAAATAACCAGACTGAGACGCACACAAΆΆGTTTCCCT CTATTATTTTTATAATGATGTGAAGATGC
TACATAΆTGAGTACACTTTGCCTTACTTTACTGCAGATGGACCTACCAGGCCCAAΆCGGAC
ATGTAGCTATGACAGAAGAGCAACCGCTA
TGAΆTGTCTCAAACTGTTGGCCTAGGCGATCAGCACAGATGATGAΆTCTGGAAGTACATTC
CAAGAAGGAAΆGCTGGAGCGTGGGAACTA ACCAGATGCAGGGGATGAATCCACACCTTTCAGTTGATCATCTGAΆGGGAΆΆΆCTAAGAΆT
TTTCATGAGAAAΆTGACTGGCTATTTTCA
ACTTTG
Reverse sequence
TTCAATGCATTTAAGCTCAΆAAAAΆCAAAGCTGTAGGAAGGAGCATATTAGTAGCCTAACT CTGCTCTGCCAATAATAGTTAAGCAGATC
AAGATGCTCAΆAΆTTTTCTAATTGAΆTTGTTAGCATCAAGATGCTTCTTAGCATTTATTTT
AGAAAGATTΆACCATATTATCAΆATAΆCC
AGACAGΆGACGCACACAAΆAGTTTCAATCTATTATTTTTATAATGATGTGAAAΆTGCTΆCA
TAATGAGTACACTTTCCCTTACTTTACTG CAGATGGACCTACCAGGCCCAΆΆCGGTCATGTAGTTATGACAGAAGAACΆΆCAGTATGAΆT
TTCTCAAΆCTGTTGGCCAΆGGTGATCAGC
AΆAGATTATGAΆTTTGGAAGTACATTCCAAGAGGAAAGCTGGAGCATCGTAACTAACCAGA
TGCAGGGGATGAATCCACACCTTTCAGTT
GATCATCTGAΆGGCAAΆΆCTAΆGAATTTTCΆTGAGAAAΆTACTGGTTATTTTCAACTTTGT TGGCCAGACGAGGAGTCCAATGGGATAGA AGGΆCTAACTCAATGACGTATG Table28
TM2a TMmarker
TMInformation
Name:TM2A
OldCOSID:T0899
Sequence
CNAGCTCGANNNACCCTCACTAΆAGGGAACAAAAGCTGGAGCTCCACCGC GGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGCTCCTCC
ATTGAAAΆGGGAΆTCAAGTTTGCCAAAGAAAACTAAAAAAΆCAAAATTAT
GGTCTAGTTTTCTATAGTGACAGTTTTGGATCTTTTTGGGTCAATTGTTT
TTGTATCCTTTGCAAGTTTCTTGCAGCCGGAGGCTTAGATTTAGCTCTTT
TGATATTATACCCΆACATTTCTACAAAΆTAATGTATGGCAAΆCTGGGGGC CTATCCCATTTGCCTTAGTGTGGAGGTGTTATTCTCACATGAATCGTTTT
CCAATTATGGTTΆGTAGCAGACAATTGATGCAAAATGAAGAAATGTTCΆT
GACCAAΆAAAΆAAAAΆAAAAAA
Mappedlocations Map Chromosome Offset Confidence
Tomato-EXPEN2000(TM2A) 9 50.5 I
Table 29
TG551 RFLPmarker
RFLP Information
Name:TG551 Insert size: 950 Vector:pGEM4Z CuttingSite: PSTl DrugResistance:AMP
Forward sequence
AΆTGAAGTTCAGTTGATAΆGCTΆΆATGGTGGΆΆATΆCTAATTTTAATTGACAGTAACTTTG
CATTTCAAGGTCCATACCAAAACATTTGC
TAACACCAGTTGCTTTGTCAACGAΆAΆCCTTGGCACTCAAAΆCCCTACCAAAAGGCTGAAA TGCATTTGCAAGCTCTTGATCACCAAATT
CTTGAGGAATATGGTAAATAAATAGATTAGCACCAGGTGGACCTGTAAACAGCAAAATCGT
TTTTGATAAGTACAGGTTTATTTCTACAT
GTTCAACTACCACTGCCAAGTACACTAGTTCAAGTGACATCTCCACCACTTAATTGCATAA
AGCTTTACCAΆCGACAAATATAACAAACT TGTGCAAGTAATTTGAGTTCCTGTCTATACAGTCCAGAATCTCCATATGCTGCTCATCTCA
CAATGTTGGTTAAGGAAATTTGTCAΆGTA
AAGTTCAA
Reverse sequence
CATCTTCAAGTGTCAGCTCAAGTACAGGGGGTCAGGTTGAAGGTTGTTGAACATTTATTTT GTGACCTTTTTAGCTCTAGAATTTCTGTA
GCTAATCAAGTACAGTCCCATAACCTAGGGGCTGTTAGGGTTTTCTGCTGAATGAGGCTGC TTGTCTTTATTTTGGTTAATTATTTTCTG
GAΆATTGTTCCTCGTCATAGAGAΆTAGAAGTAGAΆGAAGAΆGAAGATAGTATAATCTATTA TATTTGTTTTTTACTTAATTTATAAAGAT TCCATAAATGCATGTGATCTTTGATCAATGATATCTTATACAAGTGTATCACTAGAATCTA TTATATTTGGATTTACTTATTTTΆTATAG GATTTCATAAACGCATGTGATC REFERENCES
Bai YL, Huang CC, van der Hulst R, Meijer Dekens F, Bonnema G, Lindhout P (2003) QTLs for tomato powdery mildew resistance (Oidium lycopersici) in
Lycopersicon parviflorum Gl.1601 co-localize with two qualitative powdery mildew resistance genes. MoI. plant microbe interactions 16:169-176.
Benito EP, ten Have A, van 't Klooster JW, van Kan JAL (1998) Fungal and plant gene expression during synchronized infection of tomato leaves by Botrytis cinerea. Eur. J. Plant Pathol. 104:207-220.
Bernacchi D, Tanksley SD (1997) An interspecific backcross of Lycopersicon esculentum x L. hirsutum: Linkage analysis and a QTL study of sexual compatibility factors and floral traits. Genetics 147:861-877.
Christou P, Murphy JE, and Swain WF (1987) Stable transformation of soybean by electroporation and root formation from transformed callus. Proc. Natl. Acad. Sd.
USA 84:3962-3966.
Churchill GA, Doerge RW (1994) Empirical threshold values for Quantitative trait mapping. Genetics 138: 963-971.
Deshayes A, Herrera-Estrella L, Caboche M (1985) Liposome-mediated transformation of tobacco mesophyll protoplasts by an Escherichia coli plasmid.
EMBO J. 4:2731-2737.
DΗalluin K, Bonne E, Bossut M, De Beuckeleer M, Leemans J (1992) Plant.
Cell 4:1495-1505.
Dik AJ, Koning G, Kohl J (1999) Evaluation of microbial antagonists for biological control of Botrytis cinerea stem infection in cucumber and tomato. Eur. J. Plant
Pathol. 105:115-122.
Doganlar S, Frary A, Ku HM and Tanksley SD (2002) Mapping Quantitative
Trait Loci in Inbred Backcross Lines of Lycopersicon pimpinellifolium (LA1589).
Genome 45:1189-1202. Draper J, Davey MR, Freeman JP, Cocking EC and Cox BJ (1982) Ti plasmid homologous sequences present in tissues from Agrobacterium plasmid-transformed
Petunia protoplasts. Plant and Cell Physiol. 23:451-458. Eckstein F (ed) (1991) Oligonucleotides and Analogues, A Practical Approach.^Oxford Univ. Press, NY 1991
Egashira H, Kuwashima A, Ishiguro H, Fukushima K, Kaya T, Imanishi S (2000) Screening of wild accessions resistant to gray mold (Botrytis cinerea Pers.) in Lycopersicon. Acta physiologiae plantarum 22:324-326.
Foolad MR, Zhang LP, Khan AA, Nino Liu D, LiIn GY (2002) Identification of QTLs for early blight (Alternaria solani) resistance in tomato using backcross populations of a Lycopersicon esculentwn x L. hirsutum cross. Theor. Appl. Genetics 104:945-958. Fulton T, van der Hoeven R, Eannetta N, Tanksley S (2002). Identification,
Analysis and Utilization of a Conserved Ortholog Set (COS) Markers for Comparative Genomics in Higher Plants. TJie Plant Cell 14(7): 1457-1467. Godoy G, Ste adman JR, Dickman MB, Dam R (1990) Use of mutants to demonstrate the role of oxalic acid in pathogenicity of Sclerotinia sclerotiorum on Phaseolus vulgaris. Physiological Molecular Plant Pathology 37, 179-191.
Grandillo S, Tanksley SD (1996) QTL analysis of horticultural traits differentiating the cultivated tomato from the closely related species Lycopersicon pimpinelli folium. Theor Appl Genet 92: 935-951. Gruber MY, Crosby WL (1993) Vectors for Plant Transformation. In: Glick BR and Thompson JE (Eds.) Methods in Plant Molecular Biology & Biotechnology, CRC Press, pp. 89-119.
Haanstra JPW, Wye C, Verbakel H, Meijer Dekens F, van den Berg P, Odinot P, van Heusden AW, Tanksley S, Lindhout P, Peleman J (1999) An integrated high density RFLP-AFLP map of tomato based on two Lycopersicon esculentum x L. pennellii F2 populations. Theor. Appl. Genetics 99: 254-271.
Hain R, Stabel P, Czernilofsky AP, Steinbliss HH, Herrera-Estrella L, Schell J (1985) Uptake, integration, expression and genetic transmission of a selectable chimaeric gene to plant protoplasts. MoL Gen. Genet. 199:161-168. Horsch RB, Fry JE, Hoffman NL, Eichholts D, Rogers SG, Fraley RT (1985) A simple method for transferring genes into plants. Science 227:1229-1231.
Jansen RC (1993) Interval Mapping of Multiple Quantitative Trait Loci. Genetics 135:205-211. Jansen RC (1994) Controlling the Type I and Type II Errors in Mapping
Quantitative Trait Loci. Genetics 138:871-881.
Kado CI (1991) Molecular mechanisms of crown gall tumorigenesis. Crit. Rev. Plant
Sd. 10:1-32. Klein TM, Gradziel T, Fromm ME, Sanford JC (1988). Factors influencing gene delivery into zea mays cells by high velocity microprojectiles. Biotechnology 6:559-563.
Klein TM, Arentzen R, Lewis PA, and Fitzpatrick- McEUigott S (1992)
Transformation of microbes, plants and animals by particle bombardment.
Bio /Technology 10:286-291. Kosambi DD (1944) The estimation of map distances from recombination values.
Ann. Eugen. 12:172-175.
Laursen CM, Krzyzek RA, Flick CE, Anderson PC, Spencer TM (1994)
Production of fertile transgenic maize by electroporation of suspension culture cells.
Plant MoI Biol. 24(1):51-61. Miki BL, Fobert PF, Charest PJ, Iyer VN (1993) Procedures for Introducing
Foreign DNA into Plants. In: Glick BR and Thompson JE (Eds.) Methods in Plant
Molecular Biology & Biotechnology, CRC Press, pp. 67-88.
Moloney MM, Walker JM, Sharma KK (1989) High efficiency transformation of
Brassica napus using Agrobacterium vectors. Plant Cell Reports 8:238-242. Myburg AA, Remington DL, O' Malley DM, Sederoff RR, Whetten RW (2001)
High-throughput AFLP analysis using infrared dye-labeled primers and an automated DNA sequencer. Biotechniques 30: 348-357.
Nesbitt TC, Tanksley SD (2001) fw2.2 directly affects the size of developing tomato fruit, with secondary effects on fruit number and photosynthate distribution. Plant Physiol. 127: 575-583.
Nicot PC, Moretti A, Romiti C, Bardin M, Caranta C, Ferriere H (2002)
Differences in susceptibility of pruning wounds and leaves to infection by Botrytis cinerea among wild tomato accessions. TGC Report 52: 24-26.
Paterson AH (ed.) (1996) Genome Mapping in Plants, Academic Press Inc San Diego, CA, USA.
Phillips RL, Somers DA, Hibberd KA. 1988. Cell/tissue culture and in vitro manipulation. In: G.F. Sprague & J. W. Dudley, eds. Corn and corn improvement, 3rd ed., p. 345-387. Madison, WI, USA, American Society of Agronomy. Pierik RLM (1999) In vitro Culture of Higher Plants, 4th edition, 360 pages, ISBN:
0-7923-5267-X.
Prins TW, Tudzynski P, von Tiedemann A, Tudzynski B, ten Have A, Hansen
ME, Tenberge K, van Kan JAL (2000) Infection strategies of Botrytis cinerea and related neurotrophic pathogens. In "Fungal Pathology" (J. Kronstad, editor). Kluwer
Academic Publishers, pp.33-64.
Roupe van der Voort JNAM, van Zandvoort P, van Eck HJ, Folkertsma RT,
Hutten RCB, Draaistra J, Gommers FJ, Jacobsen E, Helder J, Bakker J
(1997) Use of allele specificity of comigrating AFLP markers to align genetic maps from different potato genotypes. MoI. Gen Genetics 255: 438-447.
Sambrook J, and Russell DW (2001). Molecular Cloning: A Laboratory Manual.
New York, NY, USA., Cold Spring Harbor Laboratory Press.
Sanford JC, Klein TM, Wolf ED, Allen N (1987). Delivery of substances into cells and tissues using a particle bombardment process. J. Particulate Sd. Technol. 5:27- 37.
Sanford JC (1988) The biolistic process. Trends in Biotechnology 6:299-302.
Sanford JC (1990) Biolistic plant transformation. Physiologica Plantarum 79: 206-
209.
Sanford JC, Smith FD, and Russell JA (1993) Optimizing the biolistic process for different biological applications. Methods in Enzymology 217:483-509.
Steward CN, Via LE (1993) A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. Biotechniques 14: 748-750.
Tanksley SD, Ganal MW, Prince JP, de Vicente MC, Bonierbale MW, Broun P,
Fulton TM, Giovannoni JJ, Grandillo S, Martin GB (1992) High density molecular linkage maps of the tomato and potato genomes. Genetics 132: 1141-1160.
Tanksley SD, Grandillo S, Fulton TM, Zamir D, Eshed Y, Petiard V, Lopez J and Beck-Bunn T (1996) Advanced backcross QTL analysis in a cross between an elite processing line of tomato and its wild relative L. pimpinellifolium. Theor Appl
Genet 92: 213-224. Tanksley SD, Young ND5 Paterson AH, Bonierbale MW (1998) RFLP mapping in plant breeding: New tools for an old science. Bio /technology 7: 257-263. Tijssen P (1993) Hybridization With Nucleic Acid Probes. Part I. Theory and Nucleic
Acid Preparation. In: Laboratory Techniques in Biochemistry and Molecular Biology.
Elsevier.
Urbasch I (1986) Resistenz verschiedener Kultur- und Wildtomatenpflanzen (Ly coper sicon spp.) gegenύber Botrytis cinerea Pers. J Phytopathol 116: 344-351
Utkhede R, Bogdanoff C, McNevin J (2001) Effects of biological and chemical treatments on Botrytis stem canker and fruit yield of tomato under greenhouse conditions. Can. J. Plant Pathol 23: 253-259
Utkhede RS, Mathur S (2002) Biological control of stem canker of greenhouse tomatoes caused by Botrytis cinerea. Can. J. Microbiol. 48: 550-554
Van Berloo R (1999) GGT: Software for the display of graphical genotypes. J.
Heredity 90: 328-329
Van Berloo R, Aalbers H, Werkman A, Niks RE (2001) Resistance QTL confirmed through development of QTL-NILs for barley leaf rust resistance. MoZ. Breeding 8: 187-195
Van Heusden AW, Koornneef M, Voorrips RE, Bruggemann W, Pet G,
Vrielink van Ginkel R, Chen X, Lindhout P (1999) Three QTLs from Lycopersicon peruυianum confer a high level of resistance to Claυibacter michiganensis ssp michiganensis. Theor. Appl. Genetics 99: 1068-1074 Voorrips RE (2002) MapChart: software for the graphical presentation of linkage maps and QTLs. J. Heredity 93: 77-78.
Vos P, Hogers R, Bleeker M, Reijans M, van de Lee T, Homes M, Frijters A,
Pot J, Peleman J, Kuiper M (1995) AFLP: a new technique for DNA fingerprinting.
Nucl. Acids Res. 23: 4407-4414. Zhang L, Cheng L, Xu N, Zhao M, Li C, Yuan J, and Jia S (1991) Efficient transformation of tobacco by ultrasonication. Biotechnology 9:996-997.

Claims

Claims
1. A Botrytis-Tcesistant tomato plant, wherein said plant has a susceptibility to Botrytis cinerea which is at least 3 times lower than a susceptible control plant when measured by a bioassay wherein the average length of a stem lesion resulting from Botrytis cinerea infection in adult plants is measured during a three week period under standard practice conditions.
2. A plant according to claim 1, characterized in that said plant comprises within its genome at least one QTL or a ZJoiryiis-resistance-conferring part thereof selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parυiflorum Gl.1601 associated with Botrytis resistance, and wherein said QTL or said Botryt is-resistance-conferring part thereof is not in its natural genetic background.
3. A method for detecting a quantitative trait locus (QTL) associated with improved Botrytis-resistance in tomato comprising the steps of: a) crossing a Botryt is-resistant donor tomato plant with a non-resistant, or .Boiryiis-susceptible, recipient tomato plant; b) contacting one or more offspring plants with an infective amount of Botrytis; c) quantitatively determining the disease incidence and/or the rate of lesion growth in said one or more offspring plants; d) establishing a genetic linkage map that links the observed disease incidence and/or rate of lesion growth to the presence of chromosomal markers of said donor tomato plant in said one or more offspring plants, and e) assigning to a QTL the contiguous markers on said map that are linked to a reduced disease incidence and/or a reduced lesion growth rate.
4. Method according to claim 3, wherein said .Bo£r,yiϊs-resistant donor tomato plant is selected from the group consisting of Lycopersicon cerαsiforme, Lycopersicon cheesmαnii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon parυiflorum, Lycopersicon pennellii, Lycopersicon peruυianum, Lycopersicon pimpinellifolium and Solanum lycopersicoides.
5. Method according to claim 3 or 4, wherein said .Boiryiis-resistant donor tomato plant is a wild accession of Lycopersicon hirsutum or Lycopersicon parυiflorum, more preferably Lycopersicon hirsutum LYC 4/78 or Lycopersicon parυiflorum Gl.1601.
6. Method according to any one of claims 3-5, wherein said Botrytis-susceptible recipient tomato plant is a plant of the species Lycopersicon esculentum, preferably L. esculentum cv. Moneymaker.
7. Method according to any one of claims 3-6, wherein the quantitative determination of the disease incidence comprises determining the ratio of the number of successful infections (lesions) over the total number of potentially infectious contacts between infectious agent and plant, and wherein the quantitative determination of the rate of lesion growth comprises determining the increase in diameter, circumference, surface area or volume of one or more of said lesions over time.
8. Method according to any one of claims 3-7, wherein the quantitative determination of the disease incidence and/or the rate of lesion growth is performed in multiple offspring plants.
9. Method according to claim 8, wherein said offspring plants are plants of the segregating F2 population that is derived from the cross between said donor and recipient plant.
10. Method according to claim 9, wherein said F2 population is derived from seeds obtained from selfing the plants of the Fi population.
11. Method according to any one of claims 3-10, further comprising the step of isolating said QTL.
12. A QTL associated with Botrytis-vesistance in tomato obtainable by a method according to any one of claims 3-11.
13. A QTL associated with ,Bo£r;y£is-resistance in tomato, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon pαrυiflorum Gl.1601 associated with Botrytis resistance, or a Botrytis- resistance-conferring part thereof.
14. A QTL according to claim 13, comprising at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers indicated in Figures 1, 5 and 6 as being linked to said QTL, or a Bot ryfis-resistance-conferring part thereof.
15. A method of producing a Botrytis-vesistant tomato plant comprising the step of transferring a nucleic acid comprising at least one QTL according to any one of claims 12-14, or a Hctfry^s-resistance-conferring part thereof, from a .Boiryϋs-resistant donor tomato plant to a Bot ryiis-susceptible recipient tomato plant, wherein said transfer of said nucleic acid is performed by transformation, by protoplast fusion, by a doubled haploid technique or by embryo rescue.
16. A method of producing a Botrytis-resistant tomato plant comprising the steps of performing a method for detecting a QTL associated with JBo£r,y£is-resistance in tomato according to any one of claims 3-11 in a Botrytis-resistant donor tomato plant, and transferring a nucleic acid comprising at least one QTL thus detected, or a Botrytis-resistance-conierring part thereof, from said Botrytis-vesistant donor tomato plant to a 23o£ry£is-susceptible recipient tomato plant.
17. Method according to claim 15 or 16, wherein said Bot?ytis-resistant donor tomato plant is selected from the group consisting of Lycopersicon cerαsiforme, Lycopersicon cheesmαnii, Lycopersicon chilense, Lycopersicon chmielewskii, Lycopersicon esculentum, Lycopersicon hirsutum, Lycopersicon pαrυiflorum, Lycopersicon pennellii, Lycopersicon peruυianum, Lycopersicon pimpinellifolium and Solarium lycopersicoides.
18. Method according to any one of claims 15-17, wherein said Botrytis-xesistant donor tomato plant is a wild accession of Lycopersicon hirsutum or Lycopersicon pαrυiflorum, more preferably Lycopersicon hirsutum LYC 4/78 or Lycopersicon pαrυiflorum Gl.1601.
19. Method according to any one of claims 15-18, wherein said Botrytis-susceptible recipient tomato plant is a plant of the species Lycopersicon esculentum, more preferably an L. esculentum line that possess commercially desirable characteristics.
20. Method according to any one of claims 16-19, wherein said transfer of nucleic acid comprises crossing said Botrytis-resistant donor tomato plant with a Botrytis- susceptible recipient tomato plant to produce offspring plants, and selecting from among the offspring plants a plant that comprises in its genome said at least one QTL, or a jBofryfis-resistance-conferring part thereof.
21. Method according to claim 20, wherein said selection comprises the marker- assisted selection with a marker selected from the group consisting of the markers of
Tables 1 and 2 and the markers indicated in Figures 1, 5 and 6 as being linked to said QTL.
22. Method according to any one of claims 15-21, wherein said donor plant is Lycopersicon hirsutum LYC 4/78 and/or Lycopersicon pαrυiflorum Gl.1601, and wherein said DNA transferred from said donor plant into said recipient plant comprises at least one QTL associated with Botryt is-resistance in tomato, or a Bo£?";y£is-resistance-conferrmg part thereof, selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon pαrυiflorum Gl.1601 associated with Botrytis-τesistscΑce.
23. A Botrytis-resistant tomato plant, or part thereof, obtainable by a method according to any one of claims 13-22.
24. A jEfo£ryi£is-resistant tomato plant, or part thereof, comprising within its genome at least one QTL, or a Boiryiis-resistance-conferring part thereof, wherein said QTL is selected from the group consisting of the QTLs on chromosomes 1, 2 and 4 of Lycopersicon hirsutum LYC 4/78 and the QTLs on chromosomes 3, 4 and 9 in Lycopersicon parυiflorum Gl.1601 associated with Botrytis-xesist&nce, and wherein said QTL or said Ifoiry£ϊs-resistance-conferring part thereof is not in its natural genetic background.
25. Plant, or plant part according to claim 24, wherein said QTLs are indicated by at least one marker selected from the group consisting of the markers of Tables 1 and 2 and the markers indicated in Figures 1, 5 and 6 as being linked to said QTL.
26. A hybrid tomato plant, or part thereof, obtainable by crossing a tomato plant according to any one of claims 23-25 with a tomato plant that exhibits commercially desirable characteristics.
27. A tomato seed produced by growing the tomato plant of any one of claims 23- 26.
28. A tomato seed produced by backcrossing the plant of claim 26 with an L. esculentum plant having desirable phenotypic traits to obtain an L. esculentum plant that is Botrytis-resistant and has desirable phenotypic traits, and collecting the seeds produced by said plant.
29. Use of a QTL according to claim 11 or 12 for the production of Botrytis- resistant tomato plants.
30. Use of a marker selected from the group consisting of the markers of Tables 1 and 2 and the markers indicated in Figures 1, 5 and 6 as being linked to a QTL associated with Bot ryt is-resistance for the detection of Botryt is-resistant tomato plants.
PCT/NL2005/000762 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis WO2006046861A2 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
MX2013010797A MX349007B (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis.
ES05797992T ES2436094T3 (en) 2004-10-25 2005-10-24 Tomato plants that have higher levels of resistance to Botrytis
KR1020137010619A KR101365296B1 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis
EP05797992.4A EP1812575B1 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to Botrytis
MX2007004779A MX2007004779A (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis.
JP2007538841A JP5464804B2 (en) 2004-10-25 2005-10-24 Tomato plants with a high level of resistance to Botrytis
BRPI0516970-4A BRPI0516970A (en) 2004-10-25 2005-10-24 botrytis resistant tomato plant, method for detecting a quantitative trace site, quantitative trace site associated with botrytis resistance in tomato, method for producing a botrytis resistant tomato plant, tomato plant, tomato seed, and uses of a quantitative trace location, and from a marker
CA2584780A CA2584780C (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis
AU2005300181A AU2005300181B8 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to Botrytis
CN200580044768.8A CN101087884B (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis
KR1020077011767A KR101329485B1 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis
US11/738,279 US7968773B2 (en) 2004-10-25 2007-04-20 Tomato plants having higher levels of resistance to botrytis
IL182722A IL182722A (en) 2004-10-25 2007-04-22 Tomato plants having higher levels of resistance to botrytis
US13/166,958 US8575451B2 (en) 2004-10-25 2011-06-23 Tomato plants having higher levels of resistance to Botrytis
IL217617A IL217617A (en) 2004-10-25 2012-01-18 Tomato plants having higher levels of resistance to botrytis

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP04077931.6 2004-10-25
EP04077931A EP1652930A1 (en) 2004-10-25 2004-10-25 Botrytis-resistant tomato plants

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/738,279 Continuation US7968773B2 (en) 2004-10-25 2007-04-20 Tomato plants having higher levels of resistance to botrytis

Publications (2)

Publication Number Publication Date
WO2006046861A2 true WO2006046861A2 (en) 2006-05-04
WO2006046861A3 WO2006046861A3 (en) 2006-09-08

Family

ID=34928600

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/NL2005/000762 WO2006046861A2 (en) 2004-10-25 2005-10-24 Tomato plants having higher levels of resistance to botrytis

Country Status (14)

Country Link
US (2) US7968773B2 (en)
EP (3) EP1652930A1 (en)
JP (1) JP5464804B2 (en)
KR (2) KR101365296B1 (en)
CN (1) CN101087884B (en)
AU (1) AU2005300181B8 (en)
BR (1) BRPI0516970A (en)
CA (1) CA2584780C (en)
ES (1) ES2436094T3 (en)
IL (2) IL182722A (en)
MA (1) MA29041B1 (en)
MX (2) MX349007B (en)
RU (1) RU2403709C2 (en)
WO (1) WO2006046861A2 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007139386A1 (en) * 2006-06-01 2007-12-06 De Ruiter Seeds R & D B.V. Totv-resistant plants
EP1992218A1 (en) * 2007-05-18 2008-11-19 De Ruiter Seeds R&D B.V. Parthenocarpic genetic elements derived from S. habrochaites
US8093455B2 (en) 2006-04-25 2012-01-10 Monsanto Invest N.V. Tomato plants having higher levels of resistance to Botrytis
WO2012059497A1 (en) 2010-11-02 2012-05-10 Bayer Cropscience Ag N-hetarylmethyl pyrazolylcarboxamides
WO2012089757A1 (en) 2010-12-29 2012-07-05 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
US8420890B2 (en) 2006-03-28 2013-04-16 Cornell Research Foundation, Inc. Use of NAP gene to manipulate leaf senescence in plants
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
US9474222B2 (en) 2007-07-05 2016-10-25 Monsanto Invest B.V. Parthenocarpy genes in tomato
EP3257944A1 (en) 2016-06-14 2017-12-20 Nunhems B.V. Tomato plants having alterations in the dmr6 gene

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1652930A1 (en) * 2004-10-25 2006-05-03 De Ruiter Seeds R&D B.V. Botrytis-resistant tomato plants
PL2442636T3 (en) * 2009-06-17 2020-06-29 Monsanto Invest B.V. Tomato plants resulting from the introgression of a trait from Solanum pennellii into S. lycopersicum and having an increased yield
WO2012050962A1 (en) 2010-09-29 2012-04-19 University Of Georgia Research Foundation, Inc. Hybrid cotton plants with improved fiber quality and yield traits
WO2013033210A1 (en) * 2011-08-30 2013-03-07 Seminis Vegetable Seeds, Inc. Methods and compositions for producing capsicum plants with powdery mildew resistance
CN102759513A (en) * 2012-07-25 2012-10-31 山东农业大学 Method for quickly testing sensitivity of Botrytis cinerea to bactericide
CA3000049A1 (en) * 2015-10-30 2017-05-04 Rijk Zwaan Zaadteelt En Zaadhandel B.V. Tomato plant producing fruits with beneficial compounds
JP2019129705A (en) 2016-03-31 2019-08-08 日本たばこ産業株式会社 Method for introducing substance into plant

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002085105A2 (en) * 2001-04-25 2002-10-31 Seminis Vegetable Seeds, Inc. Tomato plants that exhibit resistance to $i(botrytis cinerea)
WO2003090521A2 (en) * 2002-04-24 2003-11-06 Seminis Vegetable Seeds, Inc. Tomato plants that exhibit resistance to botrytis cinerea

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1994000977A1 (en) 1992-07-07 1994-01-20 Japan Tobacco Inc. Method of transforming monocotyledon
EP1652930A1 (en) * 2004-10-25 2006-05-03 De Ruiter Seeds R&D B.V. Botrytis-resistant tomato plants
EP1849871A1 (en) * 2006-04-25 2007-10-31 De Ruiter Seeds R&D B.V. Tomato plants having higher levels of resistance to Botrytis

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002085105A2 (en) * 2001-04-25 2002-10-31 Seminis Vegetable Seeds, Inc. Tomato plants that exhibit resistance to $i(botrytis cinerea)
WO2003090521A2 (en) * 2002-04-24 2003-11-06 Seminis Vegetable Seeds, Inc. Tomato plants that exhibit resistance to botrytis cinerea

Non-Patent Citations (28)

* Cited by examiner, † Cited by third party
Title
ASTUA-MONGE GUSTAVO ET AL: "Xv4-vrxv4: A new gene-for-gene interaction identified between Xanthomonas campestris pv. vesicatoria race T3 and the wild tomato relative Lycopersicon pennellii" MOLECULAR PLANT-MICROBE INTERACTIONS, vol. 13, no. 12, December 2000 (2000-12), pages 1346-1355, XP002387447 ISSN: 0894-0282 *
BAI YULING ET AL: "A set of simple PCR markers converted from sequence specific RFLP markers on tomato chromosomes 9 to 12" MOLECULAR BREEDING, vol. 13, no. 3, April 2004 (2004-04), pages 281-287, XP002387463 ISSN: 1380-3743 *
BERNACCHI D ET AL: "Advanced backcross QTL analysis in tomato. I. Identification of QTLS for traits of agronomic importance from Lycopersicon hirsutum" THEORETICAL AND APPLIED GENETICS, SPRINGER, BERLIN, DE, vol. 97, no. 3, August 1998 (1998-08), pages 381-397, XP002289492 ISSN: 0040-5752 *
BROMMONSCHENKEL SERGIO H ET AL: "The broad-spectrum tospovirus resistance gene Sw-5 of tomato is a homolog of the root-knot nematode resistance gene Mi" MOLECULAR PLANT-MICROBE INTERACTIONS, vol. 13, no. 10, October 2000 (2000-10), pages 1130-1138, XP002387462 ISSN: 0894-0282 *
BROUWER D J ET AL: "Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub-NILs." THEORETICAL AND APPLIED GENETICS, vol. 108, no. 4, February 2004 (2004-02), pages 628-638, XP002320543 ISSN: 0040-5752 *
BROUWER D J ET AL: "QTL ANALYSIS OF QUANTITATIVE RESISTANCE TO PHYTOPHTHORA INFESTANS (LATE BLIGHT) IN TOMATO AND COMPARISONS WITH POTATO" GENOME, OTTAWA, CA, vol. 47, no. 3, June 2004 (2004-06), pages 475-492, XP008044118 ISSN: 0831-2796 *
COAKER G L ET AL: "Mapping, genetic effects, and epistatic interaction of two bacterial canker resistance QTLs from Lycopersicon hirsutum" THEORETICAL AND APPLIED GENETICS, vol. 108, no. 6, April 2004 (2004-04), pages 1047-1055, XP002387441 ISSN: 0040-5752 *
DENBY KATHERINE J ET AL: "Identification of Botrytis cinerea susceptibility loci in Arabidopsis thaliana" PLANT JOURNAL, vol. 38, no. 3, May 2004 (2004-05), pages 473-486, XP002320542 ISSN: 0960-7412 *
DIWAN N ET AL: "MAPPING OF VE IN TOMATO: A GENE CONFERRING RESISTANCE TO THE BROAD-SPECTRUM PATHOGEN, VERTICILLIUM DAHLIAE RACE 1" THEORETICAL AND APPLIED GENETICS, SPRINGER, BERLIN, DE, vol. 98, no. 2, February 1999 (1999-02), pages 315-319, XP000983786 ISSN: 0040-5752 *
EGASHIRA H ET AL: "Screening of wild accessions resistant to gray mold (botrytis cinerea pers.) in lycopersicon" ACTA PHYSIOLOGIAE PLANTARUM, PWN-POLISH SCIENTIFIC PUBLISHERS, WARSZAW, PL, vol. 22, no. 3, 2000, pages 324-326, XP002959171 ISSN: 0137-5881 cited in the application *
FULTON T M ET AL: "Advanced backcross QTL analysis of a Lycopersicon esculentum X Lycopersicon parviflorum cross" THEORETICAL AND APPLIED GENETICS, SPRINGER, BERLIN, DE, vol. 100, no. 7, May 2000 (2000-05), pages 1025-1042, XP002977011 ISSN: 0040-5752 *
GANAL M W ET AL: "GENETIC MAPPING OF A WIDE SPECTRUM NEMATODE RESISTANCE GENE (HERO) AGAINST GLOBODERA ROSTOCHIENSIS IN TOMATO" MOLECULAR PLANT-MICROBE INTERACTIONS, APS PRESS, ST. PAUL, MN, US, vol. 8, no. 6, 1995, pages 886-891, XP001041789 ISSN: 0894-0282 *
GANAL M W ET AL: "Recombination around the Tm2a and Mi resistance gene in different crosses of Lycopersicon peruvianum" THEORETICAL AND APPLIED GENETICS, vol. 92, no. 1, 1996, pages 101-108, XP008065927 ISSN: 0040-5752 *
GUIMARAES REJANE L ET AL: "Resistance to Botrytis cinerea in Solanum lycopersicoides is dominant in hybrids with tomato, and involves induced hyphal death." EUROPEAN JOURNAL OF PLANT PATHOLOGY, vol. 110, no. 1, January 2004 (2004-01), pages 13-23, XP002320546 ISSN: 0929-1873 *
HOEBERICHTS FRANK A ET AL: "A tomato metacaspase gene is upregulated during programmed cell death in Botrytis cinerea-infected leaves." PLANTA (BERLIN), vol. 217, no. 3, July 2003 (2003-07), pages 517-522, XP002387464 ISSN: 0032-0935 *
KABELKA E ET AL: "Two loci from Lycopersicon hirsutum LA407 confer resistance to strains of Clavibacter michiganensis subsp. michiganensis" PHYTOPATHOLOGY, vol. 92, no. 5, May 2002 (2002-05), pages 504-510, XP002387444 ISSN: 0031-949X *
MESBAH L A ET AL: "Genetic and physical analysis of a YAC contig spanning the fungal disease resistance locus Asc of tomato (Lycopersicon esculentum)" MOLECULAR AND GENERAL GENETICS, vol. 261, no. 1, February 1999 (1999-02), pages 50-57, XP002387449 ISSN: 0026-8925 *
MOREIRA LUCIANO ANDRADE ET AL: "Search for molecular markers linked to Liriomyza trifolii resistance in tomato" EUPHYTICA, vol. 109, no. 3, 1999, pages 149-156, XP002387442 ISSN: 0014-2336 *
PIERRE M ET AL: "High-resolution genetic mapping of the pepper resistance locus Bs3 governing recognition of the Xanthomonas campestris pv vesicatora AvrBs3 protein" THEORETICAL AND APPLIED GENETICS, vol. 101, no. 1-2, July 2000 (2000-07), pages 255-263, XP002387443 ISSN: 0040-5752 *
PILLEN K ET AL: "Construction of a high-resolution genetic map and YAC-contigs in the tomato Tm-2a region" THEORETICAL AND APPLIED GENETICS, vol. 93, no. 1-2, 1996, pages 228-233, XP008065916 ISSN: 0040-5752 *
ROSSI MAGDALENA ET AL: "Asr genes belong to a gene family comprising at least three closely linked loci on chromosome 4 in tomato" MOLECULAR AND GENERAL GENETICS, SPRINGER VERLAG, BERLIN, DE, vol. 252, no. 4, 1996, pages 489-492, XP002157441 ISSN: 0026-8925 *
SALVI S ET AL: "To clone or not to clone plant QTLs: present and future challenges" TRENDS IN PLANT SCIENCE, ELSEVIER SCIENCE, OXFORD, GB, vol. 10, no. 6, June 2005 (2005-06), pages 297-304, XP004932242 ISSN: 1360-1385 *
URBASCH I: "RESISTANCE OF DIFFERENT CULTIVATED AND WILD TOMATO PLANTS LYCOPERSICON-SPP TO BOTRYTIS-CINEREA RESISTENZ VERSCHIEDNER KULTUR- UND WILDTOMATENPFLANZEN (LYCOPERSICON SPP.) GEGENUEBER BOTRYTIS EINEREA PERS" JOURNAL OF PHYTOPATHOLOGY - PHYTOPATHOLOGISCHE ZEITSCHRIFT, BLACKWELL, BERLIN, DE, vol. 116, no. 4, 1986, pages 344-351, XP001182579 ISSN: 0931-1785 cited in the application *
VAN DER BIEZEN ERIK A ET AL: "Inheritance and genetic mapping of resistance to Alternaria alternata f. sp. lycopersici in Lycopersicon pennellii" MOLECULAR AND GENERAL GENETICS, vol. 247, no. 4, 1995, pages 453-461, XP008065937 ISSN: 0026-8925 *
WITSENBOER H M A ET AL: "TOMATO RESISTANCE TO ALTERNARIA STEM CANKER LOCALIZATION IN HOST GENOTYPES AND FUNCTIONAL EXPRESSION COMPARED TO NON-HOST RESISTANCE" THEORETICAL AND APPLIED GENETICS, vol. 78, no. 4, 1989, pages 457-462, XP008065930 ISSN: 0040-5752 *
YOUNG N D: "QTL mapping and quantitative disease resistance in plants" ANNUAL REVIEW OF PHYTOPATHOLOGY ANNUAL REVIEWS INC. {A}, P.O. BOX 10139, 4139 EL CAMINO WAY, PALO ALTO, CALIFORNIA 94306, USA SERIES : ANNUAL REVIEW OF PHYTOPATHOLOGY (ISSN 0066-4286), 1996, pages 479-501, XP002320545 ISSN: 0-8243-1334-8 *
ZHANG L P ET AL: "A MOLECULAR LINKAGE MAP OF TOMATO DISPLAYING CHROMOSOMAL LOCATIONS OF RESISTANCE GENE ANALOGS BASED ON A LYCOPERSICON ESCULENTUM X LYCOPERSICON HIRSUTUM CROSS" GENOME, OTTAWA, CA, vol. 45, no. 1, February 2002 (2002-02), pages 133-146, XP008044119 ISSN: 0831-2796 *
ZHANG L P ET AL: "Mapping QTLs conferring early blight (Alternaria solani) resistance in a Lycopersicon esculentumXL. hirsutum cross by selective genotyping." MOLECULAR BREEDING, vol. 12, no. 1, August 2003 (2003-08), pages 3-19, XP002387445 ISSN: 1380-3743 *

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8420890B2 (en) 2006-03-28 2013-04-16 Cornell Research Foundation, Inc. Use of NAP gene to manipulate leaf senescence in plants
AU2007241626B2 (en) * 2006-04-25 2013-12-05 Monsanto Invest N.V. Tomato plants having higher levels of resistance to botrytis
US8093455B2 (en) 2006-04-25 2012-01-10 Monsanto Invest N.V. Tomato plants having higher levels of resistance to Botrytis
AU2007241626C1 (en) * 2006-04-25 2014-06-19 Monsanto Invest N.V. Tomato plants having higher levels of resistance to botrytis
WO2007139386A1 (en) * 2006-06-01 2007-12-06 De Ruiter Seeds R & D B.V. Totv-resistant plants
US8946506B2 (en) 2006-06-01 2015-02-03 Monsanto Invest B.V. Plants having tomato torrado virus resistance
WO2008143504A2 (en) * 2007-05-18 2008-11-27 De Ruiter Seeds R & D B.V Parthenocarpic genetic elements derived from s. habrochaites
EP1992218A1 (en) * 2007-05-18 2008-11-19 De Ruiter Seeds R&D B.V. Parthenocarpic genetic elements derived from S. habrochaites
AU2008253807B2 (en) * 2007-05-18 2014-09-18 Monsanto Invest N.V. Parthenocarpic genetic elements derived from S. habrochaites
WO2008143504A3 (en) * 2007-05-18 2010-02-11 Monsanto Invest N.V. Parthenocarpic genetic elements derived from s. habrochaites
US9125353B2 (en) 2007-05-18 2015-09-08 Monsanto Invest B.V. Parthenocarpic genetic elements derived from S. habrochaites
US9474222B2 (en) 2007-07-05 2016-10-25 Monsanto Invest B.V. Parthenocarpy genes in tomato
US8722072B2 (en) 2010-01-22 2014-05-13 Bayer Intellectual Property Gmbh Acaricidal and/or insecticidal active ingredient combinations
WO2012059497A1 (en) 2010-11-02 2012-05-10 Bayer Cropscience Ag N-hetarylmethyl pyrazolylcarboxamides
US9206137B2 (en) 2010-11-15 2015-12-08 Bayer Intellectual Property Gmbh N-Aryl pyrazole(thio)carboxamides
WO2012089757A1 (en) 2010-12-29 2012-07-05 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
EP3257944A1 (en) 2016-06-14 2017-12-20 Nunhems B.V. Tomato plants having alterations in the dmr6 gene

Also Published As

Publication number Publication date
ES2436094T3 (en) 2013-12-27
AU2005300181A8 (en) 2011-08-11
RU2007119388A (en) 2008-11-27
MX2007004779A (en) 2007-07-11
KR101365296B1 (en) 2014-02-19
JP5464804B2 (en) 2014-04-09
EP1812575A2 (en) 2007-08-01
EP2298068A3 (en) 2011-06-15
JP2008517621A (en) 2008-05-29
CA2584780C (en) 2021-07-06
AU2005300181A1 (en) 2006-05-04
BRPI0516970A (en) 2008-09-30
CN101087884A (en) 2007-12-12
MX349007B (en) 2017-07-06
RU2403709C2 (en) 2010-11-20
US20070300314A1 (en) 2007-12-27
MA29041B1 (en) 2007-11-01
KR101329485B1 (en) 2013-11-22
KR20130055024A (en) 2013-05-27
EP1812575B1 (en) 2013-08-28
CN101087884B (en) 2014-05-14
US7968773B2 (en) 2011-06-28
IL217617A (en) 2014-01-30
EP2298068A2 (en) 2011-03-23
US20110321192A1 (en) 2011-12-29
WO2006046861A3 (en) 2006-09-08
IL182722A (en) 2014-01-30
KR20070084532A (en) 2007-08-24
AU2005300181B2 (en) 2011-07-28
EP1652930A1 (en) 2006-05-03
AU2005300181B8 (en) 2011-08-11
CA2584780A1 (en) 2006-05-04
IL182722A0 (en) 2007-07-24
US8575451B2 (en) 2013-11-05

Similar Documents

Publication Publication Date Title
AU2005300181B8 (en) Tomato plants having higher levels of resistance to Botrytis
AU2008253807B2 (en) Parthenocarpic genetic elements derived from S. habrochaites
US8093455B2 (en) Tomato plants having higher levels of resistance to Botrytis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV LY MD MG MK MN MW MX MZ NA NG NO NZ OM PG PH PL PT RO RU SC SD SG SK SL SM SY TJ TM TN TR TT TZ UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SZ TZ UG ZM ZW AM AZ BY KG MD RU TJ TM AT BE BG CH CY DE DK EE ES FI FR GB GR HU IE IS IT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2005300181

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 554558

Country of ref document: NZ

WWE Wipo information: entry into national phase

Ref document number: 2584780

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/a/2007/004779

Country of ref document: MX

Ref document number: 11738279

Country of ref document: US

WWE Wipo information: entry into national phase

Ref document number: 182722

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 200750029

Country of ref document: ES

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2007538841

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2005300181

Country of ref document: AU

Date of ref document: 20051024

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 1020077011767

Country of ref document: KR

WWE Wipo information: entry into national phase

Ref document number: 2007119388

Country of ref document: RU

Ref document number: 2005797992

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 200580044768.8

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 2005797992

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 11738279

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0516970

Country of ref document: BR

WWR Wipo information: refused in national office

Ref document number: 200750029

Country of ref document: ES

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 217617

Country of ref document: IL

Ref document number: 217615

Country of ref document: IL

Ref document number: 217616

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: 1020137010619

Country of ref document: KR