WO2000044914A1 - Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna - Google Patents

Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna Download PDF

Info

Publication number
WO2000044914A1
WO2000044914A1 PCT/US2000/002227 US0002227W WO0044914A1 WO 2000044914 A1 WO2000044914 A1 WO 2000044914A1 US 0002227 W US0002227 W US 0002227W WO 0044914 A1 WO0044914 A1 WO 0044914A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
rna
double
expression
target gene
Prior art date
Application number
PCT/US2000/002227
Other languages
French (fr)
Other versions
WO2000044914B1 (en
Inventor
Yin-Xiong Li
Michael J. Farrell
Margaret L. Kirby
Original Assignee
Medical College Of Georgia Research Institute, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Medical College Of Georgia Research Institute, Inc. filed Critical Medical College Of Georgia Research Institute, Inc.
Priority to CA002361201A priority Critical patent/CA2361201A1/en
Priority to AU26348/00A priority patent/AU776150B2/en
Priority to EP00904620A priority patent/EP1147204A1/en
Publication of WO2000044914A1 publication Critical patent/WO2000044914A1/en
Publication of WO2000044914B1 publication Critical patent/WO2000044914B1/en
Priority to AU2004100997A priority patent/AU2004100997A4/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/13Decoys
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.

Definitions

  • Double-stranded RNA has been shown to attenuate specific gene expression in C. elegans, Drosophila and Trypanosoma brucei (M. Montgomery, et al., Proc. Natl. Acad. Scl U.S.A. 95, 15502-15507 (1998); J. Kennerdell et al., Cell 95, 1017-1026 (1998); H. Ngo et al., Proc. Natl. Acad. Sci. U.S.A. 95, 14687-14692 (1998)).
  • the types of genes attenuated in these invertebrates include some encoding transcription factors and others that encode growth factor receptors.
  • the present invention provides a method for attenuating gene expression in a cell using gene-targeted double-stranded RNA (dsRNA).
  • dsRNA gene-targeted double-stranded RNA
  • the dsRNA contains a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene.
  • the cell into which the dsRNA is introduced can be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus).
  • Gene expression can be attenuated in a whole organism, an organ or tissue of an organism, including a tissue explant, or in cell culture.
  • the cell is a vertebrate cell, but the invention is not limited to vertebrates.
  • Double-stranded RNA is introduced directly into the cell or, alternatively, into the extracellular environment from which it is taken up by the cell. Inhibition is specific for the targeted gene.
  • the targeted gene can be a chromosomal gene or an extrachromosomal gene.
  • the targeted gene may be present in the genome of the cell into which the dsRNA is introduced, or in the genome of a pathogen, such as a virus, a bacterium, a fungus or a protozoan, which is capable of infecting such cell.
  • the targeted gene can be an endogenous gene or a foreign gene.
  • the method may partially or completely inhibit expression of the gene in the cell.
  • the expression of two or more genes can be attenuated concurrently by introducing two or more double stranded RNAs into the cell in amounts sufficient to attenuate expression of their respective target genes.
  • Double stranded RNAs that are administered "concurrently" are administered, together or separately, so as to be effective at generally the same time.
  • the invention provides a method for attenuating the expression of a target gene in an organism that involves introducing a double stranded RNA into an embryo in an amount sufficient to attenuate expression of the target gene, then growing the embryo into a fully developed organism, e.g., an adult organism, in which expression of the target gene is attenuated.
  • a phenotypic change in the organism associated with attenuated expression of the target gene can be identified.
  • the invention provides a method for attenuating the expression of a target gene in a tissue explant that involves explanting a tissue from an organism then introducing a double stranded RNA into a cell of the tissue explant in an amount sufficient to attenuate expression of the target gene.
  • the tissue explant exhibiting attenuated expression of the target gene is implanted back into the organism or is implanted into a different organism.
  • a phenotypic change in the tissue explant associated with attenuated expression of the target gene can be identified.
  • the invention provides a method for attenuating the expression of a target gene in a cell that includes annealing two complementary single stranded RNAs in the presence of potassium chloride to yield double stranded RNA; contacting the double stranded RNA with RNAse to purify the double stranded RNA by removing single stranded RNA; and introducing the purified double stranded RNA into the cell in an amount sufficient to attenuate expression of the target gene.
  • the invention further provides a method for treating or preventing a disease or infection in a mammal.
  • Double sfranded RNA is administered to the mammal in an amount sufficient to attenuate expression of a target gene, the expression of which is associated with the disease or infection.
  • the method can be used to treat or prevent a viral infection, in which case the double stranded RNA is an antiviral double sfranded RNA that attenuates the expression of a viral gene.
  • the method can be used to treat or prevent cancer, in which case the double sfranded RNA is an antitumor double sfranded RNA, or to treat an autosomal dominant genetic disease such as Huntington's chorea, in which case the double sfranded RNA attenuates the expression of an allele of a gene that is associated with the disease.
  • Concurrent inhibition of multiple genes is advantageous to treat diseases associated with multiple genes, or to treat two or more diseases or infections concurrently.
  • the method of the invention can further be used to reduce or prevent the rejection response to transplant tissue.
  • a double stranded RNA that attenuates the expression of a gene in the transplant tissue that can elicit an immune response in the recipient is administered to the transplant tissue.
  • the transplant tissue is hepatocytes.
  • a vertebrate cell that contains a double stranded RNA having a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of a target gene.
  • the vertebrate cell is preferably a fish cell, a murine cell, a bird cell or a human cell.
  • a vertebrate that contains the vertebrate cell of the invention is also provided.
  • the invention also provides a kit that includes reagents for attenuating the expression of a target gene in a cell.
  • the kit contains a DNA template that has two different promoters (preferably a T7 promoter, a T3 promoter or an SP6 promoter), each operably linked to a nucleotide sequence. Two complementary single sfranded RNAs can be transcribed from the DNA template, which can be annealed to form a double sfranded RNA effective to attenuate expression of the target gene.
  • the kit optionally contains amplification primers for amplifying the DNA sequence from the DNA template and nucleotide triphosphates (i.e., ATP, GTP, CTP and UTP) for forming RNA.
  • nucleotide triphosphates i.e., ATP, GTP, CTP and UTP
  • the kit contains two RNA polymerases, each capable of binding to a promoter on the DNA template and causing transcription of the nucleotide sequence to which the promoter is operably linked; a purification column for purifying single sfranded RNA, such as a size exclusion column; one or more buffers, for example a buffer for annealing single sfranded RNAs to yield double sfranded RNA; and RNAse A or RNAse T for purifying double sfranded RNA.
  • Figure 1 is a schematic of double-stranded RNA targeted to (a) green fluorescent protein(GFP); (b) Zf-T; or (c) Pax ⁇ .l; the location of the sequences that were used as templates to produce the GFP, Zf-T, or Pax ⁇ .l double-stranded RNA are indicated as dsRNA and the starting and ending bases are indicated for each.
  • GFP green fluorescent protein
  • Zf-T Zf-T
  • Pax ⁇ .l the location of the sequences that were used as templates to produce the GFP, Zf-T, or Pax ⁇ .l double-stranded RNA are indicated as dsRNA and the starting and ending bases are indicated for each.
  • Figure 2 is an agarose gel that demonstrates annealling of double- stranded Zf-T RNA.
  • Sense and antisense Zf-T RNA strands (lane 1) were freated with RNAse A before (lane 2) and after (lane 4) annealing. Each lane was loaded with 0.5 ⁇ g of freated (lanes 2 and 4) or unfreated RNA (lane 1 and
  • Figure 3 shows the effect of GFP double-stranded RNA injection on the transient expression of GFP in zebrafish embryos.
  • Columns A and C show the same field of embryos by light microscopy as seen under fluorescence in columns B and D, respectively.
  • Columns A and B show embryos injected at the single cell stage while columns C and D show embryos injected at the 16-cell stage.
  • Rows 1-3 are designated by treatment to the left as injected with the GFP expression vector alone (row 1), GFP expression vector with control double- stranded RNA (row 2), or GFP expression vector with GFP double-stranded RNA (row 3).
  • the embryo shown in row 4 was injected at the single cell stage with GFP and Zf-T double-stranded RNA.
  • the yolk fluorescence seen here is from the GFP expression vector and is specifically attenuated by double-stranded RNA to GFP.
  • double-stranded RNA targeted to Zf-T does not interfere with GFP expression and since this embryo shows the nil phenotype, the presence of the GFP expression vector does not attenuate the function of the Zf-T double-stranded RNA.
  • Figure 4 shows the ntl phenocopy produced by microinjection of double- stranded Zf-T RNA into single cell embryos.
  • Column A no abnormal phenotypes were apparent subsequent to injection of Zf-T sense or antisense RNA.
  • the injection of double-stranded control RNA also produced no apparent phenotypes.
  • Embryos injected with double-stranded Zf-T RNA exhibited greatly reduced tails and their somites lacked the typical chevron shape of those in the wild type embryos. The embryos shown are 5 days old.
  • Figure 6 shows the effect of Zf-T double-stranded RNA injection on development of the somites in zebrafish embryos.
  • RNA in situ hybridizations for shh show a one- cell- wide row of cells in the floorplate that are labeled along the length of the trunk and tail in wild type embryos and embryos injected with a control double- sfranded RNA; (a) is a top view; (b) is a side view; and (c) is a cross-section.
  • Figure 8 shows the effect of Zf-T double-stranded RNA injection on the expression of floating head: (a) side views and (b) dorsal views of tailbud stage zebrafish embryos.
  • RNA in situ hybridizations show ihatflh is expressed in an axial stripe in the wild type embryos and in those injected with the control double-stranded RNA.
  • Figure 9 shows (a) the range of phenotypes observed in 72 hour zebrafish embryos following injection of Zf-T double-stranded RNA; (b) 3 embryos with a complete phenotype; histological sections were used to confirm that the notochord was absent; and (c) one embryo with a partial phenotype which was confirmed by histological section to have an anterior notochord.
  • Figure 10 shows that the absence of Pax ⁇ .l expression results in severe abnormalities of head development;
  • (b) in situ hybridizations demonstrated that 24 hour embryos lack Zf-Pax6.1 expression following double-stranded Zf-Pax6.1 RNA injection into single cell embryos, although double-stranded control RNA injection had no apparent effect on Zf-pax6.1 expression. Scale bars 100 ⁇ m.
  • Figure 12 shows the effect of HirA double-sfranded RNA on the expression of HirA in explanted chick cardiac neural crest tissue.
  • Figure 13 shows the effect of GFP double-sfranded RNA injection on transient expression of GFP in murine cell culture.
  • the present invention provides a method for gene silencing in organisms and cells, especially vertebrates, using gene-specific double-sfranded RNA.
  • the ability to use double-sfranded RNA to specifically block expression of particular genes in a multicellular setting both in vivo and in vitro has broad implications for the study of developmental genetics. Equally important, it opens up a host of new medical applications. Examples include the construction of anti-viral agents, anti-tumor agents, and therapeutics designed to block expression of specific alleles of genes that have been implicated in autosomal dominant genetic diseases such as Huntington's chorea.
  • transplant rejection could be managed prior to transplantation by in vitro incubation of the tissues to be transplanted, such as hepatocytes, with an agent designed to block expression of genes associated with the generation of the host immune response.
  • the method of the present invention allows for attenuation of gene expression in a cell.
  • “Attentuation of gene expression” can take the form of partial or complete inhibition of gene function.
  • gene function can be partially or completely inhibited by blocking transcription from the gene to mRNA, or by blocking translation of the mRNA to yield the protein encoded by the gene, although it should be understood that the invention is not limited to any particular mechanism of attenuation of gene expression.
  • Inhibition of gene function is evidenced by a reduction or elimination, in the cell, of the activity associated with the protein encoded by the gene. Whether and to what extent gene function is inhibited can be determined using methods known in the art. For example, in many cases inhibition of gene function leads to a change in phenotype which is revealed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (F ACS).
  • RNA solution hybridization nuclease protection
  • Northern hybridization reverse transcription
  • gene expression monitoring with a microarray
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • F ACS fluorescence activated cell analysis
  • reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetylfransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof.
  • AHAS acetohydroxyacid synthase
  • AP alkaline phosphatase
  • LacZ beta galactosidase
  • GUS beta glucoronidase
  • CAT chloramphenicol acetylfransferase
  • GFP chloramphenicol acetylfransferase
  • GFP chloramphenicol acetylfransferase
  • GFP chloramphenicol acetylfran
  • Attenuation of gene expression can be quantified, and the amount of attenuation of gene expression in a freated cell compared to a cell not freated according to the present invention can be determined.
  • Lower doses dsRNA may result in inhibition in a smaller fraction of cells, or in partial inhibition in cells.
  • attenuation of gene expression can be time-dependent; the longer the period of time since the administration of the dsRNA, the less gene expression may be attenuated. Attenuation of gene expression can occur at the level of transcription (i.e., accumulation of mRNA of the targeted gene), or translation (i.e., production of the protein encoded by the targeted gene).
  • mRNA from the targeted gene can be detected using a hybridization probe having a nucleotide sequence outside the region selected for the inhibitory double-sfranded RNA, and translated polypeptide encoded by the target gene can be detected via Western blotting using an antibody raised against the polypeptide.
  • the method of the invention is not limited to any particular mechanism for reducing or eliminating cellular protein activity; indeed, as noted above, it is not yet fully understood how the introduction of dsRNA into a cell causes attenuation of expression of the targeted gene, nor is it known whether single or multiple mechanisms are at work.
  • the attenuation of gene expression achieved by the method of the invention is specific for the targeted gene.
  • the dsRNA inhibits the target gene without manifest effects on other genes of the cell.
  • the inhibition of the function of specific genes preferably, although not necessarily, passes through the germline.
  • a gene that is expressed in the cell is one that is transcribed to yield an mRNA and, optionally, a protein.
  • the targeted gene can be chromosomal (i.e., genomic) or exfrachromosomal. It may be endogenous to the cell, or it may be a foreign gene (i.e., a fransgene). The foreign gene can be integrated into the host genome, or it may be present on an exfrachromosomal genetic construct such as a plasmid or a cosmid.
  • the targeted gene can also be derived from a pathogen, such as a virus, bacterium, fungus or protozoan, which is capable of infecting an organism or cell.
  • the cell containing the target gene may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus).
  • the plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate.
  • Preferred microbes are those used in agriculture or by industry, and those that are pathogenic for plants or animals.
  • Fungi include organisms in both the mold and yeast morphologies. Examples of vertebrates include fish and mammals, including cattle, goat, pig, sheep, hamster, mouse, rat, and human; invertebrate animals include nematodes and other worms, Drosophila, and other insects.
  • the cell is a vertebrate cell.
  • the cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like.
  • the cell can be a gamete or an embryo; if an embryo, it can be a single cell embryo or a constituent cell or cells from a multicellular embryo.
  • embryo thus also includes fetal tissue.
  • the cell having the target gene may be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as from a cell of an organ or tissue, including fetal tissue, or any other cell present in an organism.
  • Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, devisrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
  • Double-stranded RNA The dsRNA is formed from one or more strands of polymerized ribonucleotide. When formed from only one strand, it takes the form of a self- complementary hairpin-type molecule that doubles back on itself to form a duplex. When formed from two strands, the two strands are complementary RNA strands.
  • the dsRNA can include modifications to either the phosphate- sugar backbone or the nucleoside. For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Likewise, bases may be modified to block the activity of adenosine deaminase.
  • the nucleotide sequence of the dsRNA is defined by the nucleotide sequence of its targeted gene.
  • the dsRNA contains a nucleotide sequence that is essentially identical to at least a portion of the target gene; preferably the dsRNA contains a nucleotide sequence that is completely identical to at least a portion of the target gene. It should be understood that in comparing an RNA sequence to a DNA sequence, an "identical" RNA sequence will contain ribonucleotides where the DNA sequence contains deoxyribonucleotides, and further that the RNA sequence will contain a uracil at positions where the DNA sequence contains thymidine.
  • the dsRNA that is completely identical to at least a portion of the target gene does not contain any additional nucleotides.
  • the portion of the target gene to which the dsRNA sequence is essentially or completely identical is preferably a sequence that is unique to the genome of the cell into which the dsRNA is to be introduced.
  • a dsRNA that is "essentially identical" to a least a portion of the target gene is a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is either identical to the sequence of that portion of the target gene or contains one or more insertions, deletions or single point mutations relative to the nucleotide sequence of that portion of the target gene.
  • the invention thus has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence.
  • a dsRNA that is "essentially identical" to at least a portion of the target gene can be functionally as a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is capable of hybridizing with a portion of the target gene transcript (e.g., under conditions including 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C hybridization for 12-16 hours; followed by washing).
  • the dsRNA nucleotide sequence that is essentially or completely identical to at least a portion of the target gene has a length of preferably at least about 25 bases, more preferably at least about 50 bases, and most preferably at least about 100 bases.
  • the dsRNA nucleotide sequence has a length of preferably less than about 400 bases, more preferably less than about 300 base, and most preferably less than about 200 bases. It will be understood that the length of the dsRNA, the degree of homology necessary to affect gene expression, and the most effective dosages can be optimized for each particular application using routine methods.
  • Single sfrands of RNA are synthesized in vitro.
  • single sfranded RNA is enzymatically synthesized from the PCR products of a DNA template, preferably a cloned a cDNA template.
  • a cloned cDNA template can be readily made from target cell RNA using reverse-franscriptase polymerase chain reaction (RT-PCR) to generate a cDNA fragment, following by cloning the cDNA fragment into a suitable vector.
  • RT-PCR reverse-franscriptase polymerase chain reaction
  • the vector is designed to allow the generation of complementary forward and reverse PCR products.
  • the vector pGEM-T (Promega, Madison WI) is well-suited for use in the method because it contains a cloning site positioned between oppositely oriented promoters (i.e., T7 and SP6 promoters; T3 promoter could also be used).
  • T7 and SP6 promoters i.e., T7 and SP6 promoters; T3 promoter could also be used.
  • complementary single sfranded RNAs are synthesized, in separate reactions, from the DNA templates via RT-PCR using two different RNA polymerases (e.g., in the case of pGEM-T, T7 polymerase and SP6 polymerase). RNAse-free DNAse is added to remove the DNA template, then the single- stranded RNA is purified.
  • Single sfrands of RNA can also be produced enzymatically or by partial/total organic synthesis.
  • the use of in vitro enzymatic or organic synthesis allows the introduction of any desired modified ribonucleotide.
  • the RNA sfrands may or may not be polyadenylated; and the RNA sfrands may or may not be capable of being franslated into a polypeptide by a cell's franslational apparatus.
  • purification of RNA is performed without the use of phenol or chloroform.
  • Double sfranded RNA is formed in vitro by mixing complementary single sfranded RNAs, preferably in a molar ratio of at least about 3:7, more preferably in a molar ratio of about 4:6, and most preferably in essentially equal molar amounts (i.e., a molar ratio of about 5:5).
  • the single sfranded RNAs are denatured prior to annealing, and the buffer in which the annealing reaction takes place contains a salt, preferably potassium chloride.
  • the mixture containing the annealed (i.e., double sfranded) RNA is preferably freated with an enzyme that is specific for single sfranded RNA (for example, RNAse A or RNAse T) to confirm annealing and to degrade any remaining single sfranded RNAs. Addition of the RNAse also serves to excise any overhanging ends on the dsRNA duplexes.
  • Double sfranded RNA can be introduced into the cell in a number of different ways.
  • the dsRNA is conveniently administered by microinjection; other methods of introducing nucleic acids into a cell include bombardment by particles covered by the dsRNA, soaking the cell or orgamsm in a solution of the dsRNA, elecfroporation of cell membranes in the presence of the dsRNA, liposome-mediated delivery of dsRNA and fransfection mediated by chemicals such as calcium phosphate, viral infection, transformation, and the like.
  • the dsRNA may be introduced along with components that enhance RNA uptake by the cell, stabilize the annealed sfrands, or otherwise increase inhibition of the target gene.
  • the cells are conveniently incubated in a solution containing the dsRNA or lipid-mediated fransfection; in the case of a whole animal or plant, the dsRNA is conveniently introduced by injection or perfusion into a cavity or interstitial space of an organism, or systemically via oral, topical, parenteral (including subcutaneous, intramuscular and intravenous administration), vaginal, rectal, infranasal, ophthalmic, or infraperitoneal administration.
  • the dsRNA can be administered via and implantable extended release device.
  • Methods for oral introduction include direct mixing of RNA with food of the organism, as well as engineered approaches in which a species that is used as food is engineered to express an RNA, then fed to the organism to be affected.
  • the dsRNA may be sprayed onto a plant or a plant may be genetically engineered to express the RNA in an amount sufficient to kill some or all of a pathogen known to infect the plant.
  • dsRNA can be supplied to a cell indirectly by introducing one or more vectors that encode both single sfrands of a dsRNA (or, in the case of a self-complementary RNA, the single self-complementary strand) into the cell.
  • the vector contains 5' and 3' regulatory elements that facilitate transcription of the coding sequence.
  • Single sfranded RNA is transcribed inside the cell, and, presumably, double sfranded RNA forms and attenuates expression of the target gene.
  • Methods for supplying a cell with dsRNA by infroducing a vector from which it can be transcribed are set forth in WO 99/32619 (Fire et al., published 1 July 1999).
  • a fransgenic animal that expresses RNA from such a recombinant construct may be produced by infroducing the construct into a zygote, an embryonic stem cell, or another multipotent cell derived from the appropriate organism.
  • a viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct.
  • the dsRNA is typically administered in an amount that allows delivery of at least one copy per cell.
  • the amount ofdsRNA administered to a cell, tissue, or organism depends on the nature of the cell, tissue, or organism, the nature of the target gene, and the nature of the dsRNA, and can readily be optimized to obtain the desired level of gene inhibition.
  • at least about 0.8 x 10 6 molecules ofdsRNA are injected; more preferably, at least about 20 x 10 6 molecules ofdsRNA are injected; most preferably, at least about 50 x 10 6 molecules ofdsRNA are injected.
  • the amount of dsRNA injected into a single cell embryo is, however, preferably at most about 1000 x 10 6 molecules; more preferably, it is at most about 500 x 10 6 molecules, most preferably, at most about 100 x 10 6 molecules.
  • the cells are preferably exposed to similar levels of dsRNA in the medium.
  • 8-10 ⁇ L of cell culture or tissue can be contacted with about 20 x 10 6 to about 2000 x 10 6 molecules ofdsRNA, more preferably about 100 x 10 6 to about 500 x 10 6 molecules ofdsRNA, for effective attenuation of gene expression.
  • the minimum effective length of the dsRNA it is routine to determine the effects ofdsRNA agents that are produced using synthesized oligoribonucleotides.
  • the administration of the dsRNA can be by microinjection or by other means used to deliver nucleic acids to cells and tissues, including culturing the tissue in medium containing the dsRNA.
  • the present invention may be used to introduce dsRNA into a cell for the treatment or prevention of disease.
  • a target gene is selected which is required for initiation or maintenance of the disease/pathology.
  • the dsRNA can be introduced into the organism using in vitro, ex vivo or in vivo methods.
  • the dsRNA is introduced into a cell, which may or may not be a cell of the organism, and the dsRNA-containing cell is then introduced into the organism.
  • cells of the organism are explanted, the dsRNA is introduced into the explanted cells, and the dsRNA-containing cells are implanted back into the host.
  • dsRNA is administered directly to the organism.
  • the dsRNA can also be delivered to a cell using one or more vectors that encode the complementary RNAs (or self-complementary RNA), which are then transcribed inside the cell and annealed to yield the desired dsRNA.
  • the target gene can be an endogenous gene of the organism, or can be the gene of a pathogen.
  • dsRNA may be introduced into a cancerous cell or tumor, and thereby inhibit expression of a gene required for maintenance of the carcinogenic/tumorigenic phenotype.
  • An exemplary list of potential target genes, including developmental genes, oncogenes, and enzymes, and a list of cancers that can be freated according to the present invention can be found in WO 99/32619 (Fire et al., published 1 July 1999).
  • a candidate target gene derived from a pathogen might, for example, cause immunosuppression of the host or be involved in replication of the pathogen, transmission of the pathogen, or maintenance of the infection.
  • the method of the invention can also be used to regulate the expression of an exogenous gene or "fransgene" that has been introduced into a host plant or animal.
  • a fransgene that is present in the genome of a cell as a result of genomic integration of the viral delivery construct can be regulated using dsRNA according to the invention.
  • the present invention allows the creation of plants with reduced susceptibility to climatic injury, insect damage, infection by a pathogen, or with altered fruit ripening characteristics.
  • the targeted gene may be an enzyme, a plant structural protein, a gene involved in pathogenesis, or an enzyme that is involved in the production of a non-proteinaceous part of the plant (i.e., a carbohydrate or lipid).
  • the method of the present invention is also useful to identify and characterize gene function in an organism.
  • dsRNA is targeted to a gene of previously unknown function, and the resultant change in phenotype is observed and, optionally, quantified.
  • This approach is useful to identify potential targets for pharmaceutics, to promote understanding normal and pathological events associated with development, to determine signaling pathways responsible for postnatal development and aging, and the like.
  • dsRNA can be designed to target a partial sequence of an expressed sequence tag (EST). Functional alterations in growth, development, metabolism, disease resistance, or other biological processes would be indicative of the normal role of the EST's gene product.
  • EST expressed sequence tag
  • dsRNA targeted to new genes found by genomic sequencing programs or other "data mining" of genomic data can be used to understand the physiological roles of these new genes.
  • the ease with which dsRNA can be introduced into an intact cell or organism containing the target gene allows the present invention to be used in high throughput screening (HTS) applications.
  • dsRNA can be produced by an amplification reaction using primers flanking the inserts of any cDNA or genomic DNA gene library derived from the target cell or orgamsm.
  • the present invention may be useful in the study of essential genes. Such genes may be required for cell or organism viability at only particular stages of development or cellular compartments.
  • the functional equivalent of conditional mutations may be produced by inhibiting activity of the target gene when or where it is not required for viability.
  • the invention allows addition of RNA at specific times of development and locations in the organism without introducing permanent mutations into the target genome.
  • the present invention can target inhibition through the appropriate exons to specifically inhibit or to distinguish among the functions of family members.
  • a hormone that contained an alternatively spliced fransmembrane domain may be expressed in both membrane bound and secreted forms.
  • the functional consequences of having only secreted hormone can be determined according to the invention by targeting the exon containing the fransmembrane domain and thereby inhibiting expression of membrane-bound hormone.
  • the present invention may be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of RNA to test samples or subjects, Preferred components are the dsRNA and a vehicle that promotes introduction of the dsRNA.
  • a kit may also include instructions to allow a user of the kit to practice the invention.
  • This technique employs a ribozyme to mediate a gene "knockdown" (Y. Xie et al., Proc. Natl. Acad. Sci. U.S.A., 94, 13777-13781 (1997)).
  • Murine NIH/3T3 cells are an extremely well- characterized tumor cell line from mice fibroblasts, and have been used to develop and test numerous therapies, including gene therapies, intended for use in humans.
  • double-sfranded RNA To determine whether double-sfranded RNA can attenuate endogenous gene expression, single cell zebrafish embryos were injected with double- sfranded RNA specifically targeted to three genes of particular interest: GFP, Zf- T and Pax6.1.
  • GFP The phenotypic role played by GFP has been well-characterized in zebrafish; Zf-T is a reporter gene that has been very useful for dissecting promoter activity in zebrafish embryos; and Pax ⁇ .l is a gene that has been thoroughly studied in other organisms.
  • the GFP expression vector, pEGFP-Nl (GenBank accession number U55762.1), was obtained from Clontech, Inc.
  • RNA from staged zebrafish embryos was obtained using the ULTRASPEC RNA isolation kit (Biotecx Laboratories, Inc.). Fifty embryos are sufficient to obtain the necessary amount of RNA
  • Zf-T cDNA fragment A 321 bp Zf-T cDNA fragment (nucleotide number 1764 to 2085; GenBank accession number S57147) was generated by reverse franscriptase-polymerase chain reaction (RT-PCR) from RNA of 8 hour zebrafish embryos.
  • the sequence of upstream primer was 5' TTGGAACAACTTGAGGGTGA 3* (SEQ ID NO: 1) and the downsfream primer was 5'CGGTCACTTTTCAAAGCGTAT 3' (SEQ ID NO:2).
  • the primers were designed to amplify a unique portion of the gene that lies outside of the T-box region (Fig. 1).
  • Ntl insertion sequence cDNA fragment Ntl insertion sequence cDNA fragment.
  • a 488 bp cDNA fragment of the ntl insertion sequence (GenBank accession number X71596) was also generated by RT-PCR. This fragment disrupts Zf-T in a ntl mutant allele and served as a negative control for the double-sfranded Zf-T RNA injection.
  • the sequence of the upstream primer was 5' ACCCTATACACCCCCACCTC 3' (SEQ ID NO:3) and the downsfream primer was 5' ATAATAGGCACCGCTCATGC 3' (SEQ ID NO:4).
  • a 298 bp Pax ⁇ .l cDNA fragment (GenBank accession number X63183) was generated by RT-PCR of RNA obtained from 24 hour zebrafish embryos.
  • the upstream primer was
  • Nkx cDNA fragments Nkx cDNA fragments. cDNA fragments for zebrafish Nkx 2-3, 2-5 and 2-7 genes were obtained in a similar manner.
  • the upstream primer was 5' AACCGTGTTTAACGGGATCA (SEQ ID NO:7) and the downsfream primer was 5' GGTTGCACTGGCACTACCAT (SEQ ID NO:8), yielding a 291 base pair product, representing positions 775-1065 of the Nkx 2-3 coding sequence.
  • the upstream primer was 5' CATCTTGCATGCTGTCCACT (SEQ ID NO:9) and the downsfream primer was 5 ' AGATCTTCACCCGGGTCTTC (SEQ ID NO: 10), yielding a 250 base pair product, representing positions 232-481 of the Nkx 2-5 coding sequence.
  • the upstream primer was 5' CATTTGCCAACACGAGTCAA (SEQ ID NO: 11) and the downsfream primer was 5' CCAGTCCAGTGCCATTTGAT (SEQ ID NO:12), yielding a 141 base pair product, representing positions 911 to 1051 of the Nkx 2-7 coding sequence.
  • GFP cDNA fragment A cDNA fragment at the 5' end of the GFP coding sequence was used as template for double-sfranded GFP RNA.
  • This 187 bp partial cDNA GFP fragment was obtained using PCR by amplifying a GFP fragment from pEGFP-Nl using chimeric primers containing T7 promoter specific sequence and a GFP sequence.
  • the forward primer was 5'- TAATACGACTCACTATAGGGTAAACGGCCACAAGTTC (SEQ ID NO: 13) and the reverse primer was 5 ' - TAATACGACTCACTATAGGGTCGTGCTGCTTCATGTG (SEQ ID NO: 14), yielding a 187 base pair product representing positions 743 to 930.
  • T7 polymerase was used to simultaneously generate sense and antisense sfrands using this PCR-generated fragment as a template.
  • Double-sfranded RNA was then generated from these cloned sequences.
  • two sets of PCR products were first generated from the cloned fragment (Fig. 1 ). One PCR product was generated using a primer that is antisense to the T7 promoter sequence, and the other PCR product was generated using a primer that was antisense to the SP6 promoter.
  • RNAse-free DNAse e.g., RQ Dnase
  • the double- sfranded RNA was formed by mixing equal quantities (i.e., 1:1 molar ratios) of the single-strand RNAs that had been denatured at 70°C for 5 minutes in 80 mM KC1 and incubating 1-2 hours at 37 °C. Prior to injection, the efficiency of RNA annealing was determined by RNAse A (0.5 ⁇ g/ml) digestion for 15 minutes at 37°C (Fig. 2).
  • RT-PCR Reverse franscriptase-polymerase chain reaction was used to quantify the message level after double-sfranded RNA treatment.
  • RNA was extracted by RNAEasy minicolumn (Qiagen). RNA samples were freated with 1 unit RNAse free-DNAse I /l ⁇ g RNA, at 37°C for 15 minutes. The RNA was extracted with phenol/chloroform and precipitated with 2.5 volumes of 95% ethanol and 50 ng RNA was used for PCR to confirm that there was no DNA contamination.
  • RNA (0.1 ⁇ g) was combined with 50 ng of oligo(dT) 15 primers in 10 ⁇ l water at 65°C for 10 minutes then cooled to room temperature for 5 minutes. The reverse franscription was carried out at 42°C for 1.5 hours with
  • RNA O.l ⁇ g of total RNA, 0.1 ⁇ g of random primer, 20 units RNasin, 200 ⁇ M dNTPs, 200 U Superscript ⁇ RNAse H reverse franscriptase (GIBCO BRL Inc.), 75 mM KC1, 3 mM MgCl 2 , 20 mM DTT in 50 mM Tris-HCl, pH 8.3, at a final volume of 20 ⁇ l.
  • One unit of ribonuclease H was added to digest the RNA at 37°C for 30 minutes. The reaction was stopped by heating at 94°C for 5 minutes.
  • the PCR was performed in 50 ⁇ l containing 2 ⁇ l cDNA product from the reverse franscription, 200 ⁇ M dNTPs, 10 pmol primers, and 1.0 unit of Taq polymerase, 50 mM KC1, 1.5 mM MgCl 2 , and 0.001% gelatin in 10 mM Tris- HCl, pH 8.3.
  • a GenAmp PCR System 2400 (Perkin Elmer) was used with the following program: 94°C, 1 minutes, 29 cycles of: 94°C for 25 seconds; 56°C for 20 seconds; 72°C for 30 seconds; final extension was at 72°C for 7 minutes.
  • the PCR product was separated on a 2% agarose gel.
  • the PCR product of the Zf-T gene (GenBank accession number S57147) is 271 bp. It covers the cDNA region of Zf-T from base 1381 to 1750.
  • the forward primer sequence was 5' TTGATCTTGGCTTCAGGAGG 3 ' (SEQ ID NO: 15) and downsfream primer was 5' TGCAATGGTTACCAGTTTTGA 3' (SEQ ID NO: 16).
  • Primers for zebrafish ⁇ actin (used as a control) (GenBank accession number AF 025305) were upstream primer 5' CCCTTGACTTTGAGCAGGAG 3' (SEQ ID NO: 17) (starting from base 665) and downsfream primer 5' ACAGGTCCTTACGGATGTCG 3 ' (ending at base 886) (SEQ ID NO: 18).
  • the PCR product size was 221 bp.
  • In situ hybridizations were performed as previously described (Wilkinson, 1992). Sense and antisense probes were generated from a region of the Zf-T gene lying outside the region targeted by the double-sfranded RNA. Embryos were fixed in 4% paraformaldehyde at 4°C or Bou n's fixative at room temperature. For histology, embryos were dehydrated in an alcohol series then cleared in xylene. Embryos were embedded in paraffin and sectioned on a microtome at a thickness of 5 ⁇ m and were mounted. The slides were deparaffinized, rehydrated and placed in acid alcohol (1% HC1 in 70% ethanol) for 5 min, then rinsed in distilled water. Giemsa staining was performed as previously described (Vacca, 1985). RESULTS
  • Targeted double-stranded RNA blocks transient expression of GFP
  • Fig. 3 shows the effect of double-sfranded GFP RNA injection on fransient GFP expression in zebrafish single cell or 16-cell zebrafish embryos.
  • Microinjection of the GFP expression vector pEGFP-Nl into single cell zebrafish embryos resulted in the fransient expression of GFP in 85% of the embryos.
  • GFP expression was monitored by fluorescence microscopy throughout early embryogenesis.
  • GFP-targeted double-sfranded RNA was generated for the region shown in Fig. 1, and embryos were co-injected with either GFP double-sfranded RNA or a confrol double-sfranded RNA (i.e., the ntl insertion sequence dsRNA).
  • Targeted double-stranded RNA blocks Zf-T gene expression
  • the T gene has dramatic phenotypes in mutant and fransgenic animals.
  • the mouse T (Brachyury) gene is required for normal mesoderm development and extension of the body axis (Herrmann et al., 1990).
  • the zebrafish homologue of the T gene (Zf-T) plays an important role in midline development. Mutation of the Zf-T gene is known to result in the no tail (ntl) mutant phenotype, a Brachyury orthologue.
  • the ntl embryos closely resemble mouse TAT mutant embryos in that they lack a differentiated notochord and show poor development of the caudal body (M. Halpern et al., Cell 75, 99-111 (1993)).
  • Brachyury encodes a member of the T-box franscription factor family that is expressed in the notochord and is essential for the proper development of midline structures. Loss of function of this gene causes arrested development of notochord. The lack of notochord differentiation leads to disrupted morphogenesis of the mesoderm during gastrulation. This is particularly evident in the appearance of the somites, which lack the chevron-shaped organization found in wild-type embryos.
  • Fig. 4 shows the effect of double-sfranded Zf-T RNA injection on Zf-T expression in zebrafish single cell embryos.
  • Fig. 4a shows the effect of double-sfranded Zf-T RNA injection on Zf-T expression in zebrafish single cell embryos.
  • Fig. 4a shows 71% of the zebrafish embryos that had been injected at the single cell stage with approximately 10 4 double-sfranded RNA molecules generated from the Zf-T cDNA fragment had phenotypes that were grossly similar to that of the ntl mutant, i.e., truncated tails and disorganized somites (Fig. 4a).
  • Injection of Zf-T single-stranded sense or antisense RNA, or double-sfranded RNA generated from the control ntl inserted sequence did not lead to a significant incidence of this phenotype (Table 1).
  • the Zf-T message was undetectable by in situ hybridization in 20% of the embryos (11/56) and weakly expressed in another 50% of embryos injected with Zf-T double-sfranded RNA (Fig. 4b).
  • Phenocopy of ntl generated by injection of Zf-T double-stranded RNA To determine whether the mutant zebrafish generated by injection of Zf-T double-sfranded RNA into single cell embryos phenocopied the ntl mutant, cross-sections of 24 hour embryos injected with Zf-T double-sfranded RNA or confrol double-sfranded RNA were examined. The results are shown in Fig. 5. Embryos injected with the Zf-T double-sfranded RNA generally lacked a fully developed notochord as is seen in naturally occurring mutants, while those injected with the confrol double-sfranded RNA had a notochord similar to that seen in uninjected embryos.
  • Fig. 7 shows the effect of Zf-T double-sfranded RNA injection on the expression of shh.
  • the expression pattern of shh throughout the floorplate of the embryos injected with the Zf-T double-sfranded RNA was 3-4 cells wide. This is identical to the expression pattern found for this gene in ntl embryos (Halpern et al., 1997). More than 50% of the embryos examined had a similar, but less complete alteration of shh expression.
  • Embryos injected with Zf-T double-sfranded RNA also show diffuse and broadened flh expression in the tailbud. This is similar to the expression pattern of flh found in the ntl mutant (A. Melby et al., Dev. Dyn. 209, 156-165 (1997)). This partial effect onflh expression was observed in more than 80% of the embryos examined.
  • Embryos injected with 4.0xl0 6 double-sfranded RNAs or less did not show a significant incidence of the ntl phenotype.
  • Embryos injected with a confrol double-sfranded RNA were phenotypically normal.
  • Embryos injected simultaneously with sense and antisense single-stranded RNAs also did not display abnormal phenotypes. Table 1. The injected RNA molecular numbers and embryos with phenotypic changes.
  • S/A indicates the unannealed sense and antisense RNA mixture.
  • microinjection of double-sfranded Zf-T RNA resulted in a high incidence of a phenotype similar to that of ntl.
  • Zf-T gene expression could not be detected by in situ hybridization and the message was decreased by 75% as momtored using semiquantitative RT-PCR in 12 hour embryos that had been injected with the double-sfranded RNA.
  • Expression of the zebrafish genes sonic hedgehog and floating head were altered in the embryos microinjected with the Zf-T double-sfranded RNA in a manner that is remarkably similar to the zebrafish no-tail mutant.
  • Targeted double-stranded RNA blocks Zf-Pax6.1 gene expression
  • Pax6 mutation Another unique and dramatic phenotype is associated with a naturally occurring Pax6 mutation, which was found in the mouse mutant small eyes. These embryos lack the lens placodes and normal forebrain structures. Zebrafish Pax6.1 transcripts can first be detected in the presumptive forebrain and hindbrain regions of the neural plate. Expression has also been observed in the optic vesicles and lens placodes, confirming that the Pax ⁇ .l protein is expressed in those areas of the eye where it is assumed to confrol differentiation. These expression patterns correlate well with a role for Pax ⁇ .l in lens placode and brain development in zebrafish. A second closely related gene, Zf-Pax ⁇ .2, has an expression pattern that overlaps with that of Pax ⁇ .l in zebrafish embryos.
  • Targeted double-stranded RNA blocks Zf-Nkx 2-7 gene expression
  • Nkx2-5 was identified by virtue of its homology to the Drosophila gene tinman. Null expression of tinman is associated with absent development of the Drosophila dorsal vessel, which is similar in some ways to the vertebrate heart. A number of members of the Nkx gene family play crucial roles in normal vertebrate heart development. Several Nkx family members are expressed in the developing heart of one or more vertebrate species, including Nkx 2-3, 2-5, 2-6, 2-7, and 2-8. Hemizygous mutations in the human Nkx2-5 gene, for example, are located on chromosome 5q34, are associated with defective cardiac septation and congenital heart block. Three Nkx family members known to be expressed in the zebrafish heart field: Nkx2-3, Nkx2-5, and Nkx2-7.
  • partial phenotypes of varying severity can be generated.
  • null phenotypes are particularly severe, this allows the identification of effects that would ordinarily be missed. That is, by permitting gene silencing at later stages of development, the technique has allowed us to explore the effects of blocking the expression of a gene whose inhibition would be lethal at an earlier developmental stage. This has allowed us to unmask potential roles for Zf-T in developmental processes in which it had not been previously implicated.
  • the most severe phenotypes mirror those found in animal mutant models, such as the zebrafish ntl mutant, naturally occurring mutation in Zf-T, and the mouse mutant small eyes, which is deficient in Pax6 expression.
  • confrol treatments i.e., single strand sense or antisense, or confrol ds RNA showed any phenotypes at any concenfrations that were tested.
  • the only phenotypes we observed were after injection of Zf-T or Pax ⁇ .l double- sfranded RNA, and these phenotypes specifically matched the treatment.
  • double-sfranded RNA targeted to Pax ⁇ .l affected head and eye development with no apparent effect on tail development (Fig. 12).
  • Zf-T ds RNA affected tail development without any apparent effect on the head or eye (Fig. 4).
  • this treatment does not behave like a non-specific, toxic effect which would be expected to yield similar phenotypes regardless of the double-sfranded RNA injected.
  • GFP a reporter gene encoding a protein that fluoresces when exposed to ultraviolet light
  • GFP a reporter gene encoding a protein that fluoresces when exposed to ultraviolet light
  • This reporter gene it has been possible to identify promoter regions that regulate gene expression in the zebrafish notochord, sympathetic neurons, and hematopoetic lineages.
  • co-injection of double-sfranded RNA specifically targeted to GFP suppressed expression of this reporter gene in well over 95% of the embryos injected with the plasmid vector.
  • the GFP plasmid vector would be a good marker for the distribution of double-sfranded RNA
  • the GFP plasmid is approximately 5000 base pairs of deoxyribonucleotides
  • the double-sfranded RNA is composed of ribonucleotides and it is a very short piece by comparison (around 200 base pairs).
  • Data from C. elegans (Montgomery et al., 1998) and our own observations indicate that the double-sfranded RNA has much freer access to the cell from the extracellular matrix than does the GFP expressing plasmid.
  • ntl the phenotype grossly similar to ntl, it is quite specific. In more than 70% of the embryos injected with the double-sfranded Zf-T RNA, the notochord was absent or greatly diminished. Twenty-one per cent of the embryos examined had no notochord. The somites in these embryos also lacked the characteristic chevron appearance observed in wild type embryos, similar to the ntl mutant. The ntl phenotype can be distinguished from that of another tailless phenotype seen in the floating head mutant by the lack of fusion of the somites across the midline. Embryos injected with Zf-T double-sfranded RNA did not show fusion of the somites across the midline providing a differential diagnosis for the ntl versus the similar floating head phenotype.
  • double-sfranded RNA can be toxic at high concentrations in eukaryotic animals (M. Kumar et al., Microbiol Mol Biol. Rev. 62, 1415-1434 (1998)).
  • double-sfranded RNA can induce interferon- ⁇ / ⁇ in non- immune cells, this toxicity is primarily due to an immune system response mediated through interferon production in response to viral infections. Immune system or interferon- ⁇ / ⁇ -mediated toxicity is very unlikely to play any role in generating the phenotypes we have observed.
  • the phenotypes that we have generated can be observed in 24 hour embryos, long before the zebrafish immune system has been established.
  • the thymus primordium appears in the zebrafish at approximately 54 hours, but does not enlarge significantly until 30 hours later.
  • Ragl and Rag2 expression cannot be detected until day 4, indicating a lack of mature T cells in the zebrafish until that time.
  • the amount of double-sfranded RNA that was used to generate the phenotypes is much less than is necessary to cause this interferon-mediated cell toxicity (M. Kumar et al., Microbiol Mol Biol Rev. 62, 1415-1434 (1998)).
  • polyl/polyC RNA can be toxic both in cultured 3T3 cells and in microinjected embryos.
  • none of the ten double-sfranded RNAs that we have so far examined elicit a toxic effect in vitro or in vivo.
  • the phenotypes that have been generated for each gene under study differ substantially from one another and are specifically related to the gene that was targeted.
  • injection of confrol double-sfranded RNA at the same concenfrations does not cause a detectable deviation from the wild type expression levels or phenotype.
  • Double-sfranded RNA injection blocks gene expression in explanted cardiac neural crest tissue
  • HirA GeneBank accession number X99375
  • PTA persistent truncus arteriosus
  • Double-sfranded RNA was generated from a chick HirA cDNA fragment in essentially the same manner as described for zebrafish in Example I .
  • the upstream primer was 5' TCTGCACCAGCATTAGCACT (SEQ ID NO: 19) and the downsfream primer was 5' TGCTGTGAGAATTCGACTGG (SEQ ID NO:20) yielding a 201 base pair product representing positions 2095 to 2295 of the HirA cDNA sequence.
  • Double-sfranded RNA injection blocks gene expression in mammalian cell culture
  • Double-sfranded GFP RNA was prepared as described in Example I.
  • Murine NIH/3T3 cells were fransfected with pEGFP-Nl and double sfranded GFP RNA using a standard fransfection procedure.
  • murine NTH/3T3 cells ( ⁇ 2x 10 8 per well) were seeded in a six- well tissue culture plate in 2 ml of DMEM with 10% FBS. The cells were then incubated at 37°C in a CO 2 incubator until they were about 70-80 % confluent (i.e., 18-24 hours).
  • Solution A was made by diluting 1 ⁇ g of pEGFP- Nl and 0.5-1 ⁇ g of double sfranded GFP RNA into 100 ⁇ l serum-free medium (OPTI-MEM® 1 Reduced Serum Medium, GIBCO BRL Cat. No. 320-1985), and Solution B was made by diluting 3-12 ⁇ l of LIPOFECTAMINE Reagent into 100 ⁇ l serum-free medium.
  • Solution A contained the plasmid pEGFP-Nl but no double sfranded RNA; for another, Solution A contained the plasmid pEGFP-Nl a confrol double-sfranded ntl RNA.
  • the two solutions were combined, mixed gently, and incubated at room temperature for 30 minutes.
  • the cells were washed once with 2 ml of serum-free DMEM.
  • 0.8 ml of serum-free DMEM was added to each tube containing the lipid-DNA complexes.
  • the tubes were mixed gently and the diluted complex solution was overlayed onto the washed cells.
  • the cells were incubated for 5 hours at 37°C in a CO 2 incubator.
  • DMEM (1 mL) was added with 20 % FBS without removing the fransfection mixture.
  • Medium was replaced at 18-24 hours following the start of fransfection.
  • Cell extracts were assayed for GFP activity 24-72 hours after the start of fransfection.
  • GFP expression was momtored by fluorescence microscopy.
  • transformed cells incubated with double-stranded GFP RNA molecules exhibited substantially reduced GFP expression.
  • transformed cells incubated with confrol dsRNA showed no apparent change in GFP expression.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Introduction of double stranded RNA into cells, cell culture, organs and tissues, and whole organisms, particularly vertebrates, specifically attenuates gene expression.

Description

COMPOSITION AND METHOD FOR IN VIVO AND IN VITRO
ATTENUATION OF GENE EXPRESSION
USING DOUBLE STRANDED RNA
This application claims the benefit of U.S. Provisional Application Serial No. 60/117,635, filed January 28, 1999.
Statement of Government Rights
This invention was made with government support under grants from the United States Public Health Service, Grant Nos. HL36059, HL51533, and HD 17063. The U.S. Government has certain rights in this invention.
Background of the Invention
Double-stranded RNA has been shown to attenuate specific gene expression in C. elegans, Drosophila and Trypanosoma brucei (M. Montgomery, et al., Proc. Natl. Acad. Scl U.S.A. 95, 15502-15507 (1998); J. Kennerdell et al., Cell 95, 1017-1026 (1998); H. Ngo et al., Proc. Natl. Acad. Sci. U.S.A. 95, 14687-14692 (1998)). The types of genes attenuated in these invertebrates include some encoding transcription factors and others that encode growth factor receptors. There is also evidence that double-stranded RNA may effectively silence gene expression in plants (M. Wassenegger et al., Plant. Mol Biol. 31, 349-362 (1998); P. Watergiyse et al., Proc. Natl Acad. Sci. U.S.A. 95, 13959- 13964 (1998)). Application of this method to vertebrates would be an extremely useful tool for the study of vertebrate developmental genetics and has numerous medical implications as well, however researchers have heretofore been unable to obtain successful gene silencing in vertebrates using this method. A definitive mechanism through which double-stranded RNA effects gene silencing remains has not been identified (M. Montgomery et al., Trends Genet. 14, 255-258 (1998)). Recently, Montgomery et al. reported that double- stranded RNA induces specific RNA degradation in nematodes (Proc. Natl. Acad. Sci. U.S.A. 95, 15502-15507 (1998)). This conclusion was based upon the fact that DNA sequences in the targeted regions of the gene were not altered and that 100% of the F2 generation reverted to the wild type phenotype. In addition, C. elegans has a unique genetic organization. Genes in this animal are organized in operons in which a single promoter controls expression of a number of genes. They showed that the double-stranded RNA affects only expression of the targeted gene. In contrast, however, others have observed heritable effects of double-stranded RNA on the expression of a number of genes in C. elegans, suggesting that more than one mechanism may be involved in double-stranded RNA-mediated inhibition of gene activity (H. Tahara, Science 28, 431-432 (1998)).
In transgenic plants, co-suppression of gene expression can be mediated through rapid degradation of the mRNA produced by the targeted gene (D. Smyth, Curr. Biol. 7, R793-795 (1997)). Others have shown that double- stranded RNA-dependent sequence-specific methylation may mediate the long- term effects of co-suppression in plants. Such a methylase may also be dependent on transcription of the targeted sequence since double-stranded RNA targeted to promoter regions in nematode had no apparent effect on transcription.
Summary of the Invention The present invention provides a method for attenuating gene expression in a cell using gene-targeted double-stranded RNA (dsRNA). The dsRNA contains a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene. The cell into which the dsRNA is introduced can be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus). Gene expression can be attenuated in a whole organism, an organ or tissue of an organism, including a tissue explant, or in cell culture. Preferably, the cell is a vertebrate cell, but the invention is not limited to vertebrates. Double-stranded RNA is introduced directly into the cell or, alternatively, into the extracellular environment from which it is taken up by the cell. Inhibition is specific for the targeted gene. The targeted gene can be a chromosomal gene or an extrachromosomal gene. For example, the targeted gene may be present in the genome of the cell into which the dsRNA is introduced, or in the genome of a pathogen, such as a virus, a bacterium, a fungus or a protozoan, which is capable of infecting such cell. The targeted gene can be an endogenous gene or a foreign gene. Depending on the particular target gene and the dose of dsRNA delivered, the method may partially or completely inhibit expression of the gene in the cell. The expression of two or more genes can be attenuated concurrently by introducing two or more double stranded RNAs into the cell in amounts sufficient to attenuate expression of their respective target genes. Double stranded RNAs that are administered "concurrently" are administered, together or separately, so as to be effective at generally the same time.
In another aspect, the invention provides a method for attenuating the expression of a target gene in an organism that involves introducing a double stranded RNA into an embryo in an amount sufficient to attenuate expression of the target gene, then growing the embryo into a fully developed organism, e.g., an adult organism, in which expression of the target gene is attenuated. Optionally, a phenotypic change in the organism associated with attenuated expression of the target gene can be identified.
In another aspect, the invention provides a method for attenuating the expression of a target gene in a tissue explant that involves explanting a tissue from an organism then introducing a double stranded RNA into a cell of the tissue explant in an amount sufficient to attenuate expression of the target gene. Optionally, the tissue explant exhibiting attenuated expression of the target gene is implanted back into the organism or is implanted into a different organism. Also optionally, a phenotypic change in the tissue explant associated with attenuated expression of the target gene can be identified.
In yet another aspect, the invention provides a method for attenuating the expression of a target gene in a cell that includes annealing two complementary single stranded RNAs in the presence of potassium chloride to yield double stranded RNA; contacting the double stranded RNA with RNAse to purify the double stranded RNA by removing single stranded RNA; and introducing the purified double stranded RNA into the cell in an amount sufficient to attenuate expression of the target gene.
The invention further provides a method for treating or preventing a disease or infection in a mammal. Double sfranded RNA is administered to the mammal in an amount sufficient to attenuate expression of a target gene, the expression of which is associated with the disease or infection. The method can be used to treat or prevent a viral infection, in which case the double stranded RNA is an antiviral double sfranded RNA that attenuates the expression of a viral gene. Alternatively, the method can be used to treat or prevent cancer, in which case the double sfranded RNA is an antitumor double sfranded RNA, or to treat an autosomal dominant genetic disease such as Huntington's chorea, in which case the double sfranded RNA attenuates the expression of an allele of a gene that is associated with the disease. Concurrent inhibition of multiple genes is advantageous to treat diseases associated with multiple genes, or to treat two or more diseases or infections concurrently.
The method of the invention can further be used to reduce or prevent the rejection response to transplant tissue. A double stranded RNA that attenuates the expression of a gene in the transplant tissue that can elicit an immune response in the recipient is administered to the transplant tissue. Preferably, the transplant tissue is hepatocytes.
Also provided by the invention is a vertebrate cell that contains a double stranded RNA having a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of a target gene. The vertebrate cell is preferably a fish cell, a murine cell, a bird cell or a human cell. A vertebrate that contains the vertebrate cell of the invention is also provided.
The invention also provides a kit that includes reagents for attenuating the expression of a target gene in a cell. The kit contains a DNA template that has two different promoters (preferably a T7 promoter, a T3 promoter or an SP6 promoter), each operably linked to a nucleotide sequence. Two complementary single sfranded RNAs can be transcribed from the DNA template, which can be annealed to form a double sfranded RNA effective to attenuate expression of the target gene. The kit optionally contains amplification primers for amplifying the DNA sequence from the DNA template and nucleotide triphosphates (i.e., ATP, GTP, CTP and UTP) for forming RNA. Also optionally, the kit contains two RNA polymerases, each capable of binding to a promoter on the DNA template and causing transcription of the nucleotide sequence to which the promoter is operably linked; a purification column for purifying single sfranded RNA, such as a size exclusion column; one or more buffers, for example a buffer for annealing single sfranded RNAs to yield double sfranded RNA; and RNAse A or RNAse T for purifying double sfranded RNA.
Brief Description of the Drawings
Figure 1 is a schematic of double-stranded RNA targeted to (a) green fluorescent protein(GFP); (b) Zf-T; or (c) Paxό.l; the location of the sequences that were used as templates to produce the GFP, Zf-T, or Paxό.l double-stranded RNA are indicated as dsRNA and the starting and ending bases are indicated for each.
Figure 2 is an agarose gel that demonstrates annealling of double- stranded Zf-T RNA. Sense and antisense Zf-T RNA strands (lane 1) were freated with RNAse A before (lane 2) and after (lane 4) annealing. Each lane was loaded with 0.5 μg of freated (lanes 2 and 4) or unfreated RNA (lane 1 and
3).
Figure 3 shows the effect of GFP double-stranded RNA injection on the transient expression of GFP in zebrafish embryos. Columns A and C show the same field of embryos by light microscopy as seen under fluorescence in columns B and D, respectively. Columns A and B show embryos injected at the single cell stage while columns C and D show embryos injected at the 16-cell stage. Rows 1-3 are designated by treatment to the left as injected with the GFP expression vector alone (row 1), GFP expression vector with control double- stranded RNA (row 2), or GFP expression vector with GFP double-stranded RNA (row 3). The embryo shown in row 4 was injected at the single cell stage with GFP and Zf-T double-stranded RNA. While the zebrafish yolk does show some autofluorescence at higher magnifications, it is not apparent at the magnification shown in columns A and B. The yolk fluorescence seen here is from the GFP expression vector and is specifically attenuated by double-stranded RNA to GFP. On the other hand double-stranded RNA targeted to Zf-T does not interfere with GFP expression and since this embryo shows the nil phenotype, the presence of the GFP expression vector does not attenuate the function of the Zf-T double-stranded RNA.
Figure 4 shows the ntl phenocopy produced by microinjection of double- stranded Zf-T RNA into single cell embryos. As shown in Column A, no abnormal phenotypes were apparent subsequent to injection of Zf-T sense or antisense RNA. The injection of double-stranded control RNA also produced no apparent phenotypes. Embryos injected with double-stranded Zf-T RNA exhibited greatly reduced tails and their somites lacked the typical chevron shape of those in the wild type embryos. The embryos shown are 5 days old. As shown in Column B, in situ hybridizations demonstrate that 9 hour embryos lack Zf-T expression following double-stranded Zf-T RNA injection into single cell embryos, although sense RNA, antisense RNA, and double-stranded control RNA injection had little effect on Zf-T expression. Scale bars=100μm.
Figure 5 shows the effect of Zf-T double-stranded RNA injection on development of the notochord in 24 hour zebrafish embryos. Wildtype zebrafish and embryos injected with the control double-stranded RNA developed an obvious notochord. Ntl mutant embryos lacked a notochord along the entire body axis. Twenty-one per cent of the embryos injected with the Zf-T double- stranded RNA also lacked a notochord along the entire body axis. Another 60% lacked notochord in the posterior portion of the body axis. Scale bars=100μm. Figure 6 shows the effect of Zf-T double-stranded RNA injection on development of the somites in zebrafish embryos. Both (a) wild type zebrafish embryos and (b) those injected with control double-stranded RNA developed characteristic chevron-shaped somites, whereas (c) zebrafish embryos that had been injected with double-stranded Zf-T RNA developed somites that lacked the typical chevron shape. Scale bars=100μm. Figure 7 shows the effect of Zf-T double-stranded RNA injection on the expression of sonic hedgehog. RNA in situ hybridizations for shh show a one- cell- wide row of cells in the floorplate that are labeled along the length of the trunk and tail in wild type embryos and embryos injected with a control double- sfranded RNA; (a) is a top view; (b) is a side view; and (c) is a cross-section. In embryos injected with Zf-T double-stranded RNA, the floorplate has expanded and expression of shh is 3-4 cells wide, similar to the expression found in the ntl mutant. Scale bars=100μm.
Figure 8 shows the effect of Zf-T double-stranded RNA injection on the expression of floating head: (a) side views and (b) dorsal views of tailbud stage zebrafish embryos. RNA in situ hybridizations show ihatflh is expressed in an axial stripe in the wild type embryos and in those injected with the control double-stranded RNA. An embryo injected with Zf-T double-stranded RNA shows diffuse flh expression in the tailbud and intense expression in the anterior nervous system, while expression in the body axis was greatly diminished. Scale bars=100μm.
Figure 9 shows (a) the range of phenotypes observed in 72 hour zebrafish embryos following injection of Zf-T double-stranded RNA; (b) 3 embryos with a complete phenotype; histological sections were used to confirm that the notochord was absent; and (c) one embryo with a partial phenotype which was confirmed by histological section to have an anterior notochord.
Figure 10 shows that the absence of Paxό.l expression results in severe abnormalities of head development; (a) 48 hour embryos injected with double- stranded control RNA had normal phenotypes. Microinjection of double- sfranded Zf-Pax6.1 RNA into single cell zebrafish embryos resulted in 25% of the embryos having reduced eyes often accompanied by diminished and disorganized forebrains; (b) in situ hybridizations demonstrated that 24 hour embryos lack Zf-Pax6.1 expression following double-stranded Zf-Pax6.1 RNA injection into single cell embryos, although double-stranded control RNA injection had no apparent effect on Zf-pax6.1 expression. Scale bars=100 μm. Figure 11 shows that co-injection of the Zf-T and Zf-Pax6.1 double- sfranded RNA. generates embryos with defective notochords and eyes; (a) at 5 days old, zebrafish embryos show significant defects in the eyes and tail; (b) cross sections of 48 hour embryos show that these defects included diminished eye and brain structures and (c) diminished or lacking notochord along with disorganized somites in the tail. Scale bars=100 μm.
Figure 12 shows the effect of HirA double-sfranded RNA on the expression of HirA in explanted chick cardiac neural crest tissue.
Figure 13 shows the effect of GFP double-sfranded RNA injection on transient expression of GFP in murine cell culture.
Detailed Description
The present invention provides a method for gene silencing in organisms and cells, especially vertebrates, using gene-specific double-sfranded RNA. The ability to use double-sfranded RNA to specifically block expression of particular genes in a multicellular setting both in vivo and in vitro has broad implications for the study of developmental genetics. Equally important, it opens up a host of new medical applications. Examples include the construction of anti-viral agents, anti-tumor agents, and therapeutics designed to block expression of specific alleles of genes that have been implicated in autosomal dominant genetic diseases such as Huntington's chorea. As another example, transplant rejection could be managed prior to transplantation by in vitro incubation of the tissues to be transplanted, such as hepatocytes, with an agent designed to block expression of genes associated with the generation of the host immune response. The method of the present invention allows for attenuation of gene expression in a cell. "Attentuation of gene expression" can take the form of partial or complete inhibition of gene function. Mechanistically, gene function can be partially or completely inhibited by blocking transcription from the gene to mRNA, or by blocking translation of the mRNA to yield the protein encoded by the gene, although it should be understood that the invention is not limited to any particular mechanism of attenuation of gene expression. Inhibition of gene function is evidenced by a reduction or elimination, in the cell, of the activity associated with the protein encoded by the gene. Whether and to what extent gene function is inhibited can be determined using methods known in the art. For example, in many cases inhibition of gene function leads to a change in phenotype which is revealed by examination of the outward properties of the cell or organism or by biochemical techniques such as RNA solution hybridization, nuclease protection, Northern hybridization, reverse transcription, gene expression monitoring with a microarray, antibody binding, enzyme linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), other immunoassays, and fluorescence activated cell analysis (F ACS). For RNA-mediated inhibition in a cell line or whole organism, gene expression is conveniently assayed by use of a reporter or drug resistance gene whose protein product is easily assayed. Such reporter genes include acetohydroxyacid synthase (AHAS), alkaline phosphatase (AP), beta galactosidase (LacZ), beta glucoronidase (GUS), chloramphenicol acetylfransferase (CAT), green fluorescent protein (GFP), horseradish peroxidase (HRP), luciferase (Luc), nopaline synthase (NOS), octopine synthase (OCS), and derivatives thereof. Multiple selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methofrexate, phosphinothricin, puromycin, and tefracyclin.
Attenuation of gene expression can be quantified, and the amount of attenuation of gene expression in a freated cell compared to a cell not freated according to the present invention can be determined. Lower doses dsRNA may result in inhibition in a smaller fraction of cells, or in partial inhibition in cells. In addition, attenuation of gene expression can be time-dependent; the longer the period of time since the administration of the dsRNA, the less gene expression may be attenuated. Attenuation of gene expression can occur at the level of transcription (i.e., accumulation of mRNA of the targeted gene), or translation (i.e., production of the protein encoded by the targeted gene). For example, mRNA from the targeted gene can be detected using a hybridization probe having a nucleotide sequence outside the region selected for the inhibitory double-sfranded RNA, and translated polypeptide encoded by the target gene can be detected via Western blotting using an antibody raised against the polypeptide. It should be noted that the method of the invention is not limited to any particular mechanism for reducing or eliminating cellular protein activity; indeed, as noted above, it is not yet fully understood how the introduction of dsRNA into a cell causes attenuation of expression of the targeted gene, nor is it known whether single or multiple mechanisms are at work.
The attenuation of gene expression achieved by the method of the invention is specific for the targeted gene. In other words, the dsRNA inhibits the target gene without manifest effects on other genes of the cell. Additionally, the inhibition of the function of specific genes preferably, although not necessarily, passes through the germline.
Targeted gene Any gene being expressed in a cell can be targeted. A gene that is expressed in the cell is one that is transcribed to yield an mRNA and, optionally, a protein. The targeted gene can be chromosomal (i.e., genomic) or exfrachromosomal. It may be endogenous to the cell, or it may be a foreign gene (i.e., a fransgene). The foreign gene can be integrated into the host genome, or it may be present on an exfrachromosomal genetic construct such as a plasmid or a cosmid. The targeted gene can also be derived from a pathogen, such as a virus, bacterium, fungus or protozoan, which is capable of infecting an organism or cell.
The cell containing the target gene may be derived from or contained in any organism (e.g., plant, animal, protozoan, virus, bacterium, or fungus). The plant may be a monocot, dicot or gymnosperm; the animal may be a vertebrate or invertebrate. Preferred microbes are those used in agriculture or by industry, and those that are pathogenic for plants or animals. Fungi include organisms in both the mold and yeast morphologies. Examples of vertebrates include fish and mammals, including cattle, goat, pig, sheep, hamster, mouse, rat, and human; invertebrate animals include nematodes and other worms, Drosophila, and other insects. Preferably, the cell is a vertebrate cell.
The cell having the target gene may be from the germ line or somatic, totipotent or pluripotent, dividing or non-dividing, parenchyma or epithelium, immortalized or transformed, or the like. The cell can be a gamete or an embryo; if an embryo, it can be a single cell embryo or a constituent cell or cells from a multicellular embryo. The term "embryo" thus also includes fetal tissue. The cell having the target gene may be an undifferentiated cell, such as a stem cell, or a differentiated cell, such as from a cell of an organ or tissue, including fetal tissue, or any other cell present in an organism. Cell types that are differentiated include adipocytes, fibroblasts, myocytes, cardiomyocytes, endothelium, neurons, glia, blood cells, megakaryocytes, lymphocytes, macrophages, neufrophils, eosinophils, basophils, mast cells, leukocytes, granulocytes, keratinocytes, chondrocytes, osteoblasts, osteoclasts, hepatocytes, and cells of the endocrine or exocrine glands.
Double-stranded RNA The dsRNA is formed from one or more strands of polymerized ribonucleotide. When formed from only one strand, it takes the form of a self- complementary hairpin-type molecule that doubles back on itself to form a duplex. When formed from two strands, the two strands are complementary RNA strands. The dsRNA can include modifications to either the phosphate- sugar backbone or the nucleoside. For example, the phosphodiester linkages of natural RNA may be modified to include at least one of a nitrogen or sulfur heteroatom. Likewise, bases may be modified to block the activity of adenosine deaminase.
The nucleotide sequence of the dsRNA is defined by the nucleotide sequence of its targeted gene. The dsRNA contains a nucleotide sequence that is essentially identical to at least a portion of the target gene; preferably the dsRNA contains a nucleotide sequence that is completely identical to at least a portion of the target gene. It should be understood that in comparing an RNA sequence to a DNA sequence, an "identical" RNA sequence will contain ribonucleotides where the DNA sequence contains deoxyribonucleotides, and further that the RNA sequence will contain a uracil at positions where the DNA sequence contains thymidine. More preferably, the dsRNA that is completely identical to at least a portion of the target gene does not contain any additional nucleotides. The portion of the target gene to which the dsRNA sequence is essentially or completely identical is preferably a sequence that is unique to the genome of the cell into which the dsRNA is to be introduced.
A dsRNA that is "essentially identical" to a least a portion of the target gene is a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is either identical to the sequence of that portion of the target gene or contains one or more insertions, deletions or single point mutations relative to the nucleotide sequence of that portion of the target gene. The invention thus has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. Alternatively, a dsRNA that is "essentially identical" to at least a portion of the target gene can be functionally as a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is capable of hybridizing with a portion of the target gene transcript (e.g., under conditions including 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50°C or 70°C hybridization for 12-16 hours; followed by washing).
The dsRNA nucleotide sequence that is essentially or completely identical to at least a portion of the target gene has a length of preferably at least about 25 bases, more preferably at least about 50 bases, and most preferably at least about 100 bases. The dsRNA nucleotide sequence has a length of preferably less than about 400 bases, more preferably less than about 300 base, and most preferably less than about 200 bases. It will be understood that the length of the dsRNA, the degree of homology necessary to affect gene expression, and the most effective dosages can be optimized for each particular application using routine methods.
Synthesis ofdsRNA
Single sfrands of RNA are synthesized in vitro. Preferably, single sfranded RNA is enzymatically synthesized from the PCR products of a DNA template, preferably a cloned a cDNA template. Provided the sequence of the target gene is known, a cloned cDNA template can be readily made from target cell RNA using reverse-franscriptase polymerase chain reaction (RT-PCR) to generate a cDNA fragment, following by cloning the cDNA fragment into a suitable vector. Preferably, the vector is designed to allow the generation of complementary forward and reverse PCR products. The vector pGEM-T (Promega, Madison WI) is well-suited for use in the method because it contains a cloning site positioned between oppositely oriented promoters (i.e., T7 and SP6 promoters; T3 promoter could also be used). After purification of the PCR products, complementary single sfranded RNAs are synthesized, in separate reactions, from the DNA templates via RT-PCR using two different RNA polymerases (e.g., in the case of pGEM-T, T7 polymerase and SP6 polymerase). RNAse-free DNAse is added to remove the DNA template, then the single- stranded RNA is purified. Single sfrands of RNA can also be produced enzymatically or by partial/total organic synthesis. The use of in vitro enzymatic or organic synthesis allows the introduction of any desired modified ribonucleotide. The RNA sfrands may or may not be polyadenylated; and the RNA sfrands may or may not be capable of being franslated into a polypeptide by a cell's franslational apparatus. Preferably, purification of RNA is performed without the use of phenol or chloroform.
Double sfranded RNA is formed in vitro by mixing complementary single sfranded RNAs, preferably in a molar ratio of at least about 3:7, more preferably in a molar ratio of about 4:6, and most preferably in essentially equal molar amounts (i.e., a molar ratio of about 5:5). Preferably, the single sfranded RNAs are denatured prior to annealing, and the buffer in which the annealing reaction takes place contains a salt, preferably potassium chloride. Prior to administration, the mixture containing the annealed (i.e., double sfranded) RNA is preferably freated with an enzyme that is specific for single sfranded RNA (for example, RNAse A or RNAse T) to confirm annealing and to degrade any remaining single sfranded RNAs. Addition of the RNAse also serves to excise any overhanging ends on the dsRNA duplexes.
Delivery ofdsRNA to a cell Double sfranded RNA can be introduced into the cell in a number of different ways. For example, in the case of an embryo, the dsRNA is conveniently administered by microinjection; other methods of introducing nucleic acids into a cell include bombardment by particles covered by the dsRNA, soaking the cell or orgamsm in a solution of the dsRNA, elecfroporation of cell membranes in the presence of the dsRNA, liposome-mediated delivery of dsRNA and fransfection mediated by chemicals such as calcium phosphate, viral infection, transformation, and the like. The dsRNA may be introduced along with components that enhance RNA uptake by the cell, stabilize the annealed sfrands, or otherwise increase inhibition of the target gene. In the case of a cell culture or tissue explant, the cells are conveniently incubated in a solution containing the dsRNA or lipid-mediated fransfection; in the case of a whole animal or plant, the dsRNA is conveniently introduced by injection or perfusion into a cavity or interstitial space of an organism, or systemically via oral, topical, parenteral (including subcutaneous, intramuscular and intravenous administration), vaginal, rectal, infranasal, ophthalmic, or infraperitoneal administration. In addition, the dsRNA can be administered via and implantable extended release device. Methods for oral introduction include direct mixing of RNA with food of the organism, as well as engineered approaches in which a species that is used as food is engineered to express an RNA, then fed to the organism to be affected. The dsRNA may be sprayed onto a plant or a plant may be genetically engineered to express the RNA in an amount sufficient to kill some or all of a pathogen known to infect the plant.
Alternatively, dsRNA can be supplied to a cell indirectly by introducing one or more vectors that encode both single sfrands of a dsRNA (or, in the case of a self-complementary RNA, the single self-complementary strand) into the cell. Preferably, the vector contains 5' and 3' regulatory elements that facilitate transcription of the coding sequence. Single sfranded RNA is transcribed inside the cell, and, presumably, double sfranded RNA forms and attenuates expression of the target gene. Methods for supplying a cell with dsRNA by infroducing a vector from which it can be transcribed are set forth in WO 99/32619 (Fire et al., published 1 July 1999). A fransgenic animal that expresses RNA from such a recombinant construct may be produced by infroducing the construct into a zygote, an embryonic stem cell, or another multipotent cell derived from the appropriate organism. A viral construct packaged into a viral particle would accomplish both efficient introduction of an expression construct into the cell and transcription of RNA encoded by the expression construct.
The dsRNA is typically administered in an amount that allows delivery of at least one copy per cell. The amount ofdsRNA administered to a cell, tissue, or organism depends on the nature of the cell, tissue, or organism, the nature of the target gene, and the nature of the dsRNA, and can readily be optimized to obtain the desired level of gene inhibition. To attenuate gene expression in a single cell embryo, for example, at least about 0.8 x 106 molecules ofdsRNA are injected; more preferably, at least about 20 x 106 molecules ofdsRNA are injected; most preferably, at least about 50 x 106 molecules ofdsRNA are injected. The amount of dsRNA injected into a single cell embryo is, however, preferably at most about 1000 x 106 molecules; more preferably, it is at most about 500 x 106 molecules, most preferably, at most about 100 x 106 molecules. In the case of administration ofdsRNA to a cell culture or to cells in tissue, by methods other than injection, for example by soaking, elecfroporation, or lipid- mediated fransfection, the cells are preferably exposed to similar levels of dsRNA in the medium. For example, 8-10 μL of cell culture or tissue can be contacted with about 20 x 106 to about 2000 x 106 molecules ofdsRNA, more preferably about 100 x 106 to about 500 x 106 molecules ofdsRNA, for effective attenuation of gene expression. Once the minimum effective length of the dsRNA has been determined, it is routine to determine the effects ofdsRNA agents that are produced using synthesized oligoribonucleotides. The administration of the dsRNA can be by microinjection or by other means used to deliver nucleic acids to cells and tissues, including culturing the tissue in medium containing the dsRNA. Scientific, industrial and medical applications of the technology
The present invention may be used to introduce dsRNA into a cell for the treatment or prevention of disease. To treat or prevent a disease or other pathology, a target gene is selected which is required for initiation or maintenance of the disease/pathology. The dsRNA can be introduced into the organism using in vitro, ex vivo or in vivo methods. In an in vitro method, the dsRNA is introduced into a cell, which may or may not be a cell of the organism, and the dsRNA-containing cell is then introduced into the organism. In an ex vivo method, cells of the organism are explanted, the dsRNA is introduced into the explanted cells, and the dsRNA-containing cells are implanted back into the host. In an in vivo method, dsRNA is administered directly to the organism. As noted above, the dsRNA can also be delivered to a cell using one or more vectors that encode the complementary RNAs (or self-complementary RNA), which are then transcribed inside the cell and annealed to yield the desired dsRNA.
In medical applications, the target gene can be an endogenous gene of the organism, or can be the gene of a pathogen. For example, dsRNA may be introduced into a cancerous cell or tumor, and thereby inhibit expression of a gene required for maintenance of the carcinogenic/tumorigenic phenotype. An exemplary list of potential target genes, including developmental genes, oncogenes, and enzymes, and a list of cancers that can be freated according to the present invention can be found in WO 99/32619 (Fire et al., published 1 July 1999). A candidate target gene derived from a pathogen might, for example, cause immunosuppression of the host or be involved in replication of the pathogen, transmission of the pathogen, or maintenance of the infection.
The method of the invention can also be used to regulate the expression of an exogenous gene or "fransgene" that has been introduced into a host plant or animal. For example, a fransgene that is present in the genome of a cell as a result of genomic integration of the viral delivery construct can be regulated using dsRNA according to the invention.
The present invention allows the creation of plants with reduced susceptibility to climatic injury, insect damage, infection by a pathogen, or with altered fruit ripening characteristics. In these applications, the targeted gene may be an enzyme, a plant structural protein, a gene involved in pathogenesis, or an enzyme that is involved in the production of a non-proteinaceous part of the plant (i.e., a carbohydrate or lipid). By inhibiting enzymes at one or more points in a metabolic pathway or genes involved in pathogenesis, the effect may be enhanced: each activity will be affected and the effects may be magnified by targeting multiple different components. Metabolism may also be manipulated by inhibiting feedback control in the pathway or production of unwanted metabolic byproducts.
The method of the present invention is also useful to identify and characterize gene function in an organism. In this "functional genomics" approach, dsRNA is targeted to a gene of previously unknown function, and the resultant change in phenotype is observed and, optionally, quantified. This approach is useful to identify potential targets for pharmaceutics, to promote understanding normal and pathological events associated with development, to determine signaling pathways responsible for postnatal development and aging, and the like. For example, dsRNA can be designed to target a partial sequence of an expressed sequence tag (EST). Functional alterations in growth, development, metabolism, disease resistance, or other biological processes would be indicative of the normal role of the EST's gene product. As another example, dsRNA targeted to new genes found by genomic sequencing programs or other "data mining" of genomic data can be used to understand the physiological roles of these new genes. The ease with which dsRNA can be introduced into an intact cell or organism containing the target gene allows the present invention to be used in high throughput screening (HTS) applications. For example, dsRNA can be produced by an amplification reaction using primers flanking the inserts of any cDNA or genomic DNA gene library derived from the target cell or orgamsm.
The present invention may be useful in the study of essential genes. Such genes may be required for cell or organism viability at only particular stages of development or cellular compartments. The functional equivalent of conditional mutations may be produced by inhibiting activity of the target gene when or where it is not required for viability. The invention allows addition of RNA at specific times of development and locations in the organism without introducing permanent mutations into the target genome.
Likewise, if alternative splicing produced a family of transcripts that were distinguished by usage of characteristic exons, the present invention can target inhibition through the appropriate exons to specifically inhibit or to distinguish among the functions of family members. For example, a hormone that contained an alternatively spliced fransmembrane domain may be expressed in both membrane bound and secreted forms. Instead of isolating a nonsense mutation that terminates translation before the fransmembrane domain, the functional consequences of having only secreted hormone can be determined according to the invention by targeting the exon containing the fransmembrane domain and thereby inhibiting expression of membrane-bound hormone.
The present invention may be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of RNA to test samples or subjects, Preferred components are the dsRNA and a vehicle that promotes introduction of the dsRNA. Such a kit may also include instructions to allow a user of the kit to practice the invention. Model systems
Zebrafish. Successful large-scale chemical mutagenesis screens in the zebrafish have led to speculation that this organism will become the vertebrate equivalent of Drosophila for the study of developmental genetics (C. Nusslein- Volhard, Science 266, 572-574 (1994)). In order for this goal to be realized, as the zebrafish genome is further elucidated, it is imperative to develop techniques for targeted gene knockouts to make maximal use of this vertebrate system. As a vertebrate model, zebrafish has advantages over the mouse including rapid ex- utero development of the relatively transparent embryos, allowing easy access to and visualization of developmental processes. Until now, however, only one technique has been available for targeted interference with gene expression in the zebrafish. This technique employs a ribozyme to mediate a gene "knockdown" (Y. Xie et al., Proc. Natl. Acad. Sci. U.S.A., 94, 13777-13781 (1997)).
Murine NIH/3T3 cells. Murine NIH/3T3 cells are an extremely well- characterized tumor cell line from mice fibroblasts, and have been used to develop and test numerous therapies, including gene therapies, intended for use in humans.
EXAMPLES
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
Example I. Double-sfranded RNA injection blocks gene expression in zebrafish
To determine whether double-sfranded RNA can attenuate endogenous gene expression, single cell zebrafish embryos were injected with double- sfranded RNA specifically targeted to three genes of particular interest: GFP, Zf- T and Pax6.1. The phenotypic role played by GFP has been well-characterized in zebrafish; Zf-T is a reporter gene that has been very useful for dissecting promoter activity in zebrafish embryos; and Paxό.l is a gene that has been thoroughly studied in other organisms.
Materials
The GFP expression vector, pEGFP-Nl (GenBank accession number U55762.1), was obtained from Clontech, Inc.
Isolation of zebrafish RNA
RNA from staged zebrafish embryos was obtained using the ULTRASPEC RNA isolation kit (Biotecx Laboratories, Inc.). Fifty embryos are sufficient to obtain the necessary amount of RNA
Generation of double-stranded RNA
Zf-T cDNA fragment. A 321 bp Zf-T cDNA fragment (nucleotide number 1764 to 2085; GenBank accession number S57147) was generated by reverse franscriptase-polymerase chain reaction (RT-PCR) from RNA of 8 hour zebrafish embryos. The sequence of upstream primer was 5' TTGGAACAACTTGAGGGTGA 3* (SEQ ID NO: 1) and the downsfream primer was 5'CGGTCACTTTTCAAAGCGTAT 3' (SEQ ID NO:2). To avoid targeting related genes, the primers were designed to amplify a unique portion of the gene that lies outside of the T-box region (Fig. 1).
Ntl insertion sequence cDNA fragment. A 488 bp cDNA fragment of the ntl insertion sequence (GenBank accession number X71596) was also generated by RT-PCR. This fragment disrupts Zf-T in a ntl mutant allele and served as a negative control for the double-sfranded Zf-T RNA injection. The sequence of the upstream primer was 5' ACCCTATACACCCCCACCTC 3' (SEQ ID NO:3) and the downsfream primer was 5' ATAATAGGCACCGCTCATGC 3' (SEQ ID NO:4). Pax 6.1 cDNA fragment. A 298 bp Paxό.l cDNA fragment (GenBank accession number X63183) was generated by RT-PCR of RNA obtained from 24 hour zebrafish embryos. The upstream primer was
5'TTTTCGAGGTTCCCTTGTTG (SEQ ID NO:5) and the downsfream primer was 5 'AGCCTTTGTATCCTCGCTGA (SEQ ID NO:6). This cDNA fragment lies 5' to the paired box and homeobox.
Nkx cDNA fragments. cDNA fragments for zebrafish Nkx 2-3, 2-5 and 2-7 genes were obtained in a similar manner. For the Nkx 2-3 gene (GenBank accession number U66571), the upstream primer was 5' AACCGTGTTTAACGGGATCA (SEQ ID NO:7) and the downsfream primer was 5' GGTTGCACTGGCACTACCAT (SEQ ID NO:8), yielding a 291 base pair product, representing positions 775-1065 of the Nkx 2-3 coding sequence. For the Nkx 2-5 gene (GenBank accession number U66572), the upstream primer was 5' CATCTTGCATGCTGTCCACT (SEQ ID NO:9) and the downsfream primer was 5 ' AGATCTTCACCCGGGTCTTC (SEQ ID NO: 10), yielding a 250 base pair product, representing positions 232-481 of the Nkx 2-5 coding sequence. For the Nkx 2-7 gene (GenBank accession number U66573), the upstream primer was 5' CATTTGCCAACACGAGTCAA (SEQ ID NO: 11) and the downsfream primer was 5' CCAGTCCAGTGCCATTTGAT (SEQ ID NO:12), yielding a 141 base pair product, representing positions 911 to 1051 of the Nkx 2-7 coding sequence.
GFP cDNA fragment. A cDNA fragment at the 5' end of the GFP coding sequence was used as template for double-sfranded GFP RNA. This 187 bp partial cDNA GFP fragment was obtained using PCR by amplifying a GFP fragment from pEGFP-Nl using chimeric primers containing T7 promoter specific sequence and a GFP sequence. The forward primer was 5'- TAATACGACTCACTATAGGGTAAACGGCCACAAGTTC (SEQ ID NO: 13) and the reverse primer was 5 ' - TAATACGACTCACTATAGGGTCGTGCTGCTTCATGTG (SEQ ID NO: 14), yielding a 187 base pair product representing positions 743 to 930. T7 polymerase was used to simultaneously generate sense and antisense sfrands using this PCR-generated fragment as a template.
Generation of double-sfranded RNA. The Zf-T, Paxό.l, GFP, and Nkx 2-3, 2-5 and 2-7 fragments thus obtained were each individually cloned into pGEM-T vectors containing T7 and SP6 promoters (Promega, Madison, WI). The clones were sequenced to ensure their identity. Double-sfranded RNA was then generated from these cloned sequences. To produce the double-sfranded RNA, two sets of PCR products were first generated from the cloned fragment (Fig. 1 ). One PCR product was generated using a primer that is antisense to the T7 promoter sequence, and the other PCR product was generated using a primer that was antisense to the SP6 promoter. The other primers used in these PCRs were specific to the 3' end of the inserted gene fragment relative to the promoter- specific primer being used. PCR products were purified on CENTRICON-100 columns according to manufacturer's instructions (Centricon). T7 RNA polymerase or SP6 RNA polymerase was used to synthesize RNA from each of these templates. In vitro transcription reactions were incubated at 37°C for two hours. At completion of each RNA polymerase reaction, RNAse-free DNAse (e.g., RQ Dnase) was added to the reaction to remove the DNA template. The reaction was incubated at 37°C for an additional 15 minutes, then at 70°C for 10 minutes to inactivate the DNAse. RNA was generated in this manner in order to avoid the small amounts of contaminating RNA that can be generated from the opposite strand in RNA synthesis reactions in which plasmids are used as templates. This is especially important for the control experiments since very small amounts ofdsRNA can silence gene expression. RNA was purified by centrifugation through a QUICKSPIN column (Boeringer Mannheim); a Sephadex G25 or G50 size exclusion column can also be used. The double- sfranded RNA was formed by mixing equal quantities (i.e., 1:1 molar ratios) of the single-strand RNAs that had been denatured at 70°C for 5 minutes in 80 mM KC1 and incubating 1-2 hours at 37 °C. Prior to injection, the efficiency of RNA annealing was determined by RNAse A (0.5 μg/ml) digestion for 15 minutes at 37°C (Fig. 2).
Microinjection of single cell zebrafish embryos
Individual single cell embryos were placed in fish embryo water on agarose ramps in petri dishes. Micropipettes are pulled to a fine point and the tip of the pipette is broken using fine tip forceps. The double-sfranded RNA is loaded into the micropipette by suction and injected just above the yolk under a dissecting microscope. Single cell embryos are injected with approximately 106 molecules of dsRNA. The injected embryos were subsequently incubated in embryo medium (Westerfield, 1993) at 28.5 °C for 12 hours to 5 days.
RT-PCR Reverse franscriptase-polymerase chain reaction (RT-PCR) was used to quantify the message level after double-sfranded RNA treatment. One hundred zebrafish embryos injected with double-sfranded RNA targeted to Zf-T, control double-sfranded RNA or uninjected controls were collected at 10 hours. RNA was extracted by RNAEasy minicolumn (Qiagen). RNA samples were freated with 1 unit RNAse free-DNAse I /l μg RNA, at 37°C for 15 minutes. The RNA was extracted with phenol/chloroform and precipitated with 2.5 volumes of 95% ethanol and 50 ng RNA was used for PCR to confirm that there was no DNA contamination. RNA (0.1 μg) was combined with 50 ng of oligo(dT)15 primers in 10 μl water at 65°C for 10 minutes then cooled to room temperature for 5 minutes. The reverse franscription was carried out at 42°C for 1.5 hours with
O.lμg of total RNA, 0.1 μg of random primer, 20 units RNasin, 200 μM dNTPs, 200 U Superscript π RNAse H reverse franscriptase (GIBCO BRL Inc.), 75 mM KC1, 3 mM MgCl2, 20 mM DTT in 50 mM Tris-HCl, pH 8.3, at a final volume of 20 μl. One unit of ribonuclease H was added to digest the RNA at 37°C for 30 minutes. The reaction was stopped by heating at 94°C for 5 minutes. The PCR was performed in 50 μl containing 2 μl cDNA product from the reverse franscription, 200 μM dNTPs, 10 pmol primers, and 1.0 unit of Taq polymerase, 50 mM KC1, 1.5 mM MgCl2, and 0.001% gelatin in 10 mM Tris- HCl, pH 8.3. A GenAmp PCR System 2400 (Perkin Elmer) was used with the following program: 94°C, 1 minutes, 29 cycles of: 94°C for 25 seconds; 56°C for 20 seconds; 72°C for 30 seconds; final extension was at 72°C for 7 minutes. The PCR product was separated on a 2% agarose gel. The PCR product of the Zf-T gene (GenBank accession number S57147) is 271 bp. It covers the cDNA region of Zf-T from base 1381 to 1750. The forward primer sequence was 5' TTGATCTTGGCTTCAGGAGG 3 ' (SEQ ID NO: 15) and downsfream primer was 5' TGCAATGGTTACCAGTTTTGA 3' (SEQ ID NO: 16). Primers for zebrafish β actin (used as a control) (GenBank accession number AF 025305) were upstream primer 5' CCCTTGACTTTGAGCAGGAG 3' (SEQ ID NO: 17) (starting from base 665) and downsfream primer 5' ACAGGTCCTTACGGATGTCG 3 ' (ending at base 886) (SEQ ID NO: 18). The PCR product size was 221 bp.
In situ hybridizations and histology
In situ hybridizations were performed as previously described (Wilkinson, 1992). Sense and antisense probes were generated from a region of the Zf-T gene lying outside the region targeted by the double-sfranded RNA. Embryos were fixed in 4% paraformaldehyde at 4°C or Bou n's fixative at room temperature. For histology, embryos were dehydrated in an alcohol series then cleared in xylene. Embryos were embedded in paraffin and sectioned on a microtome at a thickness of 5 μm and were mounted. The slides were deparaffinized, rehydrated and placed in acid alcohol (1% HC1 in 70% ethanol) for 5 min, then rinsed in distilled water. Giemsa staining was performed as previously described (Vacca, 1985). RESULTS
Targeted double-stranded RNA blocks transient expression of GFP
Fig. 3 shows the effect of double-sfranded GFP RNA injection on fransient GFP expression in zebrafish single cell or 16-cell zebrafish embryos. Microinjection of the GFP expression vector pEGFP-Nl into single cell zebrafish embryos resulted in the fransient expression of GFP in 85% of the embryos. GFP expression was monitored by fluorescence microscopy throughout early embryogenesis. GFP-targeted double-sfranded RNA was generated for the region shown in Fig. 1, and embryos were co-injected with either GFP double-sfranded RNA or a confrol double-sfranded RNA (i.e., the ntl insertion sequence dsRNA). When embryos were co-injected with pEGFP-Nl and 2.9x105 double-sfranded RNA molecules, fewer than 3% of embryos had detectable GFP expression. Eighty-four per cent (84%) of embryos co-injected with confrol double-sfranded RNA showed abundant GFP expression.
When the embryos were injected at the 16-cell stage, injection of pEGFP- Nl alone or pEGFP-Nl with confrol double-sfranded RNA resulted in embryos with scattered, brightly fluorescent cells at 36 hours of development. Co- injection of GFP double-sfranded RNA with the pEGFP-Nl completely quenched the GFP signal.
When Zf-T double-sfranded RNA was co-injected with the pEGFP-Nl plasmid into single cell embryos, the embryos had the ntl phenotype described below, and showed brilliant GFP expression in scattered cells. These results show that expression of a transiently ttansfected plasmid can be specifically attenuated by targeted double-sfranded RNA.
Targeted double-stranded RNA blocks Zf-T gene expression
The T gene has dramatic phenotypes in mutant and fransgenic animals. The mouse T (Brachyury) gene is required for normal mesoderm development and extension of the body axis (Herrmann et al., 1990). The zebrafish homologue of the T gene (Zf-T) plays an important role in midline development. Mutation of the Zf-T gene is known to result in the no tail (ntl) mutant phenotype, a Brachyury orthologue. The ntl embryos closely resemble mouse TAT mutant embryos in that they lack a differentiated notochord and show poor development of the caudal body (M. Halpern et al., Cell 75, 99-111 (1993)). Brachyury encodes a member of the T-box franscription factor family that is expressed in the notochord and is essential for the proper development of midline structures. Loss of function of this gene causes arrested development of notochord. The lack of notochord differentiation leads to disrupted morphogenesis of the mesoderm during gastrulation. This is particularly evident in the appearance of the somites, which lack the chevron-shaped organization found in wild-type embryos.
Fig. 4 shows the effect of double-sfranded Zf-T RNA injection on Zf-T expression in zebrafish single cell embryos. We found 71% of the zebrafish embryos that had been injected at the single cell stage with approximately 104 double-sfranded RNA molecules generated from the Zf-T cDNA fragment had phenotypes that were grossly similar to that of the ntl mutant, i.e., truncated tails and disorganized somites (Fig. 4a). Injection of Zf-T single-stranded sense or antisense RNA, or double-sfranded RNA generated from the control ntl inserted sequence, did not lead to a significant incidence of this phenotype (Table 1). Simultaneous injection of sense and antisense RNA that were not annealed did not result in a significant incidence of the ntl phenotype.
After injection of the Zf-T double-sfranded RNA, the Zf-T message was undetectable by in situ hybridization in 20% of the embryos (11/56) and weakly expressed in another 50% of embryos injected with Zf-T double-sfranded RNA (Fig. 4b). Semi-quantitative RT-PCR using β actin to confrol for PCR efficiency and loading, showed an overall 75% reduction in the Zf-T message level from that seen in embryos injected with an unrelated double-sfranded RNA.
To determine whether the Zf-T double-sfranded RNA had a global effect on gene expression, we co-injected it with pEGFP-Nl into single cell embryos (Fig. 3, row 4). In these experiments, every embryo that exhibited a ntl phenotype also had significant GFP expression. This supports the view that the phenotypes generated by the injection of double-sfranded RNA are not the result of non-specific effects on gene expression.
Phenocopy of ntl generated by injection of Zf-T double-stranded RNA To determine whether the mutant zebrafish generated by injection of Zf-T double-sfranded RNA into single cell embryos phenocopied the ntl mutant, cross-sections of 24 hour embryos injected with Zf-T double-sfranded RNA or confrol double-sfranded RNA were examined. The results are shown in Fig. 5. Embryos injected with the Zf-T double-sfranded RNA generally lacked a fully developed notochord as is seen in naturally occurring mutants, while those injected with the confrol double-sfranded RNA had a notochord similar to that seen in uninjected embryos. Twenty-one per cent of the embryos examined that had been injected with Zf-T double-sfranded RNA completely lacked notochord (6/28). Somites in the Zf-T attenuated embryos were disrupted in a similar fashion to that seen in ntl zebrafish (Fig. 6). The typical chevron appearance of the somites was lacking, but somites were not fused across the midline as is seen in floating head mutants.
Effect of Zf-T double-stranded RNA on the expression of sonic hedgehog and floating head
The expression patterns of shh andflh, two genes that are also essential to proper midline development in zebrafish, were examined by in situ hybridization. Fig. 7 shows the effect of Zf-T double-sfranded RNA injection on the expression of shh. In 27 % of the embryos examined (15/26), the expression pattern of shh throughout the floorplate of the embryos injected with the Zf-T double-sfranded RNA was 3-4 cells wide. This is identical to the expression pattern found for this gene in ntl embryos (Halpern et al., 1997). More than 50% of the embryos examined had a similar, but less complete alteration of shh expression. In the embryos injected with the confrol double-sfranded RNA, in situ hybridization showed shh expression limited to a one-cell stripe along the midline as is found in wild-type embryos. In wild-type zebrafish embryos, flh is expressed in the anterior and posterior nervous system and in a narrow axial strip. The effect of Zf-T double- sfranded RNA injection on the expression of flh is shown in Fig.8. In 33% of the embryos examined (6/18), expression of flh in the Zf-T double-sfranded RNA injected embryos was unaffected in the anterior and posterior nervous system but was greatly diminished or absent along the axis. Embryos injected with Zf-T double-sfranded RNA also show diffuse and broadened flh expression in the tailbud. This is similar to the expression pattern of flh found in the ntl mutant (A. Melby et al., Dev. Dyn. 209, 156-165 (1997)). This partial effect onflh expression was observed in more than 80% of the embryos examined.
Dose-response for generation of the ntl phenotype
To determine the number of double-sfranded RNA molecules required to generate a phenotype, single cell embryos were injected with approximately 1 nl of a solution containing double-sfranded Zf-T RNA concenfrations ranging from 1.6x10s to 5.0xl08 molecules of double-sfranded RNA/nl. Phenotype was determined for each embryo at 48 hours post-injection. As can be seen in Table 1, embryos that had been injected with 106 or more Zf-T double-sfranded RNAs exhibited a very high incidence of the ntl phenotype. A grossly complete phenotype was observed in more than 20% and a partial phenotype was observed in 50% of these embryos (Table 1; Fig. 9). Embryos injected with 4.0xl06 double-sfranded RNAs or less did not show a significant incidence of the ntl phenotype. Embryos injected with a confrol double-sfranded RNA were phenotypically normal. Embryos injected simultaneously with sense and antisense single-stranded RNAs also did not display abnormal phenotypes. Table 1. The injected RNA molecular numbers and embryos with phenotypic changes.
Injection Molecules(l) Number Viable Phenotypic change
(X 106) of embryos embryos
None Partial Full
Uninjected 0 296 239 239 0 0
S ssRNA(2) 100 768 621 619 2(0.6%) 0
A ssRNA(3) 100 715 583 580 3(0.5%) 0
S/A ssRNA(3) 100 708 587 585 2(0.3%) 0
C dsRNA(4) 100 959 815 810 5(0.6%) 0
Zf-T dsRNA
0.16 550 468 466 2(0.4%) 0
0.8 ND 79 73 4(5%) 2(3%)
4 328 288 275 11(4%) 2(0.7%)
20 257 229 196 23(10%) 10(4%)
50 161 129 79 38(29%) 12(9%)
100 1975 1618 455 839(51%) 322(20%)
290 769 531 93 275(51%) 163(31%)
500 1206 822 97 438(53%) 287(35%)
(1) The injected RNA numbers for each embryo.
(2) Single-stranded RNA of sense (S) and antisense (A) direction.
(3) S/A indicates the unannealed sense and antisense RNA mixture.
(4) Confrol (C) double-sfranded RNA.
Thus, microinjection of double-sfranded Zf-T RNA resulted in a high incidence of a phenotype similar to that of ntl. Furthermore, Zf-T gene expression could not be detected by in situ hybridization and the message was decreased by 75% as momtored using semiquantitative RT-PCR in 12 hour embryos that had been injected with the double-sfranded RNA. Expression of the zebrafish genes sonic hedgehog and floating head were altered in the embryos microinjected with the Zf-T double-sfranded RNA in a manner that is remarkably similar to the zebrafish no-tail mutant.
Targeted double-stranded RNA blocks Zf-Pax6.1 gene expression
Another unique and dramatic phenotype is associated with a naturally occurring Pax6 mutation, which was found in the mouse mutant small eyes. These embryos lack the lens placodes and normal forebrain structures. Zebrafish Pax6.1 transcripts can first be detected in the presumptive forebrain and hindbrain regions of the neural plate. Expression has also been observed in the optic vesicles and lens placodes, confirming that the Paxό.l protein is expressed in those areas of the eye where it is assumed to confrol differentiation. These expression patterns correlate well with a role for Paxό.l in lens placode and brain development in zebrafish. A second closely related gene, Zf-Paxό.2, has an expression pattern that overlaps with that of Paxό.l in zebrafish embryos.
As shown in Fig.10, injection of double-sfranded RNA of the zebrafish Paxό.l cDNA fragment resulted in embryos with grossly underdeveloped heads and absent or greatly diminished eyes. Expression of Paxό.l message was absent in embryos injected with double-sfranded RNA, but undiminished in embryos injected with ntl double-sfranded RNA. Twenty-five percent of the embryos injected with the Zf-Pax6.1 double-sfranded RNA exhibited phenotypes. Thus, microinjection of double-sfranded RNA targeted to Paxό.l was associated with depressed expression of Paxό.l and resulted in absent or greatly reduced eye and forebrain development, similar to the phenotype seen in mouse mutants.
Targeted double-stranded RNA blocks Zf-Nkx 2-7 gene expression
Nkx2-5 was identified by virtue of its homology to the Drosophila gene tinman. Null expression of tinman is associated with absent development of the Drosophila dorsal vessel, which is similar in some ways to the vertebrate heart. A number of members of the Nkx gene family play crucial roles in normal vertebrate heart development. Several Nkx family members are expressed in the developing heart of one or more vertebrate species, including Nkx 2-3, 2-5, 2-6, 2-7, and 2-8. Hemizygous mutations in the human Nkx2-5 gene, for example, are located on chromosome 5q34, are associated with defective cardiac septation and congenital heart block. Three Nkx family members known to be expressed in the zebrafish heart field: Nkx2-3, Nkx2-5, and Nkx2-7.
In this experiment, embryos that were injected with Zf-Nkx 2-7 double- sfranded RNA exhibit altered heart morphology and the hearts function poorly.
Targeted silencing of multiple genes
As shown in Fig. 11, embryos that were injected simultaneously with Zf- T and Zf-Pax6.1 double-sfranded RNA exhibited defective development of both the tail and head, combining the phenotypic defects associated with mutations of either gene alone. Examination of cross-sections through the head confirmed that eye and brain structures were defective in embryos injected with Zf-T double-sfranded RNA. Cross-sections through the tail region showed that notochord was lacking or greatly diminished and somites were disorganized. There was a greater incidence of defects in the tail region (greater than 90%) than in the eye or head (25%). This demonstrates that multiple genes can be simultaneously targeted for diminished expression by injection of targeted double-sfranded RNAs.
DISCUSSION
We have now shown that targeted gene silencing can be accomplished in a vertebrate embryo by injection of double-sfranded RNA into single cell embryos. This method allowed us to disrupt the activity of specific genes encoding the zebrafish homologue of Brachyury (Zf-T), zebrafish Paxό.l and the reporter gene, GFP. We also have shown that multiple genes can be targeted simultaneously using this method. In addition, embryos that were co-injected with a GFP expression vector and Zf-T double-sfranded RNA developed ntl phenotypes while GFP expression was unaffected, showing that the effects of the Zf-T double-sfranded RNA are not non-specific.
Depending on the timing and/or amount ofdsRNA injected, partial phenotypes of varying severity can be generated. In cases where null phenotypes are particularly severe, this allows the identification of effects that would ordinarily be missed. That is, by permitting gene silencing at later stages of development, the technique has allowed us to explore the effects of blocking the expression of a gene whose inhibition would be lethal at an earlier developmental stage. This has allowed us to unmask potential roles for Zf-T in developmental processes in which it had not been previously implicated. The most severe phenotypes mirror those found in animal mutant models, such as the zebrafish ntl mutant, naturally occurring mutation in Zf-T, and the mouse mutant small eyes, which is deficient in Pax6 expression. Functionally attenuating expression of Zf-T resulted in a reproducible phenotype that mirrored that found of the ntl mutant where the same gene was altered by an insertional mutation. Interestingly, we were able to use this inserted sequence as a negative confrol for these experiments as it produced no phenotype. By a number of criteria, more than 20% of all embryos injected with the Zf-T double-sfranded RNA developed in a manner that phenocopied the ntl mutant. Zf-T gene silencing produced by injection of double-sfranded RNA was apparent at the message level and by the specific phenotypes that were generated. In the zebrafish embryos, co-injection of unannealed sense and antisense RNA sfrands did not result in a high percentage of mutants. This is in contrast to results obtained in the nematode where phenotypes could be obtained when the sense and antisense sfrands were injected separately (A. Fire et al., Nature 391, 806-810 (1998)).
None of the confrol treatments, i.e., single strand sense or antisense, or confrol ds RNA showed any phenotypes at any concenfrations that were tested. The only phenotypes we observed were after injection of Zf-T or Paxό.l double- sfranded RNA, and these phenotypes specifically matched the treatment. In this regard double-sfranded RNA targeted to Paxό.l affected head and eye development with no apparent effect on tail development (Fig. 12). On the other hand Zf-T ds RNA affected tail development without any apparent effect on the head or eye (Fig. 4). Thus this treatment does not behave like a non-specific, toxic effect which would be expected to yield similar phenotypes regardless of the double-sfranded RNA injected.
GFP, a reporter gene encoding a protein that fluoresces when exposed to ultraviolet light, allows promoter activity to be monitored in living embryos throughout development. Using this reporter gene, it has been possible to identify promoter regions that regulate gene expression in the zebrafish notochord, sympathetic neurons, and hematopoetic lineages. We microinjected single-cell embryos with a plasmid vector containing GFP regulated by a promoter that drives ubiquitous expression during early development. We found that co-injection of double-sfranded RNA specifically targeted to GFP suppressed expression of this reporter gene in well over 95% of the embryos injected with the plasmid vector.
While it might at first be thought that the GFP plasmid vector would be a good marker for the distribution of double-sfranded RNA, the differences in these two nucleotides might predict great differences in their processing by the embryo for two reasons. The GFP plasmid is approximately 5000 base pairs of deoxyribonucleotides while the double-sfranded RNA is composed of ribonucleotides and it is a very short piece by comparison (around 200 base pairs). Data from C. elegans (Montgomery et al., 1998) and our own observations indicate that the double-sfranded RNA has much freer access to the cell from the extracellular matrix than does the GFP expressing plasmid.
Whether this is because of the difference in nucleotide composition or size is not known.
The injection of Zf-T double-sfranded RNA into single cell zebrafish embryos resulted in greatly diminished expression of the Zf-T as monitored by in situ hybridization and semi-quantitative RT-PCR, and resulted in phenotypes very similar to those found in ntl zebrafish embryos. Our in situs of ntl are shown at 9 hours. Most of the published ntl in situs show embryos at 11 hours or later and the signal is stronger than what we have shown in Fig. 4. However, it seems clear from this figure that the ntl expression is completely absent after the double-sfranded RNA injection and correlates perfectly with the phenotypes of the older embryos. This visual result is substantiated by semiquantitative RT- PCR showing that the Zf-T message is reduced to 70% of confrol level. It should be emphasized that semiquantitative RT-PCR was done using pooled zebrafish embryos and the message levels would represent the whole range of phenotypes shown in Fig. 9. Thus a 70% reduction in message level seems quite reasonable.
Not only is the phenotype grossly similar to ntl, it is quite specific. In more than 70% of the embryos injected with the double-sfranded Zf-T RNA, the notochord was absent or greatly diminished. Twenty-one per cent of the embryos examined had no notochord. The somites in these embryos also lacked the characteristic chevron appearance observed in wild type embryos, similar to the ntl mutant. The ntl phenotype can be distinguished from that of another tailless phenotype seen in the floating head mutant by the lack of fusion of the somites across the midline. Embryos injected with Zf-T double-sfranded RNA did not show fusion of the somites across the midline providing a differential diagnosis for the ntl versus the similar floating head phenotype.
That these phenotypic characteristics were due to specific attenuation of Zf-T expression was supported by in situ hybridizations showing altered expression patterns of shh and flh. Zf-T expression was greatly diminished in 30-50% and absent in 20% of the embryos injected with the Zf-T double- sfranded RNA. Expression of shh and flh were also altered in the zebrafish midline in these embryos in a manner similar to that found in the ntl mutant. The expression patterns of these genes appeared to be identical to those found in the ntl mutant in approximately 25% of the microinjected embryos that were examined. The expression patterns were altered in a similar, but less complete manner, in more than 60 % of the microinjected embryos. Twenty-five percent of zebrafish embryos that were injected with Zf- Paxό.l double-sfranded RNA had underdeveloped heads and absent or greatly diminished eyes. In situ hybridizations confirmed that Paxό.l expression was greatly diminished in more than 90% of the embryos injected with Zf-Pax6.1 double-sfranded RNA. Paxό.l expression was not affected in embryos injected with a confrol double-sfranded RNA. The relatively low occurrence of phenotypes in embryos injected with Paxό.l double-sfranded RNA may be due to functional redundancy of the closely related Paxό.2, which is expressed in overlapping regions of the zebrafish embryo. Interestingly, simultaneous injection of double-sfranded RNA targeted to Paxό.1 and ntl gives a very clear compound phenotype that is quite distinct from the phenotypes resulting from injection of either double-sfranded RNA separately. We believe that this data along with that from simultaneous injection of GFP expression vector with Zf-T double-sfranded RNA in which the effect appeared completely independent forms a compelling argument to support the idea that treatment with double- sfranded RNA causes a relatively specific cellular response.
Finally, it is known that certain types of double-sfranded RNA, such as mismatched or polyl/polyC RNA, can be toxic at high concentrations in eukaryotic animals (M. Kumar et al., Microbiol Mol Biol. Rev. 62, 1415-1434 (1998)). Although double-sfranded RNA can induce interferon-α/β in non- immune cells, this toxicity is primarily due to an immune system response mediated through interferon production in response to viral infections. Immune system or interferon-α/β -mediated toxicity is very unlikely to play any role in generating the phenotypes we have observed. First, the phenotypes that we have generated can be observed in 24 hour embryos, long before the zebrafish immune system has been established. The thymus primordium appears in the zebrafish at approximately 54 hours, but does not enlarge significantly until 30 hours later. Ragl and Rag2 expression cannot be detected until day 4, indicating a lack of mature T cells in the zebrafish until that time. Second, the amount of double-sfranded RNA that was used to generate the phenotypes is much less than is necessary to cause this interferon-mediated cell toxicity (M. Kumar et al., Microbiol Mol Biol Rev. 62, 1415-1434 (1998)). We have also found that polyl/polyC RNA can be toxic both in cultured 3T3 cells and in microinjected embryos. However, none of the ten double-sfranded RNAs that we have so far examined elicit a toxic effect in vitro or in vivo. Third, the phenotypes that have been generated for each gene under study differ substantially from one another and are specifically related to the gene that was targeted. Finally, injection of confrol double-sfranded RNA at the same concenfrations does not cause a detectable deviation from the wild type expression levels or phenotype.
In summary, these results show that double-sfranded RNA can efficiently disrupt gene activity in zebrafish. This inhibitory activity appears to be specific to the targeted gene. Non-specific double-sfranded RNA had no apparent phenotypic effect. We have also shown that multiple genes can be simultaneously targeted.
Example II.
Double-sfranded RNA injection blocks gene expression in explanted cardiac neural crest tissue
Attenuated expression of HirA (GenBank accession number X99375) is known to be associated with increased persistent truncus arteriosus (PTA). Double-sfranded RNA was generated from a chick HirA cDNA fragment in essentially the same manner as described for zebrafish in Example I . The upstream primer was 5' TCTGCACCAGCATTAGCACT (SEQ ID NO: 19) and the downsfream primer was 5' TGCTGTGAGAATTCGACTGG (SEQ ID NO:20) yielding a 201 base pair product representing positions 2095 to 2295 of the HirA cDNA sequence.
Explanted chick neural crest was incubated for 1.5 hours with HirA dsRNA or nonspecific dsRNA (confrol ntl dsRNA) in DMEM. The concentration of double-stranded RNA applied was approximately 106 molecules per nanoliter. Following exposure to the double-sfranded RNA each piece of tissue was washed in PBS prior to placing the tissue into culture. Fig. 12 shows that double-sfranded HirA RNA effectively silences expression of HirA in cardiac neural crest cell culture. Using RT-PCR as described in Example I, it was determined that the HirA message was decreased by 58%. This inhibitory activity appears to be specific to the targeted gene. Non-specific double-sfranded RNA had no apparent effect.
Example III.
Double-sfranded RNA injection blocks gene expression in mammalian cell culture
Double-sfranded GFP RNA was prepared as described in Example I. Murine NIH/3T3 cells were fransfected with pEGFP-Nl and double sfranded GFP RNA using a standard fransfection procedure. First, murine NTH/3T3 cells (~2x 108 per well) were seeded in a six- well tissue culture plate in 2 ml of DMEM with 10% FBS. The cells were then incubated at 37°C in a CO2 incubator until they were about 70-80 % confluent (i.e., 18-24 hours).
For each fransfection, Solution A was made by diluting 1 μg of pEGFP- Nl and 0.5-1 μg of double sfranded GFP RNA into 100 μl serum-free medium (OPTI-MEM® 1 Reduced Serum Medium, GIBCO BRL Cat. No. 320-1985), and Solution B was made by diluting 3-12 μl of LIPOFECTAMINE Reagent into 100 μl serum-free medium. For one confrol experiment, Solution A contained the plasmid pEGFP-Nl but no double sfranded RNA; for another, Solution A contained the plasmid pEGFP-Nl a confrol double-sfranded ntl RNA. The two solutions were combined, mixed gently, and incubated at room temperature for 30 minutes. The cells were washed once with 2 ml of serum-free DMEM. For each fransfection, 0.8 ml of serum-free DMEM was added to each tube containing the lipid-DNA complexes. The tubes were mixed gently and the diluted complex solution was overlayed onto the washed cells. The cells were incubated for 5 hours at 37°C in a CO2 incubator. DMEM (1 mL) was added with 20 % FBS without removing the fransfection mixture. Medium was replaced at 18-24 hours following the start of fransfection. Cell extracts were assayed for GFP activity 24-72 hours after the start of fransfection. GFP expression was momtored by fluorescence microscopy.
As shown in Fig. 13, transformed cells incubated with double-stranded GFP RNA molecules exhibited substantially reduced GFP expression. In contrast, transformed cells incubated with confrol dsRNA showed no apparent change in GFP expression.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (e.g., GenBank amino acid and nucleotide sequence submissions) cited herein are incorporated by reference. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

Claims

What is claimed is:
1. A method for attenuating the expression of a target gene in a cell comprising infroducing into the cell a double stranded RNA in an amount sufficient to attenuate expression of the target gene, wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene.
2. The method of claim 1 wherein the target gene is an endogenous gene.
3. The method of claim 1 wherein the target gene is a foreign gene.
4. The method of claim 1 wherein the targeted gene is a chromosomal gene.
5. The method of claim 1 wherein the targeted gene is an exfrachromosomal gene.
6. The method of claim 1 wherein the targeted gene is derived from a pathogen capable of infecting the cell.
7. The method of claim 6 wherein the pathogen is selected from the group consisting of a virus, bacterium, fungus or protozoan.
8. The method of claim 1 wherein the cell is a vertebrate cell.
9. The method of claim 8 wherein the vertebrate cell is a fish cell.
10. The method of claim 8 wherein the vertebrate cell is a mammalian cell.
11. The method of claim 10 wherein the mammalian cell is a murine cell.
12. The method of claim 10 wherein the vertebrate cell is an avian cell.
13. The method of claim 1 wherein the cell is an invertebrate cell.
14. The method of claim 1 wherein the cell is a plant cell.
15. The method of claim 1 wherein the double sfranded RNA comprises a nucleotide sequence that is completely identical to the nucleotide sequence of at least a portion of the target gene.
16. The method of claim 1 in which the essentially identical nucleotide sequence is at least 50 bases in length.
17. The method of claim 1 wherein the double sfranded RNA is administered in an amount sufficient to completely inhibit expression of the target gene.
18. The method of claim 1 in which the double stranded RNA comprises one strand which is self-complementary.
19. The method of claim 1 in which the double sfranded RNA comprises two separate complementary strands.
20. The method of claim 1 wherein the cell is an embryo.
21. The method of claim 20 wherein the embryo is a fish embryo.
22. The method of claim 20 wherein the double sfranded RNA is introduced into the embryo using microinjection.
23. The method of claim 1 wherein the cell is present in a cell culture, a tissue, an organ, or an organism.
24. The method of claim 23 wherein the cell is present in an organism, and the double sfranded RNA is introduced into a body cavity or interstitial space of the organism.
25. The method of claim 23 wherein the cell is present in an organism, and wherein the double sfranded RNA delivered to the organism via oral, topical, parenteral, vaginal, rectal, infranasal, ophthalmic, or infraperitoneal administration.
26. The method of claim 23 wherein the cell is present in a cell culture or a tissue explant, and wherein introduction of the double stranded RNA into the cell comprises incubating the cell culture or tissue explant in a solution comprising the double sfranded RNA.
27. The method of claim 1 wherein the double sfranded RNA is freated with RNAse prior to its introduction into the cell.
28. The method of claim 1 further comprising, prior to infroducing the double sfranded RNA into the cell, annealing two complementary single sfranded RNAs to yield the double sfranded RNA.
29. The method of claim 1 wherein the complementary single sfranded RNAs are annealed in the presence of potassium chloride.
30. The method of claim 1 wherein the function of the target gene is unknown.
31. The method of claim 1 further comprising infroducing into the cell a second double sfranded RNA in an amount sufficient to attenuate expression of a second target gene, wherein the second double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the second target gene.
32. The method of claim 1 comprising infroducing into the cell multiple double sfranded RNAs in an amount sufficient to attenuate expression of multiple target genes, wherein each double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of a target gene.
33. A method for attenuating the expression of a target gene in an organism comprising: infroducing a double sfranded RNA into an embryo in an amount sufficient to attenuate expression of the target gene, wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene; growing the embryo into an adult organism in which expression of the target gene is attenuated.
34. The method of claim 33 wherein the organism is a vertebrate.
35. The method of claim 33 further comprising identifying a phenotypic change in the organism associated with attenuated expression of the target gene.
36. The method of claim 33 wherein expression of the target gene in the organism is completely inhibited.
37. A method for attenuating the expression of a target gene in cell culture comprising: infroducing a double sfranded RNA into a cell in an amount sufficient to attenuate expression of the target gene, wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene; and culturing the cell to yield a cell culture in which expression of the target gene is attenuated.
38. The method of claim 37 wherein the cell is a vertebrate cell.
39. The method of claim 37 further comprising identifying a phenotypic change in the cell culture associated with attenuated expression of the target gene.
40. The method of claim 37 wherein expression of the target gene in the cell culture is completely inhibited.
41. A method for attenuating the expression of a target gene in a tissue explant comprising: explanting a tissue from an organism; and introducing a double sfranded RNA into a cell of the tissue explant in an amount sufficient to attenuate expression of the target gene, wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene.
42. The method of claim 41 wherein the tissue explant exhibiting attenuated expression of the target gene is implanted back into the organism.
43. The method of claim 41 wherein the tissue explant exhibiting attenuated expression of the target gene is implanted into a second organism.
44. The method of claim 41 wherein the tissue is fetal tissue.
45. The method of claim 41 wherein the organism is a vertebrate.
46. The method of claim 41 further comprising identifying a phenotypic change in the tissue explant associated with attenuated expression of the target gene.
47. The method of claim 41 wherein expression of the target gene in the organism is completely inhibited.
48. A method for attenuating the expression of a target gene in a cell comprising: annealing two complementary single sfranded RNAs in the presence of potassium chloride to yield double sfranded RNA; contacting the double sfranded RNA with RNAse to purify the double sfranded
RNA by removing single sfranded RNA; and introducing the purified double sfranded RNA into the cell in an amount sufficient to attenuate expression of the target gene; wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene.
49. A method for treating or preventing a disease or infection in a mammal comprising: identifying a target gene, wherein expression of the target gene is associated with the disease or infection; and administering to the mammal a double sfranded RNA in an amount sufficient to attenuate expression of the target gene; wherein the double sfranded RNA comprises a nucleotide sequence that is essentially identical the nucleotide sequence of at least a portion of the target gene.
50. The method of claim 49 for treating or preventing a viral infection, wherein the double sfranded RNA is an antiviral double sfranded RNA that attenuates the expression of a viral gene.
51. The method of claim 49 for treating or preventing cancer, wherein the double sfranded RNA is an antitumor double sfranded RNA.
52. The method of claim 49 for treating an autosomal dominant genetic disease wherein the double sfranded RNA attenuates the expression of an allele of a gene that is associated with the disease.
53. The method of claim 52 wherein the disease is Huntington's chorea.
54. The method of claim 49 comprising: identifying a plurality of target genes, wherein expression of the target genes is associated with the disease or infection; and concurrently administering to the mammal a plurality of double sfranded RNAs in an amounts sufficient to attenuate expression of the target genes; wherein each double sfranded RNA comprises a nucleotide sequence that is essentially identical the nucleotide sequence of at least a portion of a target gene.
55. The method of claim 49 further comprising: identifying a second target gene, wherein expression of the second target gene is associated with a second disease or infection; and administering to the mammal a second double sfranded RNA in an amount sufficient to attenuate expression of the second target gene concurrent with the administration of the first double sfranded RNA; wherein the second double sfranded RNA comprises a nucleotide sequence that is essentially identical the nucleotide sequence of at least a portion of the second target gene.
56. A method for reducing or preventing the rejection response to transplant tissue comprising administering to the transplant tissue a double stranded RNA that attenuates the expression of a gene in the transplant tissue that can elicit an immune response in the recipient.
57. The method of claim 56 wherein the transplant tissue is hepatocytes.
58. A vertebrate cell comprising a double sfranded RNA comprising a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of a target gene.
59. The vertebrate cell of claim 58 selected from the group consisting of a fish cell, a murine cell, a bird cell and a human cell.
60. A vertebrate comprising the cell of claim 58.
61. A kit comprising reagents for attenuating the expression of a target gene in a cell, the kit comprising: a DNA template comprising two different promoters selected from the group consisting of a T7 promoter, a T3 promoter and an SPό promoter, each promoter operably linked to a nucleotide sequence, such that two complementary single sfranded RNAs are capable of being transcribed from the DNA template, and wherein the complementary single stranded RNAs comprise a nucleotide sequence that is essentially identical to the nucleotide sequence of at least a portion of the target gene; a plurality of primers for amplification of the nucleotide sequence; nucleotide triphosphates for forming RNA; at least two RNA polymerases, each capable of binding to a promoter on the
DNA template and causing franscription of the nucleotide sequence to which the promoter is operably linked; a purification column for purifying single sfranded RNA; buffer for annealing single sfranded RNAs to yield double sfranded RNA; and
RNAse A or RNAse T for purifying double sfranded RNA.
PCT/US2000/002227 1999-01-28 2000-01-28 Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna WO2000044914A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
CA002361201A CA2361201A1 (en) 1999-01-28 2000-01-28 Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
AU26348/00A AU776150B2 (en) 1999-01-28 2000-01-28 Composition and method for (in vivo) and (in vitro) attenuation of gene expression using double stranded RNA
EP00904620A EP1147204A1 (en) 1999-01-28 2000-01-28 Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
AU2004100997A AU2004100997A4 (en) 1999-01-28 2004-11-23 Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US11763599P 1999-01-28 1999-01-28
US60/117,635 1999-01-28
US17544000P 2000-01-11 2000-01-11
US60/175,440 2000-01-11

Publications (2)

Publication Number Publication Date
WO2000044914A1 true WO2000044914A1 (en) 2000-08-03
WO2000044914B1 WO2000044914B1 (en) 2000-09-14

Family

ID=26815474

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/002227 WO2000044914A1 (en) 1999-01-28 2000-01-28 Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna

Country Status (5)

Country Link
US (6) US20020114784A1 (en)
EP (2) EP2314700A1 (en)
AU (2) AU776150B2 (en)
CA (1) CA2361201A1 (en)
WO (1) WO2000044914A1 (en)

Cited By (386)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000068374A1 (en) * 1999-05-10 2000-11-16 Syngenta Participations Ag Regulation of viral gene expression
WO2000063364A3 (en) * 1999-04-21 2001-01-11 American Home Prod Methods and compositions for inhibiting the function of polynucleotide sequences
WO2001036646A1 (en) * 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna
WO2001068836A2 (en) * 2000-03-16 2001-09-20 Genetica, Inc. Methods and compositions for rna interference
WO2002016620A2 (en) * 2000-08-19 2002-02-28 Axordia Limited Modulation of stem cell differentiation
WO2002055692A2 (en) * 2001-01-09 2002-07-18 Ribopharma Ag Method for inhibiting the expression of a target gene and medicament for treating a tumor disease
WO2002059300A2 (en) * 2000-12-28 2002-08-01 J & J Research Pty Ltd Double-stranded rna-mediated gene suppression
WO2002066638A1 (en) * 2001-02-22 2002-08-29 Gencom Corporation Recombinant gene containing inverted repeat sequence and utilization thereof
WO2003004649A1 (en) * 2001-07-06 2003-01-16 Consejo Superior De Investigaciones Cientificas Method of interfering with a virus infection in plants
WO2003033700A1 (en) * 2001-10-12 2003-04-24 Ribopharma Ag Method for inhibiting the replication of viruses
WO2003035082A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for inhibiting expression of a target gene
WO2003035870A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for treating a carcinoma of the pancreas
WO2002055693A3 (en) * 2001-01-09 2003-07-17 Ribopharma Ag Method for inhibiting the expression of a target gene
WO2003070972A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics Inc. RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070197A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF TGF-BETA AND TGF-BETA RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070914A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003070918A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Rna interference by modified short interfering nucleic acid
WO2003070966A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2003087367A2 (en) * 2002-04-18 2003-10-23 Lynkeus Biotech Gmbh Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
WO2004018687A2 (en) 2002-08-07 2004-03-04 Basf Plant Science Gmbh Nucleic acid sequences encoding proteins associated with abiotic stress response
WO2004043979A2 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004044138A2 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
EP1444362A2 (en) * 2001-10-19 2004-08-11 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
WO2004094595A2 (en) 2003-04-17 2004-11-04 Alnylam Pharmaceuticals Inc. MODIFIED iRNA AGENTS
WO2004101756A2 (en) 2003-05-09 2004-11-25 Diadexus, Inc. Ovr110 antibody compositions and methods of use
GB2372995B (en) * 2000-11-29 2004-12-29 Hoffmann La Roche Inhibition of the transcription of a target gene in a cell or tissues
US6841351B2 (en) 1999-07-30 2005-01-11 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
EP1555317A1 (en) 1998-03-20 2005-07-20 Benitec Australia Ltd. Synthetic genes and genetic constructs comprising the same
WO2005066371A2 (en) 2003-12-31 2005-07-21 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
EP1572902A2 (en) * 2002-02-01 2005-09-14 Ambion, Inc. HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
WO2005118787A2 (en) 2004-05-10 2005-12-15 The University Of North Carolina At Chapel Hill Method of screening candidate compounds for susceptibility to biliary excretion
EP1612266A2 (en) 2004-06-10 2006-01-04 National Taiwan University Prostaglandin reductase
WO2006009575A1 (en) 2004-06-22 2006-01-26 The Board Of Trustees Of The University Of Illinois METHODS OF INHIBITING TUMOR CELL PROLIFERATION WITH FOXM1 siRNA
WO2006017932A1 (en) 2004-08-18 2006-02-23 Genesense Technologies Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
WO2006032707A2 (en) 2004-09-24 2006-03-30 Basf Plant Science Gmbh Plant cells and plants with increased tolerance to environmental stress
WO2006034048A2 (en) 2004-09-18 2006-03-30 University Of Maryland, Baltimore Therapeutic agents targeting the ncca-atp channel and methods of use thereof
US7022828B2 (en) 2001-04-05 2006-04-04 Sirna Theraputics, Inc. siRNA treatment of diseases or conditions related to levels of IKK-gamma
EP1645633A2 (en) 2004-10-05 2006-04-12 SunGene GmbH Constitutive expression cassettes for regulation of plant expression
EP1655364A2 (en) 2004-11-05 2006-05-10 BASF Plant Science GmbH Expression cassettes for seed-preferential expression in plants
EP1662000A2 (en) 2004-11-25 2006-05-31 SunGene GmbH Expression cassettes for guard cell-preferential expression in plants
EP1666599A2 (en) 2004-12-04 2006-06-07 SunGene GmbH Expression cassettes for mesophyll- and/or epidermis-preferential expression in plants
EP1669456A2 (en) 2004-12-11 2006-06-14 SunGene GmbH Expression cassettes for meristem-preferential expression in plants
EP1669455A2 (en) 2004-12-08 2006-06-14 SunGene GmbH Expression cassettes for vascular tissue-preferential expression in plants
US7067722B2 (en) 1999-08-26 2006-06-27 Monsanto Technology Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
WO2006069610A2 (en) 2004-07-02 2006-07-06 Metanomics Gmbh Process for the production of fine chemicals
WO2006074418A2 (en) 2005-01-07 2006-07-13 Diadexus, Inc. Ovr110 antibody compositions and methods of use
WO2003070193A3 (en) * 2002-02-20 2006-08-24 James Mcswiggen RNA interference mediated inhibition of HIV gene expression using short interfering nucleic acid (siNA)
WO2006089950A2 (en) 2005-02-26 2006-08-31 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
WO2006120197A2 (en) 2005-05-10 2006-11-16 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
EP1723958A2 (en) 2005-05-19 2006-11-22 L'oreal dsRNA vectorisation with cationic particles and their topical use
US7148336B2 (en) 1999-08-26 2006-12-12 Calgene Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acid levels
US7166771B2 (en) 2002-06-21 2007-01-23 Monsanto Technology Llc Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
US7176304B2 (en) 2002-02-20 2007-02-13 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US7196184B2 (en) 2002-01-22 2007-03-27 Alnylam Europe Ag Double-stranded RNA (DSRNA) and method of use for inhibiting expression of the AML-1/MTG8 fusion gene
WO2005041859A3 (en) * 2003-04-30 2007-04-26 Sirna Therapeutics Inc Conjugates and compositions for cellular delivery.
WO2007054441A2 (en) 2005-11-08 2007-05-18 Basf Plant Science Gmbh Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants
WO2007087815A2 (en) 2004-12-17 2007-08-09 Metanomics Gmbh Process for the control of production of fine chemicals
WO2008092153A2 (en) 2007-01-26 2008-07-31 University Of Louisville Research Foundation, Inc. Modification of exosomal components for use as a vaccine
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
US7417072B2 (en) 2005-05-12 2008-08-26 Wisconsin Alumni Research Foundation Blockade of Pin1 prevents cytokine production by activated immune cells
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7452987B2 (en) 2002-08-05 2008-11-18 Silence Therapeutics Aktiengesellschaft (Ag) Interfering RNA molecules
US7456335B2 (en) 2001-09-03 2008-11-25 Basf Plant Science Gmbh Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants
WO2009002832A2 (en) 2007-06-22 2008-12-31 University Of Maryland, Baltimore Inhibitors of ncca-atp channels for therapy
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
EP2036984A2 (en) 2002-07-26 2009-03-18 BASF Plant Science GmbH Reversion of the negative selective effect of negative marker proteins as selection procedure
EP2045327A2 (en) 2005-03-08 2009-04-08 BASF Plant Science GmbH Expression enhancing intron sequences
WO2009044392A2 (en) 2007-10-03 2009-04-09 Quark Pharmaceuticals, Inc. Novel sirna structures
US7531718B2 (en) 1999-08-26 2009-05-12 Monsanto Technology, L.L.C. Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7541344B2 (en) 2003-06-03 2009-06-02 Eli Lilly And Company Modulation of survivin expression
US7566813B2 (en) 2002-03-21 2009-07-28 Monsanto Technology, L.L.C. Nucleic acid constructs and methods for producing altered seed oil compositions
WO2009094647A2 (en) 2008-01-25 2009-07-30 Introgen Therapeutics, Inc. P53 biomarkers
EP2090662A2 (en) 2006-04-05 2009-08-19 Metanomics GmbH Process for the production of a fine chemical
US7582744B2 (en) 2004-08-10 2009-09-01 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides
US7595306B2 (en) 2003-06-09 2009-09-29 Alnylam Pharmaceuticals Inc Method of treating neurodegenerative disease
WO2009123764A2 (en) 2008-04-04 2009-10-08 Calando Pharmaceuticals, Inc. Compositions and use of epas1 inhibitors
US7601888B2 (en) 2002-03-21 2009-10-13 Monsanto Technology L.L.C. Nucleic acid constructs and methods for producing altered seed oil compositions
WO2009147684A2 (en) 2008-06-06 2009-12-10 Quark Pharmaceuticals, Inc. Compositions and methods for treatment of ear disorders
US7655790B2 (en) 2002-07-12 2010-02-02 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
US7659389B2 (en) 2001-05-18 2010-02-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MYC and/or MYB gene expression using short interfering nucleic acid (siNA)
US7659390B2 (en) 2002-02-20 2010-02-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA)
US7662952B2 (en) 2002-02-20 2010-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
US7662951B2 (en) 2000-08-30 2010-02-16 Sirna Therapeutics, Inc. RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
US7667029B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US7667030B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
EP2159289A2 (en) 2005-06-23 2010-03-03 BASF Plant Science GmbH Improved methods for the production of stably transformed plants
US7678897B2 (en) 2002-02-20 2010-03-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
EP2163635A1 (en) 2004-08-02 2010-03-17 BASF Plant Science GmbH Method for isolation of transcription termination sequences
US7691999B2 (en) 2002-02-20 2010-04-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA)
US7696345B2 (en) 2002-11-05 2010-04-13 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7700760B2 (en) 2002-02-20 2010-04-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
DE112008001453T5 (en) 2007-05-22 2010-04-29 Basf Plant Science Gmbh Plant cells and plants with increased tolerance and / or resistance to environmental stress and increased biomass production CO
EP2186903A2 (en) 2005-02-09 2010-05-19 BASF Plant Science GmbH Expression cassettes for regulation of expression in monocotyledonous plants
US7732660B2 (en) 2001-01-26 2010-06-08 Commonwealth Scientific And Industrial Research Corporation Methods and means for producing efficient silencing construct using recombinational cloning
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
EP2202314A1 (en) 2007-01-15 2010-06-30 BASF Plant Science GmbH Use of subtilisin (RNR9) polynucleotides for achieving a pathogen resistance in plants
WO2010074783A1 (en) 2008-12-23 2010-07-01 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
WO2010080452A2 (en) 2008-12-18 2010-07-15 Quark Pharmaceuticals, Inc. siRNA COMPOUNDS AND METHODS OF USE THEREOF
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
EP2216407A2 (en) 2003-03-07 2010-08-11 Alnylam Pharmaceuticals, Inc. Therapeutic Compositions
WO2010101951A1 (en) 2009-03-02 2010-09-10 Alnylam Pharmaceuticals, Inc. Nucleic acid chemical modifications
US7795422B2 (en) 2002-02-20 2010-09-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
WO2010107955A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF BTB AND CNC HOMOLOGY 1, BASIC LEUCINE ZIPPER TRANSCRIPTION FACTOR 1 (BACH 1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) SEQUENCE LISTING
WO2010107952A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010107958A1 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 6 (STAT6) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010107957A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111468A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE NERVE GROWTH FACTOR BETA CHAIN (NGFß) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SINA)
WO2010111464A1 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF APOPTOSIS SIGNAL-REGULATING KINASE 1 (ASK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111471A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 1 (STAT1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111497A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE INTERCELLULAR ADHESION MOLECULE 1 (ICAM-1)GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111490A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE THYMIC STROMAL LYMPHOPOIETIN (TSLP) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010122110A1 (en) 2009-04-22 2010-10-28 Basf Plant Science Company Gmbh Whole seed specific promoter
DE112008003433T5 (en) 2007-12-21 2010-11-04 Basf Plant Science Gmbh Plants with increased yield (KO NUE)
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
EP2258858A1 (en) 2009-06-05 2010-12-08 Universitätsklinikum Freiburg Transgenic LSD1 animal model for cancer
US7851615B2 (en) 2003-04-17 2010-12-14 Alnylam Pharmaceuticals, Inc. Lipophilic conjugated iRNA agents
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
US7858625B2 (en) 2001-05-18 2010-12-28 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2011005860A2 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011003901A1 (en) 2009-07-10 2011-01-13 Basf Plant Science Company Gmbh Expression cassettes for endosperm-specific expression in plants
WO2011008823A2 (en) 2009-07-14 2011-01-20 Mayo Foundation For Medical Education And Research Peptide-mediated non-covalent delivery of active agents across the blood brain barrier
WO2011011775A1 (en) 2009-07-24 2011-01-27 The Regents Of The University Of California Methods and compositions for treating and preventing disease associated with avb5 integrin
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
US7884264B2 (en) 2006-01-17 2011-02-08 Biolex Therapeutics, Inc. Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in duckweed plants
US7893248B2 (en) 2002-02-20 2011-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
US7897753B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of XIAP gene expression using short interfering nucleic acid (siNA)
US7897752B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of telomerase gene expression using short interfering nucleic acid (siNA)
US7897757B2 (en) 2002-02-20 2011-03-01 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA)
US7910724B2 (en) 2002-02-20 2011-03-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US7910725B2 (en) 2002-02-20 2011-03-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
EP2298358A1 (en) 2002-05-06 2011-03-23 Alnylam Pharmaceuticals Inc. Methods for delivery of nucleic acids
US7915479B2 (en) 2004-10-13 2011-03-29 University Of Georgia Research Foundation, Inc. Nematode resistant transgenic plants
EP2302076A1 (en) 2005-02-14 2011-03-30 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
US7923549B2 (en) 2002-02-20 2011-04-12 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US7923547B2 (en) 2002-09-05 2011-04-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7928220B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA)
US7928219B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (SINA)
US7928218B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US7935812B2 (en) 2002-02-20 2011-05-03 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US7943757B2 (en) 2002-02-20 2011-05-17 Mcswiggen James RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
WO2011063409A1 (en) 2009-11-23 2011-05-26 Aquabounty Technologies, Inc. Maternally induced sterility in animals
WO2011066475A1 (en) 2009-11-26 2011-06-03 Quark Pharmaceuticals, Inc. Sirna compounds comprising terminal substitutions
EP2330202A2 (en) 2006-01-06 2011-06-08 University Of Georgia Research Foundation, Inc. Cyst nematode resistant transgenic plants
WO2011067712A1 (en) 2009-12-03 2011-06-09 Basf Plant Science Company Gmbh Expression cassettes for embryo-specific expression in plants
WO2011072091A1 (en) 2009-12-09 2011-06-16 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the cns
WO2011071916A2 (en) 2009-12-07 2011-06-16 The Johns Hopkins University Sr-bi as a predictor of human female infertility and responsiveness to treatment
WO2011073326A2 (en) 2009-12-18 2011-06-23 Novartis Ag Organic compositions to treat hsf1-related diseases
US7968762B2 (en) 2004-07-13 2011-06-28 Van Andel Research Institute Immune-compromised transgenic mice expressing human hepatocyte growth factor (hHGF)
US7977472B2 (en) 2002-02-20 2011-07-12 Leonid Beigelman RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
WO2011084193A1 (en) 2010-01-07 2011-07-14 Quark Pharmaceuticals, Inc. Oligonucleotide compounds comprising non-nucleotide overhangs
US7985853B2 (en) 2002-02-20 2011-07-26 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
WO2011094345A1 (en) 2010-01-26 2011-08-04 National Jewish Health Methods and compositions for risk prediction, diagnosis, prognosis, and treatment of pulmonary disorders
WO2011098449A1 (en) 2010-02-10 2011-08-18 Novartis Ag Methods and compounds for muscle growth
EP2360249A1 (en) 2005-03-31 2011-08-24 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
EP2359832A2 (en) 2004-09-18 2011-08-24 University of Maryland, Baltimore Therapeutic agents targeting the NCCA-ATP channel and methods of use thereof
US8008472B2 (en) 2001-05-29 2011-08-30 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
US8008473B2 (en) 2002-02-20 2011-08-30 Mcswiggen James RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA)
US8013143B2 (en) 2002-02-20 2011-09-06 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
WO2011109427A2 (en) 2010-03-01 2011-09-09 Alnylam Pharmaceuticals, Inc. Improving the biological activity of sirna through modulation of its thermodynamic profile
US8017761B2 (en) 2001-05-18 2011-09-13 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of Stearoyl-CoA desaturase (SCD) gene expression using short interfering nucelic acid (siNA)
US8017762B2 (en) 2003-04-17 2011-09-13 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US8022272B2 (en) 2001-07-13 2011-09-20 Sungene Gmbh & Co. Kgaa Expression cassettes for transgenic expression of nucleic acids
WO2011120053A1 (en) 2010-03-26 2011-09-29 Mersana Therapeutics, Inc. Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof
WO2011123621A2 (en) 2010-04-01 2011-10-06 Alnylam Pharmaceuticals Inc. 2' and 5' modified monomers and oligonucleotides
US8034791B2 (en) 2001-04-06 2011-10-11 The University Of Chicago Activation of Egr-1 promoter by DNA damaging chemotherapeutics
EP2377952A1 (en) 2007-04-26 2011-10-19 Ludwig Institute For Cancer Research Methods for diagnosing and treating astrocytomas
EP2380986A1 (en) 2006-01-12 2011-10-26 BASF Plant Science GmbH Use of stomatin (STM1) polynucleotides for achieving a pathogen resistance in plants
WO2011133868A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Conformationally restricted dinucleotide monomers and oligonucleotides
WO2011131707A1 (en) 2010-04-23 2011-10-27 Novartis Ag ORGANIC COMPOSITIONS TO TREAT BETA-ENaC-RELATED DISEASES
WO2011133871A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. 5'-end derivatives
WO2011133876A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
EP2386653A2 (en) 2004-09-16 2011-11-16 Turun Yliopisto Methods for the utilization of novel target genes related to immune-mediated diseases
WO2011145777A1 (en) 2010-05-20 2011-11-24 광주과학기술원 Pharmaceutical composition including an hif-2α inhibitor as an active ingredient for preventing or treating arthritis
WO2011146938A1 (en) 2010-05-21 2011-11-24 NanoOncology, Inc. Reagents and methods for treating cancer
US8067575B2 (en) 2002-02-20 2011-11-29 Merck, Sharp & Dohme Corp. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US8067570B2 (en) 2006-01-20 2011-11-29 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of RTP801
EP2394662A2 (en) 2004-04-02 2011-12-14 The Regents of The University of California Methods and compositions for treating and preventing disease associated with AlphavBeta5 intergrin
US8084600B2 (en) 2006-05-04 2011-12-27 Novartis Ag Short interfering ribonucleic acid (siRNA) with improved pharmacological properties
WO2011163466A1 (en) 2010-06-23 2011-12-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Regulation of skin pigmentation by neuregulin-1 (nrg-1)
WO2011163121A1 (en) 2010-06-21 2011-12-29 Alnylam Pharmaceuticals, Inc. Multifunctional copolymers for nucleic acid delivery
US8097422B2 (en) 2007-06-20 2012-01-17 Salk Institute For Biological Studies Kir channel modulators
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
EP2412383A1 (en) 2006-07-28 2012-02-01 Children's Memorial Hospital Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells
EP2415486A2 (en) 2001-05-18 2012-02-08 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012027467A1 (en) 2010-08-26 2012-03-01 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF PROLYL HYDROXYLASE DOMAIN 2 (PHD2) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012027206A1 (en) 2010-08-24 2012-03-01 Merck Sharp & Dohme Corp. SINGLE-STRANDED RNAi AGENTS CONTAINING AN INTERNAL, NON-NUCLEIC ACID SPACER
WO2012037254A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
EP2434019A1 (en) 2003-08-01 2012-03-28 BASF Plant Science GmbH Process for the production of fine chemicals
US8148342B2 (en) 2004-09-28 2012-04-03 Quark Pharmaceuticals Inc. Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases
US8153776B2 (en) 2000-03-16 2012-04-10 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
WO2012051567A2 (en) 2010-10-15 2012-04-19 The Trustees Of Columbia University In The City Of New York Obesity-related genes and their proteins and uses thereof
EP2447275A1 (en) 2006-07-13 2012-05-02 University of Iowa Research Foundation Methods and reagents for treatment of age-related macular degeneration
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
WO2012061537A2 (en) 2010-11-02 2012-05-10 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
WO2012061443A2 (en) 2010-11-01 2012-05-10 NanoOncology, Inc. Compositions of a peptide-based system for cell-specific targeting
WO2012078536A2 (en) 2010-12-06 2012-06-14 Quark Pharmaceuticals, Inc. Double stranded oligonucleotide compounds comprising positional modifications
WO2012078209A1 (en) 2010-12-06 2012-06-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnosis and treatment of adrenocortical tumors using human microrna-483
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
JP4954550B2 (en) * 2003-12-19 2012-06-20 大日本住友製薬株式会社 Novel nucleic acid introduction method
EP2471809A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
EP2484780A1 (en) 2004-07-23 2012-08-08 The University of North Carolina At Chapel Hill Methods and materials for determining pain sensibility and predicting and treating related disorders
US8258288B2 (en) 2002-02-20 2012-09-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA)
WO2012118911A1 (en) 2011-03-03 2012-09-07 Quark Pharmaceuticals, Inc. Oligonucleotide modulators of the toll-like receptor pathway
WO2012118910A2 (en) 2011-03-03 2012-09-07 Quark Pharmaceuticals, Inc. Compositions and methods for treating lung disease and injury
EP2500429A2 (en) 2005-05-31 2012-09-19 Devgen N.V. RNAi for the control of insects and arachnids
US8273866B2 (en) 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US8278287B2 (en) 2008-04-15 2012-10-02 Quark Pharmaceuticals Inc. siRNA compounds for inhibiting NRF2
US8283332B2 (en) 2009-04-17 2012-10-09 University Of Louisville Research Foundation, Inc. PFKFB4 inhibitors and methods of using the same
EP2508608A1 (en) 2003-06-09 2012-10-10 Alnylam Pharmaceuticals Inc. Method of treating neurodegenerative disease
US8299042B2 (en) 2002-04-26 2012-10-30 Alnylam Pharmaceuticals, Inc. Methods and compositions for silencing genes without inducing toxicity
US8329463B2 (en) 2000-12-01 2012-12-11 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8329989B2 (en) 2008-09-29 2012-12-11 Monsanto Technology Llc Soybean transgenic event MON87705 and methods for detection thereof
US8329667B2 (en) 2004-04-23 2012-12-11 The Trustees Of Columbia University In The City Of New York Inhibition of hairless protein mRNA
WO2012170957A2 (en) 2011-06-08 2012-12-13 Nitto Denko Corporation Retinoid-liposomes for enhancing modulation of hsp47 expression
WO2013030778A2 (en) 2011-09-02 2013-03-07 Novartis Ag Organic compositions to treat hsf1-related diseases
US8394628B2 (en) 2000-03-30 2013-03-12 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
US8404654B2 (en) 2006-01-20 2013-03-26 Quark Pharmaceuticals, Inc. Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes
US8426377B2 (en) 2003-04-17 2013-04-23 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
WO2013059496A1 (en) 2011-10-18 2013-04-25 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
WO2013067076A2 (en) 2011-11-03 2013-05-10 Quark Pharmaceuticals, Inc. Methods and compositions for neuroprotection
WO2013070821A1 (en) 2011-11-08 2013-05-16 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the nervous system
US8470792B2 (en) 2008-12-04 2013-06-25 Opko Pharmaceuticals, Llc. Compositions and methods for selective inhibition of VEGF
EP2607477A1 (en) 2007-05-03 2013-06-26 The Brigham and Women's Hospital, Inc. Multipotent stem cells and uses thereof
US8476245B2 (en) 2004-02-11 2013-07-02 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti matrix metalloproteinase DNAzymes
WO2013105022A2 (en) 2012-01-09 2013-07-18 Novartis Ag Organic compositions to treat beta-catenin-related diseases
US8507455B2 (en) 2007-12-04 2013-08-13 Alnylam Pharmaceuticals, Inc. Folate conjugates
US8541384B2 (en) 2002-07-24 2013-09-24 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
WO2013149194A1 (en) 2012-03-29 2013-10-03 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
EP2657350A1 (en) 2007-07-14 2013-10-30 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US8575123B2 (en) 2008-04-11 2013-11-05 Tekmira Pharmaceuticals Corporation Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
WO2013166004A2 (en) 2012-05-02 2013-11-07 Novartis Ag Organic compositions to treat kras-related diseases
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
US8586726B2 (en) 2007-07-18 2013-11-19 The Trustees Of Columbia University In The City Of New York Tissue-specific MicroRNAs and compositions and uses thereof
US8614311B2 (en) 2007-12-12 2013-12-24 Quark Pharmaceuticals, Inc. RTP801L siRNA compounds and methods of use thereof
EP2687609A2 (en) 2008-11-10 2014-01-22 The United States of America As Represented by the Secretary Department of Health and Human Services Method for treating solid tumor
WO2014018554A1 (en) 2012-07-23 2014-01-30 La Jolla Institute For Allergy And Immunology Ptprs and proteoglycans in autoimmune disease
WO2014045126A2 (en) 2012-09-18 2014-03-27 Uti Limited Partnership Treatment of pain by inhibition of usp5 de-ubiquitinase
US8697875B2 (en) 2008-12-23 2014-04-15 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
EP2719380A2 (en) 2008-09-16 2014-04-16 University of Maryland, Baltimore SUR1 inhibitors for therapy
US8703769B2 (en) 2005-07-15 2014-04-22 The University Of North Carolina At Chapel Hill Use of EGFR inhibitors to prevent or treat obesity
US8710209B2 (en) 2009-12-09 2014-04-29 Nitto Denko Corporation Modulation of HSP47 expression
EP2727996A1 (en) 2008-11-06 2014-05-07 The Johns-Hopkins University Treatment of chronic inflammatory respiratory disorders with NP1 inhibitors
US8785408B2 (en) 2007-06-27 2014-07-22 Quark Pharmaceuticals, Inc. Compositions and methods for reducing or protecting against delayed graft function (DGF)
US8796436B2 (en) 2003-04-17 2014-08-05 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US8796442B2 (en) 2007-03-21 2014-08-05 Brookhaven Science Associates, Llc. Combined hairpin-antisense compositions and methods for modulating expression
WO2014134179A1 (en) 2013-02-28 2014-09-04 The Board Of Regents Of The University Of Texas System Methods for classifying a cancer as susceptible to tmepai-directed therapies and treating such cancers
WO2014134255A2 (en) 2013-02-28 2014-09-04 Novartis Ag Organic compositions to treat epas1-related diseases
US8841432B2 (en) 2011-04-21 2014-09-23 Snu R&Db Foundation Shuttle vectors for mycobacteria-escherichia coli and uses thereof
WO2014151734A1 (en) 2013-03-15 2014-09-25 The Trustees Of Columbia University In The City Of New York Fusion proteins and methods thereof
US8846868B2 (en) 2008-04-17 2014-09-30 Fusion Antibodies Limited Anti-AREG/HB-EGF antibodies and treatment
WO2015015498A1 (en) 2013-07-31 2015-02-05 Qbi Enterprises Ltd. Methods of use of sphingolipid polyalkylamine oligonucleotide compounds
WO2015015496A1 (en) 2013-07-31 2015-02-05 Qbi Enterprises Ltd. Sphingolipid-polyalkylamine-oligonucleotide compounds
US8968702B2 (en) 2006-03-30 2015-03-03 Duke University Inhibition of HIF-1 activation for anti-tumor and anti-inflammatory responses
WO2015051135A2 (en) 2013-10-04 2015-04-09 Novartis Ag Organic compositions to treat hepcidin-related diseases
WO2015054451A1 (en) 2013-10-09 2015-04-16 The United States Of America As Represented By The Secretary Department Of Health And Human Services Detection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma
US9029527B2 (en) 1998-03-20 2015-05-12 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
WO2015070009A2 (en) 2013-11-08 2015-05-14 The Board Of Regents Of The University Of Texas System Vh4 antibodies against gray matter neuron and astrocyte
US9051566B2 (en) 2001-01-31 2015-06-09 Alnylam Pharmaceuticals, Inc. Post-transcriptional gene silencing using expressed double stranded RNA
WO2015098113A1 (en) 2013-12-27 2015-07-02 独立行政法人医薬基盤研究所 Therapeutic drug for malignant tumors
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
EP2913341A1 (en) 2006-12-22 2015-09-02 University of Utah Research Foundation Method of detecting ocular diseases and pathologic conditions and treatment of same
US9150605B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
KR20150129189A (en) 2014-05-08 2015-11-19 서울대학교산학협력단 USE OF REV-ERBα FOR TREATING DOPAMINE-DEPENDENT DISORDERS
KR20150129190A (en) 2014-05-08 2015-11-19 서울대학교산학협력단 USE OF REV-ERBα FOR TREATING AFFECTIVE AND ADDICTIVE DISORDERS
US9198911B2 (en) 2010-11-02 2015-12-01 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
EP2962697A1 (en) 2006-11-27 2016-01-06 diaDexus, Inc. Ovr110 antibody compositions and methods of use
WO2016011123A1 (en) 2014-07-16 2016-01-21 Arrowhead Research Corporation Organic compositions to treat apoc3-related diseases
EP2980220A1 (en) 2005-09-20 2016-02-03 BASF Plant Science GmbH Improved methods controlling gene expression
US9274117B2 (en) 2013-12-21 2016-03-01 Catholic University Industry Academic Use of SIRT7 as novel cancer therapy target and method for treating cancer using the same
US9301923B2 (en) 2009-12-23 2016-04-05 Novartis Ag Lipids, lipid compositions, and methods of using them
WO2016057693A1 (en) 2014-10-10 2016-04-14 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhalation delivery of conjugated oligonucleotide
WO2016077624A1 (en) 2014-11-12 2016-05-19 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
US9352312B2 (en) 2011-09-23 2016-05-31 Alere Switzerland Gmbh System and apparatus for reactions
EP2363479B1 (en) 1999-01-30 2016-07-13 Alnylam Europe AG Oligoribonucucleotide for inhibiting the expression of a predefined gene
US9409983B2 (en) 2009-07-23 2016-08-09 The Board Of Trustess Of The University Of Illinois Methods and compositions involving PBEF inhibitors for lung inflammation conditions and diseases
US9416363B2 (en) 2011-09-13 2016-08-16 Monsanto Technology Llc Methods and compositions for weed control
US9422558B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US9422557B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
EP3072555A1 (en) 2011-09-02 2016-09-28 The Trustees of Columbia University in the City of New York Mk2/3 inhibitors to treat metabolic disturbances of obesity
WO2016176617A2 (en) 2015-04-29 2016-11-03 New York University Method for treating high-grade gliomas
EP3103451A1 (en) 2007-01-12 2016-12-14 University of Maryland, Baltimore Targetting ncca-atp channel for organ protection following ischemic episode
WO2016210292A1 (en) 2015-06-25 2016-12-29 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance
US9540642B2 (en) 2013-11-04 2017-01-10 The United States Of America, As Represented By The Secretary Of Agriculture Compositions and methods for controlling arthropod parasite and pest infestations
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9669103B2 (en) 2015-03-18 2017-06-06 Korea National University Of Transportation Industry-Academic Cooperation Foundation Metal-particle-based oral-administrating liver-specific nucleic acid delivery system and method of manufacturing the same
US9682123B2 (en) 2013-12-20 2017-06-20 The Trustees Of Columbia University In The City Of New York Methods of treating metabolic disease
US9708621B2 (en) 1999-08-13 2017-07-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US9738727B2 (en) 2011-10-14 2017-08-22 Genentech, Inc. Anti-HtrA1 antibodies and methods of use
US9751933B2 (en) 2012-06-14 2017-09-05 Scripps Korea Antibody Institute Antibody specific for CLEC14A and uses thereof
WO2017152073A1 (en) 2016-03-04 2017-09-08 University Of Louisville Research Foundation, Inc. Methods and compositions for ex vivo expansion of very small embryonic-like stem cells (vsels)
US9765351B2 (en) 2006-02-13 2017-09-19 Monsanto Technology Llc Modified gene silencing
WO2017161001A1 (en) 2016-03-15 2017-09-21 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion
US9777275B2 (en) 2002-02-01 2017-10-03 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US9777288B2 (en) 2013-07-19 2017-10-03 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
US9796979B2 (en) 2011-03-03 2017-10-24 Quark Pharmaceuticals Inc. Oligonucleotide modulators of the toll-like receptor pathway
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9885038B2 (en) 2007-08-14 2018-02-06 Commonwealth Scientific & Industrial Research Organisation Gene silencing methods
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
WO2018057575A1 (en) 2016-09-21 2018-03-29 Alnylam Pharmaceuticals, Inc Myostatin irna compositions and methods of use thereof
US9969677B2 (en) 2010-12-22 2018-05-15 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase modulators and uses thereof
US9988634B2 (en) 2010-03-08 2018-06-05 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US9994915B2 (en) 2010-10-11 2018-06-12 Sanford-Burnham Medical Research Institute miR-211 expression and related pathways in human melanoma
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
US10004814B2 (en) 2013-11-11 2018-06-26 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety
US10040853B2 (en) 2011-09-09 2018-08-07 Fred Hutchinson Cancer Research Center Methods and compositions involving NKG2D inhibitors and cancer
US10041068B2 (en) 2013-01-01 2018-08-07 A. B. Seeds Ltd. Isolated dsRNA molecules and methods of using same for silencing target molecules of interest
US10072065B2 (en) 2015-08-24 2018-09-11 Mayo Foundation For Medical Education And Research Peptide-mediated delivery of immunoglobulins across the blood-brain barrier
US10077451B2 (en) 2012-10-18 2018-09-18 Monsanto Technology Llc Methods and compositions for plant pest control
US10106793B2 (en) 2002-02-01 2018-10-23 Life Technologies Corporation Double-stranded oligonucleotides
US10196637B2 (en) 2011-06-08 2019-02-05 Nitto Denko Corporation Retinoid-lipid drug carrier
US10240161B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10334848B2 (en) 2014-01-15 2019-07-02 Monsanto Technology Llc Methods and compositions for weed control using EPSPS polynucleotides
US10342761B2 (en) 2014-07-16 2019-07-09 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
US10378012B2 (en) 2014-07-29 2019-08-13 Monsanto Technology Llc Compositions and methods for controlling insect pests
US10421822B2 (en) 2015-10-30 2019-09-24 Genetech, Inc. Anti-HtrA1 antibodies and methods of use thereof
US10435701B2 (en) 2013-03-14 2019-10-08 Monsanto Technology Llc Methods and compositions for plant pest control
WO2019199673A1 (en) 2018-04-09 2019-10-17 President And Fellows Of Harvard College Modulating nuclear receptors and methods of using same
WO2019217459A1 (en) 2018-05-07 2019-11-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US10513703B2 (en) 2014-11-10 2019-12-24 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
US10557138B2 (en) 2013-12-10 2020-02-11 Beeologics, Inc. Compositions and methods for virus control in Varroa mite and bees
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
US10584144B2 (en) 2015-03-09 2020-03-10 University Of Kentucky Research Foundation RNA nanoparticles for brain tumor treatment
WO2020061381A1 (en) 2018-09-19 2020-03-26 La Jolla Institute For Immunology Ptprs and proteoglycans in rheumatoid arthritis
US10609930B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10612019B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
EP3632901A1 (en) 2009-12-10 2020-04-08 The Trustees of Columbia University in the City of New York Histone acetyltransferase activators and uses thereof
US10640457B2 (en) 2009-12-10 2020-05-05 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase activators and uses thereof
WO2020089841A1 (en) 2018-10-31 2020-05-07 Garcia Joe G N Biomarkers and methods of use for radiation-induced lung injury
US10655136B2 (en) 2015-06-03 2020-05-19 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
EP3677310A1 (en) 2012-10-08 2020-07-08 St. Jude Children's Research Hospital Therapies based on control of regulatory t cell stability and function via a neuropilin-1:semaphorin axis
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
EP3702470A2 (en) 2015-09-09 2020-09-02 The Trustees of Columbia University in the City of New York Reduction of er-mam-localized app-c99 and methods of treating alzheimer's disease
US10781446B2 (en) 2015-03-09 2020-09-22 University Of Kentucky Research Foundation RNA nanoparticle for treatment of gastric cancer
US10801028B2 (en) 2009-10-14 2020-10-13 Beeologics Inc. Compositions for controlling Varroa mites in bees
US10808249B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
WO2020236600A1 (en) 2019-05-17 2020-11-26 Alnylam Pharmaceuticals, Inc. Oral delivery of oligonucleotides
US10857145B2 (en) 2015-09-29 2020-12-08 Duke University Compositions and methods for identifying and treating dystonia disorders
US10883103B2 (en) 2015-06-02 2021-01-05 Monsanto Technology Llc Compositions and methods for delivery of a polynucleotide into a plant
US10883108B2 (en) 2016-03-31 2021-01-05 The Schepens Eye Research Institute, Inc. Endomucin inhibitor as an anti-angiogenic agent
US10888579B2 (en) 2007-11-07 2021-01-12 Beeologics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
EP3778644A2 (en) 2014-12-23 2021-02-17 The Trustees of Columbia University in the City of New York Fgfr-tacc fusion proteins and methods thereof
WO2021060624A1 (en) 2019-09-24 2021-04-01 테고사이언스(주) Composition for preventing or treating keloid or hypertrophic scar
US10968449B2 (en) 2015-01-22 2021-04-06 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US10988764B2 (en) 2014-06-23 2021-04-27 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
WO2021092371A2 (en) 2019-11-06 2021-05-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery
WO2021123920A1 (en) 2019-12-18 2021-06-24 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2021124172A1 (en) 2019-12-18 2021-06-24 Novartis Ag 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2021142191A1 (en) 2020-01-08 2021-07-15 Regeneron Pharmaceuticals, Inc. Treatment of fibrodysplasia ossificans progressiva
WO2021150300A1 (en) 2020-01-22 2021-07-29 Massachusetts Institute Of Technology Inducible tissue constructs and uses thereof
US11085044B2 (en) 2015-03-09 2021-08-10 University Of Kentucky Research Foundation miRNA for treatment of breast cancer
US11091770B2 (en) 2014-04-01 2021-08-17 Monsanto Technology Llc Compositions and methods for controlling insect pests
WO2021173965A1 (en) 2020-02-28 2021-09-02 Massachusetts Institute Of Technology Identification of variable influenza residues and uses thereof
US11141492B2 (en) 2013-07-03 2021-10-12 City Of Hope Anticancer combinations
CN113851845A (en) * 2021-10-13 2021-12-28 中国信息通信研究院 Integrated filtering duplex antenna for inhibiting in-band signal
US11214801B2 (en) 2017-09-11 2022-01-04 Arrowhead Pharmaceuticals, Inc. RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
WO2022006286A1 (en) 2020-06-30 2022-01-06 Lunglife Ai Methods for detecting lung cancer
WO2022011214A1 (en) 2020-07-10 2022-01-13 Alnylam Pharmaceuticals, Inc. Circular sirnas
US11279768B1 (en) 2015-04-03 2022-03-22 Precision Biologics, Inc. Anti-cancer antibodies, combination therapies, and uses thereof
US11324820B2 (en) 2017-04-18 2022-05-10 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (HBV) infection
WO2022147481A1 (en) 2020-12-30 2022-07-07 Ansun Biopharma Inc. Combination therapy of an oncolytic virus delivering a foreign antigen and an engineered immune cell expressing a chimeric receptor targeting the foreign antigen
WO2022147214A2 (en) 2020-12-31 2022-07-07 Alnylam Pharmaceuticals, Inc. Cyclic-disulfide modified phosphate based oligonucleotide prodrugs
WO2022147223A2 (en) 2020-12-31 2022-07-07 Alnylam Pharmaceuticals, Inc. 2'-modified nucleoside based oligonucleotide prodrugs
US11492623B2 (en) 2018-08-13 2022-11-08 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof
WO2022269518A2 (en) 2021-06-23 2022-12-29 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2023283403A2 (en) 2021-07-09 2023-01-12 Alnylam Pharmaceuticals, Inc. Bis-rnai compounds for cns delivery
WO2023012165A1 (en) 2021-08-02 2023-02-09 Universite De Montpellier Compositions and methods for treating cmt1a or cmt1e diseases with rnai molecules targeting pmp22
US11807857B2 (en) 2014-06-25 2023-11-07 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
WO2023220744A2 (en) 2022-05-13 2023-11-16 Alnylam Pharmaceuticals, Inc. Single-stranded loop oligonucleotides
WO2023230531A1 (en) 2022-05-24 2023-11-30 Lunglife Ai, Inc. Methods for detecting circulating genetically abnormal cells
WO2024006999A2 (en) 2022-06-30 2024-01-04 Alnylam Pharmaceuticals, Inc. Cyclic-disulfide modified phosphate based oligonucleotide prodrugs
WO2024059824A2 (en) 2022-09-16 2024-03-21 Arsenal Biosciences, Inc. Immune cells with combination gene perturbations
WO2024059618A2 (en) 2022-09-13 2024-03-21 Arsenal Biosciences, Inc. Immune cells having co-expressed tgfbr shrnas
WO2024073732A1 (en) 2022-09-30 2024-04-04 Alnylam Pharmaceuticals, Inc. Modified double-stranded rna agents
US11964028B2 (en) 2015-04-17 2024-04-23 University Of Kentucky Research Foundation RNA nanoparticles and method of use thereof

Families Citing this family (78)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9096636B2 (en) 1996-06-06 2015-08-04 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
AU1628599A (en) 1997-12-05 1999-06-28 Medical College Of Georgia Research Institute, Inc. Regulation of t cell-mediated immunity by tryptophan
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
IL142094A0 (en) 1998-09-29 2002-03-10 Gamida Cell Ltd Methods of controlling proliferation and differentiation of stem and progenitor cells
EP2314700A1 (en) * 1999-01-28 2011-04-27 Medical College of Georgia Research Institute, Inc Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US20040138168A1 (en) * 1999-04-21 2004-07-15 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
GB2377221B (en) * 2000-03-17 2004-08-18 Benitec Australia Ltd Genetic silencing
WO2002000904A2 (en) * 2000-06-23 2002-01-03 E. I. Du Pont De Nemours And Company Recombinant constructs and their use in reducing gene expression
US20080242627A1 (en) * 2000-08-02 2008-10-02 University Of Southern California Novel rna interference methods using dna-rna duplex constructs
IL159756A0 (en) * 2001-07-12 2004-06-20 Univ Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
WO2003007800A2 (en) * 2001-07-17 2003-01-30 The General Hospital Corporation Methods for diagnosing and treating diseases and conditions of the digestive system and cancer
US20040096880A1 (en) * 2001-08-07 2004-05-20 Kmiec Eric B. Compositions and methods for the treatment of diseases exhibiting protein misassembly and aggregation
CA2455424A1 (en) * 2001-08-07 2003-02-20 University Of Delaware Compositions and methods for the prevention and treatment of huntington's disease
DE10230997A1 (en) * 2001-10-26 2003-07-17 Ribopharma Ag Drug to increase the effectiveness of a receptor-mediates apoptosis in drug that triggers tumor cells
WO2003046173A1 (en) * 2001-11-28 2003-06-05 Center For Advanced Science And Technology Incubation, Ltd. siRNA EXPRESSION SYSTEM AND PROCESS FOR PRODUCING FUNCTIONAL GENE-KNOCKDOWN CELLS AND THE LIKE USING THE SAME
IL152904A0 (en) 2002-01-24 2003-06-24 Gamida Cell Ltd Utilization of retinoid and vitamin d receptor antagonists for expansion of renewable stem cell populations
EP1465982A4 (en) 2002-01-25 2006-06-07 Gamida Cell Ltd Methods of expanding stem and progenitor cells and expanded cell populations obtained thereby
JP2005527198A (en) 2002-02-14 2005-09-15 シティ・オブ・ホープ Methods for producing interfering RNA molecules in mammalian cells and therapeutic uses of the interfering RNA molecules
US20040248296A1 (en) * 2002-03-20 2004-12-09 Beresford Paul J. HIV therapeutic
US20030180756A1 (en) * 2002-03-21 2003-09-25 Yang Shi Compositions and methods for suppressing eukaryotic gene expression
JP2005537028A (en) * 2002-06-26 2005-12-08 ザ ペン ステート リサーチ ファウンデーション Methods and materials for treating human papillomavirus infections
AU2003274906A1 (en) * 2002-07-31 2004-02-16 Nucleonics, Inc. Double stranded rna structures and constructs, and methods for generating and using the same
CN1685063B (en) 2002-08-12 2011-12-21 新英格兰生物实验室公司 Methods and compositions relating to gene silencing
US9150606B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2'-modified nucleosides for use in gene modulation
JP2006523103A (en) * 2003-02-21 2006-10-12 ザ ペン ステイト リサーチ ファウンデーション RNA interference compositions and methods
US20050054103A1 (en) * 2003-03-07 2005-03-10 Tony Peled Expansion of renewable stem cell populations using modulators of PI 3-kinase
US20050186289A1 (en) * 2003-04-01 2005-08-25 Medical College Of Georgia Research Institute, Inc. Regulation of T cell-mediated immunity by D isomers of inhibitors of indoleamine-2,3-dioxygenase
US7598287B2 (en) 2003-04-01 2009-10-06 Medical College Of Georgia Research Institute, Inc. Use of inhibitors of indoleamine-2,3-dioxygenase in combination with other therapeutic modalities
US20050059044A1 (en) * 2003-06-03 2005-03-17 Graham Michael Wayne Double-stranded nucleic acid
WO2005040388A2 (en) * 2003-08-22 2005-05-06 Nucleonics Inc. Eukariotic expression systems for expression of inhibitory rna in multiple intracellular compartments
MXPA06002216A (en) * 2003-08-28 2006-04-27 Novartis Ag INTERFERING RNA DUPLEX HAVING BLUNT-ENDS AND 3aCO-MODIFICATIONS.
EP1694842B1 (en) * 2003-11-04 2011-03-23 Geron Corporation Rna amidates and thioamidates for rnai
WO2005076998A2 (en) * 2004-02-05 2005-08-25 Intradigm Corporation Rnai therapeutics for treatment of eye neovascularization diseases
EP2514758B2 (en) 2004-03-15 2021-06-23 City of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20070265220A1 (en) * 2004-03-15 2007-11-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US7851452B2 (en) * 2004-03-22 2010-12-14 The Trustees Of The University Of Pennsylvania Methods of use of bcl-6-derived nucleotides to induce apoptosis
DE602005020943D1 (en) * 2004-07-01 2010-06-10 Gen Probe Inc METHOD AND COMPOSITIONS FOR DETECTING NUCLEIC ACIDS IN A BIOLOGICAL SAMPLE
US8030284B2 (en) * 2004-08-23 2011-10-04 Sylentis S.A.U. Treatment of eye disorders characterized by an elevated intraocular pressure by siRNAs
WO2006030442A2 (en) 2004-09-16 2006-03-23 Gamida-Cell Ltd. Methods of ex vivo progenitor and stem cell expansion by co-culture with mesenchymal cells
CN101107362A (en) 2004-10-21 2008-01-16 文甘扎公司 Methods and materials for conferring resistance to pests and pathogens of plants
TWI386225B (en) * 2004-12-23 2013-02-21 Alcon Inc Rnai inhibition of ctgf for treatment of ocular disorders
TWI401316B (en) * 2004-12-23 2013-07-11 Alcon Inc Rnai inhibition of serum amyloid a for treatment of glaucoma
TW200639252A (en) * 2005-02-01 2006-11-16 Alcon Inc RNAi-mediated inhibition of ocular hypertension targets
CA2598234A1 (en) * 2005-03-11 2006-09-21 Alcon, Inc. Rnai-mediated inhibition of frizzled related protein-1 for treatment of glaucoma
DE202005004135U1 (en) * 2005-03-11 2005-05-19 Klocke Verpackungs-Service Gmbh Multi-component packaging with applicator
US20070074311A1 (en) * 2005-08-30 2007-03-29 Pioneer Hi-Bred International, Inc. Compositions and methods for modulating expression of gene products
GB0521351D0 (en) * 2005-10-20 2005-11-30 Genomica Sau Modulation of TRPV expression levels
GB0521716D0 (en) * 2005-10-25 2005-11-30 Genomica Sau Modulation of 11beta-hydroxysteriod dehydrogenase 1 expression for the treatment of ocular diseases
US8846393B2 (en) 2005-11-29 2014-09-30 Gamida-Cell Ltd. Methods of improving stem cell homing and engraftment
CA2687964A1 (en) 2007-06-01 2009-02-19 The Trustees Of Princeton University Treatment of viral infections by modulation of host cell metabolic pathways
JP5733796B2 (en) 2008-05-13 2015-06-10 ジェン−プロウブ インコーポレイテッド Inactivatable target capture oligomers for use in selective hybridization and capture of target nucleic acid sequences
EP2367958B1 (en) * 2008-11-25 2017-08-23 Gen-Probe Incorporated Compositions and methods for detecting small rnas, and uses thereof
US20100257634A1 (en) * 2009-04-03 2010-10-07 Venganza Inc. Bioassay for gene silencing constructs
US8901097B2 (en) 2009-11-08 2014-12-02 Quark Pharmaceuticals, Inc. Methods for delivery of siRNA to the spinal cord and therapies arising therefrom
EP2633049B1 (en) 2010-10-27 2018-10-10 Harrisvaccines Inc Methods and compositions to protect aquatic invertebrates from disease
US10004797B2 (en) 2010-10-27 2018-06-26 Harrisvaccines, Inc. Method of rapidly producing improved vaccines for animals
US8822427B2 (en) 2010-10-27 2014-09-02 Harrisvaccines Methods and compositions to protect aquatic invertebrates from disease
CA2831613A1 (en) 2011-03-31 2012-10-04 Moderna Therapeutics, Inc. Delivery and formulation of engineered nucleic acids
EP2814951B1 (en) 2012-02-13 2019-04-03 Gamida-Cell Ltd. Culturing of mesenchymal stem cells
US9283287B2 (en) 2012-04-02 2016-03-15 Moderna Therapeutics, Inc. Modified polynucleotides for the production of nuclear proteins
AU2013243953A1 (en) 2012-04-02 2014-10-30 Modernatx, Inc. Modified polynucleotides for the production of nuclear proteins
US9567569B2 (en) 2012-07-23 2017-02-14 Gamida Cell Ltd. Methods of culturing and expanding mesenchymal stem cells
US9175266B2 (en) 2012-07-23 2015-11-03 Gamida Cell Ltd. Enhancement of natural killer (NK) cell proliferation and activity
GB201215857D0 (en) 2012-09-05 2012-10-24 Sylentis Sau siRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions
CN104781402A (en) 2012-09-05 2015-07-15 西伦蒂斯私人股份公司 siRNA and their use in methods and compositions for the treatment and/or prevention of eye conditions
EP2971165A4 (en) * 2013-03-15 2016-11-23 Moderna Therapeutics Inc Removal of dna fragments in mrna production process
WO2014152031A1 (en) 2013-03-15 2014-09-25 Moderna Therapeutics, Inc. Ribonucleic acid purification
WO2014144767A1 (en) 2013-03-15 2014-09-18 Moderna Therapeutics, Inc. Ion exchange purification of mrna
EP2971033B8 (en) 2013-03-15 2019-07-10 ModernaTX, Inc. Manufacturing methods for production of rna transcripts
CA2917348A1 (en) 2013-07-11 2015-01-15 Moderna Therapeutics, Inc. Compositions comprising synthetic polynucleotides encoding crispr related proteins and synthetic sgrnas and methods of use
EP3052511A4 (en) 2013-10-02 2017-05-31 Moderna Therapeutics, Inc. Polynucleotide molecules and uses thereof
US10011837B2 (en) 2014-03-04 2018-07-03 Sylentis Sau SiRNAs and their use in methods and compositions for the treatment and/or prevention of eye conditions
WO2015196128A2 (en) 2014-06-19 2015-12-23 Moderna Therapeutics, Inc. Alternative nucleic acid molecules and uses thereof
AU2015289656A1 (en) 2014-07-16 2017-02-16 Modernatx, Inc. Circular polynucleotides
US11434486B2 (en) 2015-09-17 2022-09-06 Modernatx, Inc. Polynucleotides containing a morpholino linker
CA3063661A1 (en) 2017-03-31 2018-10-04 Pebble Labs, Inc. Novel system for the biocontrol of pathogens in aquaculture and other animal systems
US11446339B2 (en) 2017-03-31 2022-09-20 Pebble Labs Inc. System for the biocontrol of white spot syndrome virus (WSSV) in aquaculture

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5422241A (en) * 1991-07-03 1995-06-06 Ambion, Inc. Methods for the recovery of nucleic acids from reaction mixtures
WO1999032619A1 (en) * 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
WO1999061631A1 (en) * 1998-05-26 1999-12-02 Novartis Ag Dsrna-mediated regulation of gene expression in plants

Family Cites Families (142)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US56235A (en) * 1866-07-10 Improvement in paring-knives
US114784A (en) * 1871-05-16 Improvement in compounds for cure of chills and fever
US18999A (en) * 1857-12-29 Improvement in seed-planters
US228691A (en) * 1880-06-08 Lard-cooler
US173478A (en) * 1876-02-15 Improvement in zitherns
US132257A (en) * 1872-10-15 Improvement in machines for putting glue into grooves
US180756A (en) * 1876-08-08 Improvement in processes for treating silver ore
US162126A (en) * 1875-04-13 Improvement in sulky-plows
US157030A (en) * 1874-11-17 Improvement in centering devices
US51263A (en) * 1865-11-28 Improvement in preserving eggs
US84471A (en) * 1868-12-01 Sigismund beer
US27783A (en) * 1860-04-10 Improvement in apparatus for evaporating sugar-juices
US3931397A (en) * 1971-11-05 1976-01-06 Beecham Group Limited Biologically active material
US4024222A (en) * 1973-10-30 1977-05-17 The Johns Hopkins University Nucleic acid complexes
GB2007055B (en) * 1977-10-21 1982-08-18 Plessey Co Ltd Circuit arrangement
US4283393A (en) * 1979-03-13 1981-08-11 Merck & Co., Inc. Topical application of interferon inducers
US4469863A (en) * 1980-11-12 1984-09-04 Ts O Paul O P Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof
US4605394A (en) * 1982-12-03 1986-08-12 Simon V. Skurkovich Methods for the treatment of pathological conditions by removing interferon from the organism
JPS5936698A (en) * 1982-08-20 1984-02-28 Science & Tech Agency Recombinant dna recombined with gene of virus of hepatitis b, transformed animal cell, and preparation of protein of virus of hepatitis b
US5208149A (en) * 1983-10-20 1993-05-04 The Research Foundation Of State University Of New York Nucleic acid constructs containing stable stem and loop structures
US5190931A (en) * 1983-10-20 1993-03-02 The Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5272065A (en) * 1983-10-20 1993-12-21 Research Foundation Of State University Of New York Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA
US5173410A (en) * 1984-02-15 1992-12-22 Lubrizol Genetics Inc. Transfer vector
US4897355A (en) * 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US4766072A (en) * 1985-07-17 1988-08-23 Promega Corporation Vectors for in vitro production of RNA copies of either strand of a cloned DNA sequence
CA1326450C (en) 1985-08-26 1994-01-25 William A. Carter Modulation of aids virus-related events by double stranded rnas (dsrnas)
GB8601680D0 (en) 1986-01-23 1986-02-26 Agricultural Genetics Co Modification of plant viruses
US5453566A (en) * 1986-03-28 1995-09-26 Calgene, Inc. Antisense regulation of gene expression in plant/cells
US5107065A (en) * 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
PH24467A (en) 1987-03-03 1990-07-18 Hem Res Inc Synergistics interplay of lymphokines and dsrnas
US4950652A (en) 1987-03-23 1990-08-21 Hem Research, Inc. dsRNAs for combination therapy in the treatment of viral diseases
AU1820588A (en) 1987-07-17 1989-01-19 Hem Research, Inc. Double-stranded rna correction of abnormalities in circulating immune complexes and monocyte function
IE72103B1 (en) 1987-08-12 1997-03-12 Hem Res Inc Promotion of host defense by systemic dsRNA treatment
IE66830B1 (en) 1987-08-12 1996-02-07 Hem Res Inc Topically active compositions of double-stranded RNAs
EP0306347B1 (en) 1987-09-04 1995-05-10 Hem Pharmaceuticals Corp. Diagnosis of double-stranded RNA deficiency states
US5874555A (en) * 1987-10-30 1999-02-23 California Institute Of Technology Triple helices and processes for making same
US4963532A (en) 1987-11-25 1990-10-16 Hem Research, Inc. dsRNA-based prevention of viral escape
PH25365A (en) 1987-12-23 1991-05-13 Hem Research Rhase l inhibitor as a marker for virus infections
US5922602A (en) 1988-02-26 1999-07-13 Biosource Technologies, Inc. Cytoplasmic inhibition of gene expression
CA1320446C (en) 1988-06-20 1993-07-20 William A. Carter Modulation of lymphokine-resistant cellular states by dsrnas
EP0350151B1 (en) 1988-07-07 1994-03-30 Hem Pharmaceuticals Corp. Diagnosing and treating chronic fatigue syndrome
DE59010432D1 (en) 1989-03-16 1996-09-05 Boehringer Ingelheim Int Genetic units to inhibit the function of RNA
US5703055A (en) * 1989-03-21 1997-12-30 Wisconsin Alumni Research Foundation Generation of antibodies through lipid mediated DNA delivery
US5034323A (en) 1989-03-30 1991-07-23 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
WO1990012094A1 (en) 1989-04-05 1990-10-18 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce A clone of double-stranded rna virus and applications thereof
WO1990012488A2 (en) 1989-04-05 1990-11-01 The United States Of America, As Represented By The Secretary, U.S. Department Of Commerce A clone of double-stranded rna virus applied to antibody production, study of retrovirus-like frameshifting and production of proteins in yeast
JPH04507083A (en) 1989-05-19 1992-12-10 ヘム・リサーチ・インコーポレーテッド Short therapeutic dsRNA of defined structure
GB8916213D0 (en) * 1989-07-14 1989-08-31 Ici Plc Dna constructs,cells and plants derived therefrom
US5279833A (en) * 1990-04-04 1994-01-18 Yale University Liposomal transfection of nucleic acids into animal cells
US5264618A (en) * 1990-04-19 1993-11-23 Vical, Inc. Cationic lipids for intracellular delivery of biologically active molecules
US5227292A (en) * 1990-07-12 1993-07-13 University Of Utah Neurofibromatosis type 1 gene
EP0580754A1 (en) * 1991-04-18 1994-02-02 The Salk Institute For Biological Studies Oligodeoxynucleotides and oligonucleotides useful as decoys for proteins which selectively bind to defined dna sequences
FR2675803B1 (en) 1991-04-25 1996-09-06 Genset Sa CLOSED, ANTISENSE AND SENSE OLIGONUCLEOTIDES AND THEIR APPLICATIONS.
US6010908A (en) * 1992-08-21 2000-01-04 The Regents Of The University Of California Gene therapy by small fragment homologous replacement
US5283185A (en) * 1991-08-28 1994-02-01 University Of Tennessee Research Corporation Method for delivering nucleic acids into cells
CA2073630C (en) * 1991-08-30 2007-12-11 Atsushi Ohshima Method for synthesizing single-stranded stem-loop dnas, the products and uses therefor
US5714323A (en) * 1991-08-30 1998-02-03 The University Of Medecine And Dentistry Of New Jersey Over expression of single-stranded molecules
FR2685346B1 (en) * 1991-12-18 1994-02-11 Cis Bio International PROCESS FOR THE PREPARATION OF DOUBLE-STRANDED RNA, AND ITS APPLICATIONS.
PT626998E (en) * 1992-02-19 2002-04-29 State Of Oregon By S B Hi Educ "PRODUCTION OF VIRUS RESISTANT PLANTS THROUGH INTRODUCTION OF A NON-TRANSLUCENT VIRAL MOLECULA AND CODIFICATION SENSE"
DE4208107A1 (en) * 1992-03-13 1993-09-16 Bayer Ag PSEUDORABIES VIRUS (PRV) POLYNUCLEOTIDES AND THEIR USE IN THE MANUFACTURE OF VIRUS RESISTANT EUKARYOTIC CELLS
GB9210273D0 (en) 1992-05-13 1992-07-01 Ici Plc Dna
US5693535A (en) * 1992-05-14 1997-12-02 Ribozyme Pharmaceuticals, Inc. HIV targeted ribozymes
JPH08501928A (en) 1992-07-02 1996-03-05 ハイブライドン インコーポレイテッド Self-stabilizing oligonucleotides as therapeutic agents
US6372965B1 (en) * 1992-11-17 2002-04-16 E.I. Du Pont De Nemours And Company Genes for microsomal delta-12 fatty acid desaturases and hydroxylases from plants
ZA939767B (en) 1993-01-21 1994-09-14 Univ North Carolina State Nematode-resistant transgenic plants
US5981505A (en) * 1993-01-26 1999-11-09 The Trustees Of The University Of Pennsylvania Compositions and methods for delivery of genetic material
WO1995003406A2 (en) 1993-07-19 1995-02-02 Gen-Probe Incorporated Enhancement of oligonucleotide inhibition of protein production, cell proliferation, and/or multiplication of infectious disease pathogens
US5739309A (en) * 1993-07-19 1998-04-14 Gen-Probe Incorporated Enhancement of oligonucleotide inhibition of protein production, cell proliferation and / or multiplication of infectious disease pathogens
US5514546A (en) * 1993-09-01 1996-05-07 Research Corporation Technologies, Inc. Stem-loop oligonucleotides containing parallel and antiparallel binding domains
US5808036A (en) * 1993-09-01 1998-09-15 Research Corporation Technologies Inc. Stem-loop oligonucleotides containing parallel and antiparallel binding domains
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
US5908779A (en) * 1993-12-01 1999-06-01 University Of Connecticut Targeted RNA degradation using nuclear antisense RNA
US5578716A (en) * 1993-12-01 1996-11-26 Mcgill University DNA methyltransferase antisense oligonucleotides
FR2714383B1 (en) * 1993-12-29 1996-02-09 Centre Nat Rech Scient Control of gene expression.
ATE320487T1 (en) 1994-01-05 2006-04-15 Gene Shears Pty Ltd RIBOZYMES AGAINST AN HIV ACT SEQUENCE
AU706417B2 (en) 1994-02-23 1998-06-17 Ribozyme Pharmaceuticals, Inc. Method and reagent for inhibiting the expression of disease related genes
US5686649A (en) * 1994-03-22 1997-11-11 The Rockefeller University Suppression of plant gene expression using processing-defective RNA constructs
WO1995027783A1 (en) 1994-04-06 1995-10-19 Joshi Sukhwal Sadna Inhibition of hiv-1 multiplication in mammalian cells
US5631148A (en) * 1994-04-22 1997-05-20 Chiron Corporation Ribozymes with product ejection by strand displacement
US6054299A (en) * 1994-04-29 2000-04-25 Conrad; Charles A. Stem-loop cloning vector and method
US5459427A (en) * 1994-05-06 1995-10-17 Motorola, Inc. DC level shifting circuit for analog circuits
EP0772678A4 (en) 1994-09-12 1999-10-20 Hope City Modulation of drug radiation resistant genes
US5837533A (en) * 1994-09-28 1998-11-17 American Home Products Corporation Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent
US5691140A (en) * 1995-05-18 1997-11-25 New England Biolabs, Inc. Bidirectional in vitro transcription vectors utilizing a single RNA polymerase for both directions
US5693773A (en) * 1995-06-07 1997-12-02 Hybridon Incorporated Triplex-forming antisense oligonucleotides having abasic linkers targeting nucleic acids comprising mixed sequences of purines and pyrimidines
US5932241A (en) * 1995-06-07 1999-08-03 Valentis, Incorporated Cationic lipid DNA complexes for gene targeting
AU710874B2 (en) 1995-06-30 1999-09-30 Dna Plant Technology Corporation Delayed ripening tomato plants
GB9517779D0 (en) 1995-08-31 1995-11-01 Roslin Inst Edinburgh Biological manipulation
WO1997010360A1 (en) 1995-09-13 1997-03-20 Chiron Corporation Method and construct for screening for inhibitors of transcriptional activation
WO1997034638A1 (en) 1996-03-20 1997-09-25 The Regents Of The University Of California Antisense approach to gene inhibition
US6022863A (en) 1996-05-21 2000-02-08 Yale University Regulation of gene expression
US5850026A (en) * 1996-07-03 1998-12-15 Cargill, Incorporated Canola oil having increased oleic acid and decreased linolenic acid content
DE69734589T2 (en) * 1996-08-02 2006-08-10 Genesense Technologies Inc., Markham Antitumor Antisense Sequences Against H1 and R2 Compounds of Ribonucleotide Reduction
DE19631919C2 (en) 1996-08-07 1998-07-16 Deutsches Krebsforsch Anti-sense RNA with secondary structure
US5747338A (en) * 1996-08-15 1998-05-05 Chiron Corporation Method and construct for screening for inhibitors of transcriptional activation
US5814500A (en) * 1996-10-31 1998-09-29 The Johns Hopkins University School Of Medicine Delivery construct for antisense nucleic acids and methods of use
GB9703146D0 (en) * 1997-02-14 1997-04-02 Innes John Centre Innov Ltd Methods and means for gene silencing in transgenic plants
BR9808647A (en) 1997-02-21 2000-05-23 Danisco Inhibition of antisense intron of starch branching expression enzyme
EP0921195A1 (en) 1997-03-10 1999-06-09 Japan Tobacco Inc. Antisense base sequences
GB9706381D0 (en) 1997-03-27 1997-05-14 Cambridge Advanced Tech Improvements relating to the specificity of gene expression
US6217900B1 (en) * 1997-04-30 2001-04-17 American Home Products Corporation Vesicular complexes and methods of making and using the same
GB9710475D0 (en) 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
EP1019429A4 (en) 1997-08-20 2001-08-08 Somagenics Inc Antisense and antigene therapeutics with improved binding properties and methods for their use
GB9720148D0 (en) * 1997-09-22 1997-11-26 Innes John Centre Innov Ltd Gene silencing materials and methods
CA2306733A1 (en) * 1997-10-28 1999-05-06 American Home Products Corporation Compositions and methods for delivery of genetic material
AU1526199A (en) 1997-11-18 1999-06-07 Pioneer Hi-Bred International, Inc. Targeted manipulation of herbicide-resistance genes in plants
CZ295108B6 (en) * 1998-03-20 2005-05-18 Benitec Australia Ltd Synthetic gene comprising dispersed or foreign deoxyribonucleic molecule and a gene construct containing such a synthetic gene
AU9522501A (en) 1998-03-20 2002-01-31 Benitec Australia Ltd Control of gene expression
AUPP249298A0 (en) * 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
GB9827152D0 (en) * 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
US5945290A (en) * 1998-09-18 1999-08-31 Isis Pharmaceuticals, Inc. Antisense modulation of RhoA expression
EP2314700A1 (en) * 1999-01-28 2011-04-27 Medical College of Georgia Research Institute, Inc Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
DE19956568A1 (en) * 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
US20040138168A1 (en) * 1999-04-21 2004-07-15 Wyeth Methods and compositions for inhibiting the function of polynucleotide sequences
IL145778A0 (en) 1999-04-21 2002-07-25 American Home Prod Methods and compositions for inhibiting the function of polynucleotide sequences
BR0012325A (en) 1999-07-09 2002-05-21 American Home Prod Methods and compositions for preventing the formation of abnormal RNA during the transcription of a plasmid sequence
US6423885B1 (en) * 1999-08-13 2002-07-23 Commonwealth Scientific And Industrial Research Organization (Csiro) Methods for obtaining modified phenotypes in plant cells
US6291504B1 (en) * 1999-10-20 2001-09-18 Dupont Pharmaceuticals Company Acylsemicarbazides and their uses
GB9927444D0 (en) * 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
DE10100586C1 (en) 2001-01-09 2002-04-11 Ribopharma Ag Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases
GB9930691D0 (en) 1999-12-24 2000-02-16 Devgen Nv Improvements relating to double-stranded RNA inhibition
US20030084471A1 (en) * 2000-03-16 2003-05-01 David Beach Methods and compositions for RNA interference
EP1272630A2 (en) * 2000-03-16 2003-01-08 Genetica, Inc. Methods and compositions for rna interference
GB2377221B (en) 2000-03-17 2004-08-18 Benitec Australia Ltd Genetic silencing
IL151928A0 (en) * 2000-03-30 2003-04-10 Whitehead Biomedical Inst Rna sequence-specific mediators of rna interference
GB2362383B (en) 2000-05-19 2003-12-31 Devgen Nv Gene expression system
WO2002000904A2 (en) * 2000-06-23 2002-01-03 E. I. Du Pont De Nemours And Company Recombinant constructs and their use in reducing gene expression
US7109393B2 (en) * 2000-08-15 2006-09-19 Mendel Biotechnology, Inc. Methods of gene silencing using inverted repeat sequences
US20020173478A1 (en) * 2000-11-14 2002-11-21 The Trustees Of The University Of Pennsylvania Post-transcriptional gene silencing by RNAi in mammalian cells
ES2215494T5 (en) 2000-12-01 2017-12-28 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Small RNA molecules that mediate RNA interference
US20020132257A1 (en) * 2001-01-31 2002-09-19 Tony Giordano Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell
IL159756A0 (en) 2001-07-12 2004-06-20 Univ Massachusetts IN VIVO PRODUCTION OF SMALL INTERFERING RNAs THAT MEDIATE GENE SILENCING
ES2601141T3 (en) 2001-09-13 2017-02-14 California Institute Of Technology Method for the expression of small RNA molecules within a cell
CA2462139A1 (en) 2001-09-27 2003-04-03 Timothy Albert Holton Stem-loop vector system
JP2005527639A (en) * 2001-11-02 2005-09-15 インサート セラピューティクス インコーポレイテッド Methods and compositions for therapeutic use of RNA interference
GB0130955D0 (en) 2001-12-24 2002-02-13 Cancer Res Ventures Expression system
US20040022748A1 (en) * 2002-03-12 2004-02-05 Unilever Home & Personal Care Usa, Division Of Conopco, Inc. Method of enhancing skin lightening
US20030180756A1 (en) * 2002-03-21 2003-09-25 Yang Shi Compositions and methods for suppressing eukaryotic gene expression
US20030228691A1 (en) * 2002-05-17 2003-12-11 Lewis David L. Processes for inhibiting gene expression using polynucleotides
US20040029275A1 (en) * 2002-08-10 2004-02-12 David Brown Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs
CN109993125B (en) 2019-04-03 2022-12-23 腾讯科技(深圳)有限公司 Model training method, face recognition device, face recognition equipment and storage medium

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5422241A (en) * 1991-07-03 1995-06-06 Ambion, Inc. Methods for the recovery of nucleic acids from reaction mixtures
WO1999032619A1 (en) * 1997-12-23 1999-07-01 The Carnegie Institution Of Washington Genetic inhibition by double-stranded rna
WO1999061631A1 (en) * 1998-05-26 1999-12-02 Novartis Ag Dsrna-mediated regulation of gene expression in plants

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
C. NUSSLEIN-VOLHARD, SCIENCE, vol. 266, 1994, pages 572 - 574
FIRE A ET AL: "Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans", NATURE, vol. 391, 19 February 1998 (1998-02-19), pages 806 - 811, XP002095876, ISSN: 0028-0836 *
LI YX. ET AL.: "Double-stranded RNA injection produces null phenotypes in zebrafish.", DEV BIOL 2000 JAN 15;217(2):394-405, XP002138444 *
MONTGOMERY, M. ET AL.: "RNA as a target of double-stranded RNA-mediated genetic interference in Caenorhabditis elegans", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA., vol. 95, December 1998 (1998-12-01), pages 15502 - 15507, XP002138441, ISSN: 0027-8424 *
NGÔ, H. ET AL.: "Double-stranded RNA induces mRNA degradation in Trypanosoma brucei", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA., vol. 95, December 1998 (1998-12-01), pages 14687 - 14692, XP002138442, ISSN: 0027-8424 *
See also references of EP1147204A1
TIMMONS L ET AL: "Specific interference by ingested dsRNA", NATURE, vol. 395, no. 6705, 29 October 1998 (1998-10-29), pages 854, XP002103601, ISSN: 0028-0836 *
WARGELIUS A. ET AL.: "Double-stranded RNA induces specific developmental defects in zebrafish embryos.", BIOCHEM BIOPHYS RES COMMUN 1999 SEP 16;263(1):156-61, XP002138443 *
WATERHOUSE ET AL: "Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and antisense RNA", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, vol. 95, November 1998 (1998-11-01), pages 13959 - 13964, XP002114472, ISSN: 0027-8424 *
WIANNY F. ET AL.: "Specific interference with gene function by double-stranded RNA in early mouse development.", NAT CELL BIOL 2000 FEB;2(2):70-5, XP002138445 *
Y. XIE ET AL., PROC. NATL. ACAD SCI. U.S.A., vol. 94, 1997, pages 13777 - 13781

Cited By (702)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9963698B2 (en) 1998-03-20 2018-05-08 Commonwealth Scientific And Industrial Research Organisation Control of gene expression
EP1624060A2 (en) 1998-03-20 2006-02-08 Benitec Australia Ltd. Control of gene expression
EP1555317A1 (en) 1998-03-20 2005-07-20 Benitec Australia Ltd. Synthetic genes and genetic constructs comprising the same
US9029527B2 (en) 1998-03-20 2015-05-12 Commonwealth Scientific And Industrial Research Organisation Synthetic genes and genetic constructs
US9902955B2 (en) 1999-01-30 2018-02-27 Alnylam Pharmaceuticals, Inc. Method and medicament for inhibiting the expression of a given gene
EP1798285B1 (en) 1999-01-30 2017-03-15 Alnylam Europe AG Methods and medicament for inhibition the expression of a defined gene
EP2363479B1 (en) 1999-01-30 2016-07-13 Alnylam Europe AG Oligoribonucucleotide for inhibiting the expression of a predefined gene
US8367630B2 (en) 1999-03-17 2013-02-05 The University Of North Carolina At Chapel Hill Method for inhibiting expression of a protein in a hepatocyte
EP2363478A1 (en) * 1999-04-21 2011-09-07 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhibiting the function of polynucleotide sequences
WO2000063364A3 (en) * 1999-04-21 2001-01-11 American Home Prod Methods and compositions for inhibiting the function of polynucleotide sequences
EP1801215A2 (en) * 1999-05-10 2007-06-27 Syngeta Participations AG Regulation of viral gene expression
CN100420748C (en) * 1999-05-10 2008-09-24 辛根塔参与股份公司 Regulation of viral gene expression
EP1801215A3 (en) * 1999-05-10 2008-12-17 Syngeta Participations AG Regulation of viral gene expression
WO2000068374A1 (en) * 1999-05-10 2000-11-16 Syngenta Participations Ag Regulation of viral gene expression
US6924109B2 (en) 1999-07-30 2005-08-02 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
US6841351B2 (en) 1999-07-30 2005-01-11 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
US10190127B2 (en) 1999-08-13 2019-01-29 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US9708621B2 (en) 1999-08-13 2017-07-18 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
US7148336B2 (en) 1999-08-26 2006-12-12 Calgene Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acid levels
US7067722B2 (en) 1999-08-26 2006-06-27 Monsanto Technology Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7256329B2 (en) 1999-08-26 2007-08-14 Calgene Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7563949B2 (en) 1999-08-26 2009-07-21 Monsanto Technology Llc Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US7531718B2 (en) 1999-08-26 2009-05-12 Monsanto Technology, L.L.C. Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
US8097778B2 (en) 1999-08-26 2012-01-17 Monsanto Company Nucleic acid sequences and methods of use for the production of plants with modified polyunsaturated fatty acids
WO2001036646A1 (en) * 1999-11-19 2001-05-25 Cancer Research Ventures Limited Inhibiting gene expression with dsrna
US7829693B2 (en) 1999-11-24 2010-11-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US8153776B2 (en) 2000-03-16 2012-04-10 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US8383599B2 (en) 2000-03-16 2013-02-26 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US7732417B2 (en) 2000-03-16 2010-06-08 Cold Spring Harbor Laboratory Methods and compositions for RNA interference using recombinant Dicer and Argonaut
US8202846B2 (en) 2000-03-16 2012-06-19 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
WO2001068836A3 (en) * 2000-03-16 2002-03-14 Genetica Inc Methods and compositions for rna interference
WO2001068836A2 (en) * 2000-03-16 2001-09-20 Genetica, Inc. Methods and compositions for rna interference
US10472625B2 (en) 2000-03-30 2019-11-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US8420391B2 (en) 2000-03-30 2013-04-16 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US9193753B2 (en) 2000-03-30 2015-11-24 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8742092B2 (en) 2000-03-30 2014-06-03 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8632997B2 (en) 2000-03-30 2014-01-21 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US8394628B2 (en) 2000-03-30 2013-03-12 University Of Massachusetts RNA sequence-specific mediators of RNA interference
US9012138B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US9012621B2 (en) 2000-03-30 2015-04-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US8790922B2 (en) 2000-03-30 2014-07-29 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA sequence-specific mediators of RNA interference
US8552171B2 (en) 2000-03-30 2013-10-08 University Of Massachusetts RNA sequence-specific mediators of RNA interference
WO2002016620A3 (en) * 2000-08-19 2002-08-01 Axordia Ltd Modulation of stem cell differentiation
CN1311081C (en) * 2000-08-19 2007-04-18 爱克斯澳迪亚有限公司 Stem cell differentiation
WO2002016620A2 (en) * 2000-08-19 2002-02-28 Axordia Limited Modulation of stem cell differentiation
US8017765B2 (en) 2000-08-30 2011-09-13 Merck Sharp & Dohme Corp. RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid (siNA)
US7662951B2 (en) 2000-08-30 2010-02-16 Sirna Therapeutics, Inc. RNA interference mediated treatment of Alzheimer's disease using short interfering nucleic acid (siNA)
GB2372995B (en) * 2000-11-29 2004-12-29 Hoffmann La Roche Inhibition of the transcription of a target gene in a cell or tissues
US8853384B2 (en) 2000-12-01 2014-10-07 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8993745B2 (en) 2000-12-01 2015-03-31 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8933044B2 (en) 2000-12-01 2015-01-13 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8778902B2 (en) 2000-12-01 2014-07-15 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8362231B2 (en) 2000-12-01 2013-01-29 Max-Planck-Gesellschaft zur Föderung der Wissenschaften E.V. RNA interference mediating small RNA molecules
US10633656B2 (en) 2000-12-01 2020-04-28 Max-Planck-Gesellschaft Zur Forderung Der Wissenschaften E.V. RNA interference mediating small RNA molecules
US8329463B2 (en) 2000-12-01 2012-12-11 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8895718B2 (en) 2000-12-01 2014-11-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8765930B2 (en) 2000-12-01 2014-07-01 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8445237B2 (en) 2000-12-01 2013-05-21 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8895721B2 (en) 2000-12-01 2014-11-25 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8372968B2 (en) 2000-12-01 2013-02-12 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
US8796016B2 (en) 2000-12-01 2014-08-05 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. RNA interference mediating small RNA molecules
WO2002059300A2 (en) * 2000-12-28 2002-08-01 J & J Research Pty Ltd Double-stranded rna-mediated gene suppression
WO2002059300A3 (en) * 2000-12-28 2003-07-24 J & J Res Pty Ltd Double-stranded rna-mediated gene suppression
US9587240B2 (en) 2001-01-09 2017-03-07 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7868160B2 (en) 2001-01-09 2011-01-11 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
WO2002055693A3 (en) * 2001-01-09 2003-07-17 Ribopharma Ag Method for inhibiting the expression of a target gene
WO2002055692A2 (en) * 2001-01-09 2002-07-18 Ribopharma Ag Method for inhibiting the expression of a target gene and medicament for treating a tumor disease
WO2002055692A3 (en) * 2001-01-09 2003-06-12 Ribopharma Ag Method for inhibiting the expression of a target gene and medicament for treating a tumor disease
US7423142B2 (en) 2001-01-09 2008-09-09 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US7767802B2 (en) 2001-01-09 2010-08-03 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of anti-apoptotic genes
US9074213B2 (en) 2001-01-09 2015-07-07 Alnylam Pharmacuticals, Inc. Compositions and methods for inhibiting expression of a target gene
US7473525B2 (en) 2001-01-09 2009-01-06 Alnylam Europe Ag Compositions and methods for inhibiting expression of anti-apoptotic genes
US7732660B2 (en) 2001-01-26 2010-06-08 Commonwealth Scientific And Industrial Research Corporation Methods and means for producing efficient silencing construct using recombinational cloning
US7846718B2 (en) 2001-01-26 2010-12-07 Commonwealth Scientific And Industrial Research Organisation Methods and means for producing efficient silencing construct using recombinational cloning
US8877435B2 (en) 2001-01-26 2014-11-04 Commonwealth Scientific And Industrial Research Organisation Methods and means for producing efficient silencing construct using recombinational cloning
US9051566B2 (en) 2001-01-31 2015-06-09 Alnylam Pharmaceuticals, Inc. Post-transcriptional gene silencing using expressed double stranded RNA
WO2002066638A1 (en) * 2001-02-22 2002-08-29 Gencom Corporation Recombinant gene containing inverted repeat sequence and utilization thereof
US7022828B2 (en) 2001-04-05 2006-04-04 Sirna Theraputics, Inc. siRNA treatment of diseases or conditions related to levels of IKK-gamma
US8034791B2 (en) 2001-04-06 2011-10-11 The University Of Chicago Activation of Egr-1 promoter by DNA damaging chemotherapeutics
EP3231445A1 (en) 2001-05-18 2017-10-18 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7659389B2 (en) 2001-05-18 2010-02-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of MYC and/or MYB gene expression using short interfering nucleic acid (siNA)
US7964578B2 (en) 2001-05-18 2011-06-21 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US8017761B2 (en) 2001-05-18 2011-09-13 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of Stearoyl-CoA desaturase (SCD) gene expression using short interfering nucelic acid (siNA)
EP2415486A2 (en) 2001-05-18 2012-02-08 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7858625B2 (en) 2001-05-18 2010-12-28 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US7833992B2 (en) 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US8008472B2 (en) 2001-05-29 2011-08-30 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA)
ES2192945A1 (en) * 2001-07-06 2003-10-16 Consejo Superior Investigacion Method of interfering with a virus infection in plants
WO2003004649A1 (en) * 2001-07-06 2003-01-16 Consejo Superior De Investigaciones Cientificas Method of interfering with a virus infection in plants
US8022272B2 (en) 2001-07-13 2011-09-20 Sungene Gmbh & Co. Kgaa Expression cassettes for transgenic expression of nucleic acids
US8604278B2 (en) 2001-07-13 2013-12-10 Sungene Gmbh & Co. Kgaa Expression cassettes for transgenic expression of nucleic acids
US7456335B2 (en) 2001-09-03 2008-11-25 Basf Plant Science Gmbh Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants
US7763590B2 (en) 2001-10-12 2010-07-27 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of a mutant gene
US7348314B2 (en) 2001-10-12 2008-03-25 Alnylam Europe Ag Compositions and methods for inhibiting viral replication
WO2003033700A1 (en) * 2001-10-12 2003-04-24 Ribopharma Ag Method for inhibiting the replication of viruses
US7745418B2 (en) 2001-10-12 2010-06-29 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting viral replication
EP1444362A4 (en) * 2001-10-19 2006-06-21 Agy Therapeutics Inc High-throughput transcriptome and functional validation analysis
EP1444362A2 (en) * 2001-10-19 2004-08-11 Agy Therapeutics, Inc. High-throughput transcriptome and functional validation analysis
WO2003035082A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for inhibiting expression of a target gene
WO2003035870A1 (en) * 2001-10-26 2003-05-01 Ribopharma Ag Drug for treating a carcinoma of the pancreas
US7196184B2 (en) 2002-01-22 2007-03-27 Alnylam Europe Ag Double-stranded RNA (DSRNA) and method of use for inhibiting expression of the AML-1/MTG8 fusion gene
US8829264B2 (en) 2002-01-22 2014-09-09 Cold Spring Harbor Laboratory Methods and compositions for RNA interference
US7846907B2 (en) 2002-01-22 2010-12-07 Alnylam Pharmaceuticals, Inc. Double-stranded RNA (dsRNA) and method of use for inhibiting expression of a fusion gene
EP1572902A4 (en) * 2002-02-01 2007-04-11 Ambion Inc HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
US10106793B2 (en) 2002-02-01 2018-10-23 Life Technologies Corporation Double-stranded oligonucleotides
US9777275B2 (en) 2002-02-01 2017-10-03 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
EP1572902A2 (en) * 2002-02-01 2005-09-14 Ambion, Inc. HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
US9796978B1 (en) 2002-02-01 2017-10-24 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US10036025B2 (en) 2002-02-01 2018-07-31 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US10626398B2 (en) 2002-02-01 2020-04-21 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US10196640B1 (en) 2002-02-01 2019-02-05 Life Technologies Corporation Oligonucleotide compositions with enhanced efficiency
US9732344B2 (en) 2002-02-20 2017-08-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
WO2003070193A3 (en) * 2002-02-20 2006-08-24 James Mcswiggen RNA interference mediated inhibition of HIV gene expression using short interfering nucleic acid (siNA)
US7662952B2 (en) 2002-02-20 2010-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
US10000754B2 (en) 2002-02-20 2018-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7667029B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
US7667030B2 (en) 2002-02-20 2010-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
US8008473B2 (en) 2002-02-20 2011-08-30 Mcswiggen James RNA interference mediated inhibition of TNF and TNF receptor gene expression using short interfering nucleic acid (siNA)
US7678897B2 (en) 2002-02-20 2010-03-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US7977472B2 (en) 2002-02-20 2011-07-12 Leonid Beigelman RNA interference mediated inhibition of myostatin gene expression using short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7910725B2 (en) 2002-02-20 2011-03-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
US8013146B2 (en) 2002-02-20 2011-09-06 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of matrix metalloproteinase 13 (MMP13) gene expression using short interfering nucleic acid (siNA)
US8013143B2 (en) 2002-02-20 2011-09-06 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of CXCR4 gene expression using short interfering nucleic acid (siNA)
EP1458741B1 (en) * 2002-02-20 2012-10-17 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US7910724B2 (en) 2002-02-20 2011-03-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Fos gene expression using short interfering nucleic acid (siNA)
US10351852B2 (en) 2002-02-20 2019-07-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US8273866B2 (en) 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US7897755B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US7691999B2 (en) 2002-02-20 2010-04-06 Sirna Therapeutics, Inc. RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA)
US10662428B2 (en) 2002-02-20 2020-05-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
EP2902406A1 (en) 2002-02-20 2015-08-05 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US7700760B2 (en) 2002-02-20 2010-04-20 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US9738899B2 (en) 2002-02-20 2017-08-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7897756B2 (en) 2002-02-20 2011-03-01 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of NOGO and NOGO receptor gene expression using short interfering nucleic acid (siNA)
US10889815B2 (en) 2002-02-20 2021-01-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
GB2396616B (en) * 2002-02-20 2005-09-21 Sirna Therapeutics Inc RNA interference mediated inhibition of gene expression using double stranded short interfering nucleic acid (SINA)
US8258288B2 (en) 2002-02-20 2012-09-04 Sirna Therapeutics, Inc. RNA interference mediated inhibition of respiratory syncytial virus (RSV) expression using short interfering nucleic acid (siNA)
EP3926046A2 (en) 2002-02-20 2021-12-22 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US9771588B2 (en) 2002-02-20 2017-09-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
WO2003070197A3 (en) * 2002-02-20 2004-11-25 Sirna Therapeutics Inc RNA INTERFERENCE MEDIATED INHIBITION OF TGF-BETA AND TGF-BETA RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7985853B2 (en) 2002-02-20 2011-07-26 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of platelet derived growth factor (PDGF) and platelet derived growth factor receptor (PDGFR) gene expression using short interfering nucleic acid (siNA)
US7897757B2 (en) 2002-02-20 2011-03-01 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA)
EP3459963A1 (en) 2002-02-20 2019-03-27 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
GB2396616A (en) * 2002-02-20 2004-06-30 Sirna Therapeutics Inc RNA interference mediated inhibition of gene expression using short interfering nucleic acid (SINA)
US7956178B2 (en) 2002-02-20 2011-06-07 Mcswiggen James RNA interference mediated inhibition of GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA)
US7897752B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of telomerase gene expression using short interfering nucleic acid (siNA)
US7795422B2 (en) 2002-02-20 2010-09-14 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
WO2003070972A3 (en) * 2002-02-20 2004-06-03 Ribozyme Pharm Inc RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7897753B2 (en) 2002-02-20 2011-03-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of XIAP gene expression using short interfering nucleic acid (siNA)
US8076472B2 (en) 2002-02-20 2011-12-13 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA)
EP2287305A1 (en) 2002-02-20 2011-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
EP2287306A1 (en) 2002-02-20 2011-02-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
WO2003070966A3 (en) * 2002-02-20 2004-03-11 Sirna Therapeutics Inc RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7659390B2 (en) 2002-02-20 2010-02-09 Sirna Therapeutics, Inc. RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA)
WO2003074654A3 (en) * 2002-02-20 2004-02-05 Sirna Therapeurics Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US7923549B2 (en) 2002-02-20 2011-04-12 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of interleukin and interleukin receptor gene expression using short interfering nucleic acid (siNA)
WO2003070914A3 (en) * 2002-02-20 2003-12-24 Sirna Therapeutics Inc RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7893248B2 (en) 2002-02-20 2011-02-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of Myc and/or Myb gene expression using short interfering nucleic acid (siNA)
US7943757B2 (en) 2002-02-20 2011-05-17 Mcswiggen James RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US8153778B2 (en) 2002-02-20 2012-04-10 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
WO2003074654A2 (en) * 2002-02-20 2003-09-12 Sirna Therapeurics, Inc Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
WO2003070966A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc RNA INTERFERENCE MEDIATED TARGET DISCOVERY AND TARGET VALIDATION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP2042510A2 (en) 2002-02-20 2009-04-01 Sirna Therapeutics Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleid acid (siNA)
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
WO2003070918A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Rna interference by modified short interfering nucleic acid
US7935812B2 (en) 2002-02-20 2011-05-03 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
WO2003070914A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US7855284B2 (en) 2002-02-20 2010-12-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of checkpoint kinase-1 (CHK-1) gene expression using short interfering nucleic acid (siNA)
WO2003070197A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF TGF-BETA AND TGF-BETA RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003216324B2 (en) * 2002-02-20 2009-02-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US7858771B2 (en) 2002-02-20 2010-12-28 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA)
WO2003070972A2 (en) * 2002-02-20 2003-08-28 Sirna Therapeutics Inc. RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP3354656A1 (en) 2002-02-20 2018-08-01 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US9957517B2 (en) 2002-02-20 2018-05-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7176304B2 (en) 2002-02-20 2007-02-13 Mcswiggen James RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US8067575B2 (en) 2002-02-20 2011-11-29 Merck, Sharp & Dohme Corp. RNA interference mediated inhibition of cyclin D1 gene expression using short interfering nucleic acid (siNA)
US7928218B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
EP2278004A1 (en) 2002-02-20 2011-01-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
US7928219B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (SINA)
US7928220B2 (en) 2002-02-20 2011-04-19 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of stromal cell-derived factor-1 (SDF-1) gene expression using short interfering nucleic acid (siNA)
US7566813B2 (en) 2002-03-21 2009-07-28 Monsanto Technology, L.L.C. Nucleic acid constructs and methods for producing altered seed oil compositions
US10280430B2 (en) 2002-03-21 2019-05-07 Monsanto Technology Llc Nucleic acid constructs and methods for producing altered seed oil compositions
US8802922B2 (en) 2002-03-21 2014-08-12 Monsanto Technology Llc Nucleic acid constructs and methods for producing altered seed oil compositions
US7601888B2 (en) 2002-03-21 2009-10-13 Monsanto Technology L.L.C. Nucleic acid constructs and methods for producing altered seed oil compositions
JP2005538940A (en) * 2002-04-18 2005-12-22 アキュイティ ファーマシューティカルズ、インク. Means and methods for specific inhibition of genes in the central nervous system and / or cells and tissues of the eye
WO2003087367A3 (en) * 2002-04-18 2004-04-29 Lynkeus Biotech Gmbh Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
US8202845B2 (en) 2002-04-18 2012-06-19 Acuity Pharmaceuticals, Inc. Means and methods for the specific modulation of target genes in the CNS and the eye and methods for their identification
US8946180B2 (en) 2002-04-18 2015-02-03 Opko Pharmaceuticals, Llc Means and methods for the specific modulation of target genes in the CNS and the eye and methods for their identification
WO2003087368A3 (en) * 2002-04-18 2004-04-29 Lynkeus Bio Tech Gmbh Means and methods for the specific modulation of target genes in the cns and the eye and methods for their identification
WO2003087367A2 (en) * 2002-04-18 2003-10-23 Lynkeus Biotech Gmbh Means and methods for the specific inhibition of genes in cells and tissue of the cns and/or eye
US8299042B2 (en) 2002-04-26 2012-10-30 Alnylam Pharmaceuticals, Inc. Methods and compositions for silencing genes without inducing toxicity
EP2298358A1 (en) 2002-05-06 2011-03-23 Alnylam Pharmaceuticals Inc. Methods for delivery of nucleic acids
US7166771B2 (en) 2002-06-21 2007-01-23 Monsanto Technology Llc Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
US7893249B2 (en) 2002-07-12 2011-02-22 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
US7655790B2 (en) 2002-07-12 2010-02-02 Sirna Therapeutics, Inc. Deprotection and purification of oligonucleotides and their derivatives
US8546345B2 (en) 2002-07-24 2013-10-01 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
US8541384B2 (en) 2002-07-24 2013-09-24 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
US9150863B2 (en) 2002-07-24 2015-10-06 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
US8946403B2 (en) 2002-07-24 2015-02-03 The Trustees Of The University Of Pennsylvania Compositions and methods for siRNA inhibition of angiogenesis
EP2036984A2 (en) 2002-07-26 2009-03-18 BASF Plant Science GmbH Reversion of the negative selective effect of negative marker proteins as selection procedure
US10329568B2 (en) 2002-08-05 2019-06-25 Silence Therapeutics Gmbh Interfering RNA molecules
US9222092B2 (en) 2002-08-05 2015-12-29 Silence Therapeutics Gmbh Interfering RNA molecules
US9783802B2 (en) 2002-08-05 2017-10-10 Silence Therapeutics Gmbh Interfering RNA molecules
US9790505B2 (en) 2002-08-05 2017-10-17 Silence Therapeutics Gmbh Interfering RNA molecules
US9790501B2 (en) 2002-08-05 2017-10-17 Silence Therapeutics Gmbh Interfering RNA molecules
US8933215B2 (en) 2002-08-05 2015-01-13 Silence Therapeutics Aktiengesellschaft (Ag) Interfering RNA molecules
US11578328B2 (en) 2002-08-05 2023-02-14 Silence Therapeutics Gmbh Interfering RNA molecules
US10774332B2 (en) 2002-08-05 2020-09-15 Silence Therapeutics Gmbh Interfering RNA molecules
US10323246B2 (en) 2002-08-05 2019-06-18 Silence Therapeutics Gmbh Interfering RNA molecules
US9758784B1 (en) 2002-08-05 2017-09-12 Silence Therapeutics Gmbh Interfering RNA molecules
US8324370B2 (en) 2002-08-05 2012-12-04 Silence Therapeutics Aktiengesellschaft (Ag) Interfering RNA molecules
US10266829B2 (en) 2002-08-05 2019-04-23 Silence Therapeutics Gmbh Interfering RNA molecules
US7893245B2 (en) 2002-08-05 2011-02-22 Silence Therapeutics Aktiengesellschaft (Ag) Interfering RNA molecules
US7452987B2 (en) 2002-08-05 2008-11-18 Silence Therapeutics Aktiengesellschaft (Ag) Interfering RNA molecules
US9695423B2 (en) 2002-08-05 2017-07-04 Silence Therapeutics Gmbh Interfering RNA molecules
EP2278018A2 (en) 2002-08-07 2011-01-26 BASF Plant Science GmbH Nucleic acid sequences encoding proteins associated with abiotic stress response
WO2004018687A2 (en) 2002-08-07 2004-03-04 Basf Plant Science Gmbh Nucleic acid sequences encoding proteins associated with abiotic stress response
US7923547B2 (en) 2002-09-05 2011-04-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
WO2004043979A2 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US7696345B2 (en) 2002-11-05 2010-04-13 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
WO2004044138A2 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Chimeric oligomeric compounds and their use in gene modulation
WO2004044136A2 (en) 2002-11-05 2004-05-27 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2’-modified nucleosides for use in gene modulation
US8124745B2 (en) 2002-11-05 2012-02-28 Isis Pharmaceuticals, Inc Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
US9150605B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
US10669544B2 (en) 2003-03-07 2020-06-02 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US10273477B2 (en) 2003-03-07 2019-04-30 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US8420799B2 (en) 2003-03-07 2013-04-16 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
EP2239329A1 (en) 2003-03-07 2010-10-13 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
EP3450559A1 (en) 2003-03-07 2019-03-06 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US8445665B2 (en) 2003-03-07 2013-05-21 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US11530408B2 (en) 2003-03-07 2022-12-20 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
EP2216407A2 (en) 2003-03-07 2010-08-11 Alnylam Pharmaceuticals, Inc. Therapeutic Compositions
US8110674B2 (en) 2003-03-07 2012-02-07 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US9222091B2 (en) 2003-03-07 2015-12-29 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US9708615B2 (en) 2003-03-07 2017-07-18 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US8809516B2 (en) 2003-03-07 2014-08-19 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
US8754201B2 (en) 2003-03-07 2014-06-17 Alnylam Pharmaceuticals, Inc. Therapeutic compositions
EP2669377A2 (en) 2003-04-17 2013-12-04 Alnylam Pharmaceuticals Inc. Modified iRNA agents
US11312957B2 (en) 2003-04-17 2022-04-26 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US11015194B2 (en) 2003-04-17 2021-05-25 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
US8344125B2 (en) 2003-04-17 2013-01-01 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US8796436B2 (en) 2003-04-17 2014-08-05 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
EP2666858A1 (en) 2003-04-17 2013-11-27 Alnylam Pharmaceuticals Inc. Modified iRNA agents
US7745608B2 (en) 2003-04-17 2010-06-29 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
EP2660322A2 (en) 2003-04-17 2013-11-06 Alnylam Pharmaceuticals Inc. Modified iRNA agents
US8426377B2 (en) 2003-04-17 2013-04-23 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
US9476045B2 (en) 2003-04-17 2016-10-25 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
US8865677B2 (en) 2003-04-17 2014-10-21 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
US8017762B2 (en) 2003-04-17 2011-09-13 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US10676740B2 (en) 2003-04-17 2020-06-09 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US10119138B2 (en) 2003-04-17 2018-11-06 Alnylam Pharmaceuticals, Inc. iRNA agents with biocleavable tethers
EP2664672A1 (en) 2003-04-17 2013-11-20 Alnylam Pharmaceuticals Inc. Modified iRNA agents
WO2004094595A2 (en) 2003-04-17 2004-11-04 Alnylam Pharmaceuticals Inc. MODIFIED iRNA AGENTS
US9394540B2 (en) 2003-04-17 2016-07-19 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US8507661B2 (en) 2003-04-17 2013-08-13 Alnylam Pharmaceuticals, Inc. Modified iRNA agents
US7851615B2 (en) 2003-04-17 2010-12-14 Alnylam Pharmaceuticals, Inc. Lipophilic conjugated iRNA agents
WO2005041859A3 (en) * 2003-04-30 2007-04-26 Sirna Therapeutics Inc Conjugates and compositions for cellular delivery.
EP3222294A1 (en) 2003-04-30 2017-09-27 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
WO2004101756A2 (en) 2003-05-09 2004-11-25 Diadexus, Inc. Ovr110 antibody compositions and methods of use
US7541344B2 (en) 2003-06-03 2009-06-02 Eli Lilly And Company Modulation of survivin expression
EP2508608A1 (en) 2003-06-09 2012-10-10 Alnylam Pharmaceuticals Inc. Method of treating neurodegenerative disease
US7595306B2 (en) 2003-06-09 2009-09-29 Alnylam Pharmaceuticals Inc Method of treating neurodegenerative disease
EP2434019A1 (en) 2003-08-01 2012-03-28 BASF Plant Science GmbH Process for the production of fine chemicals
US7795504B2 (en) 2003-09-24 2010-09-14 Monsanto Technology Llc Coordinated decrease and increase of gene expression of more than one gene using transgenic constructs
JP4954550B2 (en) * 2003-12-19 2012-06-20 大日本住友製薬株式会社 Novel nucleic acid introduction method
US7700280B2 (en) 2003-12-31 2010-04-20 The Penn State Research Foundation Methods for assessing cisplatin resistance, disease progression, and treatment efficacy in ovarian cancer
US8192935B2 (en) 2003-12-31 2012-06-05 The Penn State Research Foundation Methods for assessing cisplatin resistance, disease progression, and treatment efficacy in ovarian cancer as related to MetAP2 expression
WO2005066371A2 (en) 2003-12-31 2005-07-21 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
EP2395112A1 (en) 2003-12-31 2011-12-14 The Penn State Research Foundation Methods for predicting and overcoming resistance to chemotherapy in ovarian cancer and for predicting colon cancer occurrence
US7858769B2 (en) 2004-02-10 2010-12-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using multifunctional short interfering nucleic acid (multifunctional siNA)
US8476245B2 (en) 2004-02-11 2013-07-02 University Of Tennessee Research Foundation Inhibition of tumor growth and invasion by anti matrix metalloproteinase DNAzymes
EP2394662A2 (en) 2004-04-02 2011-12-14 The Regents of The University of California Methods and compositions for treating and preventing disease associated with AlphavBeta5 intergrin
US8946402B2 (en) 2004-04-23 2015-02-03 The Trustees Of Columbia University In The City Of New York Inhibition of hairless protein mRNA
US8329667B2 (en) 2004-04-23 2012-12-11 The Trustees Of Columbia University In The City Of New York Inhibition of hairless protein mRNA
WO2005118787A2 (en) 2004-05-10 2005-12-15 The University Of North Carolina At Chapel Hill Method of screening candidate compounds for susceptibility to biliary excretion
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
EP1612266A2 (en) 2004-06-10 2006-01-04 National Taiwan University Prostaglandin reductase
EP2298896A1 (en) 2004-06-22 2011-03-23 The Board of Trustees of the University of Illinois Methods of inhibiting tumor cell proliferation with FOXM1 siRNA
WO2006009575A1 (en) 2004-06-22 2006-01-26 The Board Of Trustees Of The University Of Illinois METHODS OF INHIBITING TUMOR CELL PROLIFERATION WITH FOXM1 siRNA
WO2006069610A2 (en) 2004-07-02 2006-07-06 Metanomics Gmbh Process for the production of fine chemicals
EP2080769A2 (en) 2004-07-02 2009-07-22 Metanomics GmbH Process for the production of fine chemicals
US7968762B2 (en) 2004-07-13 2011-06-28 Van Andel Research Institute Immune-compromised transgenic mice expressing human hepatocyte growth factor (hHGF)
EP2484780A1 (en) 2004-07-23 2012-08-08 The University of North Carolina At Chapel Hill Methods and materials for determining pain sensibility and predicting and treating related disorders
EP2163635A1 (en) 2004-08-02 2010-03-17 BASF Plant Science GmbH Method for isolation of transcription termination sequences
EP2166103A1 (en) 2004-08-02 2010-03-24 BASF Plant Science GmbH Method for isolation of transcription termination sequences
EP2166104A1 (en) 2004-08-02 2010-03-24 BASF Plant Science GmbH Method for isolation of transcription termination sequences
US8404862B2 (en) 2004-08-10 2013-03-26 Alnylam Pharmaceuticals, Inc. Ligand-conjugated monomers
US7582744B2 (en) 2004-08-10 2009-09-01 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides
US9453222B2 (en) 2004-08-10 2016-09-27 Alnylam Pharmaceuticals, Inc. Ligand-conjugated monomers
US8017763B2 (en) 2004-08-10 2011-09-13 Alnylam Pharmaceuticals, Inc. Chemically modified oligonucleotides
EP2990410A1 (en) 2004-08-10 2016-03-02 Alnylam Pharmaceuticals Inc. Chemically modified oligonucleotides
US8957223B2 (en) 2004-08-10 2015-02-17 Alnylam Pharmaceuticals, Inc. Ligand-conjugated monomers
WO2006017932A1 (en) 2004-08-18 2006-02-23 Genesense Technologies Inc. Small interfering rna molecules against ribonucleotide reductase and uses thereof
US7884086B2 (en) 2004-09-08 2011-02-08 Isis Pharmaceuticals, Inc. Conjugates for use in hepatocyte free uptake assays
EP2386653A2 (en) 2004-09-16 2011-11-16 Turun Yliopisto Methods for the utilization of novel target genes related to immune-mediated diseases
EP2382977A1 (en) 2004-09-18 2011-11-02 University of Maryland, Baltimore Therapeutic agents targeting the ncca-atp channel and methods of use thereof
WO2006034048A2 (en) 2004-09-18 2006-03-30 University Of Maryland, Baltimore Therapeutic agents targeting the ncca-atp channel and methods of use thereof
EP2359832A2 (en) 2004-09-18 2011-08-24 University of Maryland, Baltimore Therapeutic agents targeting the NCCA-ATP channel and methods of use thereof
WO2006032707A2 (en) 2004-09-24 2006-03-30 Basf Plant Science Gmbh Plant cells and plants with increased tolerance to environmental stress
US8148342B2 (en) 2004-09-28 2012-04-03 Quark Pharmaceuticals Inc. Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases
US8765699B2 (en) 2004-09-28 2014-07-01 Quark Pharmaceuticals, Inc. Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases
EP2166098A1 (en) 2004-10-05 2010-03-24 SunGene GmbH Constitutive expression cassettes for regulation of plant expression
EP1645633A2 (en) 2004-10-05 2006-04-12 SunGene GmbH Constitutive expression cassettes for regulation of plant expression
EP2166097A1 (en) 2004-10-05 2010-03-24 SunGene GmbH Constitutive expression cassettes for regulation of plant expression
US7915479B2 (en) 2004-10-13 2011-03-29 University Of Georgia Research Foundation, Inc. Nematode resistant transgenic plants
EP1655364A2 (en) 2004-11-05 2006-05-10 BASF Plant Science GmbH Expression cassettes for seed-preferential expression in plants
EP2163631A1 (en) 2004-11-25 2010-03-17 SunGene GmbH Expression cassettes for guard cell-preferential expression in plants
EP1662000A2 (en) 2004-11-25 2006-05-31 SunGene GmbH Expression cassettes for guard cell-preferential expression in plants
EP1666599A2 (en) 2004-12-04 2006-06-07 SunGene GmbH Expression cassettes for mesophyll- and/or epidermis-preferential expression in plants
EP2072620A2 (en) 2004-12-08 2009-06-24 SunGene GmbH Expression casstettes for vascular tissue-preferential expression in plants
EP1669455A2 (en) 2004-12-08 2006-06-14 SunGene GmbH Expression cassettes for vascular tissue-preferential expression in plants
EP1669456A2 (en) 2004-12-11 2006-06-14 SunGene GmbH Expression cassettes for meristem-preferential expression in plants
WO2007087815A2 (en) 2004-12-17 2007-08-09 Metanomics Gmbh Process for the control of production of fine chemicals
EP2096177A2 (en) 2004-12-17 2009-09-02 Metanomics GmbH Process for the production of lutein
EP2199304A1 (en) 2004-12-17 2010-06-23 Metanomics GmbH Process for the control of production of fine chemicals
WO2006074418A2 (en) 2005-01-07 2006-07-13 Diadexus, Inc. Ovr110 antibody compositions and methods of use
EP2230517A1 (en) 2005-01-07 2010-09-22 Diadexus, Inc. OVR110 antibody compositions and methods of use
EP2186903A2 (en) 2005-02-09 2010-05-19 BASF Plant Science GmbH Expression cassettes for regulation of expression in monocotyledonous plants
EP2357254A1 (en) 2005-02-14 2011-08-17 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
EP2302076A1 (en) 2005-02-14 2011-03-30 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of age-related macular degeneration
WO2006089950A2 (en) 2005-02-26 2006-08-31 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
EP2166100A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166099A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166102A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2045327A2 (en) 2005-03-08 2009-04-08 BASF Plant Science GmbH Expression enhancing intron sequences
EP2169058A2 (en) 2005-03-08 2010-03-31 BASF Plant Science GmbH Expression enhancing intron sequences
EP2166101A2 (en) 2005-03-08 2010-03-24 BASF Plant Science GmbH Expression enhancing intron sequences
EP2360249A1 (en) 2005-03-31 2011-08-24 Calando Pharmaceuticals, Inc. Inhibitors of ribonucleotide reductase subunit 2 and uses thereof
WO2006120197A2 (en) 2005-05-10 2006-11-16 Basf Plant Science Gmbh Expression cassettes for seed-preferential expression in plants
US7417072B2 (en) 2005-05-12 2008-08-26 Wisconsin Alumni Research Foundation Blockade of Pin1 prevents cytokine production by activated immune cells
EP1723958A2 (en) 2005-05-19 2006-11-22 L'oreal dsRNA vectorisation with cationic particles and their topical use
EP2500429A2 (en) 2005-05-31 2012-09-19 Devgen N.V. RNAi for the control of insects and arachnids
EP2159289A2 (en) 2005-06-23 2010-03-03 BASF Plant Science GmbH Improved methods for the production of stably transformed plants
US8703769B2 (en) 2005-07-15 2014-04-22 The University Of North Carolina At Chapel Hill Use of EGFR inhibitors to prevent or treat obesity
EP2980220A1 (en) 2005-09-20 2016-02-03 BASF Plant Science GmbH Improved methods controlling gene expression
WO2007054441A2 (en) 2005-11-08 2007-05-18 Basf Plant Science Gmbh Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants
EP2330202A2 (en) 2006-01-06 2011-06-08 University Of Georgia Research Foundation, Inc. Cyst nematode resistant transgenic plants
EP2380986A1 (en) 2006-01-12 2011-10-26 BASF Plant Science GmbH Use of stomatin (STM1) polynucleotides for achieving a pathogen resistance in plants
US8716557B2 (en) 2006-01-17 2014-05-06 Synthon Biopharmaceuticals B.V. Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in plants
US7884264B2 (en) 2006-01-17 2011-02-08 Biolex Therapeutics, Inc. Compositions and methods for inhibition of fucosyltransferase and xylosyltransferase expression in duckweed plants
US9056903B2 (en) 2006-01-20 2015-06-16 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of RTP801
US8067570B2 (en) 2006-01-20 2011-11-29 Quark Pharmaceuticals, Inc. Therapeutic uses of inhibitors of RTP801
US8404654B2 (en) 2006-01-20 2013-03-26 Quark Pharmaceuticals, Inc. Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes
US11708577B2 (en) 2006-02-13 2023-07-25 Monsanto Technology Llc Modified gene silencing
US9765351B2 (en) 2006-02-13 2017-09-19 Monsanto Technology Llc Modified gene silencing
US8968702B2 (en) 2006-03-30 2015-03-03 Duke University Inhibition of HIF-1 activation for anti-tumor and anti-inflammatory responses
EP2090662A2 (en) 2006-04-05 2009-08-19 Metanomics GmbH Process for the production of a fine chemical
US8084600B2 (en) 2006-05-04 2011-12-27 Novartis Ag Short interfering ribonucleic acid (siRNA) with improved pharmacological properties
US9493771B2 (en) 2006-05-04 2016-11-15 Novartis Ag Short interfering ribonucleic acid (siRNA) for oral administration
US8344128B2 (en) 2006-05-04 2013-01-01 Novartis Ag Short interfering ribonucleic acid (siRNA) for oral administration
US8957041B2 (en) 2006-05-04 2015-02-17 Novartis Ag Short interfering ribonucleic acid (siRNA) for oral administration
US8404831B2 (en) 2006-05-04 2013-03-26 Novartis Ag Short interfering ribonucleic acid (siRNA) for oral administration
US8404832B2 (en) 2006-05-04 2013-03-26 Novartis Ag Short interfering ribonucleic acid (siRNA) for oral administration
EP2471809A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
EP2471815A1 (en) 2006-07-11 2012-07-04 University Of Medicine And Dentistry Of New Jersey Proteins, nucleic acids encoding the same and associated methods of use
EP2479284A2 (en) 2006-07-13 2012-07-25 University of Iowa Research Foundation Methods and reagents for treatment and diagnosis of vascular disorders and age-related macular degeneration
EP2447275A1 (en) 2006-07-13 2012-05-02 University of Iowa Research Foundation Methods and reagents for treatment of age-related macular degeneration
EP2412383A1 (en) 2006-07-28 2012-02-01 Children's Memorial Hospital Methods of inhibiting tumor cell aggressiveness using the microenvironment of human embryonic stem cells
EP2962697A1 (en) 2006-11-27 2016-01-06 diaDexus, Inc. Ovr110 antibody compositions and methods of use
EP2913341A1 (en) 2006-12-22 2015-09-02 University of Utah Research Foundation Method of detecting ocular diseases and pathologic conditions and treatment of same
EP3103451A1 (en) 2007-01-12 2016-12-14 University of Maryland, Baltimore Targetting ncca-atp channel for organ protection following ischemic episode
EP2202314A1 (en) 2007-01-15 2010-06-30 BASF Plant Science GmbH Use of subtilisin (RNR9) polynucleotides for achieving a pathogen resistance in plants
WO2008092153A2 (en) 2007-01-26 2008-07-31 University Of Louisville Research Foundation, Inc. Modification of exosomal components for use as a vaccine
WO2008099013A1 (en) 2007-02-16 2008-08-21 Basf Plant Science Gmbh Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants
US9193972B2 (en) 2007-03-21 2015-11-24 Brookhaven Science Associates, Llc Combined hairpin-antisense compositions and methods for modulating expression
US8796442B2 (en) 2007-03-21 2014-08-05 Brookhaven Science Associates, Llc. Combined hairpin-antisense compositions and methods for modulating expression
EP2377952A1 (en) 2007-04-26 2011-10-19 Ludwig Institute For Cancer Research Methods for diagnosing and treating astrocytomas
EP2607477A1 (en) 2007-05-03 2013-06-26 The Brigham and Women's Hospital, Inc. Multipotent stem cells and uses thereof
DE112008001453T5 (en) 2007-05-22 2010-04-29 Basf Plant Science Gmbh Plant cells and plants with increased tolerance and / or resistance to environmental stress and increased biomass production CO
US8097422B2 (en) 2007-06-20 2012-01-17 Salk Institute For Biological Studies Kir channel modulators
WO2009002832A2 (en) 2007-06-22 2008-12-31 University Of Maryland, Baltimore Inhibitors of ncca-atp channels for therapy
US8785408B2 (en) 2007-06-27 2014-07-22 Quark Pharmaceuticals, Inc. Compositions and methods for reducing or protecting against delayed graft function (DGF)
US9689031B2 (en) 2007-07-14 2017-06-27 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
EP3754029A1 (en) 2007-07-14 2020-12-23 Ionian Technologies, LLC Nicking and extension amplification reaction for the exponential amplification of nucleic acids
EP2657350A1 (en) 2007-07-14 2013-10-30 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US9617586B2 (en) 2007-07-14 2017-04-11 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
EP2660333A1 (en) 2007-07-14 2013-11-06 Ionian Technologies, Inc. Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US10851406B2 (en) 2007-07-14 2020-12-01 Ionian Technologies, Llc Nicking and extension amplification reaction for the exponential amplification of nucleic acids
US8586726B2 (en) 2007-07-18 2013-11-19 The Trustees Of Columbia University In The City Of New York Tissue-specific MicroRNAs and compositions and uses thereof
US9885038B2 (en) 2007-08-14 2018-02-06 Commonwealth Scientific & Industrial Research Organisation Gene silencing methods
WO2009044392A2 (en) 2007-10-03 2009-04-09 Quark Pharmaceuticals, Inc. Novel sirna structures
US8614309B2 (en) 2007-10-03 2013-12-24 Quark Pharmaceuticals, Inc. Double-stranded RNA directed to CASP2 and methods of use thereof
US10888579B2 (en) 2007-11-07 2021-01-12 Beeologics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
EP4223299A2 (en) 2007-12-04 2023-08-09 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
EP4321177A2 (en) 2007-12-04 2024-02-14 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
EP3141265A1 (en) 2007-12-04 2017-03-15 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US9370582B2 (en) 2007-12-04 2016-06-21 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8106022B2 (en) 2007-12-04 2012-01-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US11110174B2 (en) 2007-12-04 2021-09-07 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US10806791B2 (en) 2007-12-04 2020-10-20 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
EP3705125A1 (en) 2007-12-04 2020-09-09 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US9370581B2 (en) 2007-12-04 2016-06-21 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8450467B2 (en) 2007-12-04 2013-05-28 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8828956B2 (en) 2007-12-04 2014-09-09 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8507455B2 (en) 2007-12-04 2013-08-13 Alnylam Pharmaceuticals, Inc. Folate conjugates
US9352048B2 (en) 2007-12-04 2016-05-31 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US9814777B2 (en) 2007-12-04 2017-11-14 Arbutus Biopharma Corporation Targeting lipids
US9867882B2 (en) 2007-12-04 2018-01-16 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US11666653B2 (en) 2007-12-04 2023-06-06 Alnylam Pharmaceuticals, Inc. Carbohydrate conjugates as delivery agents for oligonucleotides
US8614311B2 (en) 2007-12-12 2013-12-24 Quark Pharmaceuticals, Inc. RTP801L siRNA compounds and methods of use thereof
DE112008003433T5 (en) 2007-12-21 2010-11-04 Basf Plant Science Gmbh Plants with increased yield (KO NUE)
WO2009094647A2 (en) 2008-01-25 2009-07-30 Introgen Therapeutics, Inc. P53 biomarkers
WO2009123764A2 (en) 2008-04-04 2009-10-08 Calando Pharmaceuticals, Inc. Compositions and use of epas1 inhibitors
EP3604533A1 (en) 2008-04-11 2020-02-05 Arbutus Biopharma Corporation Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
US9895448B2 (en) 2008-04-11 2018-02-20 Arbutus Biopharma Corporation Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
US8575123B2 (en) 2008-04-11 2013-11-05 Tekmira Pharmaceuticals Corporation Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
US9345780B2 (en) 2008-04-11 2016-05-24 Tekmira Pharmaceuticals Corporation Site specific delivery of nucleic acids by combining targeting ligands with endosomolytic components
US8278287B2 (en) 2008-04-15 2012-10-02 Quark Pharmaceuticals Inc. siRNA compounds for inhibiting NRF2
US8846868B2 (en) 2008-04-17 2014-09-30 Fusion Antibodies Limited Anti-AREG/HB-EGF antibodies and treatment
US9089591B2 (en) 2008-06-06 2015-07-28 Quark Pharmaceuticals, Inc. Compositions and methods for treatment of ear disorders
US8431692B2 (en) 2008-06-06 2013-04-30 Quark Pharmaceuticals, Inc. Compositions and methods for treatment of ear disorders
WO2009147684A2 (en) 2008-06-06 2009-12-10 Quark Pharmaceuticals, Inc. Compositions and methods for treatment of ear disorders
EP2719380A2 (en) 2008-09-16 2014-04-16 University of Maryland, Baltimore SUR1 inhibitors for therapy
US9572311B2 (en) 2008-09-29 2017-02-21 Monsanto Technology Llc Soybean transgenic event MON87705 and methods for detection thereof
US8692080B2 (en) 2008-09-29 2014-04-08 Monsanto Technology Llc Soybean transgenic event MON87705 and methods for detection thereof
US10344292B2 (en) 2008-09-29 2019-07-09 Monsanto Technology Llc Soybean transgenic event MON87705 and methods for detection thereof
US8329989B2 (en) 2008-09-29 2012-12-11 Monsanto Technology Llc Soybean transgenic event MON87705 and methods for detection thereof
EP2727996A1 (en) 2008-11-06 2014-05-07 The Johns-Hopkins University Treatment of chronic inflammatory respiratory disorders with NP1 inhibitors
EP2687609A2 (en) 2008-11-10 2014-01-22 The United States of America As Represented by the Secretary Department of Health and Human Services Method for treating solid tumor
US8470792B2 (en) 2008-12-04 2013-06-25 Opko Pharmaceuticals, Llc. Compositions and methods for selective inhibition of VEGF
WO2010080452A2 (en) 2008-12-18 2010-07-15 Quark Pharmaceuticals, Inc. siRNA COMPOUNDS AND METHODS OF USE THEREOF
US9422242B2 (en) 2008-12-23 2016-08-23 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
US9974782B2 (en) 2008-12-23 2018-05-22 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
WO2010074783A1 (en) 2008-12-23 2010-07-01 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
US8697875B2 (en) 2008-12-23 2014-04-15 The Trustees Of Columbia University In The City Of New York Phosphodiesterase inhibitors and uses thereof
EP3424939A1 (en) 2009-03-02 2019-01-09 Alnylam Pharmaceuticals Inc. Nucleic acid chemical modifications
EP2669290A1 (en) 2009-03-02 2013-12-04 Alnylam Pharmaceuticals Inc. Nucleic Acid Chemical Modifications
WO2010101951A1 (en) 2009-03-02 2010-09-10 Alnylam Pharmaceuticals, Inc. Nucleic acid chemical modifications
WO2010107952A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CONNECTIVE TISSUE GROWTH FACTOR (CTGF) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010107955A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF BTB AND CNC HOMOLOGY 1, BASIC LEUCINE ZIPPER TRANSCRIPTION FACTOR 1 (BACH 1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) SEQUENCE LISTING
WO2010107958A1 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 6 (STAT6) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010107957A2 (en) 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111497A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE INTERCELLULAR ADHESION MOLECULE 1 (ICAM-1)GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111464A1 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF APOPTOSIS SIGNAL-REGULATING KINASE 1 (ASK1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111468A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE NERVE GROWTH FACTOR BETA CHAIN (NGFß) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SINA)
WO2010111490A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF THE THYMIC STROMAL LYMPHOPOIETIN (TSLP) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2010111471A2 (en) 2009-03-27 2010-09-30 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 1 (STAT1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US8283332B2 (en) 2009-04-17 2012-10-09 University Of Louisville Research Foundation, Inc. PFKFB4 inhibitors and methods of using the same
WO2010122110A1 (en) 2009-04-22 2010-10-28 Basf Plant Science Company Gmbh Whole seed specific promoter
DE112010003162T5 (en) 2009-04-22 2012-08-16 Basf Plant Science Company Gmbh Total seed-specific promoter
EP2258858A1 (en) 2009-06-05 2010-12-08 Universitätsklinikum Freiburg Transgenic LSD1 animal model for cancer
WO2011005861A1 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. Oligonucleotide end caps
WO2011005860A2 (en) 2009-07-07 2011-01-13 Alnylam Pharmaceuticals, Inc. 5' phosphate mimics
WO2011003901A1 (en) 2009-07-10 2011-01-13 Basf Plant Science Company Gmbh Expression cassettes for endosperm-specific expression in plants
US10377813B2 (en) 2009-07-14 2019-08-13 Mayo Foundation For Medical Education And Research Peptide-mediated non-covalent delivery of active agents across the blood-brain barrier
EP3000481A2 (en) 2009-07-14 2016-03-30 Mayo Foundation for Medical Education and Research Peptide-mediated non-covalent delivery of active agent agents across the blood brain barrier
WO2011008823A2 (en) 2009-07-14 2011-01-20 Mayo Foundation For Medical Education And Research Peptide-mediated non-covalent delivery of active agents across the blood brain barrier
US9597408B2 (en) 2009-07-14 2017-03-21 Mayo Foundation For Medical Education And Research Peptide-mediated non-covalent delivery of active agents across the blood-brain barrier
US9409983B2 (en) 2009-07-23 2016-08-09 The Board Of Trustess Of The University Of Illinois Methods and compositions involving PBEF inhibitors for lung inflammation conditions and diseases
WO2011011775A1 (en) 2009-07-24 2011-01-27 The Regents Of The University Of California Methods and compositions for treating and preventing disease associated with avb5 integrin
US10801028B2 (en) 2009-10-14 2020-10-13 Beeologics Inc. Compositions for controlling Varroa mites in bees
WO2011063409A1 (en) 2009-11-23 2011-05-26 Aquabounty Technologies, Inc. Maternally induced sterility in animals
US9701960B2 (en) 2009-11-26 2017-07-11 Quark Pharmaceuticals, Inc. siRNA compounds comprising terminal substitutions
WO2011066475A1 (en) 2009-11-26 2011-06-03 Quark Pharmaceuticals, Inc. Sirna compounds comprising terminal substitutions
US8796239B2 (en) 2009-11-26 2014-08-05 Quark Pharmaceuticals, Inc. Sirna compounds comprising terminal substitutions
US10494631B2 (en) 2009-11-26 2019-12-03 Quark Pharmaceuticals, Inc. siRNA compounds comprising terminal substitutions
EP3002332A2 (en) 2009-12-03 2016-04-06 BASF Plant Science Company GmbH Expression cassettes for embryo-specific expression in plants
WO2011067712A1 (en) 2009-12-03 2011-06-09 Basf Plant Science Company Gmbh Expression cassettes for embryo-specific expression in plants
WO2011071916A2 (en) 2009-12-07 2011-06-16 The Johns Hopkins University Sr-bi as a predictor of human female infertility and responsiveness to treatment
US9206424B2 (en) 2009-12-09 2015-12-08 Nitto Denko Corporation Modulation of HSP47 expression
EP3434773A2 (en) 2009-12-09 2019-01-30 Nitto Denko Corporation Modulation of hsp47 expression
WO2011072091A1 (en) 2009-12-09 2011-06-16 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the cns
EP2862929A1 (en) 2009-12-09 2015-04-22 Quark Pharmaceuticals, Inc. Compositions and methods for treating diseases, disorders or injury of the CNS
US8710209B2 (en) 2009-12-09 2014-04-29 Nitto Denko Corporation Modulation of HSP47 expression
US10093923B2 (en) 2009-12-09 2018-10-09 Nitto Denko Corporation Modulation of HSP47 expression
EP3012324A2 (en) 2009-12-09 2016-04-27 Nitto Denko Corporation Modulation of hsp47 expression
EP3632901A1 (en) 2009-12-10 2020-04-08 The Trustees of Columbia University in the City of New York Histone acetyltransferase activators and uses thereof
US11034647B2 (en) 2009-12-10 2021-06-15 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase activators and uses thereof
US10640457B2 (en) 2009-12-10 2020-05-05 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase activators and uses thereof
EP3000885A2 (en) 2009-12-18 2016-03-30 Arrowhead Research Corporation Organic compositions to treat hsf1-related diseases
EP3406720A1 (en) 2009-12-18 2018-11-28 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat hsf1-related diseases
EP3766976A1 (en) 2009-12-18 2021-01-20 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat hsf1-related diseases
WO2011073326A2 (en) 2009-12-18 2011-06-23 Novartis Ag Organic compositions to treat hsf1-related diseases
US9301923B2 (en) 2009-12-23 2016-04-05 Novartis Ag Lipids, lipid compositions, and methods of using them
WO2011084193A1 (en) 2010-01-07 2011-07-14 Quark Pharmaceuticals, Inc. Oligonucleotide compounds comprising non-nucleotide overhangs
WO2011085056A1 (en) 2010-01-07 2011-07-14 Quark Pharmaceuticals, Inc. Oligonucleotide compounds comprising non-nucleotide overhangs
WO2011094345A1 (en) 2010-01-26 2011-08-04 National Jewish Health Methods and compositions for risk prediction, diagnosis, prognosis, and treatment of pulmonary disorders
WO2011098449A1 (en) 2010-02-10 2011-08-18 Novartis Ag Methods and compounds for muscle growth
WO2011109427A2 (en) 2010-03-01 2011-09-09 Alnylam Pharmaceuticals, Inc. Improving the biological activity of sirna through modulation of its thermodynamic profile
US9988634B2 (en) 2010-03-08 2018-06-05 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
US11812738B2 (en) 2010-03-08 2023-11-14 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
WO2011120053A1 (en) 2010-03-26 2011-09-29 Mersana Therapeutics, Inc. Modified polymers for delivery of polynucleotides, method of manufacture, and methods of use thereof
WO2011123621A2 (en) 2010-04-01 2011-10-06 Alnylam Pharmaceuticals Inc. 2' and 5' modified monomers and oligonucleotides
US9725479B2 (en) 2010-04-22 2017-08-08 Ionis Pharmaceuticals, Inc. 5′-end derivatives
WO2011133876A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising acyclic and abasic nucleosides and analogs
WO2011133871A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. 5'-end derivatives
WO2011133868A2 (en) 2010-04-22 2011-10-27 Alnylam Pharmaceuticals, Inc. Conformationally restricted dinucleotide monomers and oligonucleotides
EP3061824A2 (en) 2010-04-23 2016-08-31 Arrowhead Research Corporation Organic compositions to treat beta-enac-related diseases
WO2011131707A1 (en) 2010-04-23 2011-10-27 Novartis Ag ORGANIC COMPOSITIONS TO TREAT BETA-ENaC-RELATED DISEASES
EP3431604A1 (en) 2010-04-23 2019-01-23 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat beta-enac-related diseases
WO2011145777A1 (en) 2010-05-20 2011-11-24 광주과학기술원 Pharmaceutical composition including an hif-2α inhibitor as an active ingredient for preventing or treating arthritis
WO2011146938A1 (en) 2010-05-21 2011-11-24 NanoOncology, Inc. Reagents and methods for treating cancer
EP3190187A1 (en) 2010-05-21 2017-07-12 Peptimed, Inc. Reagents and methods for treating cancer
WO2011163121A1 (en) 2010-06-21 2011-12-29 Alnylam Pharmaceuticals, Inc. Multifunctional copolymers for nucleic acid delivery
WO2011163466A1 (en) 2010-06-23 2011-12-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Regulation of skin pigmentation by neuregulin-1 (nrg-1)
EP3330377A1 (en) 2010-08-02 2018-06-06 Sirna Therapeutics, Inc. Rna interference mediated inhibition of catenin (cadherin-associated protein), beta 1 (ctnnb1) gene expression using short interfering nucleic acid (sina)
WO2012018754A2 (en) 2010-08-02 2012-02-09 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012024170A2 (en) 2010-08-17 2012-02-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
EP4079856A1 (en) 2010-08-17 2022-10-26 Sirna Therapeutics, Inc. Rna interference mediated inhibition of hepatitis b virus (hbv) gene expression using short interfering nucleic acid (sina)
WO2012027206A1 (en) 2010-08-24 2012-03-01 Merck Sharp & Dohme Corp. SINGLE-STRANDED RNAi AGENTS CONTAINING AN INTERNAL, NON-NUCLEIC ACID SPACER
EP3372684A1 (en) 2010-08-24 2018-09-12 Sirna Therapeutics, Inc. Single-stranded rnai agents containing an internal, non-nucleic acid spacer
WO2012027467A1 (en) 2010-08-26 2012-03-01 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF PROLYL HYDROXYLASE DOMAIN 2 (PHD2) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
WO2012037254A1 (en) 2010-09-15 2012-03-22 Alnylam Pharmaceuticals, Inc. MODIFIED iRNA AGENTS
US9994915B2 (en) 2010-10-11 2018-06-12 Sanford-Burnham Medical Research Institute miR-211 expression and related pathways in human melanoma
WO2012051567A2 (en) 2010-10-15 2012-04-19 The Trustees Of Columbia University In The City Of New York Obesity-related genes and their proteins and uses thereof
US10912816B2 (en) 2010-10-15 2021-02-09 The Trustees Of Columbia University In The City Of New York Obesity-related genes and their proteins and uses thereof
WO2012058210A1 (en) 2010-10-29 2012-05-03 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA)
EP3766975A1 (en) 2010-10-29 2021-01-20 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9970005B2 (en) 2010-10-29 2018-05-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
EP3327125A1 (en) 2010-10-29 2018-05-30 Sirna Therapeutics, Inc. Rna interference mediated inhibition of gene expression using short interfering nucleic acids (sina)
US11932854B2 (en) 2010-10-29 2024-03-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US11193126B2 (en) 2010-10-29 2021-12-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
WO2012061443A2 (en) 2010-11-01 2012-05-10 NanoOncology, Inc. Compositions of a peptide-based system for cell-specific targeting
US9730877B2 (en) 2010-11-02 2017-08-15 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
WO2012061537A2 (en) 2010-11-02 2012-05-10 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US11298570B2 (en) 2010-11-02 2022-04-12 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US9198911B2 (en) 2010-11-02 2015-12-01 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US9895301B2 (en) 2010-11-02 2018-02-20 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US10265258B2 (en) 2010-11-02 2019-04-23 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US10994157B2 (en) 2010-11-02 2021-05-04 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US9737469B2 (en) 2010-11-02 2017-08-22 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US9763866B2 (en) 2010-11-02 2017-09-19 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
US11806555B2 (en) 2010-11-02 2023-11-07 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
WO2012078209A1 (en) 2010-12-06 2012-06-14 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Diagnosis and treatment of adrenocortical tumors using human microrna-483
WO2012078536A2 (en) 2010-12-06 2012-06-14 Quark Pharmaceuticals, Inc. Double stranded oligonucleotide compounds comprising positional modifications
US9969677B2 (en) 2010-12-22 2018-05-15 The Trustees Of Columbia University In The City Of New York Histone acetyltransferase modulators and uses thereof
US9796979B2 (en) 2011-03-03 2017-10-24 Quark Pharmaceuticals Inc. Oligonucleotide modulators of the toll-like receptor pathway
WO2012118910A2 (en) 2011-03-03 2012-09-07 Quark Pharmaceuticals, Inc. Compositions and methods for treating lung disease and injury
WO2012118911A1 (en) 2011-03-03 2012-09-07 Quark Pharmaceuticals, Inc. Oligonucleotide modulators of the toll-like receptor pathway
US9487778B2 (en) 2011-03-03 2016-11-08 Quark Pharmaceuticals, Inc. Oligonucleotide modulators of the toll-like receptor pathway
US8841432B2 (en) 2011-04-21 2014-09-23 Snu R&Db Foundation Shuttle vectors for mycobacteria-escherichia coli and uses thereof
US8664376B2 (en) 2011-06-08 2014-03-04 Nitto Denko Corporation Retinoid-liposomes for enhancing modulation of HSP47 expression
EP3075855A1 (en) 2011-06-08 2016-10-05 Nitto Denko Corporation Retinoid-liposomes for enhancing modulation of hsp47 expression
US8741867B2 (en) 2011-06-08 2014-06-03 Nitto Denko Corporation Retinoid-liposomes for treating fibrosis
WO2012170957A2 (en) 2011-06-08 2012-12-13 Nitto Denko Corporation Retinoid-liposomes for enhancing modulation of hsp47 expression
US10195145B2 (en) 2011-06-08 2019-02-05 Nitto Denko Corporation Method for treating fibrosis using siRNA and a retinoid-lipid drug carrier
US10196637B2 (en) 2011-06-08 2019-02-05 Nitto Denko Corporation Retinoid-lipid drug carrier
US9456984B2 (en) 2011-06-08 2016-10-04 Nitto Denko Corporation Method for treating fibrosis using siRNA and a retinoid-lipid drug carrier
EP3098314A1 (en) 2011-09-02 2016-11-30 Arrowhead Research Corporation Organic compositions to treat hsf1-related diseases
EP3521432A1 (en) 2011-09-02 2019-08-07 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat hsf1-related diseases
US9771430B2 (en) 2011-09-02 2017-09-26 The Trustees Of Columbia University In The City Of New York Method of treating a metabolic disorder induced by obesity in a subject in need thereof by administering MK2/3 inhibitors
EP3072555A1 (en) 2011-09-02 2016-09-28 The Trustees of Columbia University in the City of New York Mk2/3 inhibitors to treat metabolic disturbances of obesity
WO2013030778A2 (en) 2011-09-02 2013-03-07 Novartis Ag Organic compositions to treat hsf1-related diseases
US10040853B2 (en) 2011-09-09 2018-08-07 Fred Hutchinson Cancer Research Center Methods and compositions involving NKG2D inhibitors and cancer
US10808249B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
US9422557B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
US9416363B2 (en) 2011-09-13 2016-08-16 Monsanto Technology Llc Methods and compositions for weed control
US9422558B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10435702B2 (en) 2011-09-13 2019-10-08 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US10428338B2 (en) 2011-09-14 2019-10-01 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
US11033894B2 (en) 2011-09-23 2021-06-15 Abbott Diagnostics Scarborough, Inc. System and apparatus for reactions
US10040061B2 (en) 2011-09-23 2018-08-07 Alere Switzerland Gmbh System and apparatus for reactions
US9352312B2 (en) 2011-09-23 2016-05-31 Alere Switzerland Gmbh System and apparatus for reactions
US9738727B2 (en) 2011-10-14 2017-08-22 Genentech, Inc. Anti-HtrA1 antibodies and methods of use
EP3960726A1 (en) 2011-10-18 2022-03-02 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
EP3597644A1 (en) 2011-10-18 2020-01-22 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
WO2013059496A1 (en) 2011-10-18 2013-04-25 Dicerna Pharmaceuticals, Inc. Amine cationic lipids and uses thereof
WO2013067076A2 (en) 2011-11-03 2013-05-10 Quark Pharmaceuticals, Inc. Methods and compositions for neuroprotection
WO2013070821A1 (en) 2011-11-08 2013-05-16 Quark Pharmaceuticals, Inc. Methods and compositions for treating diseases, disorders or injury of the nervous system
WO2013105022A2 (en) 2012-01-09 2013-07-18 Novartis Ag Organic compositions to treat beta-catenin-related diseases
US10023862B2 (en) 2012-01-09 2018-07-17 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat beta-catenin-related diseases
WO2013149194A1 (en) 2012-03-29 2013-10-03 The Trustees Of Columbia University In The City Of New York Methods for treating hair loss disorders
EP3272868A1 (en) 2012-05-02 2018-01-24 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat kras-related diseases
WO2013166004A2 (en) 2012-05-02 2013-11-07 Novartis Ag Organic compositions to treat kras-related diseases
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
EP3736333A1 (en) 2012-05-02 2020-11-11 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat kras-related diseases
EP3919620A1 (en) 2012-05-02 2021-12-08 Sirna Therapeutics, Inc. Short interfering nucleic acid (sina) compositions
US10240161B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10240162B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10934555B2 (en) 2012-05-24 2021-03-02 Monsanto Technology Llc Compositions and methods for silencing gene expression
US9751933B2 (en) 2012-06-14 2017-09-05 Scripps Korea Antibody Institute Antibody specific for CLEC14A and uses thereof
WO2014018554A1 (en) 2012-07-23 2014-01-30 La Jolla Institute For Allergy And Immunology Ptprs and proteoglycans in autoimmune disease
WO2014045126A2 (en) 2012-09-18 2014-03-27 Uti Limited Partnership Treatment of pain by inhibition of usp5 de-ubiquitinase
EP3677310A1 (en) 2012-10-08 2020-07-08 St. Jude Children's Research Hospital Therapies based on control of regulatory t cell stability and function via a neuropilin-1:semaphorin axis
US10844398B2 (en) 2012-10-18 2020-11-24 Monsanto Technology Llc Methods and compositions for plant pest control
US10077451B2 (en) 2012-10-18 2018-09-18 Monsanto Technology Llc Methods and compositions for plant pest control
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
US10041068B2 (en) 2013-01-01 2018-08-07 A. B. Seeds Ltd. Isolated dsRNA molecules and methods of using same for silencing target molecules of interest
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
US9868949B2 (en) 2013-02-28 2018-01-16 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat EPAS1-related diseases
US11261444B2 (en) 2013-02-28 2022-03-01 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat EPAS1-related diseases
WO2014134179A1 (en) 2013-02-28 2014-09-04 The Board Of Regents Of The University Of Texas System Methods for classifying a cancer as susceptible to tmepai-directed therapies and treating such cancers
WO2014134255A2 (en) 2013-02-28 2014-09-04 Novartis Ag Organic compositions to treat epas1-related diseases
US10538765B2 (en) 2013-02-28 2020-01-21 Arrowhead Pharmaceuticals, Inc. Organic compositions to treat EPAS1-related diseases
US10609930B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10612019B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10435701B2 (en) 2013-03-14 2019-10-08 Monsanto Technology Llc Methods and compositions for plant pest control
WO2014151734A1 (en) 2013-03-15 2014-09-25 The Trustees Of Columbia University In The City Of New York Fusion proteins and methods thereof
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
US10208296B2 (en) 2013-03-15 2019-02-19 The Trustees Of Columbia University In The City Of New York Fusion proteins and methods thereof
US11505788B2 (en) 2013-03-15 2022-11-22 The Trustees Of Columbia University In The City Of New York Fusion proteins and methods thereof
US11141492B2 (en) 2013-07-03 2021-10-12 City Of Hope Anticancer combinations
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9777288B2 (en) 2013-07-19 2017-10-03 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
US9856495B2 (en) 2013-07-19 2018-01-02 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US11377667B2 (en) 2013-07-19 2022-07-05 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US10597676B2 (en) 2013-07-19 2020-03-24 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
WO2015015498A1 (en) 2013-07-31 2015-02-05 Qbi Enterprises Ltd. Methods of use of sphingolipid polyalkylamine oligonucleotide compounds
WO2015015496A1 (en) 2013-07-31 2015-02-05 Qbi Enterprises Ltd. Sphingolipid-polyalkylamine-oligonucleotide compounds
WO2015051135A2 (en) 2013-10-04 2015-04-09 Novartis Ag Organic compositions to treat hepcidin-related diseases
WO2015054451A1 (en) 2013-10-09 2015-04-16 The United States Of America As Represented By The Secretary Department Of Health And Human Services Detection of hepatitis delta virus (hdv) for the diagnosis and treatment of sjögren's syndrome and lymphoma
US10100306B2 (en) 2013-11-04 2018-10-16 Monsanto Technology Llc Compositions and methods for controlling arthropod parasite and pest infestations
US9540642B2 (en) 2013-11-04 2017-01-10 The United States Of America, As Represented By The Secretary Of Agriculture Compositions and methods for controlling arthropod parasite and pest infestations
US10927374B2 (en) 2013-11-04 2021-02-23 Monsanto Technology Llc Compositions and methods for controlling arthropod parasite and pest infestations
WO2015070009A2 (en) 2013-11-08 2015-05-14 The Board Of Regents Of The University Of Texas System Vh4 antibodies against gray matter neuron and astrocyte
US10004814B2 (en) 2013-11-11 2018-06-26 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety
US11529428B2 (en) 2013-11-11 2022-12-20 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety
US10729787B2 (en) 2013-11-11 2020-08-04 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety
US10557138B2 (en) 2013-12-10 2020-02-11 Beeologics, Inc. Compositions and methods for virus control in Varroa mite and bees
US9682123B2 (en) 2013-12-20 2017-06-20 The Trustees Of Columbia University In The City Of New York Methods of treating metabolic disease
US9274117B2 (en) 2013-12-21 2016-03-01 Catholic University Industry Academic Use of SIRT7 as novel cancer therapy target and method for treating cancer using the same
WO2015098113A1 (en) 2013-12-27 2015-07-02 独立行政法人医薬基盤研究所 Therapeutic drug for malignant tumors
US10334848B2 (en) 2014-01-15 2019-07-02 Monsanto Technology Llc Methods and compositions for weed control using EPSPS polynucleotides
US11091770B2 (en) 2014-04-01 2021-08-17 Monsanto Technology Llc Compositions and methods for controlling insect pests
KR20150129189A (en) 2014-05-08 2015-11-19 서울대학교산학협력단 USE OF REV-ERBα FOR TREATING DOPAMINE-DEPENDENT DISORDERS
KR20150129190A (en) 2014-05-08 2015-11-19 서울대학교산학협력단 USE OF REV-ERBα FOR TREATING AFFECTIVE AND ADDICTIVE DISORDERS
US10988764B2 (en) 2014-06-23 2021-04-27 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
US11807857B2 (en) 2014-06-25 2023-11-07 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
EP3736334A1 (en) 2014-07-16 2020-11-11 Arrowhead Pharmaceuticals, Inc. Rnai compositions to treat apoc3-related diseases
US10342761B2 (en) 2014-07-16 2019-07-09 Novartis Ag Method of encapsulating a nucleic acid in a lipid nanoparticle host
WO2016011123A1 (en) 2014-07-16 2016-01-21 Arrowhead Research Corporation Organic compositions to treat apoc3-related diseases
US11124792B2 (en) 2014-07-29 2021-09-21 Monsanto Technology Llc Compositions and methods for controlling insect pests
US10378012B2 (en) 2014-07-29 2019-08-13 Monsanto Technology Llc Compositions and methods for controlling insect pests
WO2016057693A1 (en) 2014-10-10 2016-04-14 Alnylam Pharmaceuticals, Inc. Methods and compositions for inhalation delivery of conjugated oligonucleotide
US10513703B2 (en) 2014-11-10 2019-12-24 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
US11060091B2 (en) 2014-11-10 2021-07-13 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) iRNA compositions and methods of use thereof
US10745708B2 (en) 2014-11-12 2020-08-18 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
US11111497B2 (en) 2014-11-12 2021-09-07 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
WO2016077624A1 (en) 2014-11-12 2016-05-19 Nmc, Inc. Transgenic plants with engineered redox sensitive modulation of photosynthetic antenna complex pigments and methods for making the same
EP3778644A2 (en) 2014-12-23 2021-02-17 The Trustees of Columbia University in the City of New York Fgfr-tacc fusion proteins and methods thereof
EP3925979A2 (en) 2014-12-23 2021-12-22 The Trustees of Columbia University in the City of New York Fgfr-tacc fusion proteins and methods thereof
US10968449B2 (en) 2015-01-22 2021-04-06 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US11085044B2 (en) 2015-03-09 2021-08-10 University Of Kentucky Research Foundation miRNA for treatment of breast cancer
US10781446B2 (en) 2015-03-09 2020-09-22 University Of Kentucky Research Foundation RNA nanoparticle for treatment of gastric cancer
US10584144B2 (en) 2015-03-09 2020-03-10 University Of Kentucky Research Foundation RNA nanoparticles for brain tumor treatment
US9669103B2 (en) 2015-03-18 2017-06-06 Korea National University Of Transportation Industry-Academic Cooperation Foundation Metal-particle-based oral-administrating liver-specific nucleic acid delivery system and method of manufacturing the same
US11279768B1 (en) 2015-04-03 2022-03-22 Precision Biologics, Inc. Anti-cancer antibodies, combination therapies, and uses thereof
US11964028B2 (en) 2015-04-17 2024-04-23 University Of Kentucky Research Foundation RNA nanoparticles and method of use thereof
WO2016176617A2 (en) 2015-04-29 2016-11-03 New York University Method for treating high-grade gliomas
US10883103B2 (en) 2015-06-02 2021-01-05 Monsanto Technology Llc Compositions and methods for delivery of a polynucleotide into a plant
US10655136B2 (en) 2015-06-03 2020-05-19 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
WO2016210292A1 (en) 2015-06-25 2016-12-29 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion, enrichment, and maintenance
US10072065B2 (en) 2015-08-24 2018-09-11 Mayo Foundation For Medical Education And Research Peptide-mediated delivery of immunoglobulins across the blood-brain barrier
US11266626B2 (en) 2015-09-09 2022-03-08 The Trustees Of Columbia University In The City Of New York Reduction of ER-MAM-localized APP-C99 and methods of treating alzheimer's disease
EP3702470A2 (en) 2015-09-09 2020-09-02 The Trustees of Columbia University in the City of New York Reduction of er-mam-localized app-c99 and methods of treating alzheimer's disease
US11529343B2 (en) 2015-09-29 2022-12-20 Duke University Compositions and methods for identifying and treating dystonia disorders
US11285142B2 (en) 2015-09-29 2022-03-29 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for identifying and treating dystonia disorders
US10857145B2 (en) 2015-09-29 2020-12-08 Duke University Compositions and methods for identifying and treating dystonia disorders
US11512143B2 (en) 2015-10-30 2022-11-29 Genentech, Inc. Anti-HtrA1 antibodies and methods of use thereof
US10421822B2 (en) 2015-10-30 2019-09-24 Genetech, Inc. Anti-HtrA1 antibodies and methods of use thereof
US10421821B2 (en) 2015-10-30 2019-09-24 Genentech, Inc. Anti-HtrA1 antibodies and methods of use thereof
WO2017152073A1 (en) 2016-03-04 2017-09-08 University Of Louisville Research Foundation, Inc. Methods and compositions for ex vivo expansion of very small embryonic-like stem cells (vsels)
WO2017161001A1 (en) 2016-03-15 2017-09-21 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion
EP4049665A1 (en) 2016-03-15 2022-08-31 Children's Medical Center Corporation Methods and compositions relating to hematopoietic stem cell expansion
US10883108B2 (en) 2016-03-31 2021-01-05 The Schepens Eye Research Institute, Inc. Endomucin inhibitor as an anti-angiogenic agent
US11680266B2 (en) 2016-03-31 2023-06-20 The Schepens Eye Research Institute, Inc. Endomucin inhibitor as an anti-angiogenic agent
WO2018057575A1 (en) 2016-09-21 2018-03-29 Alnylam Pharmaceuticals, Inc Myostatin irna compositions and methods of use thereof
US10933081B2 (en) 2016-09-21 2021-03-02 Alnylam Pharmaceuticals, Inc. Myostatin iRNA compositions and methods of use thereof
US11324820B2 (en) 2017-04-18 2022-05-10 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (HBV) infection
US11214801B2 (en) 2017-09-11 2022-01-04 Arrowhead Pharmaceuticals, Inc. RNAi agents and compositions for inhibiting expression of apolipoprotein C-III (APOC3)
WO2019199673A1 (en) 2018-04-09 2019-10-17 President And Fellows Of Harvard College Modulating nuclear receptors and methods of using same
WO2019217459A1 (en) 2018-05-07 2019-11-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery
US11492623B2 (en) 2018-08-13 2022-11-08 Alnylam Pharmaceuticals, Inc. Hepatitis B virus (HBV) dsRNA agent compositions and methods of use thereof
WO2020061381A1 (en) 2018-09-19 2020-03-26 La Jolla Institute For Immunology Ptprs and proteoglycans in rheumatoid arthritis
WO2020089841A1 (en) 2018-10-31 2020-05-07 Garcia Joe G N Biomarkers and methods of use for radiation-induced lung injury
WO2020236600A1 (en) 2019-05-17 2020-11-26 Alnylam Pharmaceuticals, Inc. Oral delivery of oligonucleotides
WO2021060624A1 (en) 2019-09-24 2021-04-01 테고사이언스(주) Composition for preventing or treating keloid or hypertrophic scar
WO2021092371A2 (en) 2019-11-06 2021-05-14 Alnylam Pharmaceuticals, Inc. Extrahepatic delivery
WO2021124172A1 (en) 2019-12-18 2021-06-24 Novartis Ag 3-(5-methoxy-1-oxoisoindolin-2-yl)piperidine-2,6-dione derivatives and uses thereof
WO2021123920A1 (en) 2019-12-18 2021-06-24 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2021142191A1 (en) 2020-01-08 2021-07-15 Regeneron Pharmaceuticals, Inc. Treatment of fibrodysplasia ossificans progressiva
WO2021150300A1 (en) 2020-01-22 2021-07-29 Massachusetts Institute Of Technology Inducible tissue constructs and uses thereof
WO2021150837A1 (en) 2020-01-22 2021-07-29 Massachusetts Institute Of Technology Inducible tissue constructs and uses thereof
WO2021173965A1 (en) 2020-02-28 2021-09-02 Massachusetts Institute Of Technology Identification of variable influenza residues and uses thereof
WO2022006286A1 (en) 2020-06-30 2022-01-06 Lunglife Ai Methods for detecting lung cancer
WO2022011214A1 (en) 2020-07-10 2022-01-13 Alnylam Pharmaceuticals, Inc. Circular sirnas
WO2022147480A1 (en) 2020-12-30 2022-07-07 Ansun Biopharma, Inc. Oncolytic virus encoding sialidase and multispecific immune cell engager
WO2022147481A1 (en) 2020-12-30 2022-07-07 Ansun Biopharma Inc. Combination therapy of an oncolytic virus delivering a foreign antigen and an engineered immune cell expressing a chimeric receptor targeting the foreign antigen
WO2022147214A2 (en) 2020-12-31 2022-07-07 Alnylam Pharmaceuticals, Inc. Cyclic-disulfide modified phosphate based oligonucleotide prodrugs
WO2022147223A2 (en) 2020-12-31 2022-07-07 Alnylam Pharmaceuticals, Inc. 2'-modified nucleoside based oligonucleotide prodrugs
WO2022269518A2 (en) 2021-06-23 2022-12-29 Novartis Ag Compositions and methods for the treatment of hemoglobinopathies
WO2023283403A2 (en) 2021-07-09 2023-01-12 Alnylam Pharmaceuticals, Inc. Bis-rnai compounds for cns delivery
WO2023012165A1 (en) 2021-08-02 2023-02-09 Universite De Montpellier Compositions and methods for treating cmt1a or cmt1e diseases with rnai molecules targeting pmp22
CN113851845A (en) * 2021-10-13 2021-12-28 中国信息通信研究院 Integrated filtering duplex antenna for inhibiting in-band signal
CN113851845B (en) * 2021-10-13 2024-01-26 中国信息通信研究院 Integrated filtering duplex antenna for inhibiting in-band signals
WO2023220744A2 (en) 2022-05-13 2023-11-16 Alnylam Pharmaceuticals, Inc. Single-stranded loop oligonucleotides
WO2023230531A1 (en) 2022-05-24 2023-11-30 Lunglife Ai, Inc. Methods for detecting circulating genetically abnormal cells
WO2024006999A2 (en) 2022-06-30 2024-01-04 Alnylam Pharmaceuticals, Inc. Cyclic-disulfide modified phosphate based oligonucleotide prodrugs
WO2024059618A2 (en) 2022-09-13 2024-03-21 Arsenal Biosciences, Inc. Immune cells having co-expressed tgfbr shrnas
WO2024059824A2 (en) 2022-09-16 2024-03-21 Arsenal Biosciences, Inc. Immune cells with combination gene perturbations
WO2024073732A1 (en) 2022-09-30 2024-04-04 Alnylam Pharmaceuticals, Inc. Modified double-stranded rna agents

Also Published As

Publication number Publication date
AU2634800A (en) 2000-08-18
US8148345B2 (en) 2012-04-03
WO2000044914B1 (en) 2000-09-14
US20150152413A1 (en) 2015-06-04
US20130251693A1 (en) 2013-09-26
AU2004100997A4 (en) 2005-02-24
CA2361201A1 (en) 2000-08-03
US20020114784A1 (en) 2002-08-22
AU776150B2 (en) 2004-08-26
EP1147204A1 (en) 2001-10-24
EP2314700A1 (en) 2011-04-27
US20090156520A1 (en) 2009-06-18
US20090215880A1 (en) 2009-08-27
US20040147475A1 (en) 2004-07-29
US7888325B2 (en) 2011-02-15

Similar Documents

Publication Publication Date Title
US7888325B2 (en) Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA
US9862949B2 (en) Method for the inhibition of angiogenesis
CA2118235C (en) Synthetic antisense oligodeoxynucleotides and pharmaceutical compositions containing them
EP1458863B1 (en) A system for stable expression of sirnas in mammalian cells
KR101485071B1 (en) Method for regulating muscle cell proliferation and differentiation, treating muscle cell, controling gene expression which are using MICRORNAS, and derepession vector of MICRORNAS molecule, Kit and Myocyt using them
US20040002077A1 (en) siRNA expression system and method for producing functional gene knock-down cell using the system
KR20050044565A (en) Method of inhibiting gene expression
EP1462525A1 (en) siRNA EXPRESSION SYSTEM AND PROCESS FO RPRODUCING FUNCTIONAL GENE KNOCKDOWN CELL OR THE LIKE USING THE SAME
CA2462144A1 (en) Micro-rna molecules
KR20100017422A (en) Methods of identifying genes involved in memory formation using small interfering rna(sirna)
US20060088837A1 (en) Expression system for stem-loop rna molecule having rnai effect
CN112272516B (en) Compositions and methods for somatic reprogramming and imprinting
JP4268169B2 (en) Determinants of self-renewal of embryonic stem cells

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

AK Designated states

Kind code of ref document: B1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: B1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

B Later publication of amended claims
121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
WWE Wipo information: entry into national phase

Ref document number: 26348/00

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2361201

Country of ref document: CA

Kind code of ref document: A

Ref document number: 2361201

Country of ref document: CA

REEP Request for entry into the european phase

Ref document number: 2000904620

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2000904620

Country of ref document: EP

WWP Wipo information: published in national office

Ref document number: 2000904620

Country of ref document: EP

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

WWG Wipo information: grant in national office

Ref document number: 26348/00

Country of ref document: AU